(tomdcblotgwsasadqmapssb

ifL

0

Genomics 56, 90–97 (1999)Article ID geno.1998.5676, available online at http://www.idealibrary.com on

0CA

The PISSLRE Gene: Structure, Exon Skipping, and Exclusionas Tumor Suppressor in Breast Cancer

Joanna Crawford,* ,1 Leonarda Ianzano,† ,1 Maria Savino,† Scott Whitmore,*Anne-Marie Cleton-Jansen,‡ Chatri Settasatian,* Maria d’Apolito,† Ram Seshadri,*Jan C. Pronk,§ Arleen D. Auerbach,¶ Peter C. Verlander,¶ Christopher G. Mathew,\

Alex J. Tipping,\ Norman A. Doggett,** Leopoldo Zelante,†David F. Callen,* and Anna Savoia† ,2

*Department of Cytogenetics and Molecular Genetics, Adelaide Women’s and Children’s Hospital, North Adelaide, South Australia5006, Australia; †Servizio di Genetica Medica, IRCCS-Ospedale CSS, I-71013 San Giovanni Rotondo, Foggia, Italy; ‡Department of

Pathology, University of Leiden, Leiden, The Netherlands; §Department of Human Genetics, Free University, Amsterdam, TheNetherlands; ¶Laboratory of Human Genetics and Hematology, The Rockefeller University, 1230 York Avenue, New York, New York10021-6399; \Division of Medical and Molecular Genetics UMDS, 8th Floor Guy’s Tower, Guy’s Hospital, London SE1 9RT, United

Kingdom; and **Center for Human Genome Studies, Los Alamos National Laboratory, Los Alamos, New Mexico 87545

Received August 26, 1998; accepted November 16, 1998

shssraabassmacflecfggpfP1

paTPpt

In sporadic breast cancer, loss of heterozygosityLOH) frequently occurs in three discrete regions ofhe long arm of chromosome 16q, the most telomericf which is located at 16q24.3. Among the genesapped to this region, PISSLRE is a plausible can-

idate tumor suppressor gene. It codes for a putativeyclin-dependent kinase that, as with other mem-ers of this family, is likely to be involved in regu-

ating the cell cycle and therefore may have a role inncogenesis. We characterized the genomic struc-ure of PISSLRE and found that the splicing of thisene is complex. A variety of different transcriptsere identified, including those due to cryptic splice

ites, exon skipping, insertion of intronic sequences,nd exon scrambling. The last phenomenon was ob-erved in a rare PISSLRE transcript in which exonsre joined at a nonconsensus splice site in an orderifferent from that predicted by the genomic se-uence. To screen the PISSLRE gene in breast tu-ors with ascertained LOH at 16q24.3, we have an-

lyzed each exon by single-strand conformationalolymorphism. No variation was found in the codingequence, leading us to conclude that another tumoruppressor must be targeted by LOH in sporadicreast cancer. © 1999 Academic Press

The HGMW-approved symbol for the gene described in this papers CDK10 [cyclin-dependent kinase (CDC2-like) 10]. Sequence datarom this article have been deposited with the EMBL/GenBank Dataibraries under Accession Nos. AJ010341 to AJ010344.

1 The first two authors contributed equally to this study.2 To whom correspondence should be addressed. Telephone: 139

882 410825. Fax: 139 0882 411616. E-mail: genetcss@fg.nettuno.it.

90888-7543/99 $30.00opyright © 1999 by Academic Pressll rights of reproduction in any form reserved.

INTRODUCTION

In sporadic breast carcinomas and other tumors,uch as prostate and hepatocellular cancers, loss ofeterozygosity (LOH) has been frequently detected foreveral regions of the long arm of chromosome 16,uggesting the presence of tumor suppressor genesesponsible for these malignancies (Cleton-Jansen etl., 1994; Driouch et al., 1997; Latil et al., 1997; Piao etl., 1998). The smallest region of overlap is locatedetween the genetic markers D16S3026 and D16S303t 16q24.3 (Moerland et al., 1997). Physical and tran-cript mapping studies of this interval have identifiedeveral new transcripts and have allowed previouslyapped genes to be more finely localized (Whitmore et

l., 1998a). These include BBC1, FAA, GAS11, and16orf13, which have all been excluded as candidatesor breast cancer based on mutation analysis (Moer-and et al., 1997; Whitmore et al., 1998b; Cleton-Jansent al., 1998); DPEP1 and MC1R, which have been ex-luded based on their expression pattern and knownunction (Austruy et al., 1993; Gantz et al., 1994); andenes that have not yet been excluded, such as paraple-in, the gene responsible for hereditary spastic para-legia (Casari et al., 1998; Settastian et al., submittedor publication), PRSM1 (Scott et al., 1996), andISSLRE (Grana et al., 1994; Brambilla and Draetta,994; Bullrech et al., 1995).The PISSLRE gene codes for a putative cyclin-de-

endent kinase (CDK) (Grana et al., 1994; Brambilland Draetta, 1994). It contains the regulatory Tyr andhr residues present in all protein kinases and aSTAIRE-like motif named PISSLRE. The PISSLRErotein is most closely related to p58/GTA (55% iden-ity), the galactosyl transferase associated protein,

wtaa

pLclsnto(ehw1

Pgocagt1

dcfssstiSams

epgPtaroafdaaB

sRw

gCtmtBGA(jpacruto

aPpCCGG5rttti0fi1

ps1osmebdR(fAGTe(icpeP[8cp7wdgwD

91MOLECULAR CHARACTERIZATION OF THE PISSLRE GENE

hich, contrary to the role played by other CDKs, ishought to act as an antiproliferative factor (Bunnell etl., 1990). PISSLRE also shares 38–45% identity withll members of the CDK family.The CDKs are regulated both by binding their cyclin

artners and by phosphorylation of key residues (Mac-achlan et al., 1995; Morgan, 1997). As with otheryclin/CDK complexes involved in regulating particu-ar cell cycle transitions, such as initiation of DNAynthesis or cell division, PISSLRE is essential forormal cell growth. The presence of the PISSLRE pro-ein is necessary for the progression from G2 to M, andverexpression of the gene leads to growth suppressionLi et al., 1995). Although the gene is ubiquitouslyxpressed in adult human tissues, the expression isigher in terminally differentiated cells, which areithdrawn from the cell cycle (Brambilla and Draetta,994; Grana et al., 1994).Based on these observations, we hypothesized that

ISSLRE represents a plausible tumor suppressorene. Many cell cycle checkpoints are deregulated inncogenesis, and this is often due to alterations inyclin–CDK complexes (Patel et al., 1997). Loss of neg-tive growth control, including a lack of response torowth-inhibitory factors, is a common feature of manyumor cells (MacLachlan et al., 1995; Dirks and Rutka,997).To examine the possible role of PISSLRE in the

evelopment or progression of malignancies, we haveharacterized the gene in more detail and screened itor the presence of mutations in sporadic breast canceramples with ascertained LOH at 16q24.3. Our datahow a heterogeneous assortment of PISSLRE tran-cripts that most likely result from complex splicing ofhe gene, involving cryptic splice sites, exon skipping,nsertion of intronic sequences, and exon scrambling.creening for mutations excludes the possibility thatlterations of the PISSLRE gene are involved in tu-origenesis, at least in the subset of breast tumors

elected for restricted LOH at 16q24.3.

MATERIALS AND METHODS

Genomic structure characterization. To determine the intron/xon boundaries of the PISSLRE gene, we used two different ap-roaches. The first of these, sequencing of genomic PCR fragmentsenerated from primers designed against the cDNA sequence ofISSLRE, was successful when introns were of limited size. Whenhe intervening intronic sequence was too large for efficient PCRmplification, direct sequencing of cosmid DNA was performed. Di-ect sequencing of exons, exon/intron boundaries, and in some casesf whole introns was carried out on DNA of cosmids c371D5, c344H1,nd c378G9 (Whitmore et al., 1998a). Sequence analysis was per-ormed with 7 mg of cosmid DNA using a fluorescence-labeledideoxy-nucleotide termination method (Dye Terminator) in a 373Automated DNA sequencer (ABI). The nucleotide sequences of exonsnd their flanking regions have been submitted to the EMBL Dataank under Accession Nos. AJ010341 to AJ010344.

59 RACE. Characterization of the 59 region of PISSLRE tran-cripts was carried out by the rapid amplification of cDNA ends (59ACE) method (Frohman et al., 1998). Total cellular RNA from liveras reverse transcribed with Superscript II RNase H-RT using a

ene-specific primer spanning exons 5 and 6 (GSP5-6, 59-CATCAC-AGGAAGATGCTCTC-39) at 50°C for 50 min. The first-strand syn-

hesis product was purified and homopolymer tailed according to theanufacturer’s instructions. Standard 50-ml PCRs using 1/5 of the

ailed cDNA were performed with 2.5 ml of Taq polymerase (GibcoRL), using a nested primer in exon 5 (GSP5, 59-GATGTTCGGAT-ACGCAGGC-39) in combination with the kit-supplied 59 RACEbridged Anchor Primer. A second-round nested PCR using GSP4-5

59-ATGCCATCCTTCTCCTTGTC-39) spanning exons 4 and 5 in con-unction with the kit-provided Universal Amplification Primer waserformed on a 1/100 dilution of the previous PCR product. Thebove procedure was then repeated using total RNA from a bladderarcinoma cell line and liver RNA, this time using GSP4-5 as theeverse transcription primer with subsequent nested amplificationssing GSP3 (59-GGTTCAGCTTCTCAAACTCC-39) in exon 3 andhen GSP2-1 (59-AGCGCTGGATCCTCTGCTTG-39) overlapping ex-ns 2 and 1 in X78342.

Northern blot analysis. Northern blots (Clontech) were probed,ccording to the manufacturer’s instructions, with three differentISSLRE PCR products. Probes were amplified using the followingrimers: 1F (59-TGAGCCACCGCCCCCAGCCT-39) and 1R (59-ATC-TCTGCTTGTGCTCTTC-39) for exon 1 (107 bp); 2F (59-CAG-GCTCGGCATGGCGGAG-39) and 2R (59-CCTGTGTTCCGGAG-CACCG-39) for exon 2 (98 bp); 9F (59-TCAGTGGTGTCTGT-AAGGG-39) and 12R (59-ACAAGACCCTATAGCTTCGC-59) for a93-bp fragment in the 39UTR. The probes were radiolabeled usingandom primers. The same filter was first hybridized with exon 2 andhen with exon 1. Another filter containing RNA from identicalissues was probed with the 39UTR fragment. Blots were washedwice in 23 SSC, 0.05% SDS at room temperature for 20 min, twicen 0.13 SSC, 0.1% SDS at room temperature for 20 min, and once in.13 SSC, 0.05% SDS at 50°C for 5 min. Blots were exposed to X-raylm for 1, 3, and 4 days using probes specific for the 39UTR and exonsand 2, respectively.

Mutation analysis. LOH analysis of breast tumor samples waserformed as previously described using 25 polymorphic markerspanning the long arm of chromosome 16 (Cleton-Jansen et al.,994; Moerland et al., 1997). Breast tumor samples showing LOHnly at 16q24.3 or with complex LOH including 16q24.3 werecreened for mutations in the PISSLRE gene. Genomic DNA (10g) from 17 tumors was digested with TaqI and PvuII restrictionnzymes (BRL). DNA fragments were transferred to a nylon mem-rane (Amersham) and hybridized with radioactively labeled ran-om primed PISSLRE cDNA. RT-PCR was carried out on totalNA extracted from tumor tissue blocks using TRIzol reagent

Gibco BRL). The PCR primers used to amplify cDNA were asollows: F1, 59-CAGACAGATGAGATTGTCGCA-39; F2, 59-CAGGGACCTGAAGGTTTCC-39; R1, 59-CAGACAACCCTT-TCGGTC-39; and R2, 59-ATGGGAACTTGTGCTTCAGGPCR-39.he size of the products generated was analyzed by acrylamide gellectrophoresis or by single-strand conformational polymorphismSSCP). Primers for SSCP of genomic DNA were designed inntronic sequences such that coding and flanking intronic regionsould be analyzed (Table 1). SSCP analysis was performed onaired breast tumor DNA and normal DNA isolated from periph-ral blood lymphocytes of the same patients. Amplification ofISSLRE sequence was performed in 25-ml PCRs containing

a-32P]dCTP or [a-35S]dATP. Initial denaturation was for 6 min at5°C, followed by amplification for 30 cycles under the followingonditions: denaturation at 94°C for 30 s, annealing at the tem-erature based on the primer sequence for 30 s, and extension at2°C for 30 s. Two microliters of the completed reaction mixturesas added to an equal volume of formamide dye. This mixture wasenatured by boiling and immediately loaded on 8% acrylamideels. Bands showing altered mobility when compared to controlsere reamplified and directly sequenced in a 373A automatedNA sequencer (ABI).

G

Xwtobpatf1bLdeltcctr

LigeSSlspftggm

tttDjTtLet

92 CRAWFORD ET AL.

RESULTS AND DISCUSSION

enomic Characterization of the PISSLRE Gene

The PISSLRE gene has two entries in GenBank:78342 and L33264. The former is 1863 bases in sizeith a putative translational initiation codon in posi-

ion 121 that shows a perfect Kozak consensus and anpen reading frame (ORF) of 360 amino acids (Bram-illa and Draetta, 1994). The latter is 1425 bp with autative ORF of 316 amino acids that does not containny in-frame ATG (Grana et al., 1994). Alignment ofhe two cDNA sequences reveals a stretch of homologyrom base 92 to the end of L33264 with base 208 to677 of X78342. However, a 134-bp region of X78342etween bases 1106 and 1239 appeared to be deleted in33264 (Fig. 1). The two transcripts showed significantifferences at both 59 and 39 regions, leading to differ-nces in the N- and C-terminal sequences of the trans-ation product. The differences at the 59 end suggesthat these two cDNAs may represent alternatively pro-essed forms of the gene. The 39UTRs of each cDNAontain identical sequences but differ in length due toermination at different sites, suggesting a possibleecognition of alternative polyadenylation signals.

To elucidate the origin of the different forms of PISS-

TAB

Alignment of the Exon-Intron B

Scorea 59 Acceptor siteExon

(size in bp) 39 Donor

11 caagagaggcgggg CCA b 1a (61) TTC gtaagg1a 1 1b (99) AGG gtgcg

33 ctggaattacaggc GTG 2 (108) GAT gtgaga

87 cccttctgtttcag CTG 3 (73) TGT gtgatg

95 tgtttccattccag ATC 4 (72) ATG gtgagc

91 acctccctccccag GCA 5 (103) GAG gtacg

92 tctgtttcttccag CAT 6 (82) CAG gtgcgt

86 gaccctctgcacag GTC 7 (68) CAG gtggg

99 tttttccatcacag GGA 8 (53) CAG gtggg

87 cctctctgctgcag CGG 9 (70) CTG gtaagt

82 gcttctgtgtgtag GTA 10 (60) GTG gtgag

95 actgttctctgcag GGC 11 (124) CCG gtggg

82 cctgcctcccatag GGC 12 (140) AAG gtgctg

91 gctgcctcctccag GGC 13 (53) TAC gtgagt

90 ccttctccctgcag CCT 14a 1 14b (95) CCC tga89 tattcccacaccag GTC 14b (44) GGC tga

a Splice junction boundaries were scored according to Shapiro andb The nonconsensus 59 acceptor splice site for exon 1 is used onlyc Oligonucleotide designed with a T7 tail (59-taatacgactcactatagggd Intron size determined by PCR on genomic DNA.

RE and to develop a strategy for the mutation screen-ng in breast tumor samples, we characterized theenomic structure of this gene. PISSLRE consists of 14xons ranging in size between 44 and 140 bp (Table 1).plice junction boundaries were scored according tohapiro and Senapathy (1987) and agree with pub-

ished consensus sequences for donor and acceptorplice sites. To ascertain the sizes of the introns, PCRroducts from genomic DNA were compared to thoserom RNA. This proved to be a problem at the 59 end ofhe gene, as we were repeatedly unable to generate aenomic product. Therefore, intron sizes for the 59 re-ion and other nonamplifiable introns were deter-ined by direct sequence analysis (Table 1).Comparison of the genomic sequence of PISSLRE with

he two cDNA sequences L33264 and X78342 indicateshat the 59 region of the transcripts consists of one andwo exons, respectively. Sequence analysis of genomicNA showed that the first two exons of X78342 were

oined in a different order from the genomic orientation.hus, if we number exons according to their position inhe genomic DNA, X78342 contains exons 2-1-3, whereas3364 contains only exons 1 and 3 (Fig. 1). In the latter,xon 1 is preceded by 30 bp of sequence corresponding tohe upstream genomic sequence and identical to that of

1

ndaries of the PISSLRE Gene

e ScoreaIntron

(size in bp)Intronic primers (59 3 39)

for mutation screening

g 74 1 (1188) 1F- cagacgaagcccgggaaggaggg 72 1R- cacgaggctccccagacccagg 78 2 (1442) 2F- cggtgaagtagtgagttggcc

2R- gaccgagtcagaagcatctga 57 3 (1300)d 3F- ccactgcactccagcctgg

3R- gccctgtttcagagcacaggga 83 4 (800)d 4F- gctgaggctgcgtgtgg

4R- cactgggcatgaggttgtcc 89 5 (260) 5F- ggtcgccccagttctcc

5R- aggtggggtcatctcttctctga 85 6 (563) 6F- ttaggagaaggccggagagtg

6R- tccccaagtgccctgtttcgttata 86 7 (780)d 7F- ggccgagagccttctgagg

7R- acaaatggagtgcgagcagca 86 8 (70) 8F- gaagtctacgggcattggtg

8R- agcttcggcctgacatcct 92 9 (711) 9F- gaagtctacgggcattggtg

9R- agcttcggcctgacatccat 84 10 (432) 10F- ctctcggggaggctgtgtc

10R- gagtgggaggctggcaaagac 72 11 (108) 11F- cgcagtcaggtcctctgttcc

11R- gaaacggtctggacagtgtgt 66 12 (222) 12F- ccacgccctctgcgcctcag

12R- cgaaacggtctggacagtgtgc 83 13 (249) 13F- gaggaagccgcactcacaag

13R- ccagcaggccacttctccacc14F- cggcagagctggactcagacc14R- agtcagtggaggatgttccc

napathy (1987).he rare instance when exon 2 is spliced upstream of exon 1.at the 59 end.

LE

ou

sit

aggcggag

gcc

ag

tggt

ggc

tgac

tgca

cct

gag

cgtc

atc

gtg

Sein t-39)

ta

soT3wTgatctoats

C

s

lwee3mEswobDr

swthbadttn

teite

93MOLECULAR CHARACTERIZATION OF THE PISSLRE GENE

he published cDNA, with the exception of a C instead ofn A at the first nucleotide.In an attempt to reconcile the genomic and tran-

cript exon order, we performed Southern blot analysisn overlapping cosmids spanning the PISSLRE gene.his blot of NotI/BamHI-digested cosmids 371D5,44H1, and 378G9 (Whitmore et al., 1998a) was probedith specific oligonucleotides from exons 1, 2, and 3.he resultant hybridization pattern supported theenomic exon order 1-2-3 (data not shown). Sequencenalysis of the 59 region of the PISSLRE gene showedhat the hybridizing bands were of the expected sizeorresponding to specific restriction enzyme sites iden-ified within the sequence. Each exonic probe identifiednly a single specific genomic fragment, arguinggainst the likelihood of a duplication of exon 2 andherefore the involvement of an identical upstreamequence in the assembly of the X78342 transcript.

haracterization of 59 Region of PISSLRETranscripts

The presence of putative donor splice site consensusequences at the 39 end of both exons 1 and 2, and the

FIG. 1. PISSLRE transcripts. (A) Genomic structure of the PISrapped from the antisense strand of intron 9 due to the presence oft al., 1998a). (B) Schematic representation of the L33246 and X7843nitiates at exon 1 with an alternative splicing between exons 1 andhrough the mechanism of exon scrambling. The presence of exon 1bxon 3 and the rest of the transcript. (C) Schematic diagram of a m

ack of acceptor sequences at the 59 ends, is consistentith a model in which transcription initiates at eitherxon (Table 1). The presence of L33246 could thus bexplained by splicing of the region between exons 1 and(Fig. 1). The abnormally spliced X78432 transcriptay arise through the mechanism of exon scrambling.xon scrambling is a phenomenon previously de-cribed in human genes, such as DCC and EST-1, asell as in rat cytochrome P450 and ABP, where a pairf exons is joined accurately at consensus splice sites,ut in an order different from that present in genomicNA (Nigro et al., 1991; Cocquerelle et al., 1992; Zaphi-

opoulos, 1996, 1997; Caldas et al., 1998).To understand the 59 region of the PISSLRE tran-

cripts better, Northern blot and 59 RACE analysisere performed. We investigated the expression of

ranscripts containing exons 1 and 2 in different adultuman tissues by probing a multiple tissue Northernlot with specific probes (Fig. 2). Exon 1 probe revealedprominent 2.0-kb mRNA with additional products of

ifferent sizes. This hybridization pattern was similaro that obtained with a probe localized to the 39UTR,hus indicating that the different transcripts are alter-ative forms of the PISSLRE gene. Exon 2 probe did

E gene. Asterisks indicate cryptic splice sites. ET32.46 is an exonnking sequences with strong resemblance of splice sites (Whitmoreanscripts. L33246 is consistent with a model in which transcription

We suggested that the abnormally spliced X78432 transcript arisesessential for the initiator codon AUG in exon 1 to be in-frame withanism to resolve the scrambled exon in X78342.

SLRfla

2 tr2.is

ech

neL

goc

peo(eefi

c

alSagcwl

94 CRAWFORD ET AL.

ot detect any specific transcripts, even after extendedxposure (4 days), indicating the scarcity of the PISS-RE messenger RNA containing exon 2.Initial 59 RACE was performed on liver RNA using a

ene-specific reverse transcription primer spanning ex-ns 5 and 6 (GSP5-6) with subsequent nested amplifi-ation using GSP5 within exon 5 and GSP4-5 overlap-

FIG. 2. Northern blot analysis of adult tissue RNAs probed with tDNA. Tissues are indicated by 1, heart; 2, brain; 3, placenta; 4, lun

FIG. 3. 59 RACE products. (A) Initial 59 RACE on liver RNAlternatively spliced GSP4-5 amplified products were obtained by seacking exon 3 and/or exon 1b were amplified in addition to thoseubsequent 59 RACE on bladder carcinoma cell line and liver RNA usimplified products contain exon 2 with a further 21-bp 59 extensioenerated by GSP4-5 (b). Alternatively spliced products identicalontamination and scarcity of exon 2 containing PISSLRE transcriptould also find final-round RACE products amplified by GSP3. How

ikely due to the fact that the exon 3 containing transcripts are less

ing the exon 4–5 boundary. These preliminary RACExperiments generated 59 ends that maintained homol-gy to the published X78342 sequence from base 357the position of GSP4-5) base 108 (the most 59 base ofxon 1) and then diverged for 30 bp at the extreme 59nd (Fig. 3A). These 30 bp matched perfectly with therst 30 bp of L33246 and with the genomic sequence

e different fragments, exon 2, exon 1, and the 39UTR of the PISSLRE5, liver; 6, skeletal muscle; 7, kidney; 8, pancreas.

ing sequential GSP5-6, GSP5, and GSP4-5 primers. A variety ofncing seven randomly chosen clones. Fully 59 extending transcriptstaining exons 4, 3, 1b, and 1a and the 30-bp UTR (solid bar). (B)sequential GSP4-5, GSP3, and GSP2-1 primers. Final-round GSP2-1pen bar) (a). Unexpectedly, final-round RACE products were alsohose described for (A) were produced, most likely due to GSP4-5he presence of GSP4-5 amplified products led us to assume that wer, no RACE product generated by this primer was identified, most

undant (only about half the RACE products contain exon 3).

hreg;

usqueconngn (oto ts. Teveab

pc

s(Pao2utaWPpiafisPi(fia

pqp(satdP

fssosajosk

natTs(s(rMibt

Pa1XbsTim

A

qtXfvdstaccc11C

i1aaepy

tLond6wn

opbaptroiecms

95MOLECULAR CHARACTERIZATION OF THE PISSLRE GENE

rior to exon 1. Notably, none of these RACE productsontained exon 2 (Fig. 3A).

In an attempt to isolate exon 2 containing tran-cripts, we designed a primer spanning exons 2 and 1GSP2-1) and used this in a second round of nestedCR. We obtained 59 ends homologous to X78342 withn extension of an additional 21 bp from the 59 extremef the published sequence (Fig. 3B). Interestingly, exonwas only ever amplified when GSP2-1 primer was

sed in the final round of PCR. This led us to postulatehat the PISSLRE messengers with exon 2 were rare,t least in liver and in the bladder carcinoma cell line.e were surprised to note that GSP2-1 final-round

CR also generated products amplified by the GSP4-5rimer. This GSP4-5 primer had been used for thenitial RACE reverse transcription and therefore wast a concentration 500 times lower than GSP2-1 at thenal-round PCR step (see Materials and Methods). Asuch, GSP4-5 was not expected to generate final-roundCR products. We hypothesize that the observed lim-

ted amplification of the expected GSP2-1 PCR productand conversely the unexpected presence of GSP4-5nal-round amplification product) is due to the lowbundance of exon 2 containing transcripts.Exon skipping was also observed in these RACE

roducts, with approximately half of the isoforms se-uenced missing exon 1b and/or exon 3 (Fig. 3). Skip-ing of exon 1b disrupts the ORF initiated in exon 1aFig. 1), and thus transcripts without exon 1b are pre-umably nonfunctional. Isoforms deleted for exon 3lone maintain the ORF and as such may be functionalranscripts. However, future assays are necessary toetermine what, if any, effect exon 3 deletion has onISSLRE function.In conclusion, we speculate that the most prominent

unctional transcript of the PISSLRE gene is a mes-enger containing exon 1 and missing exon 2. Since noequence was found to extend further than the 59 endf the published cDNA, the putative transcription startite is likely to be the first nucleotide of L33246. Anlternative rare transcript contains exon 2, which isoined to exon 1 at a nonconsensus splice site in anrder different from that predicted by the genomicequence. This probably occurs through a mechanismnown as exon scrambling.The phenomenon of exon scrambling was first recog-

ized in transcripts that are not polyadenylated andre expressed at much lower levels than the normalranscripts (Nigro et al., 1991; Cocquerelle et al., 1992).he scrambled exons are joined accurately at consen-us splice sites and are often adjacent to large intronsCocquerelle et al., 1992). These same exons involved incrambling are also associated with exon skippingZaphiropoulos, 1996). However, Caldas et al. (1998)ecently reported finding scrambled transcripts of theLL gene that were polyadenylated, adjacent to small

ntrons, and joined at nonconsensus sites. The scram-led transcript of PISSLRE appears to share some ofhe characteristics of the misspliced MLL messengers.

ISSLRE exon 2 is flanked by relatively small introns,nd the consensus acceptor splice site upstream of exonis absent (Fig. 1). Since the extreme 59 228 bp of

78342 were identified by RACE methodology (Bram-illa and Draetta, 1994), we cannot ascertain whethercrambled PISSLRE transcripts are polyadenylated.he functional significance of this scrambled transcript

s unclear, particularly as it appears to constitute ainor proportion of PISSLRE RNA.

lternative Splicing Transcripts

Comparison of genomic DNA sequence to cDNA se-uences in GenBank also allowed us to define alterna-ively spliced transcripts of the PISSLRE gene (Fig. 1).78342 and L33264 contain alternatively processed

orms of exon 1: exon 1a and exon 1b. This sequenceariation may arise due to the recognition of a crypticonor splice site (TTCgtaagga) localized 61 bp down-tream of the start of the exon 1, thus distinguishingwo portions: exons 1a and 1b (Table 1). Similarly, thebsence of the 134-bp sequence observed in L33264 inomparison with X78342 may arise due to the use of aryptic acceptor splice site, tgtattcccacaccagGTC, lo-ated 134 bp 59 to the true splice acceptor site of exon4 (Table 1). The two alternative forms of this exon,4a and 14b, are responsible for the difference in the-terminal translation products of the two transcripts.In addition to the putative isoforms of PISSLRE

solated from a human cDNA library (Grana et al.,994), searches in the EST database identified otherlternative transcripts. ESTs yg28h12 and zb85g07ppear to arise from the presence of cryptic sites inxons 3 and 5, respectively. Intronic sequences areresent in yo60f10, yl10e1, yl66f12, zw29f02, yj68f06,j84c12, nl17b09, and Z46149.Transcript mapping studies of 16q24.3 identified a

rapped exon, ET32.46, in close proximity to the PISS-RE gene (Whitmore et al., 1998a). Sequence analysisf the sole 2.0-kb clone isolated from a human carci-oma cell line library established that this cDNA waserived from the PISSLRE gene and contained the last58 bp of intron 9 followed by exons 10 to 14, however,ithout any evident ORF upstream of exon 10 (dataot shown).Northern blot analysis displayed an extensive heter-

geneity of PISSLRE transcripts (Fig. 2), as also re-orted in previous papers (Grana et al., 1994; Bram-illa and Draetta, 1994). The smallest transcript ofpproximately 2.0 kb is likely to correspond to theublished PISSLRE gene; however, the molecular na-ure of all other RNAs is unknown. Since we haveeported the characterization of several variants, somef the transcripts might result from alternative splic-ng of PISSLRE. However, the alternative splicing ofxons 1, 3, or 5 led to a shift of the ORF and theorresponding production of presumably nonfunctionalessengers. Similarly, transcripts containing intronic

equences most likely represent splicing artifacts or

iFatts

M

pcflo11emosswlbfbior(stgIbtg

nimcagi

ftiR

A

B

B

B

C

C

C

C

C

D

D

F

G

G

G

L

L

M

96 CRAWFORD ET AL.

ntermediates generated during intron processing.urther studies, such as the direct identification of thelternative transcripts or proteins and the demonstra-ion of their presence among species, may provide bet-er insight into the understanding of the different tran-cripts and also of the PISSLRE gene.

utation Screening in Breast Tumors

To investigate whether the PISSLRE gene was aotential tumor suppressor gene involved in breastancer, primers were designed in the genomic DNAanking each exon and used to screen for the presencef mutations in breast specimens (Table 1). A total of7 primary breast tumors showing restricted LOH at6q24.3, or complex loss including 16q24.3 (Moerlandt al., 1997), were analyzed by single-stranded confor-ational polymorphism analysis. No base change was

bserved in the coding region of the PISSLRE gene. Aingle nucleotide insertion (IVS9 2 13insC) and a sub-titution (IVS9 1 16C . G), both found in intron 9, asell as a transition (IVS10 1 12C . T) in intron 10, are

ikely to be polymorphisms or rare variants. Southernlot analysis of digested tumor DNA was also per-ormed to identify possible genomic rearrangements,ut none of the tumors showed aberrant bands. Tonvestigate the possibility that mutations are occurringutside the regions screened, such as in the promoteregion, we performed RT-PCR on tumor samplesNorthern blot analysis was not possible due to thecarcity of available RNA). RT-PCR allowed us to de-ect PISSLRE messenger in all tumor samples, sug-esting that the gene was expressed (data not shown).n addition, given the sporadic nature of the tumorseing studied, it is unlikely that all deleterious muta-ions would be found outside the coding regions of theene responsible.PISSLRE maps to a region known to exhibit LOH

ot only in breast tumors but also in other tumors. Fornstance, LOH studies in prostate cancers have also

apped a tumor suppressor gene associated with thisarcinoma to 16q24.3 (Suzuki et al., 1996; Godfrey etl., 1997). Knowledge of the structure of the PISSLREene will allow verification of its possible involvementn other neoplasias.

ACKNOWLEDGMENTS

This study was supported by grants from the Italian Associationor Cancer Research (A.I.R.C.), the Italian Ministry of Health, andhe National Health and Medical Research Council of Australia. M.S.s supported by a fellowship from the Italian Foundation for Canceresearch (F.I.R.C.).

REFERENCES

ustry, E., Jeanpierre, C., Antignac, C., Whitmore, S. A., Van-Cong,N., Bernhein, A., Callen, D. F., and Junien, C. (1993). Physical andgenetic mapping of the dipeptidase gene DPEP1 to 16q24.3.Genomics 15: 684–687.

rambilla, R., and Draetta, G. (1994). Molecular cloning of PISS-LRE, a novel putative member of the cdk family of protein serine/threonine kinases. Oncogene 9: 3037–3041.ullrech, F., MacLachlan, T. K., Sang, N., Druck, T., Veronese, M. L.,Allen, S. L., Chiorazzi, N., Koff, A., Heubner, K., Croce, C. M., andGiordano, A. (1995). Chromosomal mapping of members of thecdc2 family of protein kinase, cdk3, cdk6, PISSLRE, andPITALRE, and a cdk inhibitor, p27Kip1, to regions involved inhuman cancer. Cancer Res. 55: 1199–1205.unnell, B. A., Heath, L. S., Adams, D. E., Lahti, J. M., and Kidd,V. J. (1990). Increased expression of a 58-kDa protein kinase leadsto changes in the CHO cell cycle. Proc. Natl. Acad. Sci. USA 87:7467–7471.aldas, C., So, C. W., MacGregor, A., Ford, A. M., McDonald, B.,Chan, L. C., and Wiedemann, L. M. (1998). Exon scrambling ofMLL transcripts occur commonly and mimic partial genomic du-plication of the gene. Gene 208: 167–176.

asari, G., De Fusco, M., Ciarmatori, S., Zeviani, M., Mora, M.,Fernandez, P., De Michele, G., Filla, A., Cocozza, S., Marconi, R.,Durr, A., Fonatine, B., and Ballabio, A. (1998). Spastic paraplegiaand OXPHOS impairment caused by mutations in paraplegin, anuclear-encoded mitochondrial metalloprotease. Cell 93: 973–983.leton-Jansen, A.-M., Moerland, E. W., Kuipers-Dijkshoorn, N. J.,Callen, D. F., Sutherland, G. R., Hansen, B., Devilee, P., andCornelisse, C. J. (1994). At least two different regions are involvedin allelic imbalance on chromosome arm 16q in breast cancer.Genes Chromosomes Cancer 9: 101–107.

leton-Jansen, A.-M., Moerland, E. W., Pronk, J. C., van Berkel, C.,Apostolou, S., Crawford, J., Savoia, A., Auerbach, A. D., Mathew,C. G., Callen, D. F., and Cornelisse, C. J. (1998). Mutation analysisof the Fanconi A gene in breast tumours with loss of heterozygosityat 16q24.3. Br. J. Cancer, in press.ocquerelle, C., Daubersies, P., Majerus, M.-A., Kerckaert, J.-P., andBailleul, B. (1992). Splicing with inverted order of exons occursproximal to large introns. EMBO J. 11: 1095–1098.irks, P. B., and Rutka, J. T. (1997). Current concepts in neuro-oncology: The cell cycle-a review. Neurosurgery 40: 1000–1013.riouch, K., Dorion-Bonnet, F., Briffod, M., Champeme, M. H.,Longy, M., and Lidereau, R. (1997). Loss of heterozygosity onchromosome arm 16q in breast cancer metastases. Genes Chromo-somes Cancer 19: 185–191.

rohman, M. A., Dush, M. K., and Martin, G. R. (1998). Rapidproduction of full-length cDNAs from rare transcripts: Amplifica-tion using a single gene-specific oligonucleotide primer. Proc. Natl.Acad. Sci. USA 85: 8998–9002.antz, I., Yamada, T., Tashiro, T., Konda, Y., Shimoto, Y., Miwa, H.,and Trent, J. M. (1994). Mapping of the gene encoding the mela-nocortin-1 (a-melanocyte stimulating hormone) receptor (MC1R)to human chromosome 16q24.3 by fluorescence in situ hybridiza-tion. Genomics 19: 394–395.odfrey, T. E., Cher, M. L., Chabra, V., and Jensen, R. H. (1997).Allelic imbalance mapping of chromosome 16 shows two regions ofcommon deletion in prostate adenocarcinoma. Cancer Genet. Cy-togenet. 98: 36–42.rana, X., Claudio, P. P., De Luca, A., Sang, N., and Giordano, A.(1994). PISSLRE, a human novel CDC2-related protein kinase.Oncogene 9: 2097–2103.

atil, A., Cussenot, O., Fournier, G., Driouch, K., and Lidereau, R.(1997). Loss of heterozygosity at chromosome 16q in prostate ad-enocarcinoma: Identification of three independent regions. CancerRes. 57: 1058–1062.

i, S., MacLachlan, T. K., De Luca, A., Claudio, P. P., Condorelli, G.,and Giordano, A. (1995). The cdc2-related kinase, PISSLRE, isessential for cell growth and acts in G2 phase of the cell cycle.Cancer Res. 55: 3992–3995.acLachlan, T. K., Sang, N., and Giordano, A. (1995). Cyclins, cy-clin-dependent kinases and cdk inhibitors: Implications in cell

M

M

N

P

P

S

S

S

W

W

Z

Z

97MOLECULAR CHARACTERIZATION OF THE PISSLRE GENE

cycle control and cancer. Crit. Rev. Eukaryot. Gene Expr. 5: 127–156.oerland, E., Breuning, M. H., Cornelisse, C. J., and Cleton-Jansen,A.-M. (1997). Exclusion of BBC1 and CMAR as candidate breasttumor-suppressor genes. Br. J. Cancer 78: 1550–1553.organ, D. O. (1997). Cyclin-dependent kinases: Engines, clocks,and microprocessors. Annu. Rev. Cell. Dev. Biol. 13: 261–291.igro, J. M., Cho, K. R., Fearon, E. R., Kern, S. E., Ruppert, J. M.,Oliner, J. D., Kinzler, K. W., and Vogelstein, B. (1991). Scrambledexons. Cell 64: 607–613.

atel, V., Jakus, J., Harris, C. M., Ensley, J. F., Robbins, K. C., andYeudall, W. A. (1997). Altered expression and activity of G1/Scyclins and cyclin-dependent kinases characterize squamous cellcarcinomas of the head and neck. Int. J. Cancer 73: 551–555.

iao, Z., Park, C., Park, J. H., and Kim, H. (1998). Allelotype analysisof hepatocellular carcinoma. Int. J. Cancer 75: 29–33.

cott, I. C., Halila, R., Jenkins, J. M., Mehan, S., Apostolou, S.,Winqvist, R., Callen, D. F., Prockop, D. J., Peltonen, L., and Ka-dler, K. E. (1996). Molecular cloning, expression and chromosomallocalization of a human gene encoding a 33 kDa putative metal-lopeptidase (PRSM1). Gene 174: 135–143.

hapiro, M. B., and Senapathy, P. (1987). RNA splice junctions ofdifferent classes of eukaryotes: Sequence statistics and func-tional implications in gene expression. Nucleic Acids Res. 15:7155–7174.

uzuki, H., Komiya, A., Emi, M., Kuramochi, H., Shiraishi, T., Yatani,R., and Shimazaki, J. (1996). Three distinct commonly deleted re-gions of chromosome arm 16q in human primary and metastaticprostate cancer. Genes Chromosomes Cancer 17: 225–233.hitmore, S. A., Crawford, J., Apostolou, S., Eyre, H., Baker, E., Karen,M. L., Settasatian, C., Goldup, S., Seshadri, R., Gibson, R. A.,Mathew, C. G., Cleton-Jansen, A.-M., Savoia, A., Pronk, J. C., Auer-bach, A. D., Doggett, N. A., Sutherland, G. R., and Callen, D. F.(1998a). Construction of a high-resolution physical and transcriptionmap of chromosome 16q24.3: A region of frequent loss of heterozy-gosity in sporadic breast cancer. Genomics 50: 1–8.hitmore, S. A., Settasatian, C., Crawford, J., Lower, K. M., Cor-nelisse, C. J., Moerland, E. W., Cleton-Jansen, A.-M., Tipping,A. J., Matthew, C. J., Savino, M., Savoia, A., Verlander, P., Auer-bach, A. D., VanBerkel, C., Pronk, J. C., Doggett, N. A., and Callen,D. F. (1998b). Characterization and screening for mutations inbreast cancer of the growth arrest specific 11 (GAS11) and C16orf3genes at 16q24.3. Genomics 52: 325–331.

aphiropoulos, P. G. (1996). Circular RNAs from transcripts of therat cytochrome P450 2C24 gene: Correlation with exon skipping.Proc. Natl. Acad. Sci. USA 93: 6536–6541.

aphiropoulos, P. G. (1997). Exon skipping and circular RNA forma-tion in transcripts of the human cytochrome P-450 2C18 gene inepidermis and of the rat androgen binding protein gene in testis.Mol. Cell. Biol. 17: 2985–2993.