THE JOURNAL OF BIOLOGICAL CHEMISTRY (0 1992 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 267, No. 22, Issue of August 5, pp. 15692-15700,1992 Printed in U. S. A.

Three Genes for the Human High Affinity Fc Receptor for IgG (FcrRI) Encode Four Distinct Transcription Products*

(Received for publication, December 31, 1991)

Linda K. Ernst$, Jan G. J. van de Winkel$, Ing-Ming Chiu$ll, and Clark L. Anderson$II From the $Department of Internal Medicine and (Comprehensive Cancer Center, Ohio State University, Columbus, Ohio 43210 and the §Department of Immunology, University Hospital Utrecht, Utrecht, The Netherlands

Three distinct but closely related classes of receptors that bind the Fc portion of immunoglobulin G (FcyRI, -11, and -111) have been identified in humans. Only FcyRI has high affinity for ligand and has a unique third extracellular domain (EC3). We have character- ized three genes for human Fc-yRI (A, B, and C). Each gene consists of six exons, spans 9.4 kilobase pairs, and localizes to chromosome 1. Although they are re- markably similar, genes B and C are notably different from A; in-frame stop codons are present in the EC3 domain of genes B and C, and deletions occur in a splice donor sequence of gene B. Four distinct Fc-yRI tran- scripts were analyzed. One transcript, from gene A, would encode a transmembrane receptor with three external domains. A second transcript, an alterna- tively spliced product of gene B, would encode a two- external domain transmembrane receptor. Two tran- scripts, from genes B and C, have stop codons in EC3 and would be predicted to generate secreted receptors.

Immunoglobulin G (IgG)’ antibodies manifest some of their diverse biological effects by first binding and then clustering Fc receptors (FcyR) on the outer membranes of human leu- kocytes. Studies to date of the molecular mechanisms by which FcyR clustering generates biological signals have fo- cused on the structure of these molecules. These FcyR have been found to constitute a small family of integral membrane glycoproteins, a group within the Ig gene superfamily, whose members appear to fall into three structural classes (I, 11,111). FcyRI is unique in that it expresses high affinity for ligand (KO, 10R-109 M-’), possesses a third extracellular (EC3) Ig-like domain not seen in the other two-domain low affinity FcyR, and is expressed only on cells of the mononuclear phagocyte

* This work was supported by United States Public Health Service Award R01-CA44983. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in thispaper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) M91645, M91646, and M91647.

11 To whom correspondence and reprint requests should be ad- dressed Dept. of Internal Medicine, Ohio State University College of Medicine, 2054 Davis Medical Research Center, 480 West 9th Ave., Columbus, OH 43210. Tel.: 614-293-4819. Fax: 614-293-5631.

The abbreviations used are: IgG, immunoglobulin G; FcyR, recep- tors for Fc domain of IgG; S, signal; EC, extracellular; TM, trans- membrane; C, cytoplasmic; yIFN, y-interferon; kb, kilobase pair(s1; bp, base pair(s); UT, untranslated PMN, polymorphonuclear leuko- cytes; PBMC, peripheral blood mononuclear cells; RT, reverse tran- scription; PCR, polymerase chain reaction; N-CAM, neural cell adhe- sion molecule; IBF, immunoglobulin-binding factor; PIPES, 1,4-pi- perazinediethanesulfonic acid.

system and at low levels on neutrophilic polymorphonuclear leukocytes (PMN). The receptor appears able to mediate most of the functions manifested by FcyR on leukocytes, including endocytosis, cytolysis, and inflammatory mediator release (1, 2). Its expression is regulated by both y-interferon (yIFN) and glucocorticoids (3,4).

Attempting ultimately to correlate the structure of FcyRI with its function, we have recently centered our attention on the organization and nucleotide sequence of its genes. We had earlier described gene A for human FcyRI (5); it consists of 6 exons spanning 9.4 kilobase pairs (kb) (Fig. 1B). This gene was identified by screening a human genomic DNA library with a 483-base pair (bp) probe from the 5’ end of FcyRI cDNA p135 (Fig. lA). Seven positive phage clones were isolated; one phage clone (phage 1) that appeared to be full- length by hybridization analysis was chosen for sequence analysis. The coding region of the FcyRIA gene described by these studies was found to be nearly identical with the se- quence of the cDNA p135 ((5, 6), Fig. 5). However, Southern blot analysis of human genomic DNA from 13 randomly selected individuals showed an additional hybridizing HindIII restriction fragment that was not present in the phage 1 clone used to characterize the FcyRIA gene. This observation sug- gested the existence of a second FcyRI gene lacking the more 5’ of the two internal HindIII sites observed in the FcyRIA gene (5).

Therefore, in this study we analyzed the remaining six phage clones isolated from the original genomic library screen in more detail to identify potential candidates for other FcyRI genes. Here we report the structures of two additional FcyRI genes (B and C) that are remarkably similar in gene organi- zation but appear to generate three unique transcripts that are distinct from the three Ig-like domain transmembrane receptor encoded by FcyRIA.

EXPERIMENTAL PROCEDURES

Screening and Isolation of Genomic DNA Clones-A human ge- nomic library was constructed and screened as described previously (5). Briefly, human leukocyte DNA was isolated, partially digested with Sau3A1, sized using a NaCl gradient (10-25 kb), and partially filled-in using the Klenow fragment of DNA polymerase I. This DNA was ligated to XhoI-digested XFIX (Stratagene) phage arms that had been partially filled-in to be compatible with the partially filled-in Sau3AI ends of the genomic DNA. We screened 5 X lo5 plaques with the 5’ 483-bp EcoRI fragment (nucleotides 1-483, Fig. 1A) of the FcyRI cDNA p135 (generously provided by B. Seed, Massachusetts General Hospital) (6). Hybridization and washes were performed as described previously (7). Seven independent hybridization-positive plaques were purified to homogeneity after two additional cycles of screening with the 483-bp EcoRI fragment.

Characterization of Genomic Clones-DNA from clones 1 to 7 was isolated, digested with HindIII or HindIII plus SalI (SalI is in the polylinker of the vector), separated on agarose gels, and analyzed with probes made from the 5’ 121-bp NcoI, the 3’ 200-bp PstI cDNA

15692

Human High Affinity Fc-y Receptor Genes and Transcripts 15693

fragments, and the complete cDNA p135 (Fig. 1A). Hybridizing fragments of clones 1, 4, and 5 were cloned into the pBluescript KS(+) vector (Stratagene). These subcloned fragments were charac- terized by standard restriction endonuclease mapping (8) and South- ern analyses. The DNA sequence of the insert fragments was deter- mined by the chain termination method (9) using a T7 polymerase sequencing kit (Pharmacia LKB Biotechnology Inc.). All exons, the exon-intron junctions, the 5"flanking region, and parts of the introns were sequenced on both strands using synthetic oligonucleotides (18- mers) corresponding to known exon or intron sequences, or the T7 and T3 primers of pBluescript KS(+). DNA sequences were analyzed using a computer program from DNA Star, Inc.

RNase Protection Analysis-A 367-bp EcoRI to AflII fragment of cDNA p135 (nucleotides 483-844, Fig. 1A) was used as a probe in RNase protection analysis of both DNA and RNA. The 367-bp EcoRI- AflII fragment was inserted into pBluescript KS for synthesis of an antisense RNA probe using T7 polymerase, [a-"'P]UTP, and an RNA transcription kit (Stratagene). For phage DNA analysis, the riboprobe ( 5 X 105 cpm in 30 pl of 80% formamide, 0.4 M NaC1,40 mM PIPES (pH 6.4), and 1 mM EDTA) was hybridized overnight at 45 "C with 40 ng of DNA from phage clones 1 to 7. The samples were digested as described (5) followed by phenol extraction, precipitation, and separation on a 6% polyacrylamide, 7 M urea denaturing gel in preparation for autoradiography. 32P-End-labeled Hinff fragments of pBR322 DNA were used as molecular weight markers.

For RNA analysis, total cellular RNA was isolated from U937 cells, a human FcyRI expressing monocyte cell line (American Type Cul- ture Collection), from U937 cells after overnight incubation with 150 units/ml yIFN (Genentech), from PMN and PBMC (lo), and from FcyRII expressing K562 cells. RNA was isolated using the RNAzol B method (CinnaIBiotecx, Friendswood, TX). The riboprobe was hybridized overnight at 45 "C with 30 pg of total RNA, and RNase protection analysis was performed as described above.

Southern Blot Analysis-High molecular weight genomic DNA was prepared from human leukocytes by standard methods (11). Hamster/ human hybrid cell line DNA was obtained from Bios Corp., New Haven, CT. DNA was digested with restriction enzymes (Boehringer Mannheim), fractionated through an agarose gel, transferred to Hy- bond-N (Amersham), and subjected to Southern blot analysis as previously described (7). Blots were hybridized with probes made from the cDNA p135 described above. Probes were labeled with [a- '"PldCTP using a random-primed DNA labeling kit (Boehringer Mannheim). "'P-End-labeled HindIII fragments of X-phage DNA were used as molecular weight markers.

RTIPCR Amplification Methods-Oligonucleotides for sequencing and PCR were synthesized by Oligos Etc., Inc., Guilford, CT. R T was performed by using 1 pg of total RNA in a cDNA synthesis reaction utilizing Moloney murine leukemia virus reverse transcriptase sup- plied in a first-strand cDNA synthesis kit (Pharmacia). PCR was performed by adding one-tenth of the RT product into a 100-pl volume reaction containing 10 mM Tris-HC1 (pH 8.3), 1.5 mM MgCI,, 50 mM KCl, 0.1 mg/ml gelatin, 200 p M concentration each of four dNTPs, 25 pmol of each oligonucleotide primer, and 0.1 unit of Taq DNA polymerase (Boehringer Mannheim). FcyRI-specific primers were primer 9 (5'-ACACCACAAAGGCAGTGA-3') corresponding to EC1 nucleotides 1-18 in Fig. 8 and primer 10 (5"CACCCAGAGAA- CAGTGTT-3') corresponding to the reverse complement of TM/C nucleotides 764-881 in Fig. 8, a. PCR conditions were 95 "C for 5 min; 55 "C, 3 min; 72 "C, 5 min; 40 cycles of 94 "C for 1 min, 55 "C for 1 min, 72 "C for 1 min; 72 "C for a 15-min extension. PCRproducts were fractionated by agarose gel electrophoresis and visualized by ethidium bromide staining. Gels to be used for Southern analyses were treated for 30 min in 1.5 M NaCl and 0.25 M NaOH and set up for transfer.

Analysis of RTIPCR Products Using Gene-specific Oligonucleotides QS Probes-Oligonucleotides 37A (5"GAATATCTGTCACTGTGA- 3 ' ) and 39B/C (5'-GAATATCACAATACACTG-3') corresponding to EC2 nucleotides 487-504, a and b l , respectively, in Fig. 8 were 5'- phosphorylated with [y-"PIATP and polynucleotide kinase. 1-2 X lo6 cpm of labeled oligonucleotides were used in Southern blot and slot-blot analyses. Filters were prehybridized in 5 X SSC (1 X SSC is 150 mM sodium chloride and 15 mM sodium citrate), 1 X P E (1 X PE is defined in Ref. 7), and 150 pg/ml salmon sperm DNA (Sigma) a t 33 "C for 1 h (12). The end-labeled probe was added to the prehybrid- ization mixture and incubated a t 33 "C overnight for Southern analy- sis or for 1-2 h for slot-blot analysis. The filters were washed in 5 X SSC at room temperature for 5 min and in 5 X SSC, 0.1% sodium dodecyl sulfate at 42 "C for 5 min and analyzed by autoradiography.

Cloning of RTIPCR Products-The RT/PCR products were puri- fied and concentrated by using an Elutip-D column (Schleicher and Schuell). pBluescript KS was digested with EcoRV and incubated with dTTP and DNA Taq polymerase according to the method of Marchuk et at. (13) to generate a T-tailed vector. One-twentieth of the PCR reaction was mixed with 100 ng of vector and ligated overnight a t 4 "C with T 4 DNA ligase.

RESULTS

Identification of Additional H u m a n FcyRI Genes A strategy for identifying additional genes was suggested

by the sequence comparison of the FcyRIA gene with the cDNA p135. A total of three nucleotide differences were noted (Fig. 5), one each in the first signal (Sl), first extracellular (ECl), and transmembrane/cytoplasmic (TM/C) exons. Thus, to rapidly identify sequence differences between FcyRIA and the remaining six phage clones, portions of the cDNA p135 that were identical with gene A were subcloned for the synthesis of riboprobes and utilized in RNase protec- tion analysis.

We subcloned a portion of the cDNA p135 (PEA, 367 bp from the EcoRI site in EC2 to the AflII site in EC3, Fig. L4) that was identical in sequence with gene A downstream of the phage T7 promotor. RNase protection analysis was performed by hybridizing an RNA probe made from PEA to DNA isolated from phages 1-7. Due to the presence of intron D in the genomic DNA contained in the phage clones, two fragments would be expected to be protected by the riboprobe, a 113-bp

A

Exons S1SZ EC1 EC2 EC3 TMiC

N Pv E Ns A

An PI35

P 121 327 483 624 844 1121 1321bp

Probes:

.121. PEA 367bp L 113 254 +x?

B

E X D N S1 S2 ECl ECZ EC3 TM/C Gene

n E N :8 : N 8 0 N E E BNEBHE N N L B H I I h I I II I I I II Ih I I I I , , I A

I I

I t = % 5 4 u, :I: 7 4 "b A.C

s I + 7 3 kb

:I: 735 kb "J B

FIG. 1. A, structure of the human FcyRI cDNA p135. The exon organization derived from the gene map is drawn to scale (1321 bp), 5' to 3', left to right. Exon-intron boundaries are indicated by vertical solid lines. The signal sequences ( S ) , extracellular domains ( E C ) , transmembrane domain (TM, black box), and cytoplasmic (C) regions are shown. The restriction endonuclease sites and nucleotide map units are shown for AflII (A), EcoRI ( E ) , NcoI ( N ) , NsiI (Ns), PstI (P), and PuuII (Pu). Only sites relevant to discussion are indicated. The fragments of p135 utilized as hybridization probes are shown (121 = XhoI-NcoI, 483 = XhoI-EcoRI, 200 = PstI-Xhol). The 367-bp EC2-EC3 fragment of p135 (PEA) used for RNase protection analyses (this figure and Fig. 6, "Experimental Procedures") is shown. B, structural organization of three genes for human FcyRI. The exon- intron organization is drawn to scale as a linear map, 5' to 3', left to right. Exon locations (5' S1, S2, EC1, EC2, EC3, TM/C 3') are indicated by black boxes. Restriction enzyme sites for BglII ( B ) , EcoRI ( E ) , HindIII ( H ) , and NcoI ( N ) are indicated by uertical lines. The HindIII and NcoI sites which vary among the three genes are marked by arrowheads. Below the maps, three subcloned HindIII fragments for FcrRI genes A and C and two fragments (HindIII-Hind111 and HindIII-Sal1 (S)) for gene B are shown.

15694 Human High Affinity Fc-y Receptor Genes and Transcripts

fragment from EC2 and a 254-bp fragment from EC3. In fact, three patterns of protected fragments were observed (Fig. 2). Two phages (1 and 2) protected fragments with sizes predicted by sequence identity to PEA (113 and 254 bp). Three phages (3, 5, and 7) protected a smaller (-100 bp) EC2 and a “full- length” 254-bp EC3 fragment. Additionally, we noted a third pattern (phages 4 and 6) showing a smaller EC3 fragment size (-200 bp) as well as a smaller (-100 bp) EC2 fragment.

DNA from these phages was next analyzed by digestion with HindIII to determine if any phages contained the HindIII difference revealed by the genomic Southern blot analysis (5). DNA digests from all phages were hybridized with the most 5’ 121-bp NcoI (Fig. lA), and the most 3‘ 200-bp PstI (Fig. 1A) fragments of FcyRI cDNA p135 to determine which of them were full-length (not shown). Phages 3,6, and 7 did not hybridize with the 5‘ NcoI probe and therefore do not contain the 5’ end of the gene including the area surrounding the 5’ HindIII site. A 1.9-kb HindIII fragment from phages 1,2, and 4 hybridized with this 5’ NcoI probe as seen in gene A; however, in phage 5 we observed a larger (-7.3 kb) hybridizing fragment.

All seven phages were found to hybridize to the 3‘ 200-bp PstI probe. Phage 5, however, required a double digest with HindIII and SalI (SalI is in the polylinker of the cloning vector) to release the 3‘ end of the genomic DNA from the phage arm. Upon hybridizing double-digested phage 5 DNA with the whole cDNA p135 probe, we noted two fragments of very similar size (-7.3-7.35 kb). Most likely these two simi-

I 5 2 3 4 6 7 M bp

.I, -396 -344

a

- 298 - 254

- 221 - 200

220

“154

-113

- 100 -75

FIG. 2. Ribonuclease protection analysis of DNA from hu- man FcyRI genomic clones. 40 ng of DNA from each of seven FcyRI genomic clones (designated I to 7) were hybridized to a riboprobe made from the EC2-EC3 portion of the cDNA p135 (PEA, Fig. lA , “Experimental Procedures”). Arrows indicate major protected bands. The 100-bp fragment of phage 4 appears obvious on the original autoradiogram. Sizes of protected fragments were determined by comparison with pBR322 digested with HinfI ( M ) .

larly sized fragments were due to the loss of the 5’ HindIII site predicted from genomic Southern data to be characteristic of a second gene, FcyRIB (5). The 5’ exons (Sl, S2, and EC1) of a putative gene B would be contained within a 7.3-kb HindIII fragment rather than within two 5’ exon-containing fragments with sizes of 1.9 and 5.4 kb as seen in gene A. The HindIII and HindIII/SalI fragments of phage 5 were sub- cloned into pBluescript KS and further analyzed.

Remarkably, phages 4 and 6 were found to exhibit a third pattern of hybridization with the PEA riboprobe. The unique protected EC3 band size of these phages in the RNase protec- tion assay (Fig. 2) suggested further genetic diversity. Phage 4 hybridized with all of the tested cDNA probes and resulted in three hybridizing HindIII fragments of 1.9, 5.4, and 7.4 kb as seen previously for gene A; phage 6 was not full-length for the 5’ exons. Therefore, we subcloned the phage 4 fragments to analyze them in greater detail. This phage was tentatively considered to contain a third gene and was designated FcyRIC.

Mapping and Organization of Three Human FcyRI Genes A restriction map of recombinant DNA from phages 5 (gene

B) and 4 (gene C) was constructed by digestion with the restriction endonucleases BglII, EcoRI, HindIII, and NcoI (Fig. 1B). In addition to the lost HindIII site in gene B, we discovered an NcoI site downstream of the exon S1 in gene A that was lost in both phages 5 and 4. All other enzyme sites tested were the same as those found in gene A. The gene organization of exons and introns was determined to be the same as in gene A, with localization of exons to the same restriction fragments, and with similar intron distances.

Evidence from Southern Blot Analysis for Three Human FcyRI Genes

DNA samples from 13 individuals digested with HindIII were previously shown to exhibit an identical pattern of hybridization with a 5’ 121-bp NcoI p135 probe (5). Two hybridizing bands of 1.9 and 7.3 kb were present in all tested individuals (3 shown in Fig. 3, lanes H) suggesting that a second gene, distinct from the FcyRIA gene, was present in all tested donors. Comparison of the restriction enyme maps of the three phages revealed three different patterns of HindIII and NcoI sites (Fig. 1B). To assess whether the three patterns were due to the presence of three distinct genes or to two genes with one restriction fragment length polymor- phism, we digested genomic DNA from 10 individuals with these two enzymes and analyzed the digests on a Southern blot. Upon digestion of genomic DNA with NcoI and hybrid- ization with the 5’-end probe, DNA from 10 individuals yielded two bands of the sizes of 0.6 and 1.9 kb (Fig. 3, lanes N ) . Next we digested genomic DNA from 10 individuals with both HindIII and NcoI and hybridized with the 5’ 121-bp NcoI probe (Fig. 3, lanes H/N). Three bands of 0.6 (gene A), 1.1 (gene C), and 1.9 kb (gene B) were noted in all 10 individuals. From the restriction enzyme mapping data (Fig. 1B), three distinctly sized bands (originating from the 5’ end of each gene) would be expected from a double digest of genomic DNA with these two enzymes. The presence of the three band sizes in all randomly selected donors argues against the possibility of an allelic form of one FcyRI gene. Addi- tionally, the hybridization signal of all three bands shows approximately equal intensity which may indicate that the three identified genes are the total number of genes in the human genome.

Human High Affinity Fey Receptor Genes and Transcripts 15695

I 2 3 Kb M H N H/N H N H/N H N H/N Kb

23. I-

9.4 - 6.6 -

4.4 -

2.3- 2.0-

-1.9

- 1 . 1

0.5- - 0.6

FIG. 3. Southern blot of human genomic DNA digested with enzymes that identify differences among the three genes for FcyRI. DNA from three individuals (designated I to 3 ) was digested with HindIII ( H ) , NcoI (N), or with both enzymes (H/N). The digested DNA was electrophoresed in an agarose gel, transferred to Hybond-N, and hybridized with the 5’ 121-bp NcoI fragment of cDNA p135 (Fig. 1A). X-Phage DNA digested with HindIII was used as a marker ( M ) .

FIG. 4. Southern analysis of hamster/human hybrid cell lines localizes all three human FcyRI genes to chromosome 1. Genomic DNA from human ( H U ) , hybrid cell lines 1099, 937, 867 (chromosome 1 positive), 860 (chromosome 1 negative), and hamster (CHO) was digested with HindIII and NcoI. Digested DNA was electrophoresed, transferred to a nylon membrane, and hybridized with the 5’ 121-bp NcoI fragment of cDNA p135. Hybridizing frag- ments from the three genes are indicated by A, B, and C. X-Phage DNA digested with HindIII was used as a marker ( M ) .

Localization of Human FcyRI Genes A, B, and C to Chromosome 1

We next tested whether the three genes for FcyRI were all localized to the same chromosome. Prior reports had localized FcyRII and FcyRIII genes to chromosome 1 (14-16). DNA was obtained from a panel of hamster/human hybrid cell lines that contained all human chromosomes; three of these cell lines contained human chromosome 1. The DNA was digested with both HindIII and NcoI and was analyzed in a genomic Southern blot hybridized with the 5’ 121-bp NcoI cDNA probe. As seen in Fig. 4, DNA from chromosome 1 containing cell lines 1099 and 937, and human genomic DNA (HU), all contain 0.6- (gene A), 1.1- (gene C), and 1.9-kb (gene B) hybridizing bands. One additional chromosome 1-containing

cell line, 867, was positive only for the 0.6- and 1.9-kb bands. All three chromosome 1-containing cell lines contained chro- mosome 5 in common and cell lines 937 and 1099 shared chromosome 21. Control cell line 860 (Fig. 4) contained both chromosomes 5 and 21, but was negative for hybridization with the FcyRI probe. DNA from seven additional hybrid cell lines collectively containing all human chromosomes except chromosome 1 did not hybridize with the FcyRI probe (not shown). We conclude that the FcyRIA, -B, and -C genes all localize to chromosome 1, and we speculate that a re- arrangement or deletion of DNA in cell line 867 accounts for the inability to detect the 1.1-kb gene C fragment.

Sequence Comparison of FcyRI A, B, and C Genes The nucleotide sequences of human genomic DNA from

phages 5 (gene B) and 4 (gene C) were compared to the previously described FcyRI gene A sequence (Fig. 5). Numer- ous nucleotide changes, detailed below, were observed scat- tered throughout the exons and introns of genes B and C, as compared to gene A, despite remarkable similarity in the overall gene structure.

Gene B-The gene B sequence showed a total of 15 distinct changes from FcyRIA (Fig. 5). These consist of 2 deletions (5 and 4 bp), 2 substitutions (2 and 6 bp), and 11 single nucleo- tide substitutions. Nine of the changes were found in exons. In EC2, an ACG (Thr) was changed to ATG (Met) in gene B (nucleotide 58), and 3 bases (TGT) in gene A were replaced with 6 bases (ACAATA) in gene B (nucleotides 260-265 EC2), resulting in a valine being replaced by glutamine and tyrosine. The most significant difference was in exon EC3, the unique external domain for FcyRI (6), where a CAG (Gln) codon was replaced by a TAG (stop, nucleotide 123 EC3). This premature termination codon would predict the translation of a two- domain FcyRI lacking a membrane-spanning portion and a cytoplasmic tail. Three additional single base substitutions in exons EC3 and TM/C appear downstream of the EC3 termi- nation codon at nucleotides 268 in EC3 and 156 and 324 in TM/C.

Of the several changes seen in the 5’ and 3’ untranslated (UT) regions and within the sequenced portions of the introns of gene B, only a few appear noteworthy. The splice donor sequence of intron E in gene A contains a 4-bp repeat se- quence. In gene B, we observed the deletion of one 4-bp unit in this splice donor sequence (nucleotides 298-301 EC3, Fig. 5, gene B). Additionally, within intron A, a 2-base substitution (nucleotides 587-588 S l ) alters the recognition sequence for an NcoI restriction enzyme site, and, in intron B, a single base pair substitution (nucleotide 245 S2) results in modifi- cation of the HindIII recognition sequence. These are the two restriction enzyme sites predicted by the mapping data to have been lost in gene B.

Gene C-The gene C sequence shows 15 changes from the sequence of gene A; 4 of these are shared with gene B (Fig. 5). One deletion, one substitution of 6 bp, and 13 single nucleotide substitutions were noted; 11 changes occur in ex- ons. In EC2, a CTA (Leu) is changed to CCA (Pro, nucleotide 28), an ATG (Met) is changed to AAG (Lys, nucleotide 226), and a CGC (Arg) is changed to CAC (His, nucleotide 238). Additionally, as found in gene B, 3 nucleotides (TGT, Val in gene A) are substituted with 6 bases (ACAATA, Gln-Tyr, nucleotides 260-265 EC2) in gene C.

As with gene B, the most potentially significant change occurs in exon EC3 of gene C. Here a single base deletion of an adenosine at nucleotide position 64 in EC3 shifts the protein reading frame. Six codons downstream is a TGA termination codon. Therefore, a protein translated from this

15696 Human High Affinity Fcr Receptor Genes and Transcripts

A B C

A/B C

A B C

A/C B

A B C

A B/C

A/C B

A/C B

A B/C

A B/C

A/B C

A/C B

A B C

A B/C

A B C

A B C

catggcctcatagaggctgatatagaaacttctggattcaaatgattgtttggaggcattagccaggcattgaaccaattataaagagtgaggttttggccatattctaaccgtaagaaa 120 ........................................................ C-"""

CCAGCAGMCCTCTTCMTATCTTGCATGT~ACAGATTTCACTGCTCCCACCAGCTTGGAGACMCATGTGGTTCTTGACMCTCTGCTCCTTTGGGgtaagttggactcagaggggaca 480 MetTrpPheLeuThrThrLeuLeuLeuTrpV

gttagaagggtacaggctgtggctgttgtgagtcaagagttttgtcttcctgtggtaactctgggtagaactcatgagtatgaagcaacttgtatctgtgctt~tttattagagc 600 . NcoI .

~ """""""""""""""""""""""""""""""""""""""""""""""""""""Ct"""""" """""""""""""""""""""""""""""""""""""""""""""""""""""c""""""-

- I n t r o n A (0.4 kb)--attattttccttggaccaactgatatctttattctctgatctcttgcagTTCCAGTTGATGGGCMGTGGgtgagtgatctctaactcagcttctccttc 100 alProValAspGlyGLnValA

............................................................ - sz tatgccactttcctacttccaaaggatgggtcctattaacctgcagaagagcatatagggaaagcagagaaagaagaaagatttataaattatgtaaaatctcccatattcagagcatga 220 """""""""""""""""""""""""""""a""""""""""""""""""""""""""""""~

Hind1 I I

9"" ttttcataaaaactatgatttgtaagctt-------Intron B (0 .9 kb)- - - - - - -cctt tactccacttgatctt t t tct t t t tct tct tgtaatctccaagtagACACCACMA 60

EC1

spThrThrLy

"""""""""""" .............................. - sALaValIle~LeuGlnProProTrpValSerValPheGlnGluGluThrValThrLeuHisCysGluValLeuHisLeuProGlySerSerSerThrGlnTrpPheLeuAsnGlyTh GGCAGTGATC~TTGCAGCCTCCATGGGTCAGCGTGTTCCAAGAGGAAACCGTMCCTTGCACTGTGAGGTGCTCCATCTGCCTGGGAGCAGCTCTACACAGTGGTTTCTCMTGGCAC 180

rAlaThrGlnThrSerThrProSerTyrArgIleThrSerAlaSerValAs~spSerGlyGluTyrArgCysGlnArgGlyLeuSerGlyArgSerAspProIleGlnLeuGluIleHi

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - C - - - - - - - - - - - - - - - - - - - - - - - EC1 -

AGCCACTCAGACCTCGACCCCCAGCTACAGAATCACCTCTGCCAGTGTCAATGACAGTGGTGAATACAGGTGCCAGAGAGGTCTCTCAGGGCGAAGTGACCCCATACAGCTGGAAATCCA 300 - EC1 ............................................................

sArgG CAGAGgtaattatgacttggaccaggaggg----------------------Intron C (4.4 kb)-----------ttttgggttcatatttttcagGCTGGCTACTACTGCAGGT 40 """"""""""""""" - - - - - - - - - - - - - - - - - - - - - - - - - - - C - - - - - - - - - - - - EC2

LSerSerArgValPheThrGluGlyGluProLeuALaLeuArgCysHisAlaTrpLysAspLysLeuValTyrAsnValLeuTyrTyrArgAsnGlyLysAlaPheLysPhePheHisTr

Pro. LyTrpLeuLeuLeuGlnVa

Met. -

CTCCAGCAGAGTCTTCACGGAAGGAGAACCTCTGGCCTTGAGGTGTCATGCGTGGAAGGATMGCTGGTGTACAATGTGCTTTACTATCGAAATGGCAAAGCCTTTAAGTTTTTCCACTG 160

EcoRI . pAsnSerAsnLeuThrIleLeuLysThrAsnIleSerHisAsnGlyThrTyrHisCysSerGl~etGLyLysHisArgTyrThrSerAlaGlyIleSer***Va~ThrValLysG ~TAACCTCACCATTCTGAAAACCAACATAAGTCACAATGGCACCTACCATTGCTCAGGCATGGGAAAGCATCGCTACACATCAGCAGGAATATCT** *GTCACTGTGAAAGgta t 277

""""""""-T""""""""""""""""""""""""""""""""""""""""""""""""""" EC2 . Lys . His. .GlnTyr .

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - A C A A T A - - - - - - - - - - - - - - - 280 - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - A - - - - - - - - - - - A - - - - - - - - - - - - - - - - - - - - - A C M T A - - - - - - - - - - - - - - - ECZ -

tgtattggaatagtcatagaactgatagtccctccccctgaggaccatcataa----Intron 0 (1.5 kb)------ctttctccttagAGCTATTTCCAGCTCCAGTGCTGAATGC 40 EC3

LuLeuPheProAlaProValLeuAsnAl

""""""""""""""""""""""""""- ....................

. G*lyGlyI leTrpSerProTer . - aSerValThrSerProLeuLeuGluGlyAsnLeuValThrLeuSerCysGluThrLysLeuLeuLeuGlnArgProGlyLeuGlnLeuTyrPheSerPheTyrMetGlySerLysThrLe ATCTGTGACATCCCCACTCCTGGAGGGGMTCTGGTCACCCTGAGCTGTGAAACAAAGTTGCTCTTGCAGAGGCCTGGTTTGCAGCTTTACTTCTCCTTCTACATGGGCAGCAAGACCCT 160

. Ter . - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - T - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - EC3 """"""""."""*"""""""""""""""""""""""""""""""""""""""""""""""" -

uArgGLyArgAsnThrSerSerGluTyrGlnIleLeuThrAlaArgArgGluAspSerGlyLeuTyrTrpCysGluAlaAlaThrGluAspGlyAsnValLeuLysArgSerProG~uLe GCGAGGCAGGAACACATCCTCTGAATACCAAATACTAACTGCTAGAAGAGAAGACTCTGGGTTATACTGGTGCGAGGCTGCCACAGAGGATGGAAATGTC~CGCAGCCCTGAGTT 280

.AflII . - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - A - - - - - - - - - - - - EC3 - """"""""""""""T""""""""""""""""""""""""""""""""""""""""""""""

A GAACAGCTGCAGGAAGGGGTGCACCGGAAGGAGCCCCAGGGGGCCACGTAGCAGCGGCTCAGTGGGTGGCCATCGATCTGGACCGTCCCCTGCCCACTTGCTCCCCGTGAGCACTGCGTA 380 GluGlnLeuGlnGluGLyValHisArgLysGluProGLnGlyAlaThrTer

Human High Affinity Fey Receptor Genes and Transcripts 15697

gene might not contain a membrane-spanning region due to this premature stop codon in EC3. Four additional single nucleotide substitutions appear downstream from this stop codon.

Additionally, several nucleotide changes are noted in the 5’ and 3’ UT regions and in the sequenced portions of the introns for gene C. As predicted from the mapping data, the Hind111 site (nucleotides 244-249 S2) was present whereas the NcoI site was lost (nucleotide 587 Sl). The 4-bp deletion in the splice donor sequence of intron E of gene B is not found in gene C.

Detection of Transcripts for FcyRIBIC Genes

To determine if genes B and C are transcribed, we assessed the presence of FcyRI transcripts in the human monocyte cell line, U937, by RNase protection assay. As riboprobe sequence we chose the longest stretch of nucleotide differences among the three genes which occurs in EC2 where 3 bases in gene A (TGT) are substituted by 6 bases in both genes B and C (ACAATA, nucleotides 260-265 EC2). This stretch is con- tained in the PEA construct (367 bp of p135 from the EcoRI site in EC2 to the AflII site in EC3, Fig. lA) that we had earlier used to analyze the DNA in the phage isolates for FcyRI (Fig. 2). This portion of p135 cDNA is identical with gene A sequence. For genes B and C, the 6-bp substitution found in EC2 is 99 bp from the EcoRI site in this exon. Gene B has one additional nucleotide difference, and gene C has four single nucleotide differences from the sequence contained in PEA (Fig. 5, EcoRI in EC2 to AflII in EC3). It would, therefore, be expected that an RNA probe synthesized from PEA would fully protect a gene A transcript (367 bp) from RNase digestion, whereas both gene B and gene C transcripts would be digested at the position of the 6-base substitution into two protected fragments of 99 bp and 265 bp. Theoreti- cally, smaller fragments might also be found if the RNase efficiently recognizes the single base pair differences between PEA and gene B and C transcripts.

RNase protection analysis was performed by hybridizing an RNA probe synthesized from the PEA construct to RNA from FcyRI negative (K562) and positive (U937) cell lines. Three protected bands of -100,260, and 370 bp were observed in U937 cell RNA (Fig. 6, lane U-). The intensity of all three bands was increased by culturing U937 cells with yIFN prior to RNA isolation (Fig. 6, lane U+). In this sample there are additional bands that may be the result of RNase digestion of the single nucleotide differences in genes B and C and the riboprobe. No protected bands were observed in yeast tRNA and in RNA from K562 (Fig. 6, lanes t and K ) . U937 cells, therefore, express transcripts from gene A and gene(s) B and/ or C, which are up-regulated by culture of cells with yIFN. The prevalence of B/C-type RNA observed in U937 cells indicates active transcription of these gene(s) and suggests they are likely to be functional. This particular approach, however, was unable to distinguish between gene B and C transcripts, so it seemed formally possible that only one of these genes was being transcribed.

Detection of Transcripts for FcyRIB and FcyRIC Genes Attempting to assess the transcriptional products of genes

B and C, we reverse-transcribed (RT) mRNA from FcyRI expressing cells and amplified FcyRI sequences by the polym- erase chain reaction (PCR) method for subsequent hybridi- zation with gene-specific probes. The amplification was per- formed with oligonucleotide primers from the EC1 (primer 9) and the TM/C (primer 10) exons which would be expected to amplify a product of 880 bp. Surprisingly, two products of -880 and 600 bp resulted; both were amplified in RNA from peripheral blood mononuclear cells (PBMC), PMN, and U937 cells cultured with or without yIFN while neither product was seen in K562 RNA.

To determine if the smaller sized product was related to FcyRI, we performed restriction endonuclease digest analysis (not shown) using enzymes with known sites in EC1 (PuuII), EC2 (EcoRI), and EC3 (NsiI, AflII) (Fig. lA). Upon digestion with PuuII and EcoRI, both the 880- and 600-bp fragments were digested and resulted in band sizes predicted from the cDNA p135 restriction enzyme sites. However, upon digestion with either NsiI or AflII, only the 880-bp fragment was di- gested while the 600-bp fragment remained unchanged. Therefore, it appeared that the smaller transcript did not contain part or all of the EC3 domain which would account for its reduction in size. When the PCR products were hy- bridized with the cDNA p135, both the 880- and 600-bp fragments bound this probe.

To ascertain whether genes A, B, and C produce transcripts of both sizes, we end-labeled gene-specific oligonucleotides from the EC2 exon (Fig. 8 and “Experimental Procedures”) for hybridization to the PCR amplified products. Oligonucle- otide 37A, which consists of gene A sequence, hybridized only to the full-length 880-bp amplification product (Fig. 7A). In contrast, the oligonucleotide 39B/C, which would recognize the RT/PCR products of either FcyRIB or -C, hybridized to both the 880- and 600-bp fragments (Fig. 7B) and did not cross-hybridize to the control gene A-like cDNA p135. Inter- estingly, the relative intensity of hybridization of 39B/C varied considerably between the two fragment sizes in the various cell lines that were tested, suggesting that expression of the transcripts among FcyRI expressing cell lines may be cell-specific. It also appeared that yIFN treatment of U937 cells (Fig.7, A and B, U937+) increased the expression of all transcripts recognized by the probes 37A and 39B/C when compared to transcripts from untreated U937 cells (Fig. 7, A and B, U937-).

The two sizes of RT/PCR products appeared to consist of three distinct types of transcripts; i.e. the 880-bp fragment hybridized with both the 37A and 39B/C probes while the 600-bp fragment hybridized only with the 39B/C probe. In order to analyze individual transcripts, the two sized RT/ PCR products from yIFN-cultured U937 and from PBMC were cloned into pBluescript, and individual clones were hybridized with the 37A or 39B/C probes. All tested 880-bp inserts (57 clones) from U937 cells hybridized the 37A probe, while all tested 600-bp inserts (29 clones) from U937 cells were positive with the 39B/C probe. However, with 21 clones containing 880-bp inserts from PBMC, 16 clones hybridized

lowercase letters, unsequenced introns are shown as dotted lines with their total lengths indicated in parentheses. When nucleotide sequences for genes B and C differ from gene A, they are shown below those of FcrRIA. Dashed lines indicate nucleotide identity to gene A. Base pair substitutions are shown by the nucleotide change; nucleotide deletions are indicated by asterisks. Nucleotide changes resulting in amino acid differences are indicated by listing the new amino acid code above the code for gene A. The 5’ enhancer consensus and 3’ polyadenylation signal sequences are ouerlined. Restriction endonuclease recognition sequences described in the text are underlined and named. The three nucleotides (391, S1; 71, EC1; 199, TM/C) which are different from the cDNA p135 and their amino acid changes are double underlined. Nucleotide numbers for the most 3’ in each row are indicated in the right margin; all exon-containing sequences are numbered individually.

15698 Human High Affinity Fcr Receptor Genes and Transcripts

298-

260-

221- 220

154- 1

100-

75 -

FIG. 6. Ribonuclease protection assay of RNA from FcyRI expressing U937 cells. 30 pg of total RNA from negative controls tRNA (lane t ) and K562 cells (lane K ) and from U93T cells cultured in the absence (lane U-) or presence (lane U+) of yIFN were hybridized to a riboprobe synthesized from an EC2-EC3 sequence, pEA (Fig. lA, “Experimental Procedures”). Arrows indicate major protected bands. Sizes (bp) of protected fragments were determined by comparison with pBR322 digested with HinfI ( M ) .

A B

180-

‘00-

FIG. 7. Southern blot of FcyRI RT/PCR amplification prod- ucts using gene-specific oligonucleotide probes. RNA from FcyRI expressing cells U937 (U937-, no yIFN; U937+, cultured with yIFN before RNA isolation), PMN, PBMC, and nonexpressing con- t.rol cell K562, was reverse-transcribed and PCR-amplified using FcyRI-specific primers 9 (EC1) and 10 (TM/C). The cDNA p135 was used as a PCR and hybridization control. The samples were electro- phoresed in an agarose gel, transferred to Hybond-N, and hybridized with end-labeled oligonucleotide 37A (panel A ) or 39B/C (panel B ) . The four oligonucleotides used in this experiment are defined in Fig. 8 and under “Experimental Procedures.” Hybridizing fragments are shown with sizes (bp).

with the 37A probe, but 5 clones hybridized with the 39B/C probe. All tested 600-bp inserts (21 clones) from PBMC cells were positive with the 39B/C probe.

Representatives of the three types of clones were subjected to sequence analysis (Fig. 8). Two 880-bp 37A hybridizing clones gave sequence identical with a transcription product from gene A (Fig. 8, a ) that predicts a three-Ig-like domain, membrane-spanning receptor. Five 880-bp 39B/C hybridizing clones were sequenced. Two of these clones had sequence

changes that were detected in gene B (Fig. 8, b l ) ; these transcripts predict a two-Ig-like domain structure with a termination codon in EC3. The other three 880-bp 39B/C hybridizing clones had sequence changes that were detected in gene C (Fig. 8, c) including a single nucleotide deletion in EC3 that results in a translation termination codon.

Four 600-bp 39B/C hybridizing clones were sequenced and found to have nucleotide changes characteristic of gene B transcripts (Fig. 8, b2). However, in these clones, EC3 is not present; the EC2 exon is spliced directly to the TM/C exon. Thus, the FcyRI gene B transcripts undergo alternative split- ing. In the gene B 880-bp transcript, the EC2 exon is spliced to EC3, but a premature stop codon in EC3 predicts the translation of a non-membrane-spanning receptor. In con- trast, the second gene B (600 bp) transcript splices from EC2 to the TM/C exon predicting a two-Ig-like domain, mem- brane-spanning receptor. This receptor structure is similar to the FcyR low affinity receptors. The three transcripts de- scribed for genes B and C have not been described previously and will need to be analyzed extensively to determine their biological significance.

DISCUSSION

Receptors for the Fc region of IgG provide an important link between effector cells and the humoral compartment of the immune system. Three distinct classes of receptors have been identified. One high affinity class, FcyRI, and two low affinity classes, FcyRII and -111, are all members of the Ig gene superfamily. In this study, we identify and characterize three genes coding for human FcyRI. The extraordinary sim- ilarity among these three genes (>98% identity at the nucleo- tide level) suggests that they have arisen by gene duplication. In this respect, this trio of genes is similar to the group of human low affinity FcyR genes which is comprised of five genes, three duplicated genes for FcyRII and two for Fc-yRIII (17, 18).

With our description of these three FcyRI genes, we are now in a position to affirm several common structural features among the members of the human FcyR gene family. The leader peptide of all genes is contained in two exons (S1 and S2), and each Ig-like domain (EC1, EC2, and EC3) is encoded on a separate exon. The EC3 domain is similar in structure to the other extracellular exons but is unique to FcyRI (6). The splice junctions of the exons for all FcyR genes occur between the first and second nucleotide of the amino acid codons (17). The TM/C domains of the FcyRI and FcyRIII genes are encoded on a single exon. In contrast, the FcyRII genes encode the transmembrane and cytoplasmic domains on multiple exons. The greatest sequence divergence among the genes for FcyRII and FcyRIII has been found in the cytoplasmic and transmembrane domains (18), whereas we have found the greatest sequence diversity among the FcyRI genes to reside in the external domain EC2 and EC3 exons.

We have localized the three human FcyRI genes to chro- mosome 1 by analyzing DNA from hamster/human hybrid cell lines. Other laboratories, using chromosome in situ hy- bridization and mouse/human hybrids, have localized as well the genes for human FcyRII, FcyRIII, and FctRIa to chro- mosome 1, specifically to the long arm, bands q23-24 (15,16, 19). This region of human chromosome 1 contains other genes with immune functions. These include the gene for the y subunit that associates with FccRI and FcyRIIIA (lq23) (20) and the gene for the CD3 { subunit (21). The genes for the y and { subunits are highly similar and appear to have been generated by duplication. Two other members of the Ig gene superfamily, Blast-1 (1q21-23) (22), and five CD1 genes

H u m a n High Affinity Fer Receptor Genes and Transcripts 15699

- 88 1 884 599 - TMC

FIG. 8. Nucleotide sequence comparison of four transcripts derived from three human FcrRI genes. RT/PCR products resulting from amplification with FcyRI-specific oligonucleotide primers 9 (ECI, underlined nucleotides 1-18) and 10 (TMC, reverse complement of underlined nucleotides 864-881, a ) were cloned into pBluescript KS. The cloned inserts were either -880 or 600 bp in size and were screened for differential hybridization to end-labeled oligonucleotides 37A (EC2, underlined nucleotides 487-504, a ) and 39B/C (EC2, underlined nucleotides 487-504, b l ) . Representative clones were sequenced and found to consist of four types of transcripts originating from the three genes; the transcript names are listed in the left margin (lowercase letters are used in accordance with accepted nomenclature rules (18)). Nucleotide sequences for transcripts bl , b2, and c are shown below those of a; identical b l and b2 sequences are indicated by b. Dashed lines indicate nucleotide identity with the FcyRIa transcript sequence. Base pair substitutions are shown by the nucleotide change; nucleotide deletions are indicated by asterisk. Nucleotide numbering and exon names are shown in the right margin. The amino acid sequence is indicated by three-letter code; nucleotide changes resulting in amino acid differences are indicated by listing the new code above the code for the FcyRIa transcript. Exon-intron boundaries are indicated by a black box above the first nucleotide of the exon.

(1q22-23) (23), as well as three selectin genes (1q21-24) which comprise an adhesion protein family on granulocytes, lym- phocytes, and endothelial cells (24), are also localized to this region of chromosome 1. Work is in progress to ascertain whether FcyRI localizes in proximity to the FcyRII and FcyRIII genes.

All three of the FcyRI genes are transcribed as judged by RNase protection experiments and by RT/PCR amplification; four distinctly different transcripts were identified. The gene A transcript appears to be that of the bona fide FcyRI in that it resembles the three cDNAs (p135, p90, and p98/x2) de- scribed by Allen and Seed (6, 25) to consist of three-Ig-like external domain transmembrane receptors that yield Ig-bind- ing surface membrane proteins upon transfection. However, several amino acids predicted by the cDNAs p135 and p90 differ from those defined by gene A. In EC1, a threonine codon in gene A is a serine in p135 (Fig. 5, nucleotides 71-73) and a leucine codon in gene A is a valine in p90 (Fig. 5, nucleotides 170-172). In the cytoplasmic domain, a threonine encoded by p135 and p90 at position 198-200 (Fig. 5) is an isoleucine specified by gene A. The absence of the threonine as a potential phosphorylation site in a protein encoded by gene A could result in functional capabilities different from the proteins encoded by the cDNAs p135 and p90. The gene

A transcripts derived by RT/PCR cloning from U937 cells showed a sequence identical with the gene A sequence. It will be informative to obtain cDNA clones corresponding to FcyRIA to assess whether alterations in function can be attributed to these amino acid changes.

One gene B transcript encodes a transmembrane receptor with two extracellular domains in which the EC2 exon pre- cisely splices to the TM/C exon; the EC3 exon is not utilized. A possible mechanism for the alternative usage of EC3 is suggested by a splice donor mutation found in gene B. In contrast to genes A and C, gene B has a 4-bp deletion of repeat elements in the splice donor sequence of intron E. The loss of one repeat unit does not change the B gene splice donor sequence from a recognizable consensus donor se- quence; however, the presence of deletions in such a critical splicing element might be expected to influence the usage of the associated exons (26, 27).

The protein predicted to be the product of this gene B transcript would consist of two extracellular Ig-like domains with the exact transmembrane and cytoplasmic domains of the three-domain form. One would anticipate that such a foreshortened receptor would bind ligand but with lower af- finity than the three-domain FcyRI, since others have sug- gested that an intact three-domain structure is requisite to

15700 Human High Affinity Fey Receptor Genes and Transcripts

high affinity ligand binding (6, 28). Likewise, one would predict that such a protein would appear smaller on sizing gels than the “classical” FcyRI 72-kDa glycoprotein and may not be recognized by the anti-FcyRI monoclonal antibodies which have been shown to immunoadsorb only a 72-kDa molecule (29).

We also describe two transcripts that have stop codons in the EC3 domain; one, the product of gene B, results from a single nucleotide substitution, and the second, the product of gene C, results from a single nucleotide deletion. We speculate that the protein products of these transcripts would be soluble and secreted by the cell. An example for this mechanism of generating a secreted receptor has been described for an alternatively spliced isoform of a neural cell adhesion mole- cule (N-CAM) transcript (30). This isoform utilizes a unique extracellular exon that introduces an in-frame stop codon which prematurely terminates the coding sequence, generat- ing a truncated N-CAM protein. Transfectants expressing this isoform were found to secrete N-CAM into the culture supernatant.

The notion of secreted FcyR has been the focus of much investigation. Ig-binding factors (IBF) have been found in the supernatants of antigen-activated FcyR-positive lymphocytes and have been postulated to have immunoregulatory proper- ties (for review, see Ref. 31). One study using the monocyte cell line U937 showed the release in cell supernatants of an IBF capable of suppressing mitogen-driven IgG synthesis (32); the suppressor material generated two peaks of inhibitory activity with sizes of 30-40 kDa and 60-73 kDa. Others have generated recombinant soluble FcyR by engineering a pre- mature stop codon in the extracellular domain of an FcyRII cDNA (33, 34). Transfection of the altered cDNA yielded a soluble FcyRII, recovered in the culture medium, that was found to have immunoreactivity and biological activity similar to those of suppressive IBF. These recombinant soluble FcyR may have naturally occurring counterparts, e.g. a receptor encoded by an FcyRII cDNA clone containing a 123-bp dele- tion that spans the transmembrane domain (35), and those described herein for FcyRI.

The four distinct transcripts of the three FcyRI genes appear to be up-regulated with yIFN. Two copies of an 8-base sequence proposed as a yIFN response element for a class I1 major histocompatibility complex DQB gene (36) are noted, at nucleotides 32-39 and 178-185 of the 5‘ region (Fig. 5 ) . A glucocorticoid response element consensus sequence (37) was found at nucleotides 144-152 of the 5’ region (Fig. 5 ) . These 5’ regulatory elements, which are present in all three genes, may be relevant to the regulation of these receptors because both yIFN and glucocorticoids dramatically affect the expres- sion of FcyRI. yIFN up-regulates FcyRI expression, while glucocorticoids have been found either to enhance (mono- cytes) or to decrease (U937, PMN) the up-regulation of FcyRI by yIFN in a cell-type-specific manner (4).

From this study we have found that FcyRI is encoded by a minimum of three genes whose transcripts manifest a unique diversity. While the FcyRIA gene has retained the function of encoding a receptor with high affinity for ligand, the other two genes have altered their usage of the EC3 exon to produce variant receptors. FcyRIB encodes transcripts which likely yield both low affinity and soluble receptors; FcyRIC also has

the potential to produce a soluble receptor. Thus, not only FcyRI gene duplication but alternative splicing and point mutations are likely to be responsible for the anticipated diversity in receptor structure, distribution, and functional capabilities.

Acknowledgments-We thank Prarthana Aphale, Diane Maresco, and Kathy Miller for their expert technical assistance and Dr. Brian Seed for the generous gift of the cDNA p135.

1.

2.

3.

4.

5.

6. 7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18. 19.

20.

21.

22.

23. 24.

25. 26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

REFERENCES van de Winkel, J. G. J., and Anderson, C. L. (1991) J. Leuk. Biol. 49,511-

Ravetch, J. V., and Anderson, C. L. (1990) in Fc Receptors and the Action 524

ojAntibodies (Metzger, H., ed) pp. 211-235, American Society for Micro- biology, Washington, D. C.

Perussia, B., Dayton, E. T., Lazarus, R., Fanning, V., and Trinchieri, G. (1983) J. Ex Med 158, 1092-1113

Pan, L., Men&, D. B., Zurlo, J., and Guyre, P. M. (1990) J. Immunol. 145, 267-275

van de Winkel, J. G. J., Ernst, L. K., Anderson, C. L., and Chiu, I.”. (1991) J. Bioi. Chem. 266,13449-13455

Allen, J. M., and Seed, B. (1989) Science 243,378-381 Ernst, L. K., Rajan, V. P., Larsen, R. D., Ruff, M. M., and Lowe, J. B.

Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular Cloning: A (1989) J. Biol. Chem. 264, 3436-3447

Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY

Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467

Anderson, C. L., Shen, L., Eicher, D. M., Wewers, M. D., and Gill, J. K. (1990) J. Exp. Med. 171, 1333-1345

Bell, G. I., Karam J. H. and Rutter, W. J. (1981) Proc. Natl. Acad. Sci. U. S. A. 78,575b-5763’

Roth, M. S., Antin, J. H., Bingham, E. L., and Ginsburg, D. (1990) Transplantation 49, 714-720

Marchuk, D., Drumm, M., Saulino, A., and Collins, F. S. (1991) Nucleic Acids Res. 19, 1154

Peltz, G. A,, Grundy, H. O., Lebo, R. V., Yssel, H., Barsh, G. S., and Moore, K. W. (1989) Proc. Natl. Acad. Sci. U. S. A. 86,1013-1017

Grundy, H. O., Peltz, G., Moore, K. W., Golbus, M. S., Jackson, L. G., and Lebo, R. V. (1989) Immunogenetics 29,331-339

Sammartino, L., Webber, L. M., Hogarth, P. M., McKenzie, I. F. C., and Garson, 0. M. (1988) Immunogenetics 28,380-381

Qiu, W. Q., de Bruin, D., Brownstein, B. H., Pearse, R., and Ravetch, J. V. (1990) Science 248, 732-735

Ravetch, J. V., and Kinet, J.-P. (1991) Annu. Rev. Imrnunol. 9, 457-492 Seldin, M,. F., Moses, H. C., LeBoeuf, P. C., and Steinberg, A. D. (1988)

LeConiat, M., Kinet, J.-P., and Berger, R. (1990) Immunogenetics 32,182- GenomLcs 2,48-56

1 Rfi W&man, A. M., Hou, D., Orloff, D. G., Modi, W. S., Seuanez, H., OBrien,

S. J., and Klausner, R. D. (1988) Proc. Natl. Acad. Sci. U. S. A. 85,9709-

Staunton, D. E., Fisher, R. C., LeBeau, M. M., Lawrence, J. B., Barton, D. 9713

E., Francke, U., Dustin, M., and Thorley-Lawson, D. A. (1989) J. Erp. Med. 169,1087-1099

Yu, C. Y., and Milstein, C. (1989) EMBOJ. 8,3727-3732 Watson, M. L., Kingsmore, S. F., Johnston, G. I., Siegelman, M. H., Le

Beau, M. M., Lemons, R. S., Bora, N. S., Howard, T. A,, Weissman, I. L., McEver, R. P., and Seldin, M. F. (1990) J. Exp. Med. 172,263-272

Allen, J. M., and Seed, B. (1988) Nucleic Acids Res. 16,11824 Eperon, L. P., Estibeiro, J. P., and Eperon, I. C. (1986) Nature 324, 280-

3R3 Smi th , C. W. J., Patton, J. G., and Nadal-Ginard, B. (1989) Annu. Reu.

Genet. 23,527-577 Hulett, M. D., Osman, N., McKenzie, I. F. C., and Hogarth, P. M. (1991)

J. Immunol. 147, 1863-1868 Anderson, C. L., Guyre, P. M., Whitin, J. C., Ryan, D. H., Looney, R. J.,

and Fanger, M. W. (1986) J. Bid. Chem. 261, 12856-12864 Gower, H. J., Barton, C. H., Elsom, V. L., Thompson, J., Moore, S. E.,

Dickson, G., and Walsh, F. S. (1988) Cell 55,955-964 Fridman, W. H., and Sautes, C. (1990) in Fc Receptors and the Action of

Antibodies (Metzger, H., ed) pp. 335-355, American Society for Micro-

Calvo, C. F., Watanahe, s., Metivier, D., and Senik, A. (1986) Eur. J. biology, Washington, D. C.

Varin, N.. SautBs, C., Galinha, A., Even, J., Hogarth, P. M., and Fridman, Immunol. 16, 25-30

Qu, 2.. Odln, J., Glass, J. D., and Unkeless, J. C. (1988) J. Exp. Med. 167, W. H. (1989) Eur. J. Immunol. 19,2263-2268

Warmerdam, P. A. M., van de Winkel, J. G. J., Gosselin, E. J., and Capel, 1195-1210

Yang, Z., Sugawara, M., Ponath, P. D., Wessendorf, L., Baneji, J., Li, Y., P. J. A. (1990) J. Exp. Med. 172, 19-25

and Strominaer. J. L. (1990) Proc. Natl. Acad. Sei. U. S. A. 87, 9226- 9230

839 Johnson, P. F., and McKnight, S. L (1989) Annu. Reu. Biochem. 58, 799-