Unit 1: DNA and the Genome

Sub Topic 1.8: Genomics and Genomic Sequencing

CACCGCATCGAAATTAACTTCCAAAGTTAAG CTTGG

Higher Biology Pupil Course Notes

Page 2 of 16 Duncanrig Secondary CG 2016

On completion of this sub topic I will be able to:

State the sequence of nucleotide bases can be determined for individual genes and

entire genomes.

State that the study of the genome is called genomics.

Understand that there are different methods for sequencing of the genome.

State that restriction endonucleases are used to cut DNA into fragments.

Describe two methods of sequencing the genome – Sanger sequencing and shotgun

method.

State that fluorescent tags are used in genomic sequencing.

State the reasons for sequencing the entire genome.

State that phylogenetics is the study of evolutionary relatedness of different

organisms by comparing genome sequence data.

State that to compare sequence data, computer and bioinformatics (statistical

analysis) are required.

State that molecular clocks use the number of mutations to determine the date of

origins of groups of living things and to determine the sequence in which they

evolved.

State that fossil evidence and sequence data are use to determine the sequence of

evolutionary events.

State that phylogenetics and molecular clocks can be used to determine the main

sequence of events in evolution.

Describe the sequence of events in evolution.

Compare the genomes of different species.

Describe that comparing genomes of different species reveals a high degree of

conservation across different organisms.

State that comparing the genomes of different organisms can provide information

about the human genome.

State that bioinformatics is the fusing of molecular biology, statistical analysis and

computer technology.

Understand that analysing the human genome may give rise to personalised

medicine.

State that personalised medicines is known as pharmacogenetics.

State that personalised medicine allows genetic disease risk and treatment success

to be determined.

Understand the difficulties associated with personalised medicine.

Higher Biology Pupil Course Notes

Page 3 of 16 Duncanrig Secondary CG 2016

At the end of this topic you will have developed the following skills:

Demonstrating knowledge and understanding of biology by making statements.

Describing information, providing explanations and integrating knowledge.

Applying knowledge of biology to new situations and analysing information.

Planning and designing experiments and practical investigations to test a given

hypothesis or to illustrate particular effects.

Carrying out experiments and practical investigations safely, recording detailed

observations and collecting data.

Selecting information from a variety of sources.

Presenting information appropriately in a variety of forms.

Processing information (using calculations and units, where appropriate).

Making predictions and generalisations from evidence or information.

Drawing valid conclusions and giving explanations supported by evidence or

justification.

Evaluating experiments and practical investigations and suggesting

improvements.

Communicating findings and information effectively.

Prior Learning

Unit 1.4 DNA and the Production of Proteins.

The sequence of the DNA bases encodes information for the sequence of amino acids in proteins.

The sequence of the bases on the DNA therefore determines the function of the proteins they code for.

Messenger RNA (mRNA) is a single stranded molecule which carries a complementary copy of the code from the DNA, in the nucleus, to a ribosome.

The ribosome is the site of protein synthesis.

Proteins are assembled from amino acids at the ribosome.

Higher Biology Pupil Course Notes

Page 4 of 16 Duncanrig Secondary CG 2016

Genomic Sequencing

The sequence of the nucleotide bases on the DNA strand can be determined for

individual genes and also the entire genome. Genomic sequencing relies on

restriction endonuclease. Restriction endonuclease is a type of enzyme that

recognises short sequences of DNA called restriction sites. The enzyme then cuts the

DNA strand at an exact location. There are many restriction endonucleases and each

one is specific to one particular restriction site.

Sanger Sequencing

This is the most common method of DNA sequencing and was developed in 1977 by

Fred Sanger winning him his second Nobel Prize. In this method the DNA is used as a

template to generate a set of DNA fragments using restriction endonucleases. Each

DNA fragment generated differs from each other in length by a single base. The

fragments are then separated by size using gel electrophoresis and the bases at the

end are identified recreating the original sequence of the DNA.

Shotgun Sequencing

This method can be used to sequence large amounts of DNA such as the entire

genome. The DNA is first shredded into small fragments using restriction

endonuclease and each individual fragment is then sequenced. A computer is used to

sequence these fragments and by analysing all the areas of overlap between the DNA

fragments in a sample, the complete genome can be sequenced.

Fluorescent Tagging

A portion of DNA of unknown base sequence can be used as a template to synthesise

a complementary strand. During synthesis of the complementary strand, all the

requirements necessary are added including DNA polymerase, primer and the four

types of DNA nucleotides. In addition, a supply of modified bases called

dideoxynucleotides are included that have each been tagged with a different

fluorescent dye (ddA, ddT, ddC and ddG). During synthesis, each time a modified

base is incorporated into the new DNA strand, the synthesis of that strand is stopped

as the modified base cannot bond to a subsequent nucleotide. As long as the process

is carried out in a large enough scale, the synthesis of the complementary strand will

have been halted at every single nucleotide position.

This mixture of DNA fragments can then be separated using gel electrophoresis.

When they are separated, the smallest fragment will travel the furthest distance. The

process is automated and a computer captures the data and displays the sequence as

a series of peaks from which the sequences can be read.

Higher Biology Pupil Course Notes

Page 5 of 16 Duncanrig Secondary CG 2016

DNA Sequencing with Fluorescently Tagged Nucleotides (dideoxynucleotides).

Fluorescently tagged dideoxynucleotides:

ddC ddT

ddG ddA

DNA polymerase added and preparation is incubated to allow synthesis of DNA

Separation by gel electrophoresis and processing by automated sequence analyser

DNA replication stops every time a fluorescently tagged nucleotide is added to the DNA chain. This allows every base to be

sequenced

CACCGCATCGAAATTAACTTCCAAAGTTAAGCTTGG

Higher Biology Pupil Course Notes

Page 6 of 16 Duncanrig Secondary CG 2016

Bioinformatics

Bioinformatics is the fusing of molecular biology, statistical analysis and computer

technology. This technique allows gene sequencing and mapping on a large scale and

is rapid. There are a number of applications for this technology including the study of

evolutionary biology, inheritance and pharmacogenetics (personalised medicines).

Phylogenetics and Molecular Clocks

Phylogenetics is the study of the evolutionary relatedness amongst different groups

of organisms. Phylogenetic trees are diagrams that show evolutionary relationships,

they are constructed by comparing genome sequences. Comparison of sequences

gives evidence for three main domains of life; bacteria (prokaryotes), archaea and

eukaryotes.

Phylogenetic Tree of Life

The use of fossil evidence, sequence data and differences in DNA sequences

has determined the main sequence of events in the evolution of life.

YOU ARE HERE

Higher Biology Pupil Course Notes

Page 7 of 16 Duncanrig Secondary CG 2016

Sequence of Events in Evolution

Scientists have used a combination of genome sequence data and fossil evidence

to determine the sequence in which key events in evolution have taken place.

Evidence supports the theory that living things have undergone modifications

(changes) allowing them to become gradually more complex as evolution has

progressed. A summary of these key evolutionary events is shown in the diagram.

MIL

LIO

NS

OF

YE

AR

S A

GO

evolution of life on Earth (universal ancestor)

evolution of cells resembling prokaryotes

evolution of last universal ancestor (prokaryote)

evolution of cyanobacteria (prokaryotes) able to

photosynthesise

evolution of eukaryotes

evolution of multicellular organisms

evolution of animals

evolution of vertebrates

evolution of life of land plants

3900 – 2500

3500

4500 – 3500

580 - 500

485

1200

1850

2700

435

Higher Biology Pupil Course Notes

Page 8 of 16 Duncanrig Secondary CG 2016

Molecular Clocks

By comparing inherited DNA substitution mutations or single nucleotide

polymorphisms (SNP’s), it is possible to establish relationships between different

population groups within the same species or between different closely related species.

When two new species develop from a common ancestor, each will inherit and

continue to accumulate a unique set of random mutations. Assuming that mutations

accumulate at a constant rate, the number of mutations will be proportional to the

length of time that the two groups have been separated. Therefore, the number of

mutations will be equivalent to a set period of time – a molecular clock.

A molecular clock can be used to determine when events in human evolution occurred.

For example, fossils of our own species, Homo Sapiens, have been found throughout

the old world dating to 100, 000 years ago but molecular clock analysis suggests that

humans have been around for 150, 000 years. Could there still be fossils waiting to be

discovered?

Am

ino

Acid

Dif

fere

nce

s

Time (million years)

Higher Biology Pupil Course Notes

Page 9 of 16 Duncanrig Secondary CG 2016

Comparative Genomics

Many genomes have been sequenced, particularly of disease causing organisms, pest

species and species that are important model organisms for research. A comparison of

genomes has revealed that much of the genome is highly conserved across different

organisms. In other words, the genomes of different organisms exhibit the same or

very similar DNA sequences. Comparative genomics can compare the sequences

genomes of:

members of different species – such as disease causing microorganisms.

members of the same species – such as harmless strains of E. coli with the

strains that cause serious food poisoning.

cancerous cells and normal cells – in order to discover the cause of

uncontrolled growth in tumour cells.

model organisms – organisms that possess genes that are equivalent to

human genes and can therefore be easily studied in the lab.

Higher Biology Pupil Course Notes

Page 10 of 16 Duncanrig Secondary CG 2016

Comparative Genome Sizes of Humans and Other Model Organisms.

(Taken from Nature’s Library of Comparative Genomics.)

Organism Estimated Size

(base pairs)

Chromosome

Number

Estimated Gene

Number

Human 3 billion 46 ~25, 000

Mouse 2.9 billion 40 ~25, 000

Fruit Fly 165 million 8 13, 000

Mouse Ear

Cress (plant) 157 million 10 25, 000

Roundworm 97 million 12 19, 000

Yeast 12 million 32 6, 000

Bacteria 4.6 million 1 3, 200

The mouse ear cress has a smaller genome than the fruit fly but has twice as many

genes. The number of genes in this small plant is the same as the human. This

shows that the size of the genome and the number of genes is not proportional to an

organisms place on the evolutionary tree.

Fruit flies are thought to share 60% of their genes with humans. In addition, two

thirds of genes known to be involved in cancer have also been found in fruit flies. By

studying how these genes work in a much simpler organism, we should get a better

understanding of how these genes operate in humans and therefore be able to control

or prevent them becoming diseased.

Higher Biology Pupil Course Notes

Page 11 of 16 Duncanrig Secondary CG 2016

Case Study: The Importance of the Fugu Fish Genome (puffer fish)

The genome of the deadly Fugu (puffer fish) has been completely sequenced. It has

been discovered that it possesses one of the smallest genomes, eight times smaller

than humans and yet it has a similar number of genes. It has been found that 75% of

puffer fish genes have a human equivalent even though men and fish diverged from

their common ancestor 450 million years ago. This has proved to be a useful model

organism since the puffer fish genome project has revealed about a thousand new

genes in the human genome.

Using information from the PowerPoint and pages 97 and 98 of Torrance textbook,

summarise the key reasons why the puffer fish genome is important:

___________________________________________

________________________________________________

________________________________________________

________________________________________________

___________________________________________

________________________________________________

________________________________________________

________________________________________________

Higher Biology Pupil Course Notes

Page 12 of 16 Duncanrig Secondary CG 2016

Personal Genomics

An individual’s genome sequence can be analysed

using bioinformatic tools called personal genomics.

The potential of analysing an individual’s genome in this way

could lead to personalised medicines (pharmacogenetics).

In years to come, a person’s entire genome may be

sequenced early in life and stored as an electronic medical record available for future

consultation by doctors when required. This could include knowledge of the genetic

component of disease risk and the likelihood of success in a particular treatment as

well as understanding the complex nature of many diseases.

Pharmacogenetics

Pharmacogenetics brings together the study of how drugs

work in the body (pharmacology) and genetics.

Understanding how genes can influence the response to

drugs can help explain why some patients respond well to drugs and others do not. It

can also help doctors understand why some patients require higher or lower doses of a

particular drug. The diagram on the following page shows a case study of how

leukaemia patients have their drug therapy tailored.

Higher Biology Pupil Course Notes

Page 13 of 16 Duncanrig Secondary CG 2016

Pharmacogenetics – A Case Study

Individuals respond differently to the anti leukaemia drug 6-mercaptopurine

Most people

metabolize the drug

quickly. Doses need to be high enough to

treat leukaemia and prevent relapses.

Others metabolize

the drug slowly and

need lower doses to avoid toxic side

effects of the drug.

A small proportion of

people metabolize

the drug so poorly that its side effects

can be fatal.

The diversity in response is due to variations in the gene for an enzyme called TPMT (thiopurine methyltransferase)

After a simple blood test, individuals can be given doses of medication that are tailored to their genetic profile

Normal dose Dose for an extra slow metaboliser

(TMPT deficient)

Higher Biology Pupil Course Notes

Page 14 of 16 Duncanrig Secondary CG 2016

There are some pharmacogenetic tests already in use:

Disease Test Positive Test Recommendation

Breast cancer high levels of HER2

RNA protein

Prescribe Herceptin

Chronic Myeloid

Leukaemia

mutated bcr/abl

gene

Prescribe Gleevec or Glivec

Maturity Onset

Diabetes of the

young

altered KATP gene Prescribe sulphonylurea

Venous

Thrombosis

mutated factor V

Leiden gene

Avoid oral contraceptives

HIV variations in HLAB

and Hsp 70-Hom

genes

Avoid abacavir treatment

Using page 105 of your textbook, describe some of the ethical issues surrounding the

use of pharmacogenetics and who should have access to genetic information.

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

Higher Biology Pupil Course Notes

Page 15 of 16 Duncanrig Secondary CG 2016

Sub Topic 1.8: Genomics and Genomic Sequencing

How well do you rate your knowledge?

I am able to…….

State the sequence of nucleotide bases can be determined for individual genes and entire genomes.

State that the study of the genome is called genomics.

Understand that there are different methods for sequencing of the genome.

State that restriction endonucleases are used to cut DNA into fragments.

Describe two methods of sequencing the genome – Sanger sequencing and shotgun method.

State that fluorescent tags are used in genomic sequencing.

State the reasons for sequencing the entire genome.

State that phylogenetics is the study of evolutionary relatedness of different

organisms by comparing genome sequence data.

State that to compare sequence data, computer and bioinformatics (statistical analysis) are required.

State that molecular clocks use the number of mutations to determine the

date of origins of groups of living things and to determine the sequence in

which they evolved.

State that fossil evidence and sequence data are use to determine the sequence of evolutionary events.

State that phylogenetics and molecular clocks can be used to determine the

main sequence of events in evolution.

Describe the sequence of events in evolution.

Compare the genomes of different species.

Complete: Column 1 – before your Unit assessment Column 2 – before your Prelim Column 3 – before your final exam

Higher Biology Pupil Course Notes

Page 16 of 16 Duncanrig Secondary CG 2016

Describe that comparing genomes of different species reveals a high degree of conservation across different organisms.

State that comparing the genomes of different organisms can provide

information about the human genome.

State that bioinformatics is the fusing of molecular biology, statistical analysis and computer technology.

Understand that analysing the human genome may give rise to

personalised medicine.

State that personalised medicines is known as pharmacogenetics.

State that personalised medicine allows genetic disease risk and treatment

success to be determined.

Understand the difficulties associated with personalised medicine.