Virulence markers in Pseudomonas aeruginosa isolates from ... Chifiriuc.pdf · virulence of P. aeruginosa depends mainly on two types of virulence determinants: (i) virulence factors

Romanian Biotechnological Letters Vol. 18, No. 6, 2013 Copyright © 2013 University of Bucharest Printed in Romania. All rights reserved

ORIGINAL PAPER

Romanian Biotechnological Letters, Vol. 18, No. 6, 2013 8843

Virulence markers in Pseudomonas aeruginosa isolates from hospital-acquired infections occurred in patients with underlying cardiovascular disease

Received for publication, July 10, 2013

Accepted, August 2, 2013

ALINA-MARIA HOLBAN1, MARIANA CARMEN CHIFIRIUC1, ANI IOANA COTAR1, CORALIA BLEOTU2*, ALEXANDRU MIHAI GRUMEZESCU3, OTILIA BANU4 AND VERONICA LAZAR1 1 University of Bucharest, Faculty of Biology, Department of Microbiology and Immunology, Bucharest, Romania 2 St.S. Nicolau Institute of Virology, Bucharest, Romania 3University Politechnica of Bucharest, Faculty of Applied Chemistry and Materials Science, Organic Chemistry Department, Bucharest, Romania 4Institute of Cardiovascular Diseases Prof. C.C. Iliescu, Bucharest, Romania *Corresponding author: Coralia Bleotu E-mail: [email protected], Phone: 031 405.50.65, 0402 13.24.57 Sos. Mihai Bravu, nr. 285 Bucuresti

Abstract

The purpose of this study was to evaluate and compare the virulence profiles of 52 recent clinical isolates of Pseudomonas aeruginosa distinctly originated from patients with hospital-acquired infections and primary cardiovascular disease. The phenotypic screening evaluated seven soluble virulence factors (haemolysins, lipase, lecithinase, DN-ase, amylase, gelatinase, caseinase), as well as the adherence ability (Cravioto adapted method) and invasion (gentamicin protection assay) of HeLa cells. Eight virulence genes (lasB, plcH, protease IV, exo S, exo T, exo A, exo U, pvdA) were screened by PCR. The statistical analysis was performed using GraphPad InStat software. The most virulent were blood culture and tracheo-bronchial isolates. Although cited as mutually exclusive, a significant number of blood culture (30%) and wound secretion (24%) isolates exhibited both exoU and exoS genes. The tracheo-bronchial secretions harbored with high positivity pvdA and lasB, while the surgical wound isolates plcH and protease IV genes. The urinary tract infections isolates exhibited less virulent phenotypes, and harbored with a high positivity rate the lasB gene. Correlating virulence patterns and infection clinical outcome could be useful for setting up efficient preventive and therapeutic procedures in hospitalized patients with positive P. aeruginosa cultures.

Keywords: P. aeruginosa, soluble virulence factors, adherence, invasion, virulence genes

Introduction

The pathogenesis of Pseudomonas aeruginosa opportunistic infections is multifactorial, as suggested by the large number of cell-associated and extracellular virulence determinants; some of these determinants help colonization, whereas others facilitate bacterial invasion. The virulence of P. aeruginosa depends mainly on two types of virulence determinants: (i) virulence factors involved in acute infection, they being usually secreted and membrane bound factors. As an example, pilli allow bacteria to attach on host epithelia, while exoenzyme S (ExoS) and other adhesins stabilize attached bacteria. The role of ExoS in P. aeruginosa pathogenesis is related with its capacity of inducing cytoskeleton disruption, actin depolimerization [1], being also involved in bacteria resistance to macrophages and degradation of immunoglobulin A and G [2]. Exotoxin A (ExoA) is responsible of tissue necrosis [3], while phospholipase C have a role of thermostable haemolysin [4]. P. aeruginosa produces also other proteases involved in tissue damage, one of the mechanisms involved referring to activation on certain ion channel controlling the local clearance [5]; (ii)

ALINA-MARIA HOLBAN, MARIANA CARMEN CHIFIRIUC, ANI IOANA COTAR, CORALIA BLEOTU, ALEXANDRU MIHAI GRUMEZESCU,OTILIA BANU AND VERONICA LAZAR

8844 Romanian Biotechnological Letters, Vol. 18, No. 6, 2013

second group includes virulence factors involved in chronic infection, as siderophores (pyoverdin and pyochelin), that facilitate bacteria multiplication and growth when no or low iron is available [2]. Recent experimental evidence suggests that many successful pathogens as P. aeruginosa, generally perceived as being extracellular, can also invade and, in certain conditions, multiply within host cells [6, 7, 8]. The great variation of virulence profiles reflects the adaptive ability of the opportunistic pathogen P. aeruginosa. Due to its versatility and cosmopolite abundance this bacterial model is frequently used in host-pathogens studies, interspecies communication and virulence modulation. P. aeruginosa cause a wide range of acute and chronic infections in many hosts, being one of the major microorganisms responsible for nosocomial infections, affecting especially immuncompromised and chronic patients, as cystic fibrosis individuals [9]. P.aeruginosa can be found also as a member of normal microbiota and usually do not produce illness in normal, healthy individuals. The synthesis of its variety of virulence factors and their coordinated expression is regulated by QS signaling [2, 10, 11] or by the host signaling molecules, especially hormones [12, 13, 14]. The extent of the host tissue injury during pseudomonadal infection is dependent also on the host immunity, the size of the bacterial inoculum and on the production of specific bacterial exoproducts [5, 15]. Individuals with chronic disease or background injuries are more prone in acquiring bacterial infections. Cardiovascular disease is one of the major causes of mortality and morbidity worldwide and the costs that involve handling this disorder are huge. The 2008 overall rate of death attributable to cardiovascular disease was 244.8 per 100 000 individuals and this rate is critically growing [16]. Recent evidence demonstrates that cardiovascular disorders are usually associated with increased level of stress hormones [17, 18]. Since is clearly established that high levels of stress related molecules increase laboratory bacteria strains growth and virulence in vitro, evidence about the behavior of clinical bacteria isolated from patients prone to high levels of stress molecules is required [14]. The purpose of this study was to analyze and compare the phenotypic and genotypic virulence profiles of P. aeruginosa recent isolates from different anatomical hospital-acquired infection sites, occurred in patients with the same background disease.

Materials and Methods Bacterial Strains The study was performed on 52 P. aeruginosa strains isolated from different infections from patients hospitalized in the National Institute for Cardiovascular Diseases, Prof. C.C. Iliescu of Bucharest, during April 2011 - June 2011. Isolates were identified using automatic Vitek II system and the API 20NE microtest systems (BioMerieux). Subsequently, the strains were maintained in the “Culture Collection of Microbiology Laboratory” of the Faculty of Biology, University of Bucharest. For further experiments, the bacteria were grown for 18-20 hours in nutrient broth. P. aeruginosa isolated strains were submitted to less than 5 passages before being tested. Adherence to HeLa cells The bacterial adherence to different natural (skin, mucosa) or artificial (catheters, implants) substrata is a prerequisite in the pathogenesis of microbial infections. For the adherence assay, Cravioto’s adapted method was used [29, 30]. Briefly, HeLa cell monolayers (70-80% confluence) were washed with sterile PBS (phosphate buffer saline) and 1 ml of fresh medium without antibiotics was aseptically added to each well. PBS suspensions of P. aeruginosa obtained from mid-logarithmic phase cultures grown in nutrient broth were adjusted to 10⁸ CFU/ml and 1 ml was used for the inoculation of each well. The inoculated plates were incubated for 2 hours at 37ºC [31]. After incubation, the monolayers were washed



3 times with sterile PBS, briefly fixed in cold methanol (3 min) and stained with 1:10 v/v Giemsa solution (neutral pH) for 20 min. The plates were washed, dried at room temperature overnight, and examined by optic microscopy using wet objective (×2500 magnification), in order to evaluate the adherence indexes and patterns. The adherence indexes were expressed as the ratio between the number of the eukaryotic cells with adhered bacteria and 100 eukaryotic cells counted on the microscopic field using an Axiolab (Zeiss) microscope. Phenotypic characterization of enzymatic virulence factors Bacterial strains grown for 18 hours in nutrient broth were evaluated for seven enzymatic virulence factors [32] (pore forming toxins: lecithinase, lipase and hemolysins; exoenzymes: gelatinase, amylase, caseinase and DN-ase) by cultivating the strains on available media containing specific substrate for enzymes activity detection. For the detection of hemolysins, the strains were plated on agar containing 5% (vol/vol) sheep blood in order to obtain isolated colonies. After incubation at 37 °C for 24 h the clear zone (total lysis of red blood cells) around the colonies was registered as positive reaction. For lecithinase and lipase production the strains were spotted onto 2.5% yolk agar and respectively Tween 80 agar, containing the substrate at a final concentration of 1%. The plates were incubated at 37°C up to 7 days. An opaque, precipitation zone surrounding the spot indicate the production of the two enzymes. The caseinase and gelatinase production was studied onto 15% soluble casein and respectively on gelatin agar, containing the substrate at a final concentration of 1%. The plates were incubated at 37 °C up to 7 days. An opaque, precipitation zone surrounding the spot indicate the production of the two tested proteases. The amylase activity was determined using starch at final concentration of 1% in nutritive agar. The strains were spotted and after incubation for 24 h at 37 °C, precipitation surrounding the growth area indicated starch hydrolysis. DN-ase production was studied using DNA agar medium. The strains were spotted and after incubation for 24 h at 37 °C, a drop of HCl/1N solution was added to the spotted cultures and a clearing zone around the culture was registered as a positive reaction. Invasion assay To determine the invasion ability we used the antibiotic protection assay [33, 8]. Bacterial suspensions were inoculated on HeLa cells grown in 6-well plates and incubated at 37°C for two hours. The infection assay was performed in the same manner as the adherence assay, except that each bacterial strain was inoculated in two different wells from two different plates, first meant to reveal both adherent and invasive bacteria and second just invasive viable cells. After the incubation period in each invasion well were added 100μg/ml gentamicin and 70μg/ml amikacin in order to kill extracellular bacteria. The plates were further incubated for another hour in the same conditions. After incubation, plates were washed 3 times with sterile PBS and the HeLa cells were permeabilized with 0.1% Triton X-100 for 15 min, at 37°C. Serial dilutions of suspended cells harvested from the plate wells were seeded on nutritive agar (three technical replicates for each dilution) in order to establish the invasion indexes, calculated as Colony Forming Units CFU/ml. Screening of virulence genes Bacterial strains were grown for 18 hours in nutrient broth, cultures were harvested by centrifugation and DNA purification was performed using a commercial available DNA isolation kit (Promega, U.S.), following manufacturer′s recommendations. Genomic DNA was used as a template for PCR (Polymerase Chain Reaction) screening of 8 virulence genes: two genes codifying for proteases - lasB (elastase) and protease IV, 4 exoenzymes – exoS, exoT, exoU, exoA, one phospholipase - plcH (haemolytic phospholipase C) and one gene



codifying for the ornithine hydroxylase - pvdA (pyoverdine A), which is an enzyme involved in the biosynthesis of the P.aeruginosa siderophore pyoverdin. PCR assays were performed in 50 μl mixes containing 25 μl Green GoTaq master mix (Promega), 1.25 μM forward and reverse primers and 2.5 μl template. An annealing temperature of 60°C was used for each of the PCRs. The sequences of primers used in PCR reactions and the molecular weight of the amplification products are presented in table 1. Table 1. Sequences of the primers used in PCR reactions

Gene Primer sequence (5′–3′) Product (bp) Reference

lasB GGAATGAACGAAGCGTTCTC GGTCCAGTAGTAGCGGTTGG

300 [35]

protease IV TATTTCGCCGACTCCCTGTA GAATAGACGCCGCTGAAATC

752 [37]

exoA AACCAGCTCAGCCACATGTC CGCTGGCCCATTCGCTCCAGCGCT

207 [36]

exoS ATCGCTTCAGCAGAGTCCGTC CAGGCCAGATCAAGGCCGCGC

1352 [21]

exoT AATCGCCGTCCAACTGCATGCG TGTTCGCCGAGGTACTGCTC

152 [34]

exoU

CCGTTGTGGTGCCGTTGAAG CCAGATGTTCACCGACTCGC

134 [34]

plcH GAAGCCATGGGCTACTTCAA AGAGTGACGAGGAGCGGTAG

307 [35]

pvdA GACTCAGGCAACTGCAAC TTCAGGTGCTGGTACAGG

1281 [34]

PCR products were separated in a 1.5% agarose gel for 1 h at 100 V, stained with ethidium bromide (Sigma) and detected by UV illumination. Statistics One way analysis of variance (ANOVA) was used to analyze the data. P values < 0.05 were considered significant.

Results The qualitative assay of the bacterial adherence to the cellular substrata demonstrated that all tested strains adhered to HeLa cells, exhibiting different adherence profiles. Three major adherence patterns were identified: localized adherence, when bacteria attach to and form microcolonies on certain regions of the cell surface; diffuse adherence, when bacteria adhere evenly to the whole cell surface, and aggregative adherence, when aggregated bacteria attach to the cell in a stacked-brick arrangement (figure 1).



Figure 1. Major adherence patterns found in P.aeruginosa tested strains to HeLa cells. A=localized adherence, B=diffuse adherence, C= aggregative adherence. Adherence rates of P. aeruginosa tested isolates ranged from 25 to100%, but approximately 60% of the tested strains displayed adherence indexes exceeding 80%. An interesting finding is that the strains revealed a particular type of adherence pattern to HeLa cells according with the isolation source. Therefore, isolates originated from blood cultures (59%) and urinary tract infections exhibited mainly diffuse adherence patterns. The samples obtained from blood cultures revealed only in a small proportion (17%) an aggregative pattern. On the other hand, only a low percent of strains isolated from tracheo-bronchial and wound secretions exhibited diffuse adherence patterns, tracheo-bronchial secretion derived strains revealing the greatest percent of aggregative adherence among all groups (53%). Wound secretion isolates exhibited also a high aggregative potential (41% of tested strains) while 29% of isolates adhered diffusely on the surface of host cells. All tested strains revealed moderate localized adherence, ranging from 21% (UTIs) to 35% (tracheo-bronchial secretions). Soluble enzymatic virulence factors patterns indicated that P. aeruginosa strains preferentially express the exoenzymes amylase, caseinase and lecithinase. We also observed certain differences in the virulence profiles of strains isolated from different clinical sources. Wound secretion isolated strains did not express gelatinase, while the P. aeruginosa strains obtained from UTIs do not express DN-ase. Tracheo-bronchial and blood culture isolates are the most virulent strains, expressing all tested soluble virulence determinants (figure 2).

Figure 2: Graphic arrangement of soluble enzymatic virulence factors patterns observed in P.aeruginosa tested strains.



The quantitative assay of the invasion ability showed that P. aeruginosa strains possess the ability to invade with different rates the epithelial, non-phagocytic HeLa cells. Bearing in mind the number of tested strains and the heterogeneity of the quantitative invasion assay results, we clustered the analyzed strains in four invasion groups according to the invasion rate expressed by each strain (non-invasive, low invasive, moderately invasive, highly invasive). Strains that expressed an invasive potential that could not be clearly included in any of the invasion groups have been removed. The invasion assay revealed that a high percentage of investigated strains are very invasive, 31% isolates being clustered into the highly invasive group (figure 3).

Figure 3. Graphic stratification in different invasion groups of P. aeruginosa analyzed strains. On the X-axis are figured clustered strains according to their isolation source. Y axis represents the number of strains according to their invasive potential. Significant differences of invasive potential in tested strains, namely depending on the isolation source, were observed. Isolates from blood cultures showed the greatest invasiveness, 68% being clustered into the moderate and high invasive groups. The differences obtained by comparing the invasive potentials of blood culture isolates and the strains obtained from other anatomic sources are statistically significant (P value is 0.0051) (figure 4).



Figure 4. Statistical comparison of invasion profiles in P. aeruginosa tested strains. One-way Analysis of Variance (ANOVA) was used to compare invasive potentials of blood culture isolates vs. strains obtained from other sources, by counting and comparing the CFU/ml values, *P < 0.05. Since phenotypic changes are usually linked with a specific genotypic background, our next step was to screen for the presence of virulence genes involved in the production of the extracellular virulence factors. PCR data demonstrate a clustered distribution of certain virulence genes, depending on the isolation source of the analyzed strains (table 2). Table 2. The percentage of strains positive for presence of screened virulence genes Source

lasB plcH protease IV exo S exo T exo A exo U pvdA

UTI 65% 5% 5% 40% 65% 30% 0% 0% blood culture 35% 40% 67% 60% 40% 65% 45% 30% tracheo-bronchial secretion 70% 30% 17% 12% 80% 15% 0% 0% wound secretion 55% 55% 75% 20% 95% 55% 30% 25% The obtained results revealed that lasB and exoT genes were the most prevalent among tested strains, being present at a significant level in all four strain groups. lasB and proteaseIV genes codify for proteases and they are present to most of the tested strains, supporting the phenotypic soluble virulence factors screening results. plcH, the gene codifying for haemolytic phospholipase C is present in many P.aeruginosa strains isolated from blood cultures (40%) and wound secretions (55%), also supporting the phenotypic data demonstrating that isolates obtained from blood cultures and wound secretions are the most hemolytic. The genes codifying for Type III Secretion System (T3SS) related exotoxins exoS, exoT, and exoA were differently distributed among the tested strains. Isolates from blood cultures and wound secretions exhibit the greatest proportions of positivity for T3SS exotoxins codifying genes, being followed by tracheo-bronchial isolates. exoU, the gene codifying for highly cytotoxic exoenzyme ExoU and pvdA gene, codifying for an important enzyme involved in synthesis of siderophore pyoverdine were found only in blood culture and wound secretion derived strains.



Discussion

P. aeruginosa is estimated to be involved in 10% to 22.5% of the hospital-acquired infections (HAI) as well in adults as in children [36, 37], leading to increased health care costs and prolonged hospitalization [38]. A combination of bacteria-associated factors (intrinsic and acquired antimicrobial resistance, prevalence and persistence in the hospital environment, expression of a cocktail of virulence factors) and individual variations in host susceptibility influence the clinical outcome of infections [39]. Bacterial virulence is diminished in favorable environmental conditions and may be highly enhanced if stressful circumstances arise [19]. Sensing and responding to host signals represent one of the most efficient strategy used by versatile bacteria to modulate virulence for a better survival and persistence [13, 20] when facing host hostile environment. Depending on the anatomical site, a different mixture of signaling molecules can be found within the host and this gradient may impact on bacterial behavior. During this study there were analyzed 52 P. aeruginosa strains isolated from tracheo-bronchial secretions (50%), surgical wound infections (20%), urinary tract infections (UTI) (19%) and blood cultures (11%). Our phenotypic and genotypic data demonstrate that P. aeruginosa is able to modulate its virulence when it is the protagonist of infections occurring in different clinical contexts in patients with cardiovascular underlying disease. Furthermore, phenotypic virulence markers were correlated with some specific virulence genes profiles, revealing that bacteria could adapt easily to the microenvironment encountered within the host by modulating the expression of these genes. The most virulent strains were those isolated from systemic (blood cultures) and respiratory tract (tracheo-bronchical secretions) infections, displaying the entire spectrum of cell-associated and soluble virulence determinants and virulence genes tested.

The increased virulence of the blood culture strains could be explained by the fact that bacteria are exposed to an enhanced stress in the host blood flow [19], therefore their virulence is also amplified. The results obtained after evaluating their adherence ability, which represents the first stage in establishing an infectious process, revealed that the tested isolates exhibit different ability to adhere to the cellular substrata depending on the isolation source. Thereby, the strains isolated from blood cultures exhibit mainly a diffuse adherence, since this attachment is more likely to favor the subsequent invasion [21], as an invading bacterium is more protected after entering the host epithelial cells, comparing with the situation when it has to face multiple host defense mechanisms that can be found in the blood flow or in the extracellular environment. This hypothesis is also supported by the fact that P. aeruginosa isolated from blood cultures are the most invasive in the gentamycin protection assay, being able to remain viable and multiply within the invaded epithelial cells at a high rate, when comparing with the strains isolated from other clinical contexts. By contrast with other studies showing an inverse correlation between the ability of P. aeruginosa to invade epithelial cells and respectively to induce acute cytotoxicity (31), in our study the invasion and intracellular multiplication of blood culture strains was associated with the presence of the exoS, exoT, exoA and exoU genes. The effector proteins ExoS, ExoT, ExoU are transported by the type III secretion system of P. aeruginosa directly into the host cells. It is known that the effectors ExoS, ExoY, and ExoT inhibit invasion, while ExoU confers cytotoxicity [22, 40, 41, 42]. Our blood culture isolates exhibited an invasion phenotype, although genetically they harbor a mixed invasive-cytotoxic profile. Although cited as mutually exclusive [43], the blood culture isolates exhibited both exoU and exoS in about 30 percent of tested strains. The concomitant presence of exoU and exoS was also noticed in 24 percent of the wound secretion isolates. The presence of the exoU gene was more commonly seen in isolates obtained from blood, followed by surgical wound infections, suggesting that



this ability may be important in the development of the acute invasive infections [44]. The strains isolated from respiratory tract specimens exclusively harbored exoS, confirming other studies showing that pulmonary isolates from chistic fibrosis patients harbored the exoU gene less frequently and the exoS gene [42]. ExoT and ExoS act on a number of host small G proteins, thus altering the cytoskeleton and signaling pathways [45]. Among the tested strains exoT gene prevailed in case of respiratory tract and surgical wound samples in inverse correlation with exoS (Table 2). Previous studies have shown that ExoT contributes to bacterial dissemination and inhibit intracellular invasion and multiplication, as suggested by the gentamycin protection assay showing the highest rate of non-invasive strains among the two types of clinical isolates [46]. The tracheo-bronchial isolates lower invasive potential could be also correlated with a preponderant aggregative behavior which does not favor the invasion usually. Bacterial aggregates are also requisite for biofilm formation [26], which is frequently encountered in P. aeruginosa respiratory infections. Ciara and collaborators studied the contributions of ExoU, ExoS, and ExoT to virulence of P. aeruginosa, by analyzing each effector protein in the same isogenic background, using constructed mutants harboring each one of the three secreted proteins alone. Their results indicate that ExoU has the greatest effect on virulence of the type III secreted proteins [43]. In our study, the most virulent strains, i.e. those isolated from blood cultures and respiratory tract infections also harbored with the highest frequency exoU (Table 2), similar to other reported data for strains with similar infection site origins [47, 48]. However, although with a significant genotypic heterogeneity in the type III secretion among the clinical isolates of P. aeruginosa, all analyzed strains contain the genes for at least one or more effector proteins. The ubiquity of type III secretion genes in clinical isolates is consistent with its important role in the virulence of P. aeruginosa and the understanding of the specific contribution of ExoU, ExoS, and ExoT to the clinical outcome of the infectious process may have important implications for the therapeutic management of patients infected with P. aeruginosa [23, 43].

Along with blood culture isolates, strains obtained from tracheo-bronchial secretions are harboring the pvdA gene, involved in the synthesis of siderophore pyoverdine, which is a valuable molecules used by these bacteria to enhance iron uptake in poor or no available iron environment, as mammalian serum [24]. Also, pyoverdine was found to be important for biofilm development and bacterial virulence of respiratory isolates [49]. Peek and collaborators demonstrated that pyoverdine is a stealth siderophore that evades neutrophil-gelatinase-associated lipocalin (NGAL) recognition, the strategy by which mammals are able to specifically scavenge bacterial ferric and apo-siderophores, therefore preventing bacteria infections [50, 51]. These strains showed also elevated proportion of lasB gene encoding for elastase, similarly to other literature data [52]. ExoA was the most frequent among the blood culture and surgical wound isolates, our results being in accordance with other literature data [53]. This effector toxin inactivates elongation factor 2 and inhibits protein synthesis and also has ability to inhibit the host response to infection, being considered a promising vaccine candidate [53, 54].

The surgical wound isolates expressed, as expected, with the highest frequency plcH and protease IV genes, whose effectors are involved in tissue injuries.

The strains isolated from UTI seem to exhibit less virulent phenotypes comparing with blood culture and tracheo-bronchial isolates (Fig. 2), aspects that could be explained by a phenotypic redundancy dictated by the host conditions. For example, DN-ases are useful virulence factors for bacteria in certain conditions, as for escaping viscous secretions and NETs (neutrophil extracellular traps), which are chromatin formations involved in trapping and killing P. aeruginosa in respiratory infections [28]. Because of its anatomy and physiology it is unusual to find thick mucus and NETs within the urinary tract and this may



explain the lack of DN-ases production in UTI isolates. UTI analized strains harbored with a high positivity rate lasB gene (65%), also reported for other UTI isolates of P. aeruginosa, harboring this gene in proportion of 90% [55].

Conclusions In conclusion, P. aeruginosa strains isolated from different infection sites exhibit variations in virulence profiles reflecting the adaptive ability of this bacterial species. Therefore, deep knowledge and understanding of the contribution of different virulence factors or associations of them to the development of the infectious process according to the clinical outcome could have a significant utility for setting up efficient preventive and therapeutic procedures in hospitalized patients with positive P. aeruginosa cultures.

Acknowledgements

This study was possible with the financial support of the Sectorial Operational Program for Human Resources Development 2007-2013, co-financed by the European Social Fund, under the project number POSDRU/107/1.5/S/80765" and Ideas 154/2011.

References

1. C.L. ROCHA, J. COBURN, E.A. RUCKS, J.C. OLSON, Characterization of Pseudomonas aeruginosa exoenzyme S as a bifunctional enzyme in J774A.1 Macrophages. Infect. Immun., 71(9), 5296, 5305 (2003)

2. B.H.A. KHALIFA, D. MOISSENET, T.H. VU, M. KHEDHER, Virulence factors in Pseudomonas aeruginosa: mechanisms and modes of regulation. Ann. Biol. Clin. 69(4),393,403(2011).

3. C.M. PILLA, J.A. HOBDEN, Pseudomonas aeruginosa exotoxin a and keratitis in mice. Invest. Ophthalmol. 43(5), 1437, 1444 (2003).

4. D. HYBENOVÁ, V. MAJTÁN, The effect of subinhibitory concentrations of quinolone and macrolide antibiotics on production of thermolabile hemolysins in Pseudomonas aeruginosa. Epidemiol. Mikrobiol. Imunol., 44(4), 169, 70 (1995).

5. M.B. BUTTERWORTH, L. ZHANG, E.M. HEIDRICH, M.M. MYERBURG, P.H. THIBODEAU, Activation of the epithelial sodium channel (ENAC) by the alkaline protease from Pseudomonas aeruginosa. J. Biol. Chem., 287(39), 32556, 32565 (2012).

6. K.W. BAYLES, C. WESSON, L.E. LIOU, L.K. FOX, G.A. BOHACH, W.R. Trumble, Intracellular Staphylococcus aureus escapes the endosome and induces apoptosis in epithelial cells. Infect. Immun., 66, 336, 3421 (1998).

7. J.S. SHIN, Z. GAO, S.N. ABRAHAM. Involvement of cellular caveolae in bacterial entry into mast cell. Science, 289, 785,788 (2000).

8. D.W. ZAAS, M.J. DUNCAN, G. LI, J.R. WRIGHT, S.N. ABRAHAM, Pseudomonas invasion of type I pneumocytes is dependent on the expression and phosphorylation of caveolin-2. J. Biological Chem, 280, 4864, 4872 (2005).

9. J.R. GOVAN, V. DERETIC, Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia. Microbiol. Rev., 60,539,574 (1996).

10. C. VAN DELDEN, B.H. IGLEWSKI, Cell-to-cell signaling and Pseudomonas aeruginosa infections. Emerg. Infect. Dis., 4,551,560 (1998).

11. K. TATEDA, Y. ISHII, M. HORIKAWA, T. MATSUMOTO, S. MIYAIRI, J.C. PECHERE, T.J., STANDIFORD, M., ISHIGURO M, K. YAMAGUCHI, The Pseudomonas aeruginosa autoinducer n-3-oxododecanoyl homoserine lactone accelerates apoptosis in macrophages and neutrophils. Infect. Immun., 71, 5785,5793 (2003).

12. V. SPERANDIO, A.G. TORRES, B. JARVIS, J.P. NATARO, J.B. KAPER. Bacteria–host communication: The language of hormones. PNAS, 100, 8951, 8956 (2003).

13. D.T. HUGHES, V. SPERANDIO, Inter-kingdom signalling: communication between bacteria and their hosts. Nat. Rev. Microbiol., 6,111,120 (2008).

14. A.M. HOLBAN, V. LAZAR. Inter-kingdom cross-talk: the example of prokaryotes - eukaryotes communication. Biointerface Res Appl. Chem., 1, 95,110 (2011).



15. M.W. CALFEE, J.G. SHELTON, J.A. MCCUBREY, E.C. PESCI, Solubility and bioactivity of the Pseudomonas quinolone signal are increased by a Pseudomonas aeruginosa-produced surfactant. Infect. Immun., 73(2),878,882 (2005).

16. V.L. ROGER, A.S. GO, D.M. LLOYD-JONES, E.J. BENJAMIN, J.D. BERRY, W.B. BORDEN, D.M. BRAVATA, S. DAI, E.S. FORD, C.S. FOX, S. FRANCO, H.J. FULLERTON, C. GILLESPIE, S.M. HAILPERN, J.A. HEIT, V.J. HOWARD, M.D. HUFFMAN, B.M. KISSELA, S.J. KITTNER, D.T. LACKLAND, J.H. LICHTMAN, L.D. LISABETH, D. MAGID, G.M. MARCUS, A. MARELLI, D.B. MATCHAR, D.K. MCGUIRE, E.R. MOHLER, C.S. MOY, M.E. MUSSOLINO, G. NICHOL, N.P. PAYNTER, P.J. SCHREINER, P.D. SORLIE, J. STEIN, T.N. TURAN, S.S. VIRANI, N.D. WONG, D. WOO, M.B. TURNER., AHA statistical - update heart disease and stroke statistics. Update Circulation, 125, e2-e220 (2012).

17. N. VOGELZANGS, A.T.F. BEEKMAN, Y. MILANESCHI, S. BANDINELL, L. FERRUCCI, B.W.J.H. PENNINX, Urinary cortisol and six-year risk of all-cause and cardiovascular mortality. J. Clin. Endocrinol. Metabol., DOI: 10.1210/jc.2010-019 (2010).

18. L. MANENSCHIJN, R.G.M. VAN KRUYSBERGEN, F.H. DE JONG, J.W. KOPER, E.F.C. VAN ROSSUM, Shift work at young age is associated with elevated long-term cortisol levels and body mass index. J. Clin. Endocrinol. Metabol., DOI: 10.1210/jc.2011-1551 (2011).

19. M.N. TSENG, P.C. CHUNG, S.S. TZEAN, Enhancing the stress tolerance and virulence of an entomopathogen by metabolic engineering of dihydroxynaphthalene melanin biosynthesis genes. Appl. Environ. Microbiol., 77, 4508 (2011).

20. M.H. KARAVOLOS, D.M. BULMER, H. SPENCER, G. RAMPIONI, I. SCHMALEN, S. BAKER, D. PICKARD, J. GRAY, M. FOOKES, K. WINZER, A. IVENS, G. DOUGAN, P. WILLIAMS, C.M. KHAN, Salmonella typhi sense host neuroendocrine stress hormones and release the toxin haemolysin. E. EMBO Reports, 12(3), 252, 258 (2011).

21. J.A. LOMHOLT, K. POULSEN, M. KILIAN, Epidemic population structure of Pseudomonas aeruginosa: evidence for a clone that is pathogenic to the eye and that has a distinct combination of virulence factors. Infect. Immun., 69, 6284, 6295 (2001).

22. D.P.S. RABIN, A.R. HAUSER, Pseudomonas aeruginosa ExoU, a toxin transported by the type III secretion system, kills Saccharomyces cerevisiae. Infect. Immun., 71(7), 4144, 4150 (2003).

23. C. GENDRIN, C. CONTRERAS-MARTEL, S. BOUILLOT, S. ELSEN, D. LEMAIRE, structural basis of cytotoxicity mediated by the type III secretion toxin ExoU from Pseudomonas aeruginosa. PLoS Pathog., 8(4), e1002637 (2012).

24. M. LYTE, The role of microbial endocrinology in infectious disease. J. Endocrinol., 137, 343–5 (1993). 25. R.M. DONLAN, J.W. COSTERTON, Biofilms: survival mechanisms of clinically relevant

microorganisms. Clin.Microbiol. Rev. 15, 167e193 (2002). 26. R.L. YOUNG, K.C. MALCOLM, J.E. KRET, S.M. CACERES, K.R. POCH, Neutrophil extracellular trap

(NET)-mediated killing of Pseudomonas aeruginosa: evidence of acquired resistance within the CF airway, independent of CFTR, PLoS ONE, 6(9), e23637 (2011).

27. A.M. HOLBAN, C. SAVIUC, A.M. GRUMEZESCU, M.C. CHIFIRIUC, O. BANU, V. LAZǍR, Phenotypic investigation of virulence profiles in some Candida spp. strains isolated from different clinical specimens. Lett.Appl. NanoBioSci., 1(3),72-76 (2012).

28. I. ANGHEL, A.M. HOLBAN, A.M. GRUMEZESCU, E. ANDRONESCU, A. FICAI, A.G. ANGHEL, M. MAGANU , V. LAZAR, M.C. CHIFIRIUC. Modified wound dressing with phyto-nanostructured coating to prevent staphylococcal and pseudomonal biofilm development. NRL, 7, 690 (2012).

29. C. SAVIUC, A.M. GRUMEZESCU, A. HOLBAN, C. CHIFIRIUC, D. MIHAIESCU, V. LAZAR, Hybrid nanostructurated material for biomedical applications. Biointerface Res.App.Chem., 1, 64-71 (2011a).

30. C. SAVIUC, A.M. GRUMEZESCU, E. OPREA, V. RADULESCU, L. DASCALU, M.C. CHIFIRIUC, M. BUCUR, O. BANU, Antifungal activity of some vegetal extracts on Candida biofilms developed on inert substratum. Biointerface Res.App.Chem., 1, 15-23 (2011b).

31. S.M.J. FLEISZIG, T.S. ZAIDI, M.J. PRESTON, M. GROUT, D.J. EVANS, G.B. PIER, The relationship between cytotoxicity and epithelial cell invasion by corneal isolates of Pseudomonas aeruginosa. Infect. Immun. 64, 2288,2294 (1996).

32. W. CRAIG, S.B. KAYE, J.N. TIMOTHY, H.J. CHILTON, S. MIKSCH, A.C. HART, Genotypic and phenotypic characteristics of Pseudomonas aeruginosa isolates associated with ulcerative keratitis. J. Med. Microbiol. 54, 519, 460, 526 (2005).

33. P. LANOTTE, S. WATT, L. MEREGHETTI, N. DARTIGUELONGUE, A. RASTEGAR-LARI, A. GOUDEAU, R. QUENTIN, Genetic features of Pseudomonas aeruginosa isolates from cystic fibrosis patients compared with those of isolates from other origins. J. Med. Microbiol., 53, 73, 81 (2004).



34. S. PANAGEA, C. WINSTANLEY, Y.N. PARSONS, M.J. WALSHAW, M.J. LEDSON, C.A. HART, PCR-based detection of a cystic fibrosis epidemic strain of Pseudomonas aeruginosa. Mol. Diagn., 7, 195, 200 (2003).

35. L. SMITH, B. ROSE, P. TINGPEJ, H. ZHU, T. CONIBEAR, J. MANOS, P. BYE , M. ELKINS, M. WILLCOX, S. BELL, C. WAINWRIGHT, C. HARBOUR, Protease IV production in Pseudomonas aeruginosa from the lungs of adults with cystic fibrosis. J. Med. Microbiol., 55, 1641, 1644 (2006).

36. D. HAYES, S.E. WEST, M.J. ROCK, Z. LI, L. MARK, M. SPLAINGARD, P.M. FARRELL, Pseudomonas aeruginosa in children with cystic fibrosis diagnosed through newborn screening: assessment of clinic exposures and microbial genotypes. Pediatr. Pulmonol., 45(7), 708,716 (2010).

37. A. SIMONETTI, E. OTTAIANO, M.V. DIANA, C. ONZA, M. TRIASSI, Epidemiology of hospital-acquired infections in an adult intensive care unit: results of a prospective cohort study. Ann. Ig., 25(4), 281-289 (2013).

38. R. GAYNES, J.R. EDWARDS, National Nosocomial Infections Surveillance System. Overview of nosocomial infections caused by gram-negative bacilli. Clin. Infect. Dis., 41, 848–854 (2005).

39. M. LEDIZET, T.S. MURRAY, S. PUTTAGUNTA, M.D. SLADE, V.J. QUAGLIARELLO, B.I. KAZMIERCZAK, The ability of virulence factor expression by Pseudomonas aeruginosa to predict clinical disease in hospitalized patients. PLoS ONE, 7(11), e49578 (2012).

40. V. FINCK-BARBANÇON, J. GORANSON, L. ZHU, T. SAWA, J.P. WIENER-KRONISH, S.M.J. FLEISZIG, C. WU, L. MENDE-MUELLER, D. FRANK, ExoU expression by Pseudomonas aeruginosa correlates with acute cytotoxicity and epithelial injury. Mol. Microbiol., 25, 547, 557 (1997).

41. B.A. COWELL, D.Y. CHEN, D.W. FRANK, A.J. VALLIS, S.M. FLEISZIG, ExoT of cytotoxic Pseudomonas aeruginosa prevents uptake by corneal epithelial cells. Infect. Immun., 68(1),403, 406 (2000).

42. H. FELTMAN, G. SCHULERT, S. KHAN, M. JAIN, L. PETERSON, A.R. HAUSER, Prevalence of type III secretion genes in clinical and environmental isolates of Pseudomonas aeruginosa. Microbiology, 147(10), 2659, 69 (2001).

43. C.M. SHAVER, A.R. HAUSER. Relative Contributions of Pseudomonas aeruginosa ExoU, ExoS, and ExoT to virulence in the lung. Infect. Immun. 72(12), 6969, 6977 (2004).

44. D.W. WAREHAM, M.A. CURTIS, A genotypic and phenotypic comparison of type III secretion profiles of Pseudomonas aeruginosa cystic fibrosis and bacteremia isolates. Int. J. Med. Microbiol., 297(4), 227-34 (2007).

45. R.G. KRALL, K.A. SCHMIDT, J.T. BARBIERI, Pseudomonas aeruginosa ExoT is a Rho GTPase-activating protein. Infect. Immun., 68, 6066, 6068 (2000).

46. L.B. GARRITY-RYAN, R.K. KAZMIERCZAK, J. COMOLLI, A. HAUSER, J.N. ENGEL, The arginine finger domain of ExoT contributes to actin cytoskeleton disruption and inhibition of internalization of Pseudomonas aeruginosa by epithelial cells and macrophages. Infect.Immun. 68,7100,7113 (2000).

47. A.R. HAUSER, E. COBB, M. BODÍ, D. MARISCAL, J. VALLÉS, J.N. ENGEL, J. RELLO, Type III protein secretion is associated with poor clinical outcomes in patients with ventilator-associated pneumonia caused by Pseudomonas aeruginosa. Crit. Care Med., 30, 521,528 (2002).

48. A.R.H. ROY-BURMAN, S.R. SAVEL, B.L. SWANSON, N.S. REVADIGAR, J. FUJIMOTO, T. SAWA, D.W. FRANK, J.P. WIENER-KRONISH, Type III protein secretion is associated with death in lower respiratory and systemic Pseudomonas aeruginosa infections. J. Infect. Dis., 183, 1767, 1774 (2001).

49. I.L. LAMONT, A.F. KONINGS, D. REID, Iron acquisition by Pseudomonas aeruginosa in the lungs of patients with cystic fibrosis. BioMetals, 22(1), 53,60 (2009).

50. T.H. FLO, K.D. SMITH, S. SATO, Lipocalin 2 mediates an innate immune response to bacterial infection by sequestrating iron. Nature, 432, (7019), 917, 921 (2004).

51. M.E. PEEK, A. BHATNAGAR, N.A. MCCARTY, S.M. ZUGHAIER, Pyoverdine, the major siderophore in Pseudomonas aeruginosa, evades NGAL recognition. Interdisciplinary Perspectives on Infectious Diseases, ID 843509 (2012).

52. D.E. WOODS, M.S. SCHAFFER, H.R. RABIN, G.D. CAMPBELL, P.A. SOKOL, Phenotypic comparison of Pseudomonas aeruginosa strains isolated from a variety of clinical sites. J. Clin. Microbiol., 24(2), 260, 264 (1986).

53. P. WOLF, U. BEILE, Pseudomonas exotoxin A: from virulence factor to anti-cancer agent. Int. J. Med. Microbiol. 299(3), 161, 176 (2009).

54. A. TANOM, S. FARAJNIA, S.N. PEERAYEH, J. MAJIDI, Cloning, expression and characterization of recombinant Exotoxin A-flagellin fusion protein as a new vaccine candidate against Pseudomonas aeruginosa Infections. Iran Biomed. J., 17(1), 1,7 (2013).

55. K. WOLSKA, P. SZWEDA, Genetic features of clinical Pseudomonas aeruginosa strains. Polish Journal of Microbiology, 58(3), 255,260 (2009).

Documents

Virulence markers in Pseudomonas aeruginosa isolates from ... Chifiriuc.pdf · virulence of P. aeruginosa depends mainly on two types of virulence determinants: (i) virulence factors