Upload
timothy-sveeggen
View
217
Download
2
Embed Size (px)
Citation preview
Mutagenesis of Magnetosome Protein, Mms6:Effects on Reductase Activity
Honors Capstone ProjectTimothy Sveeggen
Class of 2015
Mutagenesis of Magnetosome Protein, Mms6 Timothy Sveeggen
AbstractRecent investigations of the biochemical function of iron have presented many opportunities for
its use in various industries. For example, iron’s ability to form magnetic nanoparticles has many
implications in the development of new medical techniques, bioengineering, and other related
fields. Because the molecular specifics of iron manipulation within a cell are not well
understood, this project was intended to investigate the properties of Mms6, a protein component
of bacterial magnetosome membranes. Magnetosomes are iron-rich compartments containing
highly regulated magnetic iron-nanoparticles, which allow bacteria to orient themselves with
respect to the magnetic field. Mms6 is believed to use its iron-binding and reductase activities to
promote the development of these magnetic particles. While a previous study identified four
amino acids in Mms6 to be critical to iron binding, this experiment investigated the effects of
these mutations on reductase activity by testing double mutants of the protein that were predicted
to be inactive. Through mutagenesis of Mms6, this study was able to confirm that double
substitutions at serine 119 & serine 122, as well as serine 119 & glutamic acid 124, inhibited
reductase activity, giving insight to the mechanism of iron reduction by Mms6.
IntroductionThe magnetosome of magnetotactic bacteria is a fascinating organelle that gives cells the ability
to orient themselves through the magnetic field. A genomic island for the magnetosome (termed
MAI) has been identified within the genome of magnetotactic bacteria, and it has been shown
that these genes are responsible for the biogenesis of the magnetosome. A specific gene, Mms6,
is of particular interest. The protein encoded by this gene is bound tightly to the magnetite
particles of the magnetosome, indicating Mms6 plays an important regulatory role in magnetite
crystal shape and morphology of magnetotactic bacteria [1, 2]. Also interesting, is that Mms6
protein has been shown to promote formation of magnetite nanoparticles in vitro [3, 4, 5].
The in vitro function of Mms6 as a biomineralization protein of ferric iron has been well
investigated by Dr. Marit Nilsen-Hamilton’s lab here at Iowa State [5, 6]. Their studies have also
found reductase activity by the Mms6 protein. To understand how Mms6 functions as a
reductase and how it binds iron during in vitro magnetite synthesis, the lab conducted site-
directed mutagenesis to create a series of recombinant proteins, consisting of point mutations that
2
Mutagenesis of Magnetosome Protein, Mms6 Timothy Sveeggen
changed one amino acid to alanine in each protein. This process identified four amino acid
residues in the protein sequence that are important for structure and function [Unpublished data].
These mutated amino acids significantly decreased iron binding and reductase activity, but not
completely. It is my project through mutagenesis of Mms6 that provided two double mutants of
these four critical sites for me and others in the Nilsen-Hamilton lab to investigate iron binding
and reductase activities.
ObjectiveAs the four potential iron binding sites (Ser119, Ser122, Asp123, and Glu124) in Mms6 protein
are all polar amino acids that can chelate iron (see figure 1), it was predicted that replacing these
polar amino acids with nonpolar alanine would alter the process of crystal formation by
decreasing the iron binding ability of Mms6. The Nilsen-Hamilton lab previously found iron
binding decreases significantly when changing any of these single amino acids into alanine
[Unpublished data], but the iron binding and reductase activity in these mutants are not
completely eradicated, and the interactions between these sites (and possibly others) still needs to
be investigated. Therefore, double or triple mutations are necessary to completely remove these
activities.
For this project, only three amino acids were targeted – due to time constraints. Two mutant
strains were made, S119A/S122A & S119A/E124A. We hypothesized that substituting these
amino acids into alanine will greatly reduce reductase activity of the wild-type control Mms6
protein, which would in turn alter magnetite formation.
3
Mutagenesis of Magnetosome Protein, Mms6 Timothy Sveeggen
Figure 1 – Note difference in polarity as shown by the ovals.
MethodsTo mutate this gene, the Agilent QuikChange II Site-Directed Mutagenesis Kit [8] was used.
While the kit contained all the buffers and solutions needed to make the modification possible,
the specific DNA primers had to be designed. After determining the proper primers and mutation
sequence, they were sent to the ISU DNA sequencing lab to be made. Once obtained, they were
amplified by Polymerase Chain Reaction (PCR) according to the kit instructions. Once enough
of the mutated sequences were made, the process of modifying E. coli to express the modified
gene began [7, 8].
Sample SequenceWild-Type ………cgtgatatcgaatcggcgcagagcgacgaggaagtc………
S119A/S122A ………cgtgatatcgaagcggcgcaggcggacgaggaagtc………
S119A/E124A ………cgtgatatcgaagcggcgcagagcgacgcggaagtc………
4
Mutagenesis of Magnetosome Protein, Mms6 Timothy Sveeggen
The amplified sequences were digested using Dpn I, which cleaved the DNA to remove the
template strands before the copied DNA was taken up by the bacteria. This digested DNA was
added to samples of E. coli strains to be incubated on ice and heat pulsed at 42ᶱ C which allowed
uptake of the mutated plasmid by the bacteria. Successful transformation was confirmed by
culturing the bacteria on ampicillin-containing plates (the inserted plasmid also contains
ampicillin resistance) and sequencing through the Iowa State DNA facility [7, 8].
Once the E. coli successfully incorporated the new plasmid, the mutated Mms6 strains were
made on a larger scale. The E. coli containing the double mutants were cultured and allowed to
express the protein through IPTG induction of the lac operon, which was then extracted and
purified using Talon resin. Talon resin binds to the protein at a specific His-poly (A) tag that is
already linked to the recombinant protein. Once bound to the resin, the material extracted from
the inclusion bodies with 7M urea was loaded onto a column which allowed unwanted cell
contents to pass through, leaving the protein attached to the resin [9]. The column was washed to
remove all unwanted proteins and the His-tagged protein was freed from the resin by competition
with imidazole. The purified protein was refolded by dialysis and then evaluated for reductase
activity.
Reductase activity was measured by loading the protein of interest into a lipid bicelle. As Mms6
is a membrane protein, this helps replicate a natural environment for in vitro assay. DHPC and
DMPC were the two lipids used to form the bicelle, which incorporated the protein during a
period of rapid freezing and thawing. Ferric citrate was the substrate used at differing
concentrations, and ferrozine was the marker for tracking reduction of ferric citrate over time. As
the protein reduces the ferric iron, ferrozine then irreversibly binds to it, causing a color change
to be read by a spectrometer based on absorbance at 562nm (A562).
ResultsNot surprisingly, double mutation at serine 119 & serine 122, showed essentially no reductase
activity compared to the wild-type. However, substitutions at serine 119 & glutamic acid 124
showed mixed results regarding reductase activity. The data shows a change in absorbance
greater than the wild-type, which leads us to think rapid precipitation of the sample may have
5
Mutagenesis of Magnetosome Protein, Mms6 Timothy Sveeggen
fooled the spectrometer. This is consistent with the observation that the end color change of
sample for S119A/E124A was the same as S119A/S119A, whereas the wild-type showed a much
more drastic change in color (Figure 4).
Figure 2 – A562 readings. Measurements were taken every minute for 6 hours. To examine reductase activity more
accurately, the time range of highest slope (absorbance/time) should be evaluated apart from the rest of the assay.
This is usually within the first hour of activity.
6
1 17 33 49 65 81 97 1131291451611771932092252412572732893053213373530
0.005
0.01
0.015
0.02
0.025
0.03
Wild-Type
0 uM80 uM160 uM320 uM
Abso
rban
ce (5
62nm
)
1 17 33 49 65 81 97 113129145161177193209225241257273289305321337353
-0.008-0.006-0.004-0.002
00.0020.0040.006
S119A/S122A
0 uM80 uM160 uM320 uM
Abso
rban
ce (5
62nm
)
1 17 33 49 65 81 97 113 129 145 161 177 193 209 225 241 257 273 289 305 321 337 3530
0.02
0.04
0.06
0.08
0.1
0.12
S119A/E124A
0 uM80 uM160 uM320 uM
Abso
rban
ce (5
62nm
)
Mutagenesis of Magnetosome Protein, Mms6 Timothy Sveeggen
Figure 3 – A562 measurements within the first hour. Slope from the equation of linear regression used to estimate the
change in absorbance.
7
1 4 7 10 13 16 19 22 25 28 31 34 37 40 43 46 49 52 55 580
0.005
0.01
0.015
0.02
0.025
f(x) = 0.000191678243956655 x + 0.00167881355932204R² = 0.982806448471659f(x) = 0.000183578771881078 x + 0.00135084745762712R² = 0.977597280420958
f(x) = 0.000271992220061128 x + 0.00180423728813559R² = 0.973930734573993
f(x) = 0.000332967490969714 x + 0.00195282485875706R² = 0.977229083689173
Wild Type
0 uMLinear (0 uM)80 uMLinear (80 uM)160 uMLinear (160 uM)320 uMAb
sorb
ance
(562
nm)
1 4 7 10 13 16 19 22 25 28 31 34 37 40 43 46 49 52 55 580
0.001
0.002
0.003
0.004
0.005
f(x) = 2.08946929702696E-05 x + 0.00132937853107345R² = 0.50905429093875f(x) = − 1.42539594331759E-05 x + 0.00253474576271187R² = 0.30723870542938
f(x) = − 1.02806335093083E-05 x + 0.00438022598870057R² = 0.245937568864921
f(x) = − 3.38983050847459E-06 x + 0.00277005649717514R² = 0.0263974035340788
S119A, S122A
0 uMLinear (0 uM)80 uMLinear (80 uM)160 uMLinear (160 uM)320 uMAb
sorb
ance
(562
nm)
1 4 7 10 13 16 19 22 25 28 31 34 37 40 43 46 49 52 55 580
0.010.020.030.040.050.060.070.08
f(x) = 0.000473812170047235 x + 0.00830706214689267R² = 0.991312225098545f(x) = 0.000492859127535427 x + 0.00913446327683616R² = 0.968822932757201
f(x) = 0.000402709085857183 x + 0.0234590395480226R² = 0.93364343217356
f(x) = 0.000943901083634343 x + 0.0187610169491525R² = 0.978742364167374
S119A, E124A
0 uMLinear (0 uM)80 uMLinear (80 uM)160 uMLinear (160 uM)320 uMAb
sorb
ance
(562
nm)
Mutagenesis of Magnetosome Protein, Mms6 Timothy Sveeggen
Figure 4 – Samples after reductase assay. Note mutant samples have same color despite different A562
measurements.
To better gauge reductase activity, the change in absorbance had to be normalized against the
molar extinction coefficient of the protein (predetermined), by dividing the slope by the
coefficient. This provides the initial velocity of enzyme activity, which is a better comparison
between similar proteins.
Samples Concentration Slope Molar Extinction Coefficient Initial Velocity (Slope/ME)
Wild-type
0 uM 0.000
2
28000 7.14286E-09
80 uM 0.000
2
28000 7.14286E-09
160 uM 0.000
3
28000 1.07143E-08
320 uM 0.000
3
28000 1.07143E-08
S119A/S122A
0 uM 28000 0
80 uM 28000 0
160 uM 28000 0
320 uM 28000 0
8
S119A/E124AWild-type
S119A/S122ANo Protein
0uM 80uM 160uM 320uM
Mutagenesis of Magnetosome Protein, Mms6 Timothy Sveeggen
S119A/
E124A
0 uM 0.000
5
28000 1.78571E-08
80 uM 0.000
5
28000 1.78571E-08
160 uM 0.000
4
28000 1.42857E-08
320 uM 0.000
9
28000 3.21429E-08
Having the initial velocities also allows us to determine the saturation (equilibrium)
concentration for the investigated proteins. However, the data for this experiment did not yield
fine enough results for confident values. The data is able to suggest the wild-type protein nears
saturation around 160-320 uM, as the slope nears zero in this range. This means the enzyme is
nearing its maximum rate of activity; it is fully saturated.
Figure 5 – The saturation plot is a measure of change in initial velocity as the concentration of substrate increases.
When the initial velocity no longer changes, the enzyme is saturated.
DiscussionA single reductase assay is able to provide a lot of information regarding a protein’s behavior.
Because of this information, it is also easier to visualize the impact mutations have on protein.
Such impacts are certainly apparent in this experiment. While further testing is needed to
confirm these results and address outliers in the data, it’s clear that replacing multiple residues of
9
Mutagenesis of Magnetosome Protein, Mms6 Timothy Sveeggen
Mms6’s putative activity center with alanine (that lacks a hydroxyl group and cannot chelate
iron) will have significant effects on reductase activity.
Aside from repeating reductase assays, evaluating the iron-binding of these mutants will be the
next step to further understand how Mms6 functions at a molecular level. It is expected that these
mutants will have decreased iron-binding to match their reduced reductase activity, given that the
reduced iron-binding of single amino acid substitutions has already been observed.
ConclusionUnderstanding the biological use of iron is critical for many industries. Within medicine,
biotechnology, and others, manipulation of iron is revealing new possibilities that change how
we think about molecular biology. By understanding the reductase activity of Mms6, we have
better insight towards the biological manipulation of iron at a molecular level. This project may
also provide better understanding of the manipulation of iron by Mms6 protein, which could
contribute to development of better iron nanocrystals in vitro.
Citations
1. Amemiya Y, Arakaki A, Staniland SS, Tanaka T, Matsunaga T. Controlled Formation of
Magnetite Crystal by Partial Oxidation of Ferrous Hydroxide in the Presence of
Recombinant Magnetotactic Bacterial Protein Mms6. Biomaterials. 2007; 28:5381-5389.
2. Arakaki, A.; Webb, J.; Matsunaga, T., A novel protein tightly bound to bacterial
magnetic particles in Magnetospirillum magneticum strain AMB-1. J Biol Chem 2003,
278, (10), 8745-50.
3. Tanaka, M.; Mazuyama, E.; Arakaki, A.; Matsunaga, T., MMS6 protein regulates crystal
morphology during nano-sized magnetite biomineralization in vivo. J Biol Chem 2011,
286, (8), 6386-92.
4. Feng S, Wang L, Palo PE, Liu X, Mallapragada SK, and Nilsen-Hamilton M. Integrated
Self-Assembly of the Mms6 Magnetosome Protein to Form an Iron-Responsive
Structure. Int. J. Mol. Sci. 2013; 14:14594-14606.
10
Mutagenesis of Magnetosome Protein, Mms6 Timothy Sveeggen
5. Wang L, Prozorov T, Palo PE, et al. Self-Assembly and Biphasic Iron-Binding
Characteristics of Mms6, A Bacterial Protein That Promotes the Formation of
Superparamagnetic Magnetite Nanoparticles of Uniform Size and Shape.
Biomacromolecules. 2012; 13:98−105.
6. Pierre JL, Fontecave M, Crichton RR. Chemistry for an Essential Biological Process: The
Reduction of Ferric Iron. BioMetals 2002. 15:342-346.
7. DiStefano JK. Disease Gene Identification. Methods in Molecular Biology. 2011; 700.
8. QuikChange II Site-Directed Mutagenesis Kit: Instruction Manual (Revision C). Agilent
Technologies Inc; 2010.
9. Clontech Laboratories Inc. Talon® Metal Affinity Resins User Manual. Catalog Number
PT1320-1 (102612).
11