The Use of Cerium Oxide and Curcumin Nanoparticles as

Marshall UniversityMarshall Digital Scholar

Theses, Dissertations and Capstones

2012

The Use of Cerium Oxide and CurcuminNanoparticles as Therapeutic Agents for theTreatment of Ventricular Hypertrophy FollowingPulmonary Arterial HypertensionMadhukar Babu [email protected]

Follow this and additional works at: http://mds.marshall.edu/etdPart of the Medical Biochemistry Commons, Medical Biotechnology Commons, Medical

Molecular Biology Commons, Medical Pharmacology Commons, and the Medical ToxicologyCommons

This Dissertation is brought to you for free and open access by Marshall Digital Scholar. It has been accepted for inclusion in Theses, Dissertations andCapstones by an authorized administrator of Marshall Digital Scholar. For more information, please contact [email protected].

Recommended CitationKolli, Madhukar Babu, "The Use of Cerium Oxide and Curcumin Nanoparticles as Therapeutic Agents for the Treatment ofVentricular Hypertrophy Following Pulmonary Arterial Hypertension" (2012). Theses, Dissertations and Capstones. Paper 353.

http://mds.marshall.edu?utm_source=mds.marshall.edu%2Fetd%2F353&utm_medium=PDF&utm_campaign=PDFCoverPages

http://mds.marshall.edu/etd?utm_source=mds.marshall.edu%2Fetd%2F353&utm_medium=PDF&utm_campaign=PDFCoverPages

http://mds.marshall.edu/etd?utm_source=mds.marshall.edu%2Fetd%2F353&utm_medium=PDF&utm_campaign=PDFCoverPages

http://network.bepress.com/hgg/discipline/666?utm_source=mds.marshall.edu%2Fetd%2F353&utm_medium=PDF&utm_campaign=PDFCoverPages







http://mds.marshall.edu/etd/353?utm_source=mds.marshall.edu%2Fetd%2F353&utm_medium=PDF&utm_campaign=PDFCoverPages

mailto:[email protected]

THE USE OF CERIUM OXIDE AND CURCUMIN NANOPARTICLES AS THERAPEUTIC AGENTS FOR THE TREATMENT OF

VENTRICULAR HYPERTROPHY FOLLOWING PULMONARY ARTERIAL HYPERTENSION

A Dissertation submitted to the Graduate College of

Marshall University

In partial fulfillment of

the requirements for the degree of

Doctor of Philosophy

in Biomedical Sciences

By

Madhukar Babu Kolli, B.V.Sc&A.H, M.S.

Approved by

Dr. Eric R. Blough, Ph.D., Committee Chairperson

Dr. Monica A. Valentovic, Ph.D.

Dr. Todd L. Green, Ph.D.

Dr. Nalini Santanam, Ph.D.

Dr. Robert O. Harris, Ph.D.

Department of Pharmacology, Physiology and Toxicology

Joan C. Edwards School of Medicine,

Marshall University

Aug, 2012

ii

ACKNOWLEDGMENTS

I would like to express my deepest gratitude to my advisor, Dr. Eric R. Blough, for

his guidance, motivation and support during my research project. Dr. Blough’s support

has been invaluable in the successful completion of this dissertation. Dr. Blough was

always there to help me with the research project selection, design and the successful

completion of the project while helping with the troubleshooting of the experiments. Dr.

Blough always gave me confidence and support at each and every phase of my career

at Marshall University and without his support and motivation this journey wouldn’t have

been possible. I’m very thankful to Dr. Blough, for his invaluable support and motivation

throughout the journey of my graduate education at Marshall University.

I would like to convey my sincere thanks to my other committee members, Drs.

Monica Valentovic, Todd Green, Nalini Santanam and Robert Harris for their valuable

suggestions in fulfilling this research project. I am very thankful to my fellow graduate

students, Radhakrishna Para and Siva Nalabotu, for their valuable support in

conducting animal studies and giving me a helpful hand in sacrificing the research study

animals, helping me to complete the project successfully. I would like to thank the

division directors at the Center for Diagnostic Nanosystems, Kevin M. Rice, Miazong

Wu and Arun Kumar, for providing me equipment and supplies needed for this project. I

would also like to thank the members of Dr. Blough’s lab, Sunil Kakarla, Anjiah Katta,

Sriramprasad Mupparaju, Anil Gutta, Satyanarayana Paturi, Sarath Meduru,

Sudarsanam Kundla, Ravi Arvapalli, Gadde Murali, Srinivasarao Thulluri, Jacqueline

Fannin, Hari ddagarla, Nandini Manne, Selvaraj Vellaisamy, Wang Cuifen, Geeta

Nandyala, Sravanthi Bodapati, Hideyo Takatsuki, and Brent Kidd for their friendly

iii

support and cooperation in research. I would like to extend my thanks to Lucy Dornon

for helping me with the echocardiography recordings.

It is the most apt situation to thank my parents, Kolli VenkataSwamy Chowdary

and Kolli Jayamma, who have been an invaluable source of emotional, moral and

financial support throughout my career, and this dissertation wouldn’t have existed

without them. I would like to thank my elder sister’s family, Radhika and Narayan

Konanki, sweet niece Yukti, nephew ChetanSai and my younger sister’s family,

Sreelakshmi and Mahesh Amilineni and nephew Aarush for their love and support. I

would like to extend my thanks to my father-in-law Asundi Venkatesulu and mother-in-

law Asundi Padma for their helpful support. I would like to thank my friends and relatives

Uday Vunnam, Guru Vemula, Pramod Yelavarthi, Anjan Reddy G.B, SubbaNaidu

Darapaneni, VenkatBaineni, Murali Edara and Praveen Yadlapalli for their continuous

moral support. I would like to thank Dr. Kristen King, Dr. Kelly Pinkston, Dr. Mike Dyer,

and Dr. Chad Brown for their help in achieving my veterinary license.

These acknowledgments would be incomplete without recognizing the support

from my wife Soujanya Kolli and my beloved son VenkatSreekar Kolli. It is their love and

encouragement that has always inspired me to do my best in this research project.

Finally I would like to thank Dr. Blough and Marshall University BMS Graduate program

for providing me financial support for this project.

iv

DEDICATION

This dissertation is dedicated to my parents, my wife and to

my son for their continuous support in this journey.

v

TABLE OF CONTENTS

ACKNOWLEDGMENTS ...................................................................................................ii

DEDICATION ..................................................................................................................iv

LIST OF FIGURES ......................................................................................................... xii

LIST OF ABBREVIATIONS ............................................................................................xv

ABSTRACT .................................................................................................................. xvii

CHAPTER I ..................................................................................................................... 1

INTRODUCTION ......................................................................................................... 1

SPECIFIC AIMS ........................................................................................................... 6

Specific aim I: ....................................................................................................... 7

Specific aim II: ...................................................................................................... 7

CHAPTER II .................................................................................................................... 8

REVIEW OF LITERATURE .......................................................................................... 8

2.1 Pulmonary arterial hypertension (PAH) .................................................................. 8

2.2 Epidemiology ....................................................................................................... 11

2.3 Right ventricular hypertrophy ............................................................................... 13

2.4 Animal models ..................................................................................................... 14

2.5 Diagnosis ............................................................................................................. 15

2.6 Current strategies for treatment of PAH ............................................................... 17

vi

2.7 Introduction to Nanotechnology ........................................................................... 19

2.8 Cerium oxide nanoparticles .................................................................................. 21

2.9 Curcumin .............................................................................................................. 25

3.0 Summary .............................................................................................................. 31

CHAPTER III ................................................................................................................. 33

PAPER 1 .................................................................................................................... 33

Cerium oxide nanoparticles attenuate monocrotaline-induced right ventricular

hypertrophy following pulmonary arterial hypertension ................................. 34

Abstract ...................................................................................................................... 35

Introduction ......................................................................................................... 37

Materials and Methods ............................................................................................... 39

Animal model and experimental design .............................................................. 39

CeO2 nanoparticle size analysis by Dynamic Light Scattering (DLS) ................. 40

CeO2 nanoparticle analysis using atomic force microscopy (AFM) .................... 40

Echocardiography ............................................................................................... 40

Tissue processing and immunoblotting .............................................................. 41

OxyBlot analysis ................................................................................................. 43

Histological analysis ........................................................................................... 44

a. Dystrophin staining .................................................................................... 44

b. Picrosirius red staining............................................................................... 44

vii

c. Dihydroethidium staining ............................................................................... 45

d. TUNEL staining ......................................................................................... 45

Serum protein immune assays ........................................................................... 46

Data analysis ...................................................................................................... 47

Results ....................................................................................................................... 48

Characterization of CeO2 nanoparticles. ............................................................. 48

CeO2 nanoparticles treatment decreases right ventricular tissue weight ............ 48

CeO2 nanoparticles treatment decreases MCT-induced changes in pulmonary

arterial pressure and cardiac remodeling. ..................................................... 48

CeO2 nanoparticles treatment decreases MCT-induced increases in oxidative

stress signaling ............................................................................................. 50

CeO2 nanoparticles treatment attenuates MCT-induced increases in AMPK

alpha, ERK1/2 and JNK phosphorylation ...................................................... 51

CeO2 nanoparticles treatment attenuates MCT-induced increases in the

expression of NF-kB-p-50 ............................................................................. 52

Effects of CeO2 nanoparticles treatment on serum protein biomarkers .............. 52

CeO2 nanoparticles treatment decreases MCT-induced cardiomyocytes apoptotic

signaling ........................................................................................................ 53

Discussion .......................................................................................................... 54

Effect of CeO2 nanoparticle administration on monocrotaline-induced pulmonary

hypertension and cardiac remodeling ........................................................... 54

viii

CeO2 nanoparticle administration diminishes indices of oxidative stress during

pulmonary arterial hypertension .................................................................... 56

CeO2 nanoparticle administration diminishes monocrotaline-induced increases in

apoptosis ....................................................................................................... 58

PAPER 3 ....................................................................................................................... 75

Curcumin nanoparticles attenuate cardiac remodeling due to pulmonary arterial

hypertension .................................................................................................. 76

Abstract ...................................................................................................................... 77

Introduction ................................................................................................................ 78

Materials and Methods ............................................................................................... 80

PAH model and experimental design ................................................................. 80

Preparation of curcumin nanoparticles ............................................................... 80

Scanning Electron Microscopy ........................................................................... 81

Atomic Force Microscopy ................................................................................... 81

Echocardiography ............................................................................................... 82

Tissue processing and immunoblotting .............................................................. 82

Histology ............................................................................................................. 84

Determination of cytokine levels in serum by ELISA method ............................. 84

Determination of cardiac TNF-α and IL-1βmRNA levels ..................................... 85

Data analysis ...................................................................................................... 86

ix

Results ....................................................................................................................... 87

Curcumin NP characterization ............................................................................ 87

Curcumin NP treatment decreases PAH induced right ventricular tissue weight 87

Curcumin NP treatment decreases MCT-induced changes in pulmonary arterial

pressure and cardiac remodeling .................................................................. 87

Curcumin nanoparticle treatment decreases serum TNF-α levels ...................... 88

Curcumin nanoparticle treatment decreases AMPK alpha phosphorylation but not

MAPK or apoptotic signaling ......................................................................... 89

Curcumin nanoparticle treatment decreases MCT-induced increases in oxidative

stress signaling ............................................................................................. 89

Discussion.................................................................................................................. 90

CHAPTER IV ............................................................................................................... 102

GENERAL DISCUSSION......................................................................................... 102

Effects of CeO2 nanoparticle administration on monocrotaline-induced RV

hypertrophy in Sprague-Dawley rats ........................................................... 103

Effects of curcumin nanoparticle administration on monocrotaline-induced right

ventricular hypertrophy in Sprague Dawley rats .......................................... 104

SUMMARY ............................................................................................................... 105

FUTURE DIRECTIONS ........................................................................................... 109

References .................................................................................................................. 112

Appendix ..................................................................................................................... 124

x

Letter from Institutional Research Board .................................................................. 124

Curriculum Vitae .......................................................................................................... 125

xi

LIST OF TABLES

Table 2-1. The updated clinical classification of pulmonary hypertension from Dana

point, 2008. .............................................................................................................. 10

Table 2-2. World Health Organization Functional Class of PAH. .................................. 11

Table 3-1. Cerium oxide nanoparticle treatment attenuates monocrotaline-induced

increases in right ventricular remodeling. ................................................................. 59

Table 3-2. Body and organ weight for control, MCT only and MCT + Cur NP rats

collected 4 weeks after injection of MCT (60mg/kg). ................................................ 94

xii

LIST OF FIGURES

Figure 2-1.The illustration shows visual examples of the size and the scale of

nanotechnology........................................................................................................ 20

Figure 2-2.The fluorite structure of cerium oxide. .......................................................... 22

Figure 2-3. Curcuma longa plant. Inserts show the flower (a.), rhizome (b.) and turmeric

powder(c.). ............................................................................................................... 26

Figure 2-4.Structure of curcumin (diferuloylmethane) ................................................... 27

Figure 2-5.Molecular targets of curcumin. ..................................................................... 28

Figure 3-1.Characterization of CeO2 nanoparticles size. .............................................. 60

Figure 3-2.CeO2 nanoparticle treatment improves pulmonary flow. .............................. 61

Figure 3-3.CeO2 nanoparticle administration diminishes pulmonary artery remodeling. 62

Figure 3-4.CeO2 nanoparticle treatment attenuates MCT-induced increases in right

ventricle wall thickness. ........................................................................................... 63

Figure 3-5.CeO2 nanoparticle treatment attenuates MCT-induced cardiac remodeling. 64

Figure 3-6.PAH associated changes in cardiac function in the MCT only animals. ....... 65

Figure 3-7.CeO2 nanoparticle administration attenuates monocrotaline-induced

increases in cardiomyocyte cross sectional area and cardiac fibrosis. .................... 66

Figure 3-8.MCT induced increases in RV fibronectin and MHC-beta are attenuated with

cerium oxide nanoparticle treatment. ....................................................................... 67

Figure 3-9.CeO2 nanoparticle treatment decreases the incidence of superoxide levels in

MCT-induced RV hypertrophy. ................................................................................ 68

Figure 3-10.Cerium oxide nanoparticle treatment decreases MCT-induced increases in

protein nitration and carbonylation. .......................................................................... 69

xiii

Figure 3-11.Cerium oxide nanoparticle treatment decreases the MCT-induced increases

in AMPK-alpha, ERK1/2 and JNK phosphorylation. ................................................. 70

Figure 3-12. Cerium oxide nanoparticle treatment decreases the MCT induced oxidative

stress associated phosphorylation of HSP-27 and NF-kB p50. ............................... 71

Figure 3-13. Alterations in serum protein biomarkers with MCT and MCT + CeO2

nanoparticle treatment. ............................................................................................ 72

Figure 3-14.CeO2 nanoparticles treatment decreases the incidence of TUNEL positive

nuclei in MCT induced RV hypertrophy. ................................................................... 73

Figure 3-15.Cerium oxide nanoparticle treatment is associated with diminished pro-

apoptotic signaling. .................................................................................................. 74

Figure 3-16.Optical characterization of curcumin nanoparticles. ................................... 95

Figure 3-17.Curcumin nanoparticle treatment improves MCT-induced decreases in

pulmonary artery flow. .............................................................................................. 96

Figure 3-18.Curcumin nanoparticle treatment attenuates PAH induced increases in RV

anterior free wall thickness. ..................................................................................... 97

Figure 3-19.Curcumin nanoparticle treatment decreases PAH-induced cardiac

remodeling. .............................................................................................................. 98

Figure 3-20. Curcumin nanoparticle treatment diminished MCT-induced increases in

inflammatory cytokines. ........................................................................................... 99

Figure 3-21. Curcumin nanoparticle treatment alters AMPK-α activation but does not

change MAPK or apoptotic signaling. .................................................................... 100

Figure 3-22.Curcumin nanoparticle treatment attenuates PAH-associated increases in

heat shock protein and protein nitrosylation. .......................................................... 101

xiv

Figure 4-1. Possible role of CeO2 nanoparticles in attenuation of MCT-induced RV

hypertrophy following pulmonary arterial hypertension. ......................................... 107

Figure 4-2. Possible role of Cur NP in cardiac remodeling following pulmonary arterial

hypertension. ......................................................................................................... 108

xv

LIST OF ABBREVIATIONS

AALAC American Association of Laboratory Animal Care

ALK1 Activin receptor like kinase type

AMP Adenosine monophosphate

AMPK Adenosine monophosphate activated kinase

ANOVA One-way analysis of variance

ATP Adenosine triphosphate

Bax Bcl-2-associated X protein

Bcl2 B-cell lymphoma 2

BMPR2 Bone morphogenetic protein receptor 2

BSA Bovine serum albumin

CeO2 Cerium oxide

Cur NP Curcumin nanoparticles

ECL Enhanced chemiluminescence

ELISA Enzyme-linked immunosorbent assay

ERK Extracellular signal-regulated kinase

GAPDH Glyceraldehyde 3-phosphate dehydrogenase

HSP Heat shock protein

i.p. Intra peritoneal

IL-1 Interleukin-1

JNK Jun-N-terminal kinase

MAPK Mitogen activated protein kinase

MCT Monocrotaline

xvi

MHC Myosin heavy chain

NF-kB Nuclear factor kappa-light-chain-enhancer of

activated B cells

NT Nitrotyrosine

PAH Pulmonary arterial hypertension

PBS Phosphate buffered saline

PBST Phosphate buffered saline with 0.5% Tween

PDE-5 Phosphodiesterase

PLAX Parasternal long-axis

PSAX Parasternal short-axis

PVR Pulmonary vascular resistance

ROS Reactive oxygen species

s.c. Subcutaneous

TBS Tris buffered saline

TBST Tris buffered saline with 0.5% Tween

TNF-α Tumor necrosis factor-alpha

TUNEL TdT-mediated dUTP nick end labeling

xvii

ABSTRACT

THE USE OF CERIUM OXIDE AND CURCUMIN NANOPARTICLES AS THERAPEUTIC AGENTS FOR THE TREATMENT OF

VENTRICULAR HYPERTROPHY FOLLOWING PULMONARY ARTERIAL HYPERTENSION

Pulmonary arterial hypertension (PAH) is a progressive and fatal disease

characterized by inflammation, increased pulmonary vascular resistance, right

ventricular failure and premature death. Monocrotaline (MCT) has been used to induce

PAH in laboratory rats. Previous in vitro and in vivo work suggested that cerium oxide

(CeO2)-and curcumin nanoparticles exhibit anti-inflammatory activity; however, it is

unknown if these materials are effective for the treatment of PAH induced cardiac

hypertrophy.

To determine the efficacy of CeO2 nanoparticle treatment in preventing MCT-

induced RV hypertrophy, male Sprague Dawley rats were divided into one of three

groups (control, MCT, or MCT + CeO2 nanoparticle, n=6/group). MCT was administered

at a dosage of 60mg/kg subcutaneously. CeO2 nanoparticle treated animals received

0.1mg/kg via tail vein injection twice a week for two weeks. Echocardiography was

performed before and at the completion of the study. CeO2 nanoparticles treatment

attenuated MCT-induced increases in RV mass, cardiomyocyte cross sectional area,

and diminished cardiac oxidative stress levels. These changes in cardiac structure and

oxidative stress were accompanied by decreased mitogen activated protein kinase

phosphorylation, diminished heat shock proteins expression, improvements in the

Bax/Bcl-2 ratio, and diminished caspase-3 activation.

xviii

To investigate the efficacy of curcumin nanoparticle (Cur NP) administration in

preventing PAH-induced cardiac remodeling after pulmonary arterial hypertension, rats

were divided into one of three groups (control, MCT, or MCT + Cur NP treatment,

n=6/group). MCT was injected at a dosage of 60mg/kg subcutaneously. Nanoparticle

treated animals received Cur NP (50mg/kg i.p.) for seven days. Cur NP treatment

diminished MCT-induced increases in pulmonary arterial pressures, RV thickness and

myocardial fibrosis. These changes in cardiac structure were accompanied by down

regulation of myosin heavy chain (MCH-β) and fibronectin protein. Cur NP treatment

also reduced expression of tissue tumor necrosis factor (TNF-α) and interleukin-1β (IL-

1β) mRNA levels, decreased heat shock protein expression and reduced the amount of

protein nitrosylation.

Taken together, the results of these studies suggest that administration of

CeO2/curcumin nanoparticles may attenuate the degree of cardiac remodeling typically

observed following the development of pulmonary arterial hypertension in the laboratory

rat. Additional studies to investigate the mechanism(s) underlying these changes may

be warranted. (WC: 349)

1

CHAPTER I

INTRODUCTION

Pulmonary arterial hypertension (PAH) is an increase in mean pulmonary arterial

pressure >25 mm Hg at rest, or >30 mm Hg during exertion. PAH is characterized by

vascular proliferation and remodeling of the small pulmonary arteries, which results in a

progressive increase in pulmonary vascular resistance. The increased resistance can

cause pressure overload and lead to right ventricular (RV) hypertrophy, which if allowed

to proceed unchecked can terminate in heart failure and death [1]. The prognosis of

patients with PAH remains poor, with approximately 10%–15% mortality within 1 year of

the diagnosis. The median life expectancy from the time of diagnosis in patients with

idiopathic PAH without targeted treatments is 2.8 years, with 1-year, 3-year, and 5-year

survival rates of 68%, 48%, and 34%, respectively [2]. As of yet, a cure for PAH has not

yet been found. Limitations in evaluating treatment approaches for PAH include its

rarity, the inclusion of small number of patients in clinical trials, and issues regarding the

use of placebo controlled trials in a disease with high mortality if left untreated [3].

The current treatment options for PAH include prostacyclin and prostacyclin

analogues (e.g., Epoprostenol, Treprostinil, Iloprost), Endothelin receptor antagonists

(e.g., Bosentan, Ambrisentan) and phosphodiesterase (PDE-5) inhibitors (e.g.,

Sildenafil, Tadalafil, Vardenafil), as well as traditional background therapy with diuretics

(e.g., Furosemide), calcium-channel blockers (e.g., Dilitiazem, Nifedipine) and

anticoagulation agents (e.g., warfarin) [4]. Even with modern medical therapy, most

2

patients experience progression of their disease and many are referred for lung

transplantation [5].

Increases in oxidative stress due to excessive levels of reactive oxygen species

(ROS), e.g., superoxide anion (•O2-), hydroxyl radical (•OH), and hydrogen peroxide

(H2O2) have been implicated in the pulmonary and cardiac dysfunction [6]. It is well

known that ROS may damage tissues either by direct oxidation of key biological

molecules (i.e., lipid peroxidation, DNA damage) or by inducing the activation of

transcription factors, e.g., nuclear factor-kB (NF-kB) leading to apoptosis [7]. Recent

studies have shown that ROS may be produced in the lung tissue of patients with

severe PAH as a consequence of tissue hypoxia or through the activation of

inflammatory mediators [8]. Indeed, inflammation has been shown to play a significant

role in PAH associated with connective tissue diseases and HIV infection through the

activation of inflammatory cascades and increased production of inflammatory cytokines

(TNF-α,IL-1β,IL-6) [9]. It is thought that excessive oxidative stress and increased tissue

levels of inflammatory mediators can damage small pulmonary arterioles, which can

result in an increase in pressure overload and right heart failure [10].

Monocrotaline (MCT) is a toxic pyrrolizidine alkaloid present in the plant

Crotalaria spectabilis that can cause injury to the vasculature of the lungs and

pulmonary arterial hypertension in animals [11]. Lung injury following MCT exposure is

thought to occur after MCT processing in the liver by cytochrome P450

monooxygenases and the conversion of MCT to pyrrolic metabolites, which travel via

3

the circulation to the lung [12]. In Sprague Dawley rats a single dose of 60 mg/kg MCT

induces a rapid intrapulmonary inflammatory response, which increases inflammatory

monocytes in the adventitia of pulmonary resistance arterioles within 8-16 h after

injection [13]. Muscularization of nonmuscular arterioles leading to increased medial

layer thickness is detectable as early as 3 and 7 days post injection and reaches

significance by 10 and 14 days, resulting in increased pulmonary vascular resistance

and pulmonary arterial hypertension. RV hypertrophy is apparent by 21 days and

becomes progressively more severe if left untreated [14]. Whether strategies designed

to diminish ROS levels and inflammatory mediators are efficacious in improving MCT

induced PAH and RV function are not well understood.

Cerium is a rare earth element of the lanthanide series, having a fluorite lattice

structure in which the unit cell, consisting of cerium atoms arranged face-centered with

oxygen atoms, are located within the cell in the tetrahedral interstices. Most of the rare

earth elements exist in trivalent state (+3), but the cerium atom can exist in either Ce+3

(fully reduced) or +4 (fully oxidized) state [15]. Due to its redox capacity, cerium oxide

(CeO2) is an excellent oxygen buffer causing simultaneous oxidation of hydrocarbons

as well as the reduction of oxides of nitrogen, thus reducing the emissions from the

diesel exhaust as fuel additive [16]. CeO2 can exhibit oxygen vacancies or defects in

lattice structure through the loss of oxygen or its electrons. These defects in CeO2

structure are dynamic and can be altered by changes in temperature, the presence of

ions, or variations in the partial pressure of oxygen [17]. Recent work has demonstrated

that decreases in CeO2 nanoparticle size is associated with the formation of oxygen

4

vacancies [18] and increased catalytic activity [19]. Recently, CeO2 nanoparticles have

been used to modulate oxidative stress in biological systems by acting as free radical

scavengers [20]. In vitro studies have demonstrated that CeO2 nanoparticles are able to

rescue HT22 cells (a hippocampus neuronal cell line) from oxidative stress-induced cell

death [21] and protect normal human breast cells from radiation-induced apoptotic cell

death [22]. In vivo studies have shown that CeO2 nanoparticles treatment can attenuate

progressive cardiac dysfunction and remodeling by inhibition of myocardial oxidative

stress, endoplasmic reticulum stress and inflammation [23]. Whether treatment with

CeO2 nanoparticles can help to prevent cardiac dysfunction following the development

of PAH is currently unclear.

Curcumin is a hydrophobic polyphenol compound extracted from turmeric, the

powdered rhizome of Curcuma longa [24]. Turmeric has been used in Ayurvedic

medicine for centuries to treat inflammatory diseases [25]. Curcumin has been shown to

exhibit anti-oxidant [26], anti-inflammatory [27], anti-microbial, and anti-carcinogenic

activities [28]. The anti-inflammatory activity of curcumin is associated with inhibition of

cyclooxygenase [29] which can block the activation of the NF-kB and activator protein-

1(AP-1) transcription factors [30]. Studies have shown that blockade of NF-kB may

contribute to curcumin dependent-inhibition of the TNF-α, IL-1β, and IL-6 inflammatory

cytokines [31]. Furthermore, curcumin significantly inhibiting the generation of ROS and

nitride radical generation by activated macrophages [32]. The free radical scavenger

activity of curcumin has also been shown to protect against cyclophosphamide and

parquat induced lung injury [33]. It is thought that curcumin treatment is associated with

5

decreased•O2- levels and lipid peroxidases activity. In addition, curcumin exposure has

also been shown to increase the amount antioxidant enzymes, e.g. superoxide

dismutase and catalase, in the heart [34]. Finally, recent work has demonstrated that

curcumin can inhibit the hypertrophy of cultured cardiomyocytes and prevent the onset

of heart failure in rat models of hypertensive heart disease and myocardial infarction

[35].

To date, no studies in either animals or humans have discovered any toxicity

associated with the use of curcumin even at very high doses (500-8000 mg/day for 3

months) [36]. In spite of its therapeutic potential, the utilization of curcumin for the

treatment of various diseases has been hindered due to its fast metabolism and poor

water solubility [37, 38]. Efforts to circumvent these problems include the development

of curcumin nano-formulations using liposomes, polymer nanoparticles, and other

synthetic materials [39]. Recent work has shown that curcumin nano-emulsions

improved oral bioavailability and therapeutic efficacy in targeted cancer therapy [40, 41].

Other work has shown that liposome-encapsulated curcumin is more effective than free

curcumin in suppression of pancreatic carcinoma [42]. Recent studies have also

reported that nano curcumin can inhibit NF-kB activation and down regulate the

expression of the pro-inflammatory cytokines TNF-α, IL-6, and IL-8 [43]. Whether

treatment with curcumin nanoparticles can help to prevent cardiac dysfunction following

the development of PAH is currently unclear.

6

SPECIFIC AIMS

Right ventricular failure is the leading cause of death in patients with PAH [44].

PAH is a progressive, fatal disease characterized by an increased pulmonary vascular

resistance that causes pressure overload of the RV, leading to RV hypertrophy and

premature death [45]. Monocrotaline (MCT) is a pyrrizolidine alkaloid that causes

increases in oxidative stress, inflammation and fibrosis of pulmonary vasculature which

can lead to pulmonary arterial hypertension and RV hypertrophy in laboratory rats [46].

The objective of this study is to develop new strategies for the treatment of

pulmonary arterial hypertension and the resultant RV hypertrophy. Recent studies have

shown that CeO2 nanoparticles exhibit anti-oxidant properties that may be useful for the

treatment of chronic inflammation [47]. CeO2 nanoparticles have shown to increase the

life span of neuronal cell lines [20], and to protect cultured cells against the damaging

effects of radiation [19]. Curcumin has demonstrated anti-oxidant and anti-inflammatory

properties suggesting to some that this molecule may be useful to treat pulmonary and

cardiovascular diseases [48]. In vitro, curcumin nanoparticles (Cur NP) have been

shown to block NF-kB activation and down regulate the expression of the pro-

inflammatory cytokines TNF-α, IL-6, and IL-8 [43].

The central hypothesis of this research is that CeO2 and curcumin nanoparticle

administration will be associated with decreases in inflammatory oxidative stress,

diminished pulmonary arterial hypertension and an attenuation of right ventricular

hypertrophy following animal exposure to MCT.

7

To test our central hypothesis and accomplish the objective of this study two specific

aims will be pursued:

Specific aim I: To investigate if CeO2 nanoparticle administration is able to attenuate

monocrotaline-induced pulmonary arterial hypertension and right ventricular

hypertrophy in Sprague Dawley rats.

Specific aim II: To investigate if systemic administration of Cur NP is able to diminish

monocrotaline-induced pulmonary arterial hypertension and right ventricular

hypertrophy in Sprague Dawley rats.

8

CHAPTER II

REVIEW OF LITERATURE

The following chapter presents a review of the current literature pertinent to the

present study. Specifically, the following areas will be addressed: pulmonary arterial

hypertension, RV hypertrophy, animal models of PAH, diagnosis of PAH, current

strategies for treatment of PAH, introduction to nanotechnology and cerium oxide

(CeO2) nanoparticles, biological effects of CeO2 nanoparticles, toxic effects of CeO2

nanoparticles, curcumin and its applications, the safety and bioavailability of curcumin.

2.1 Pulmonary arterial hypertension (PAH)

Pulmonary arterial hypertension (PAH) is caused by restricted flow through the

pulmonary arterial circulation resulting in increased pulmonary vascular resistance

which can lead to right heart failure [49]. The hemodynamic definition of PAH is rise in

mean pulmonary arterial pressure >25 mm Hg at rest or >30 mm of Hg during exercise

[10]. Elevated pulmonary pressure can result from a decrease in arterial lumen diameter

through a combination of: a) endothelial dysfunction and increased contractility of small

pulmonary arteries, b) proliferation and remodeling of endothelial and smooth muscle

cells, and c) in situ thrombosis [50].

PAH may occur primarily as a disease or secondary to various disease

conditions such as connective tissue diseases, pulmonary and cardiac diseases,

9

infection and inflammation. The nonspecific nature of the symptoms associated with the

disease often delays accurate diagnosis, making it difficult to diagnose and treat.

The 4th World Health Organization symposium on pulmonary hypertension held

in 2008 at Dana Point, California served to update the classification of PAH and is used

as a guide for the clinical assessment and treatment.

WHO Classification of PAH:

1. Pulmonary arterial hypertension 1.1 IPAH 1.2 Heritable

1.2.1 BMPR2 1.2.2 ALK1 (With or without hereditary hemorrhagic telangiectasia) 1.2.3 Unknown

1.3 Drug and Toxin induced 1.4 Associated with

1.4.1 Connective tissue diseases 1.4.2 HIV infection 1.4.3 Portal hypertension 1.4.4 Congenital heart diseases 1.4.5 Schistosomiasis 1.4.6 Chronic hemolytic anemia

1.5 Persistent pulmonary hypertension of the newborn 1.6 Pulmonary veno-occlusive disease (PVOD) and/ or Pulmonary capillary

hemangiomatosis (PCH) 2. Pulmonary hypertension owing to left heart disease

2.1 Systolic dysfunction 2.2 Diastolic dysfunction 2.3 Valvular disease

3. Chronic obstructive pulmonary disease 3.1 Chronic obstructive pulmonary disease 3.2 Interstitial drug disease 3.3 Other pulmonary diseases with mixed restrictive and obstructive pattern 3.4 Sleep disordered breathing 3.5 Chronic exposure to high altitude 3.6 Developmental abnormalities

4. Chronic thromboembolic pulmonary hypertension (CTEPH) 5. Pulmonary hypertension with unclear multifactorial mechanisms

10

5.1 Hematologic disorders : Myelo-proliferative disorders, splenectomy 5.2 Systemic disorders: Sarcoidosis, pulmonary Langerhans cell histiocytosis:

lymphangioleiomyomatosis, neurofibromatosis, vasculitis 5.3 Metabolic disorders: glycogen storage disease, Gaucherdisesase, thyroid

disorders 5.4 Others: tumoral obstruction, fibrosingmediastinitis, chronic renal failure on

dialysis ALK1 = activin receptor-like kinase type-1; BMPR2 = bone morphogenetic protein receptor type=2; HIV = human immunodeficiency virus; IPAH=Idiopathic pulmonary arterial hypertension Table 2-1. The updated clinical classification of pulmonary hypertension from

Dana point, 2008. Adapted from Simonneau et al. 2009 [45], Ryan JJ et al., 2012 [51].

Symptoms associated with PAH:

The early phases of PAH may be asymptomatic or associated with non-specific

symptoms. Patients usually present with dyspnea exacerbated by exertion, fatigue,

chest pain, and palpitations. Advanced PAH may present as right side heart failure,

dizziness, syncope, edema or cyanosis [52].

The normal pulmonary vasculature is a low resistance, high flow system. In PAH,

the vessel occlusion leads to a persistent elevation in pulmonary pressure that can lead

to right heart failure. The progressive reduction in cardiac output results in exercise

intolerance, shortness of breath, fluid retention, and possible death from right heart

failure [53].

11

Clinical presentation

Class I: Patients with PAH that causes no limitations on physical activities. Routine

physical activity does not cause increased dyspnea, chest pain, fatigue, or pre-syncope.

Class II: Patients with PAH that causes mild limitations on physical activities. Patients

are comfortable at rest but routine physical activity results in increased dyspnea, chest

pain, fatigue, or syncope.

Class III: Patients with PAH that have marked limitations on physical activities. Patients

are comfortable at rest, but less than routine physical activity results in dyspnea, chest

pain, fatigue, or palpitations.

Class IV: Patient with PAH that results in the inability to perform any physical activity

without symptoms. These patients may have signs of right heart failure. Dyspnea with or

without fatigue may be present at rest, and symptoms are increased by any physical

activity.

Table 2-2. World Health Organization Functional Class of PAH. Adapted from

Jeanne Houtchens et al., 2011[5].

2.2 Epidemiology

A national study examining PAH patients between 1980 to 2002 [54] indicated

that PAH affects just over 15 per million people [55]. The mean age of those affected

was 53±14 years at the time of diagnosis, of which 79.5% were women. The mean

12

duration between onset of symptoms and disease diagnosis was 2.8 years [56]. The

Registry to EValuate Early And Long-term PAH disease management (REVEAL

Registry) reported that IPAH that occurs with neither a family history of PAH nor an

identified risk factor associated clinical condition and that IPAH accounts for > 40% of all

PAH diagnoses in USA [56].

PAH associated with underlying systemic disease is present in approximately

50% of those diagnosed with PAH. PAH oftentimes develops as a consequence of

chronic obstructive pulmonary diseases, hypoxia, congenital heart disease and portal

hypertension. Connective tissue diseases such as scleroderma account for 11-35% of

PAH cases [57] while 1 to 10% of patients with portal hypertension go on to develop

PAH [55].

Although there are many factors involved in the pathogenesis of PAH, recent

data has suggested that increases in oxidative stress and inflammation may be a

primary driver of PAH development and progression of PAH [9]. Oxidative stress is most

commonly defined as an imbalance between the production and scavenging of reactive

oxygen species (ROS) and reactive nitrogen species (RNS) [58]. This imbalance can

alter cellular homeostasis through either direct oxidative and often irreversible damage

of basic cellular components (proteins, lipids, and nucleic acids), which can impair cell

function and lead to cellular apoptosis, tissue damage, and vasculopathy.

13

2.3 Right ventricular hypertrophy

Myocardial hypertrophy is a compensatory mechanism where the cardiac tissue

adapts to increased work load. In PAH, elevations in pulmonary vascular resistance

(PVR) lead to the development of pressure overload and RV hypertrophy [59].

Depending on the degree or duration of increased work load, ventricular hypertrophy

may progress from a compensatory state to impaired systolic or diastolic function and

heart failure. This transition is characterized by alterations in extracellular matrix

composition, energy metabolism, changes in myofilament protein expression,

dysregulation of Ca+2 handling, and the activation of different signal transduction

pathways [60].

Molecular markers of cardiac hypertrophy

Myosin and myofibrillar ATPase activity are reduced in the hypertrophied

myocardium. In the pathological hypertrophy there is a shift from α-MHC to β-MHC and

from cardiac to skeletal actin isoform expression [61]. The α-MHC form has a three to

seven fold greater ATPase activity than β-myosin. It is thought that an increase in the

abundance in β-MHC increases the efficiency of force development as it requires less

ATP to develop the same amount of muscle tension [62]. RV myocyte hypertrophy also

stimulates the expression of thyroid degrading enzyme D3 which functions to reduce

cellular metabolism [63].

14

Oxidative stress in RV hypertrophy

It is well established that elevations in ROS may be related to the development of

the cardiac hypertrophy, changes in blood vessel structure and function, and

inflammation seen with PAH [64]. Increased ROS levels have been shown to stimulate

myocardial growth, matrix remodeling and induce cellular apoptosis [65]. It is thought

that increases in NADPH oxidase, xanthine oxidase and nitric oxide synthase activity

are a major source of ROS in PAH [66]. ROS also have potent effect on the

extracellular matrix, stimulating increased accumulation of fibronectin and collagen and

activating the matrix metalloproteinases [67, 68].

2.4 Animal models

The etiology and molecular events associated with PAH have been widely

studied using animal models. The two most common animal models are the use of

monocrotaline to induce PAH and the chronic hypoxia model of PAH.

2.4.1 Monocrotaline injury model

Monocrotaline (MCT) is a pyrrolizidine alkaloid from the seeds of Crotalaria

spectabilis. The MCT model was introduced more than 40 years ago by Lalich and co-

workers [69]. In this model, PAH is typically induced by a single injection of MCT (60

mg/kg intraperitoneal or subcutaneous injection). The reactive metabolite MCT pyrrole

is bioactivated in the liver by CYP3A4 [70], which cause pulmonary mononuclear

vasculitis and severe pulmonary vascular disease [71]. The MCT rat model is widely

15

used given its technical simplicity, reproducibility, and low cost compared to other

models.

2.4.2 Chronic hypoxia model

Exposure of animals to low levels of oxygen results in alveolar hypoxia. A

reduction of the alveolar oxygen pressure to <70 mm Hg elicits strong pulmonary

arterial vasoconstriction [72]. In the laboratory chronic exposure of animals to hypobaric

hypoxia has been used to induce pulmonary vascular remodeling leading to PAH [73].

This model is widely used because it is very predictable and reproducible within a

selected animal strain. One limitation of this model is that the responses are significantly

affected by age as the response is much greater in immature animals than in adults

[74].

2.5 Diagnosis

A high index of suspicion, a meticulous history and a careful physical

examination are paramount to the diagnosis of PAH. Suspicion is increased by the

presence of increasing dyspnea on exertion in a patient [75]. A comprehensive

evaluation of pulmonary function is necessary for the accurate diagnosis of PAH. Other

diagnostic tools include echocardiography, and serological tests to examine for markers

of connective tissue remodeling [76].

16

2.5.1 Six-Minute-Walk Test

The 6-min-walk test is a sub-maximal exercise test in which the patient walks as

far as possible in 6 min. During this test, oxygen saturation, heart rate, and distance

walked are measured. The 6-min-walk test is oftentimes used in the initial patient

workup to assess exercise performance and predict prognosis [77].

2.5.2 Echocardiography

If PAH is suspected, transthoracic echocardiography is used to evaluate the right

heart hemodynamics including pulmonary arterial pressure, tricuspid regurgitation

velocity, right heart chamber dimensions, interventricular septum width, RV wall

thickness, and whether the pulmonary artery is dilated [78]. ECG may provide

suggestive or supportive evidence of PAH by demonstrating RV hypertrophy and right

atrial dilatation.

2.5.3 Cardiac magnetic resonance and high resolution computed tomography

In addition to echocardiography, cardiac magnetic resonance imaging is often

employed for the assessment of PAH since it can provide a direct evaluation of RV size,

morphology, and function, while it also allows for a non-invasive assessment of stroke

volume, cardiac output, pulmonary artery distensibility, and RV mass [79]. Similar to

magnetic resonance imaging, high-resolution computed tomography is another non-

invasive technology that is used to provide detailed views of the lung parenchyma for

the diagnosis of interstitial lung disease and emphysema [80].

17

2.5.4 Right heart catheterization

Right heart catheterization is required to confirm the diagnosis of PAH and to

assess the severity of the hemodynamic impairment [81]. Right-heart catheterization is

used to directly measure pulmonary-artery pressure and for the estimation of pulmonary

vascular resistance [57].

2.6 Current strategies for treatment of PAH

The first line therapy for PAH is supportive health care consisting of oxygen

supplementation, administration of calcium channel blockers and diuretics, and

recommendations to avoid physical exertion [82].

Prostacyclin therapy

Prostaglandin I-2 is a metabolite of arachidonic acid that is produced by the

vascular endothelium. It is a potent vasodilator, inhibits platelet aggregation, and

exhibits anti proliferative effects [83]. One of the most successful strategies for PAH

treatment has been to augment endogenous prostacylin production with exogenous

prostanoids [10]. Intravenous prostacylin (epoprostenol) for the treatment of PAH was

approved by the FDA in 1995 and has been shown to decrease pulmonary vascular

resistance, increase cardiac output, and improve life expectancy [84]. Other drugs

similar to epoprostenol include Iloprost, which is inhaled, treprostinil which is taken

subcutaneously, and the oral agent beraprost.

18

Endothelin-A receptor antagonists

Endothelin-1 is a vasoconstrictor and smooth muscle mitogen that is over

expressed in the lungs of patients with PAH [85]. Bosentan and ambrisentan are FDA

approved endothelin receptor antagonists commonly used for the treatment of PAH.

Bosentan was approved in 2001 and functions as a combined Endothelin-A and

Endothelin-B receptor antagonist. Bosenten has been found to decrease pulmonary

vascular resistance and increase cardiac output in PAH patients [86]. Ambrisentan was

FDA approved in 2007 and is available as once a day oral therapy only for idiopathic

PAH, heritable PAH and connective tissue disease-PAH [87]. Ambrisentan blocks only

the Endothelin-A receptors and similarly to bosentan has been shown to significantly

decrease pulmonary vascular resistance in PAH patients [87].

Phosphodiesterase-5 (PDE-5) inhibitors, calcium channel blockers and

antioxidants

Inhibition of the cGMP-degrading enzyme phosphodiesterase type-5 results in

vasodilatation through the NO/cGMP pathway [88]. Since the pulmonary vasculature

contains substantial amounts of phosphodiesterase type-5 enzyme, the potential clinical

benefit of phosphodiesterase type-5 inhibitors for the treatment of PAH appear to be

well justified [89]. Currently sildenafil and tadalafil are FDA approved oral PDE-5

inhibitors for the treatment of PAH. Sildenafil, approved in 1998, is typically taken three

times daily orally [90]. Tadalafil, approved in 2003, is available as once daily oral

therapy for idiopathic and connective tissue disease PAH [91].

19

McLaughlin and colleagues demonstrated that the calcium channel blockers

nifedipine and diltiazem can be used to diminish pulmonary vascular resistance and

prolong PAH patient survival [92]. In rats, compounds with antioxidant properties such

as N-acetylcysteine [93], resveratrol [94], superoxide dismutase [95, 96] SOD mimetic

tempol [97] and EUK-134 [98] have been found to inhibit PAH and or/ RV dysfunction.

2.7 Introduction to Nanotechnology

Nanotechnology is study of manipulating matter on an atomic and molecular

scale [99]. The National Nanotechnology Initiative (NNI) defines nanoparticles as

particulate matter that range in size between 1 and 100 nm (Figure 2-1). Nanomaterials,

unlike their bulk counterparts, oftentimes exhibit unique electronic, optical and catalytic

properties [100].

20

Figure 2-1.The illustration shows visual examples of the size and the scale of

nanotechnology. (Adopted from www.nano.gov )

Recent advances in nanotechnology have resulted in the development of various

engineered nanomaterials including carbon-based nanotubes, C60 -Bucky balls, metal

oxide nanoparticles, and the nano-encapsulation of drugs [101]. Nanoparticles, given

their large surface to volume ratio, are characterized by increased surface reactivity

[102].

Nanomedicine is the application of nanotechnology to medicine. Nanomedicine

includes the development of nanoparticles and nanostructured surfaces as well as

nanoanalytical techniques for the diagnosis and treatment of disease. Nanomaterials

http://www.nano.gov/

21

used in medicine include quantum dots, liposomes, multifunctional constructs and gold

nanoparticles [103]. It is thought that nanotechnology will contribute significantly to the

“find, fight, and follow” concept of early diagnosis, therapy and follow-up in medicine

and that nanotechnology will be a key contributor to the future of medical care [104].

2.8 Cerium oxide nanoparticles

Cerium has several unique properties among the rare earth elements and is used

in the production of oxide fuel cells, ultraviolet absorbents, oxygen sensors, and

automotive catalytic converters [105]. The cerium atom can easily transition from either

the +3 (fully reduced) or +4 (fully oxidized) state in several types of redox reactions [15],

which allows it to act as a catalyst [16].

Ce+3 Ce+4 + e-

Ce+3+OH. Ce+4+OH-

Ce+4+O2.- Ce+3 +O2

The oxidation state of CeO2 can change in response to alterations in

environmental temperature, the presence of other ions, and oxygen partial pressure

[106]. Investigations of nanocrystalline cerium oxide (CeO2) have demonstrated an

increase in the Ce+3valance state and radical scavenging ability with decreasing particle

size [102].

22

Figure 2-2.The fluorite structure of cerium oxide. (Adopted from Ali Bumajdad et al.,

2009).

Recently, several researchers have begun to investigate the use of CeO2

nanoparticles for biomedical purposes. Rzigalinski and coworkers demonstrated that

CeO2 nanoparticles smaller than 20 nm in size were able to prolong the lifespan of

cultured neuronal cells, with some cultures remaining still viable even after 6-8 months

[107]. Chen and colleagues reported that nanoceria particles prevented increases in

cellular ROS levels in primary rat retina cells and that the use of nanoceria in vivo

prevented loss of vision due to light induced degeneration of photo receptor cells in

albino rats [106]. Taken together, these data suggested that nanoceria may be useful

for preventing ocular degeneration. Schubert and coworkers showed that cellular

treatment with cerium or yttrium oxide nanoparticles was able to rescue HT22 cells from

oxidative stress induced cell death by functioning as antioxidants [21].

23

Recent in vivo experiments conducted by Niu and colleagues reported that CeO2

nanoparticles diminished the degree of cardiac dysfunction and remodeling in MCP-1

transgenic mice by attenuating the development of myocardial and ER oxidative stress

[23]. Similarly, CeO2 nanoparticles have also been capable of protecting lung fibroblast

cells from radiation induced damage in vitro and in vivo using athymic nude mice [108].

It is thought that CeO2 nanoparticles function to protect cells and tissues through

their ability to scavenge ROS. Indeed, Hirst and coworkers using murine macrophage

cells (J774A.1) showed treatment with CeO2 nanoparticles reduced superoxide anion

levels and that this reduction in superoxide was associated with decreased expression

of inducible nitric oxide synthase (iNOS) and inflammation [22]. Likewise, Estevez and

colleagues, using an in vitro model of brain ischemia, demonstrated that nanoceria

treatment was associated with neuroprotective effects and that this effect was

associated with increased scavenging of peroxynitrite.

Kong and coworkers showed that nanoceria could protect against retinal

degeneration in tubby mice by decreasing ROS production, up-regulating the

expression of neuroprotective genes, and by inhibiting the activation of caspase-

induced apoptotic signaling pathways [109]. CeO2 nanoparticles have also be shown to

protect against monocrotaline-induced hepatic toxicity by virtue of their ability to

increase the amount of glutathione reductase, glutathione, and glutathione peroxidases

[110].

24

Toxic effects of CeO2 nanoparticles

The potential hazardous health effects of nanoparticles are an emerging issue

amongst toxicologists and regulatory authorities. Given the extensive use of cerium

oxide nanoparticles in the glass polishing, the electronics industry, and use as a diesel

fuel additive, interest regarding the potential toxicity of these particles has intensified

[111]. Indeed, although the literature has demonstrated the CeO2 nanoparticles can

promote cell survival under conditions of oxidative stress it is likely that these

nanoparticles also exhibit toxic effects if cellular exposure is excessive.

In vitro studies by Lin and colleagues using human branchoalveolar cells (A549

cells) demonstrated that exposure to 20-nm CeO2 nanoparticles was associated with

the generation of free radicals, increased lipid peroxidation, and cell membrane damage

that led to reduced cell viability [112]. Park and coworkers showed that CeO2

nanoparticles exposure caused the induction of ROS in cultured human lung epithelial

cells (BEAS-2B) and that increases in cellular ROS were associated with decreased

levels of intracellular glutathione (GSH) and reduced cell viability [113].

Similar findings have been demonstrated in vivo. Using male Sprague Dawley

rats, Ma and colleagues demonstrated that the intratracheal instillation of cerium oxide

nanoparticles induced acute pulmonary inflammation and chronic lung injury [114].

Follow up studies by these same researchers showed that lung injury caused by cerium

oxide nanoparticles was due to increased ceria deposition in the lung, increased

pulmonary fibrosis and an up-regulation of fibrogenic cytokines [111].

25

More recently, Nalabotu and co-workers found that the intratracheal instillation of

CeO2 nanoparticles was associated with the accumulation of ceria in the liver, the

hydropic degeneration of hepatocytes, dilatation of sinusoids, and elevations in serum

liver enzyme level [115].

2.9 Curcumin

Curcumin is a constituent of turmeric, a curry powder extracted from the plant

Curcuma longa that belongs to the Zingiberaceae family (Figure 2-3). Turmeric is native

to India and Southeast Asia, and is used in cooking to add color. The ability of curcumin

to preserve food is well known. Indian Ayurvedic medicine has used turmeric for

centuries to treat biliary disorders, anorexia, cough, diabetic wounds, liver disorders,

rheumatism, and respiratory conditions [116]. Turmeric also exhibits haemostatic-like

activity and is also anti-inflammatory in nature [117].

26

Figure 2-3. Curcuma longa plant. Inserts show the flower (a.), rhizome (b.)

and turmeric powder (c.). (Adopted and modified from Seema Singh 2007).

Curcumin is a hydrophobic polyphenol compound with a characteristic yellow

color. The chemical structure of curcumin is a bis-α, β-unsaturated β-diketone. It is

characterized by two oxy-substituted aryl moieties that are linked together through by a

seven carbon chain [118] (Figure 2-4).

27

Figure 2-4.Structure of curcumin (diferuloylmethane)

Applications of curcumin

Curcumin possesses several pharmacological properties including anti-

inflammatory [119], antioxidant [120], antimicrobial [121], chemo sensitizing [122], anti-

neoplastic [123], and wound healing activities [124]. Curcumin has proven to be

beneficial in the prevention and treatment of a number of inflammatory diseases

possibly due to its ability to inhibit the inflammatory mediators cyclooxygenase (cox-2)

and lipoxygenase-5 at the transcriptional level [125]. The free radical scavenging activity

of curcumin due to the presence of H-atom donation and resonance stabilization from

two phenolic OH groups and from the electron transfer capacity of β-diketone moiety. In

addition, curcumin also down-regulates the expression of several pro-inflammatory

cytokines including tumor necrosis factor (TNF-α), the interleukins (IL-1, IL-2, IL-6, IL-8,

IL-12) and some chemokines, most likely through inactivation of the nuclear

transcription factor NF-κB [126, 127] (Figure 2-5).

The transcription factor NF-κB is thought to play a critical role in the resistance of

cancer cells to chemo and radiation therapy as it can prevent the induction of apoptosis

[128]. In recent experiments Deeb and coworkers demonstrated that curcumin

28

sensitizes prostate cancer cells to TNF-related apoptosis inducing ligand (TRAIL)-

induced apoptosis through the inhibition of NF-κB [122]. Other data has shown that

curcumin can induce cell cycle arrest and/or apoptosis in human cancer cell lines

derived from a variety of solid tumors including colorectal, lung, breast, pancreatic and

prostate carcinoma [129].

Figure 2-5.Molecular targets of curcumin. (Adopted and modified from Bharat

B. Aggarwal et al., 2009 [28] ).

In addition to its anti-cancer properties, curcumin is also widely known to possess

potent antioxidant activity as it is able to scavenge several different types of ROS

including O2 −, OH , NO and ONOO radicals [126]. In addition, Manikandan and

colleagues have shown that exposure to curcumin can also increase the activity of

29

superoxide dismutase, catalase and glutathione peroxidases [34]. It is thought that the

antioxidant activity of curcumin is attributed to its phenolic and methoxy groups [130].

The antibacterial effects of curcumin have been reported by K.S. Parvathy and

colleagues where they showed that curcumin suppressed the growth of Streptococcus,

Staphylococuus, E.coli, and Y.enterocolitica. Ronita De and coworkers using a mouse

model demonstrated that curcumin also inhibited the growth of Helicobacter pylori both

in vitro and in vivo. Whether curcumin exhibits antibacterial activity against other strains

is currently under investigation.

Safety

Animal and human clinical studies have shown that curcumin is extremely safe

even at doses as high as 12gm/day [131]. Recent phase-1 clinical trials have shown

that curcumin is not toxic to humans when administered at 8gm/day for up to 3 months

[132]. On the basis of these studies and others [131, 133], curcumin is generally

recognized as safe (GRAS) by the United State’s FDA and has been granted an

acceptable daily intake level of 0.1–3 mg/kg body weight by the Joint FAO/WHO Expert

Committee on Food Additives, 1996 [134].

30

Bioavailability

A major limiting factor of curcumin use for biomedical purposes is its solubility

and low oral bioavailability [135, 136]. The factors responsible for the low bioavailability

of curcumin are not fully understood but are likely related to the poor absorption from

the gut, the rapid metabolism and its rapid systemic elimination [137]. The serum

concentration of curcumin has been found to peak at 1–2 h after oral intake and to

gradually decline thereafter [138]. Curcumin undergoes glucuronidation and sulfation in

the liver [139]. The metabolites of curcumin for the most part appear to lack any

pharmacological activity [28]. The addition of piperdine, which functions to inhibit the

glucronidation of curcumin, has been shown to increase curcumin bioavailability in rats

and in human subjects by at least one order of magnitude [140].

In addition to piperdine supplementation, the bioavailability of curcumin could

also be increased by protecting it from degradation. Various nano-formulations have

been formulated for this purpose including PLGA nanoparticles (Nano-CUR) [141]

liposomal nano-curcumin [42], curcumin loaded magnetic nanoparticles [142], curcumin

nano-emulsions [40], and solid lipid nanoparticles [39]. Indeed, the entrapment of

curcumin into nanoparticles led to a 9-fold increase in oral bioavailability when

compared to that observed when curcumin was administered orally in bulk form [143].

This increase in bioavailability is thought to be due to improved water solubility, a higher

release rate in the intestinal juice, enhanced permeability and absorption by the small

intestine, and increased residence time in the intestinal cavity [144]. Wang and

coworkers demonstrated that liposomal encapsulated curcumin suppressed NF-κB

31

activation and attenuated the proliferation of human pancreatic carcinoma cells [145].

Supporting this contention, Bisht and colleagues showed that nano curcumin, like its

bulk counterpart, inhibited the activation of the transcription factor NF-κB, and that this

inhibition was associated with reduced levels of pro-inflammatory cytokines (IL-6, IL-8)

and TNF-α in human pancreatic cancer cell lines [43].

3.0 Summary

In summary, this review of literature described pulmonary arterial hypertension

and RV hypertrophy. PAH is an increase in pulmonary arterial pressure due to

obliteration of small pulmonary arteries causing an increase in pressure overload on the

RV leading to RV failure and death [1, 52]. Currently, there is no cure for the patients

suffering from PAH [5]. Increased markers of oxidative stress have been found in

human as well as in animal models of PAH supporting the evidence that ROS and RNS

play a major role in the development and progression of PAH [50]. Thus far, several

antioxidants including N-acetylcysteine, resveratrol and the synthetic antioxidant EUK-

134 have been tested for their efficacy in preventing the progression of PAH in animal

models.

Cerium is a rare earth element of the lanthanide series, having a fluorite lattice

structure with oxygen vacancies or defects in the lattice structure by loss of oxygen or

its electrons. At the nanometer scale, the atomic and molecular properties of nano

materials will change. Studies have demonstrated that decreases in CeO2 nanoparticles

size are associated with the formation of more oxygen vacancies [18]. Recent studies

32

have shown that CeO2 nanoparticles have been shown to protect against cardiac

dysfunction by attenuating myocardial oxidative stress and the inflammatory process in

transgenic mice through the autoregenerative antioxidant capacity.

Curcumin, a polyphenolic compound with neuroprotective, cardio protective, anti-

oxidant and anti-inflammatory properties, has been used for centuries in Ayurveda, an

Indian traditional medicine, to treat a diversity of disorders including rheumatism, body

aches, skin diseases, wounds, intestinal worms, diarrhea, intermittent fevers, hepatic

disorders, urinary discharges, dyspepsia, and inflammation. For the past two decades,

curcumin has been extensively studied as a potent anti-oxidant due to its ability to

scavenge ROS and an anti-inflammatory agent due to its down regulation of pro

inflammatory cytokines and transcription factors [126].

Whether ceria or curcumin nanoparticles are effective for the treatment of PAH is

currently unclear.

33

CHAPTER III

The following chapter includes three different research papers describing in detail

the research experiments conducted to test our hypotheses set forth for the specific

aims I and II of this dissertation project.

PAPER 1

The following paper corresponds to the specific aim I

34

Cerium oxide nanoparticles attenuate monocrotaline-induced right ventricular

hypertrophy following pulmonary arterial hypertension

Key words:

Monocrotaline, pulmonary arterial hypertension, right ventricular hypertrophy,

cerium oxide nanoparticles

Running title:

Efficacy of cerium oxide nanoparticles on right ventricular hypertrophy following

pulmonary arterial hypertension.

35

Abstract

Introduction: Cerium oxide (CeO2) nanoparticles have been shown to exhibit

potent antioxidant activity and recent data has suggested that these materials may

attenuate oxidative stress-induced cardiomyopathy. Here, we investigate whether CeO2

nanoparticle administration can diminish the amount of right ventricular hypertrophy

developed following monocrotaline (MCT)-induced pulmonary arterial hypertension

(PAH) in the laboratory rat. Methods: Male Sprague Dawley rats (175-200 gm) were

randomly divided into control, MCT only and MCT + CeO2 nanoparticle groups (n=6).

MCT animals received a single injection of MCT 60 mg/kg subcutaneously to induce

PAH. CeO2 treated animals were given 0.1 mg/kg CeO2 nanoparticles intravenously

twice a week for 2 weeks. Echocardiography was done at the start of the study and 28

days after MCT injection to assess pulmonary, cardiac structure and function. Results:

Compared to control rats, the right ventricle weight to body weight ratio was 45% and

22% higher in the MCT and MCT + CeO2 rats, respectively (p<0.05). Echocardiography

data demonstrated that CeO2 nanoparticle treatment appeared to attenuate

monocrotaline-induced changes in pulmonary flow and increases in right ventricle wall

thickness. Immunoblotting analysis demonstrated that CeO2 nanoparticle treatment

diminished MCT-induced increases in the amount of β-myosin heavy chain and

fibronectin. CeO2 nanoparticle treated rats also exhibited diminished expression of the

MAP kinases, decreased TUNEL positive nuclei. These changes were accompanied by

improvements in the Bax/Bcl2 ratio, and diminished caspase-3 activation. Conclusion:

Taken together, these data suggest that CeO2 nanoparticle administration may

36

attenuate MCT-induced PAH associated RV cardiomyocytes apoptosis possibly via

diminishing indices of oxidative stress. (WC: 250)

37

Introduction

Right ventricular failure is the leading cause of death in patients with pulmonary

arterial hypertension (PAH) [146]. PAH is defined as an increase in mean pulmonary

arterial pressure (PAPm) >25mm Hg at rest, or >30mm Hg during exercise [55]. If

improperly managed, the median life expectancy of patients with idiopathic PAH is 2.8

years, with 1-year, 3-year, and 5-year survival rates of 68%, 48%, and 34%,

respectively [2]. Even with modern medical therapy, PAH patients oftentimes

experience disease progression and eventual referral for organ transplantation [5]. The

rat monocrotaline (MCT)-PAH model is thought to recapitulate many of the pathological

features of PAH seen in humans [147]. Recent data has suggested that the cardiac

remodeling associated with MCT induced-PAH may be mediated, at least in part, by

increases in oxidative stress [98]. Whether treatments aimed at diminishing oxidative

stress levels effective in preventing the cardiac hypertrophy seen with PAH is currently

unclear.

Cerium is a rare earth element of the lanthanide series that can cycle between

the Ce+3 (fully reduced) or Ce+4 (fully oxidized) state [15]. Recent data has suggested

that CeO2 nanoparticles can act as free radical scavengers [15] and protect H9C2

cardiomyocytes from cigarette smoke extract induced oxidative damage [148]. In vivo

studies using the monocyte chemo-attractant protein-1 (MCP-1) transgenic mouse

model of oxidative stress-induced cardiac hypertrophy have shown that CeO2

nanoparticle administration can attenuate the development of cardiac dysfunction and

remodeling [23]. Supporting these data, other work has shown that the antioxidant

38

activity of CeO2 nanoparticles can protect against monocrotaline-induced hepatic toxicity

[110]. Whether CeO2 nanoparticle administration can attenuate the development of the

RV hypertrophy seen during PAH is currently unclear.

Monocrotaline (MCT) is a toxic pyrrolizidine alkaloid present in the plant

Crotalaria spectabilis that selectively injures lung endothelial cells causing the infiltration

of monocytes, a thickening of the pulmonary arterioles and the development of PAH in

the laboratory rat [12, 13]. Here we examine if the administration of CeO2 nanoparticles

is associated with the attenuation of right ventricular hypertrophy, oxidative stress

induced ventricular remodeling following monocrotaline induced PAH. Our data suggest

that CeO2 nanoparticle treatment may be effective for counteracting the hypertrophy

seen following PAH in the laboratory rat.

39

Materials and Methods

Animal model and experimental design

All procedures were performed in accordance with the Marshall University

Institutional Animal Care and Use Committee (IACUC) guidelines, using the criteria

outlined by the Assessment and Accreditation of Laboratory Animal Care (AAALAC).

Seven week old, 175-200 gm, male Sprague Dawley rats were obtained from Hilltop

laboratories (Scottdale, PA). Rats were housed two per cage with a 12:12H dark-light

cycle and temperature maintained at 22 ± 2°C. Rats were provided food and water ad

libitum and allowed to acclimatize for at least two weeks before initiating the study.

Periodic body weight and feed intake measurements were taken throughout the

duration of the study. Rats were randomly assigned to one of three different groups:

Control (n=6), MCT only (n=6), MCT + CeO2 nanoparticle (n=6). PAH was induced by a

single injection of MCT (60mg/kg S.C.) (Sigma-Aldrich, St.Louis, MO) as described

previously [149]. Animals injected with MCT were given either CeO2 nanoparticles

(0.1mg/kg via tail vein) (NanoactiveTM CeO2 nanoparticles, NanoScale materials Inc.,

Manhattan, KS) or vehicle (deionized water) twice a week for the 1st and 2nd week of the

study. Importantly, there was no toxicity or accumulation observed in vivo at therapeutic

low doses 0.1 mg/kg and 0.5 mg/kg of CeO2 nanoparticles injected via tail vein as

reported previously [47].

40

CeO2 nanoparticle size analysis by Dynamic Light Scattering (DLS)

The measurement of particle size distribution was done using a LB-550 dynamic

light scattering (DLS) particle size analyzer (Horiba scientific, Edison, NJ) at Marshall

University. Briefly, CeO2 nanoparticles were sonicated in deionized water for two

minutes to ensure equal dispersion. Particle size was performed as outlined by the

manufacturer and measured in triplicate.

CeO2 nanoparticle analysis using atomic force microscopy (AFM)

Twenty micro liters of CeO2 nanoparticles (1µg/µl) was placed on freshly cleaved

mica (V1 mica, SPI Inc, West Chester, PA). After 10 min of incubation, the surface was

gently rinsed with deionized water to remove unbound CeO2 nanoparticles and the

surface was dried under nitrogen. Particles were imaged in noncontact mode at a

frequency of 319 kHz and a scan speed of 0.5 Hz using a Nano-R microscope (Pacific

Nanotechnology Inc., Santa Clara, CA) equipped with a TM300A noncontact probe

(SensaProbes Inc., Santa Clara, CA) at MBIC, Marshall University.

Echocardiography

Echocardiography was performed prior to the start of the study and at day 28 of

the study at an ICAEL accredited echocardiography laboratory with help of trained

echocardiography technician in University Cardiovascular services, Marshall University

as outlined previously [150]. Rats were anesthetized with an intraperitoneal injection of

41

ketamine and xylazine cocktail mixture (50 mg/kg; 4:1) and the ventral thorax area

shaved. ECG analysis was performed during the echocardiography procedure to

monitor heart rate. Echocardiography measurements were obtained with a Philips

Sonos 5500 echocardiogram system using 12-MHZ transducer. M-mode and 2-D

modalities were used to measure RV and LV wall thickness at the end of diastole using

the right parasternal long axis view with the ultrasonic beam positioned perpendicular to

the ventricular wall. Papillary muscles were used as reference point for measurements

and to assure proper position in subsequent studies. Pulmonary artery flow was

measured using pulsed wave Doppler at the pulmonary valve level while pulmonary

artery diameter was measured at the level of pulmonary out flow tract during systole

using the parasternal short axis view. An apical four-chamber view was employed to

measure end-diastolic right ventricular area. Pulsed-wave Doppler was used to

measure pulmonary artery acceleration time and flow.

Tissue processing and immunoblotting

Animals were anesthetized with ketamine-xylazine (4:1) cocktail mixture

(50mg/kg, i.p) and supplemented as necessary to achieve loss of reflexive response

before tissue collection. After mid ventral laparotomy, the heart was removed and

placed in Krebs–Ringer bicarbonate buffer (KRB) containing 118 mM NaCl, 4.7 mM

KCl, 2.5 mM CaCl2, 1.2 mM KH2PO4, 1.2 mM MgSO4, 24.2 mM NaHCO3, and 10 mM D-

glucose (pH 7.4) equilibrated with 5% CO2 / 95% O2 and maintained at 37°C. The right

ventricle was separated from the left ventricle and septum, weighed and immediately

42

flash frozen in liquid nitrogen and stored at -80°C. Lungs were weighed as a measure of

the degree of pulmonary vasculitis and as an indication of the increase in pulmonary

arterial pressure [98].

Frozen right ventricles were homogenized in buffer (T-PER, 10 ml/g tissue;

Pierce, Rockford, IL, USA) containing protease (P8340, Sigma-Aldrich, St. Louis, MO,

USA) and phosphatase inhibitors (P5726, Sigma- Aldrich, St. Louis, MO, USA). After

incubation on ice for 30 min, the homogenate was collected by centrifuging at 12,000 g

for 5 min at 4°C. Protein concentration of homogenates was determined via the

Bradford method (Fisher Scientific, Rockford, IL). Homogenate samples were boiled in a

Laemmle sample buffer (Sigma-Aldrich, St. Louis, MO, USA) for 5 min. Forty

micrograms of total protein for each sample was separated on a 10% PAGEr Gold

Precast gel (Lonza, Rockland, ME) and then transferred to nitrocellulose membranes

using standard methods as detailed elsewhere [151]. Membranes were blocked with 5%

milk in Tris Buffered Saline (TBS) containing 0.05% Tween-20 (TBST) for 1 h and then

probed with primary antibodies for the detection of β-myosin heavy chain (M 8421,

sigma Aldrich, St. Louis, MO), fibronectin (AB23750, Abcam, Cambridge, MA), (AMPK-

α (#2532), p-AMPK-α (#2535), Bax (#2772), Bcl2 (#2870s), Caspase-3 (#9662),

Cleaved caspase-3 (#9661s), ERK 1/2 (#9106s), p-ERK 1/2 (#4377s), p-P-38 (#9216L),

P-38 (#9212), p-HSP-27 (#24068), HSP-27 (#2442s), HSP-70 (#4872), p-HSP-90

(#3488), p-JNK (#9251s), JNK (#9252), glyceraldehyde 3-phosphate dehydrogenase

(GAPDH) (#2118), (from Cell Signaling Technology, Inc., Beverly, MA)) and p-NFkB-

p50 (SC-33022), NFkB-p50 (SC-8414), and 3-nitrotyrosine (SC-55256) (from Santa

43

Cruz Biotechnology, Inc., Santa Cruz, CA). After an overnight incubation at 4°C in

primary antibody buffer (5% BSA in TBS-T, primary antibody diluted 1:1000)

membranes were washed with TBST, and then incubated with HRP-conjugated

secondary antibodies (anti-rabbit (#7074) or anti-mouse (#7076), Cell Signaling

Technology, Danvers, MA) for 1 h at room temperature. After removal of secondary

antibody, membranes were washed (3 x 5 min) in TBS-T and protein bands were

visualized following reaction with ECL reagent (Amersham ECL Western Blotting

reagent RPN 2106, GE Healthcare Bio-Sciences Corp., Piscataway, NJ). Target protein

levels were quantified by AlphaEaseFC image analysis software (Alpha Innotech, San

Leandro, CA) and normalized to (GAPDH).

OxyBlot analysis

OxyBlot™ Protein Oxidation Detection kit (#S7150, Millipore, MA) was used for

the immune blot detection of carbonyl groups. Carbonyl groups are introduced into

proteins due to oxidative reactions by oxygen free radicals and other reactive oxygen

species [152]. Briefly, 5 μg total protein of each sample was derivatized by reaction with

2, 4-dinitrophenylhydrazine (DNPH) at room temperature for 15 min before separation

using 10% PAGEr Gold Precast gels. Oxidized proteins were detected by

immunoblotting using the anti-DNP antibody provided in the kit [29]. Bands were

visualized following reaction with ECL reagent (Amersham ECL Western Blotting

reagent RPN 2106, GE Healthcare Bio-Sciences Corp., Piscataway, NJ). Target protein

44

levels were quantified by AlphaView SA image analysis software (Alpha Innotech, San

Leandro, CA).

Histological analysis

a. Dystrophin staining

RV tissues were serially sectioned (8 μm) using an IEC Microtome cryostat and

the sections were collected on poly-L-Lysine coated slides. Sections were stained for

dystrophin immunoreactivity and used to evaluate the cardiomyocyte cross sectional

area (CSA) as outlined elsewhere [153]. Briefly, sections were incubated for 30 min in a

blocking solution (5% bovine serum albumin [BSA] and phosphate-buffered saline [PBS]

containing 0.5% Tween 20 (PBS-T), pH 7.5 and then incubated with specific anti sera

diluted in PBS-T (anti-dystrophin 1:100, rat-igG 1:100) for 1 h at 37°C in a humidified

chamber. After washing in PBS-T (3 x 5 min), sections were incubated with the

appropriate FITC labeled secondary antibody (1:200) for 1 h at 37°C in a humidified

chamber. Muscle cross sections were visualized by epi-fluorescence using an Olympus

BX51 microscope (Olympus, Center Valley, PA), fitted with 20x and 40x objectives.

b. Picrosirius red staining

Picrosirius red staining was used to assess the collagen content deposition in RV

sections as detailed elsewhere [154]. Briefly, RV frozen tissue sections were fixed with

95% alcohol for 1 min, washed three times with running tap water, and then stained with

45

hematoxylin for 8 min, and picrosirius red for 20 min. After dehydrating sections and

mounting, collagen content was visualized at 20x magnification using an Olympus BX51

microscope (Olympus, Center Valley, PA).

c. Dihydroethidium staining

RV cardiac muscles were serially sectioned (8 μm) with an IEC Microtome

cryostat, and the sections were collected on poly-L-lysine coated glass slides. The

fluorescent superoxide marker dihydroethidium (hydro ehidine) was used to evaluate

superoxide levels as outlined elsewhere [155]. Upon oxidation, dihydroethidium is

intercalated within DNA exhibiting a bright fluorescent red [156]. Briefly, RV frozen

tissue sections were washed with phosphate-buffered saline (PBS) for 5 min and then

incubated with 200 μl of 10 μM of dihydroethidium (Molecular Probes, Eugene, OR) for

1 h at room temperature. After washing with PBS (3 x 5 min), fluorescence was

visualized under a Texas red filter using an Olympus BX-51 microscope (Olympus

America, Melville, NY, USA) equipped with Olympus WH 20x wide field. Images were

recorded digitally using a CCD camera and the integrated optical density determined

using the Alpha view image analysis software (Cell Biosciences, Inc., Santa Clara, CA).

d. TUNEL staining

DNA fragmentation was determined by TdT-mediated dUTP nick end labeling

(TUNEL) according to the manufacturer’s recommendations (In Situ Cell Death

46

Detection Kit, Roche Diagnostics, Mannheim, Germany) as described elsewhere [157].

Briefly, TUNEL staining was performed on RV tissue sections (8 μm) obtained from

control (n=3), MCT only (n=3), and MCT + CeO2 nanoparticle treated rats (n=3), which

were fixed with 4% paraformaldehyde, washed with PBS (pH 7.4), and then

permeabilized with 0.1% sodium citrate and 0.1% Triton-X. Cross-sections from each

muscle were treated with DNase I to induce DNA fragmentation as a positive control.

Heart sections were blocked with 3% BSA and the sections were incubated with the

TUNEL reaction mixture containing TdT and fluorescein dUTP. Nuclei were counter

stained using DAPI (VECTASHIELD HardSet Mounting Medium, Vector Laboratories,

and Burlingame, CA). Fluorescence images were visualized using an Olympus BX-51

microscope (Olympus America, Melville, NY) equipped with Olympus WH 20x and 40x

wide fields.

Serum protein immune assays

Sera collected during exsanguations were pooled from all six rats in each group

and sent to Myriad RBM (Austin, TX) for RodentMAP® v 2.0 Antigen analysis using a

Luminex Lab MAP instrument as detailed elsewhere [19, 115]. Each analyte was

quantified using 4 and 5 parameter, weighted and non weighted curve fitting algorithms

using proprietary data analysis software developed at Rules-Based Medicine.

47

Data analysis

Results are presented as mean ± SEM. Data were analyzed using SigmaPlot

11.0 computer software. One-way analysis of variance (ANOVA) was used for overall

comparisons. The Student Newman Keuls post hoc test was used to determine

statistical significance. The level of significance accepted a priori was p ≤ 0.05.

48

Results

Characterization of CeO2 nanoparticles

CeO2 nanoparticle diameter as determined by DLS and AFM were 300 ± 58 nm

and 300 ± 25 nm, respectively (Figure 3-1 Panels A, B).

CeO2 nanoparticles treatment decreases right ventricular tissue weight

Compared to the control animals, body weight in the MCT and MCT +

CeO2animals was 14% and 13% less, respectively (P< 0.05, Table 3-1). Conversely,

the ratio of heart weight to body weight was 22% and 4% higher in the MCT and MCT +

CeO2 animals (P< 0.05). Similarly, the ratio of right ventricle (RV) weight to body weight

ratio was 83% and 29% higher in the MCT and MCT + CeO2 nanoparticle animals (P<

0.05), while the wet lung weight to body weight ratio was 48% and 36% higher in the

MCT and MCT + CeO2 nanoparticle animals (P< 0.05).

CeO2 nanoparticles treatment decreases MCT-induced changes in pulmonary

arterial pressure and cardiac remodeling

Compared to the MCT + CeO2 nanoparticle animals, echocardiographic analysis

of pulmonary arterial flow demonstrated a mid-systolic notch in the MCT animals (Figure

3-2, Panel B). Consistent with this finding, pulmonary arterial pressure (PA Pr) was 18%

higher in MCT while PA Pr was equal to the base line measurement in the MCT + CeO2

49

animals (Figure 3-3, Panel A P<0.05). Mean pulmonary arterial diameter was 27% and

1% higher in MCT and MCT + CeO2 nanoparticle animals, respectively (Figure 3-3,

Panel B, P<0.05). Supporting these data, the mean pulmonary arterial area was 46%

higher in the MCT animals but only 3% greater in the MCT + CeO2 nanoparticle animals

(Figure 3-3, Panel C, P<0.05). Similarly, the right ventricular outflow tract diameter was

14% and 1% higher in MCT and MCT + CeO2nanoparticle animals (Figure 3-3, Panel D,

P<0.05). Similar to our findings at the whole tissue level, echocardiography analysis

demonstrated that CeO2 nanoparticle treatment attenuated MCT-induced increases in

RV anterior free wall thickness (Figure 3-4). Likewise, the interventricular septum

diameter was 16% higher in MCT animals but only 3% greater in the MCT + CeO2

animals (Figure 3-5, Panel B, P<0.05).

In the MCT only animals, the echocardiography analysis showed that the right

atrium septum tended to bow toward the left atrium (Figure 3-6, Panel A). Similarly, in

MCT animals a D-shaped inter-ventricular septum, septal flattening and tricuspid

regurgitation was observed (Figure 3-6, Panels B, C), which are all consistent with

advanced PAH and RV hypertrophy.

To examine the molecular alterations that might accompany PAH-induced

changes in RV thickness we next performed dystrophin immunofluoresence staining to

determine the average cardiomyocyte cross sectional area (CSA) in the right ventricle.

Compared to the control animals, ventricular CSA was 34% higher in the MCT animals

but only 1% greater in the MCT + CeO2 group (Figure 3-7, Panels A, B, C, D, P<0.05).

50

Although not quantitated, picrosirius red staining suggested that the degree of MCT-

induced collagen deposition was less in the CeO2 treated animals when compared to

that in the MCT only animals (Figure 3-7, Panel G).

In an effort to extend these findings, we next performed immunoblotting to

examine the effect of CeO2 nanoparticle treatment on myosin heavy chain expression.

Compared to control animals, MHC-β expression was 91% higher in the MCT animals

but only 3% higher in MCT + CeO2 group, respectively (Figure 3-8, Panel B, P<0.05).

Similarly, MCT-induced fibronectin expression was 113% higher in the MCT animals but

only 4% more in the MCT + CeO2 animals (Figure 3-8, Panel A, P<0.05).

CeO2 nanoparticles treatment decreases MCT-induced increases in oxidative

stress signaling

As an index of oxidative stress, we determined superoxide anion levels in tissue

sections obtained from the RV by quantifying dihyroethidium (DHE) fluorescence levels.

Compared to the control rats, the DHE fluorescence intensity was 71% and 12% higher

in the MCT and MCT + CeO2 nanoparticle treatment rats, respectively (Figure 3-9,

P<0.05). In an effort to extend these findings, we next examined the effects of PAH and

treatment on the amount of protein exhibiting 3-nitrotyrosine (3-NT) modification.

Compared to the control rats, 3-NT levels were 15% higher in the MCT animals (Figure

3-10, Panel A, P<0.05). Interestingly, CeO2 nanoparticle treatment actually reduced 3-

NT levels by 17% compared to that observed in the control animals (Figure 3-10, Panel

51

A, P<0.05). Likewise, compared to control rats, the amount of protein carbonylation was

14% and 4% higher in the MCT and MCT + CeO2 groups, respectively (Figure 3-10,

Panel B, P<0.05).

CeO2 nanoparticles treatment attenuates MCT-induced increases in AMPK alpha,

ERK1/2 and JNK phosphorylation

Compared to the control rats, the amount of p-AMPK alpha was 9% higher and

MCT animals and 11% lower in the MCT + CeO2 group (Figure 3-11, Panel A, P<0.05).

Total AMPK alpha levels were 1% and 9% lower in the MCT and MCT + CeO2

nanoparticle treated rats, respectively (Figure 3-11, Panel A, P<0.05). Compared to the

control rats, the amount of p-ERK 1/2 protein was 17% higher and 7% lower in MCT

and MCT + CeO2 animals, respectively (Figure 3-11, Panel B, P<0.05). Total ERK 1/2

was 12% and 2% higher in the MCT and MCT + CeO2 nanoparticle treatment rats,

respectively (Figure 3-11, Panel B).

Compared to the controls, p-JNK levels were 19% and 11% higher in the MCT

and MCT + CeO2 rats, respectively (Figure 3-11, Panel C, P<0.05). Total JNK protein

was unchanged and 6% higher in the MCT and MCT + CeO2 nanoparticle treatment

rats, respectively (Figure 3-11, Panel C).

In an effort to extend these findings, we next examined the effect of CeO2

nanoparticle treatment on the regulation of HSP-27 following MCT insult. Compared to

52

the control rats, the amount of p-HSP-27 was 88% and 9% higher in the MCT and MCT

+ CeO2 groups, respectively (Figure 3-12, Panel A, P<0.05). Similarly, total HSP-27

levels were 55% and 15% higher in the MCT and MCT + CeO2 nanoparticle treatment

rats, respectively (Figure 3-12, Panel B). No changes in the expression and

phosphorylation levels of HSP-70 and HSP-90 were observed (Data not shown).

CeO2 nanoparticles treatment attenuates MCT-induced increases in the

expression of NF-kB-p-50

Compared to the control rats, the amount of p-NF-kB-p-50 was 56% and 12%

higher in the MCT and MCT + CeO2 nanoparticles rats, respectively (Figure 3-12, Panel

B, P<0.05). Total NF-kB-p-50 was 10% lower in MCT group but only 3% lower with

CeO2 nanoparticle treatment (Figure 3-12, Panel B, P<0.05).

Effects of CeO2 nanoparticles treatment on serum protein biomarkers

Compared to control rats, MCT insult appeared to increase the amount of serum

C-reactive protein (CRP), TNF-α, CD40 Ligand, serum amyloid protein, von Willebrand

factor, vascular endothelial growth factor A, macrophage inflammatory protein-1 beta,

macrophage colony-stimulating factor-1, and tissue inhibitor of metalloproteinase-1,

which appeared to be attenuated with CeO2 nanoparticle treatment (Figure 3-13).

53

CeO2 nanoparticles treatment decreases MCT-induced cardiomyocytes apoptotic

signaling

The TdT-mediated dUTP nick end labeling (TUNEL) procedure was used to

determine the number of cardiomyocytes in the right ventricle that exhibited DNA

fragmentation. Compared to control rats, MCT insult was associated with an increase in

the number of TUNEL positive nuclei (Figure 3-14). To extend upon these findings, we

next examined the effects of treatment on Bax and Bcl-2 expression. Compared to

control rats, the ratio of Bax/Bcl-2 was 84% higher in the MCT animals but only 29%

higher in the MCT + CeO2 group (Figure 3-15, Panel A, P<0.05). Similarly, the amount

of cleaved caspase-3 (19 kDa) was 19% higher in the MCT animals but only 1% higher

in the MCT + CeO2 rats, respectively (Figure 3-15, Panel B, P<0.05).

54

Discussion

In spite of recent advances in the early diagnosis and treatment of pulmonary

arterial hypertension (PAH), right ventricular hypertrophy and failure remain the leading

cause of death seen with this disease [158]. The monocrotaline model of PAH is

characterized by elevated pulmonary pressure and increased tissue superoxide levels

that are associated with the development of right ventricular hypertrophy and failure

[46]. Previous data has suggested that antioxidant treatment in the rat monocrotaline

model of PAH can reduce oxidative stress levels and diminish the extent of right

ventricular remodeling [98, 159]. Supporting this contention, and consistent with

previous data demonstrating that CeO2 nanoparticles exhibit the ability to function as an

antioxidant both in vitro and in vivo [15, 110] we demonstrate that CeO2 nanoparticle

administration diminishes the development of right ventricular (RV) hypertrophy and

evidence of reduced MAPK, and pro-apoptotic signaling (Table 3-1, Figures 3-2, 3-3, 3-

4, 3-9,3-10,3-11, 3-12 and 3-15).

Effect of CeO2 nanoparticle administration on monocrotaline-induced pulmonary

hypertension and cardiac remodeling

Consistent with previous work [60], we observed that monocrotaline insult was

associated with increased pulmonary arterial pressure and right ventricular hypertrophy

(Table 3-1, Figures 3-2, 3-3 and 3-4). Specifically, our echocardiography data

demonstrated that MCT treated rats exhibited an 18% increase in pulmonary arterial

pressure (Figure 3-3 A), a 27% increase in mean pulmonary arterial diameter (Figure 3-

55

3 B), a 46% higher mean pulmonary arterial area (Figure 3-3 C), and a 14% increase in

right ventricular out flow tract diameter (Figure 3-3 D). More importantly, however, we

found that CeO2 nanoparticle treatment appeared to attenuate monocrotaline-induced

changes in pulmonary flow and the development of PAH and PAH associated RV

hypertrophy (Table 3-1, Figures 3-2, 3-3 and 3-4). These data are consistent with

previous work showing that CeO2 nanoparticles can protect cultured cardiac myocytes

from cigarette smoke extract [148] and hydrogen peroxide-induced oxidative damage in

culture [160].

In the present study, we noted monocrotaline-associated increases in RV tissue

weight, right ventricular anterior free wall thickness, and ventricular septal diameter was

diminished with CeO2 nanoparticle treatment (Table 3-1, Figures 3-4, 3-5). In addition,

our echocardiography analysis suggested the presence of altered atrial and ventricular

geometry including the bowing of the right atria towards left atria, septal flattening during

diastole, septal bulging into the LV cavity during systole, and tricuspid regurgitation in

the monocrotaline treated animals (Figure 3-6) but not in the CeO2 nanoparticle treated

animals.

In an effort to better characterize the hypertrophic response, we next investigated

whether monocrotaline induced increases in right ventricular mass were associated with

cardiomyocyte hypertrophy and fibrosis. To this end, we first measured cardiomyocyte

cross sectional area (CSA) in each of the three animal groups. Similar to our findings at

the whole tissue level, our histological studies and quantification of the data

56

demonstrated that CeO2 nanoparticle treatment diminished monocrotaline-induced

increases in right ventricular cardiomyocyte CSA (Figure 3-7), cardiac fibrosis (Figure 3-

7) and fibronectin protein levels (Figure 3-8 A).

In addition to changes in tissue morphology, cardiac hypertrophy is also

associated with changes in contractile protein expression. During the hypertrophic

process, the heart undergoes an up-regulation in the amount of β-MHC and a down-

regulation in the amount of α-MHC [161], which results in an increased efficiency of

cardiac contraction [162]. In the present study, and similar to previous work [163], we

found that MCT-induced increases in cardiac mass were associated with increases in β-

MHC expression (Figure 3-8 B) and importantly, that this up-regulation was attenuated

following CeO2 nanoparticle administration (Figure 3-8 B).

CeO2 nanoparticle administration diminishes indices of oxidative stress during

pulmonary arterial hypertension

It has been postulated that increases in oxidative stress may be involved in the

initiation and progression of cardiac hypertrophy in the MCT-PAH rat model [164, 165].

Consistent with previous work demonstrating the antioxidant activity of CeO2

nanoparticles [106], we found that CeO2 nanoparticle treatment was associated with

decreased tissue superoxide anion levels (Figure 3-9), diminished tyrosine nitration

(Figure 3-10 A) and an attenuation in the amount of MCT-induced protein carbonylation

(Figure 3-10 B). Whether the changes we observe in ROS stress are due entirely to the

57

antioxidant activity of CeO2 nanoparticles or if they may be related to increases in

antioxidant activity is currently unclear.

Recent work has suggested that AMPK, MAPK, HSP and NF-kB signaling are

regulated, at least in part, by oxidative stress [166-169] and that antioxidants can

function to block the activation of these molecules both in vitro and in vivo [170, 171].

Other data has demonstrated that these signaling pathways are important regulators of

ventricular remodeling following pressure overload [170, 172]. Supporting these

findings, we found that MCT-induced right ventricular hypertrophy was associated with

increased phosphorylation (activation) of AMPK-alpha, ERK 1/2, JNK-MAPK (Figure 3-

11), HSP-27 and NF-kB p50 (Figure 3-12). The effect of activation was diminished with

CeO2 nanoparticle treatment (Figure 3-11, 3-12). Whether these alterations in these

signaling pathways are responsible for the diminished cardiac remodeling we observed

with CeO2 nanoparticle treatment is currently unclear.

In humans, the involvement of leukocytes and macrophages in the inflammatory

process leading to the development of PAH associated vascular lesions is well

documented [173, 174]. It is thought that inflammation plays a significant role in MCT-

induced PAH [175]. We found that MCT administration was associated with the up-

regulation of several serum protein markers associated with inflammation (e.g. C-

reactive protein (CRP), tissue necrosis factor alpha (TNF-α)) and that this up-regulation

was attenuated following CeO2 nanoparticle administration (Figure 3-13).

58

CeO2 nanoparticle administration diminishes monocrotaline-induced increases in

apoptosis

Recent data has suggested that cardiomyocyte apoptosis may be involved in the

ventricular remodeling seen during MCT-induced PAH [176]. To examine this we

determined the number of TUNEL positive nuclei in right ventricular tissue sections

obtained from the control, MCT, and MCT + CeO2 nanoparticle groups. Consistent with

our present data we found that CeO2 nanoparticle treatment was associated with a

reduced number of TUNEL positive nuclei (Figure 3-14), diminished Bax/Bcl2 ratio

(Figure 3-15, Panel A), a decreased caspase-3 cleavage (activation) (Figure 3-15,

Panel B) which are suggestive of diminished cellular apoptosis.

Taken together, the data of the present study demonstrated that CeO2

nanoparticle administration attenuates MCT-induced increases in ventricular

hypertrophy and that this finding is associated with diminished levels of tissue oxidative

stress and apoptosis. Future experiments designed to directly uncover the

mechanism(s) of this finding may be warranted.

59

Table 3-1. Cerium oxide nanoparticle treatment attenuates monocrotaline-induced increases in right ventricular remodeling. * indicates significant difference from control animals, † indicates significant difference from the MCT only group.

60

Figure 3-1.Characterization of CeO2 nanoparticles size. Nanoparticle size was determined by DLS (Panel A) and AFM (Panel B).

61

Figure 3-2.CeO2 nanoparticle treatment improves pulmonary flow. Pulsed-wave Doppler echocardiography demonstrating normal, round shaped flow profile on day 1 (base line) of MCT rats (Panel A), triangular flow profile with mid systolic notching on day 28 of MCT rats progression to pulmonary arterial hypertension (Panel B) (arrow), - normal, round shaped flow profile on day 1 (base line) of MCT + CeO2 nanoparticle treated rats (Panel C), - attenuation of pulmonary arterial hypertension and restoring the normal, round shaped flow profile as of baseline observed with CeO2 nanoparticle treatment (Panel D).

62

Figure 3-3.CeO2 nanoparticle administration diminishes pulmonary artery remodeling. Pulsed-wave Doppler echocardiography quantified data form Pulmonary arterial pressure (Panel A), mean pulmonary arterial diameter (Panel B), mean pulmonary arterial area (Panel C), right ventricular outflow tract diameter (Panel D). Data are mean ± SEM (n= 6 rats/group). In the graphs, Grey bars represent base line and black bars represent final echocardiographic values. * indicates significant difference from base line values of MCT only group and † indicates significant difference from final values of MCT only group (p<0.05).

63

Figure 3-4.CeO2 nanoparticle treatment attenuates MCT-induced increases in right ventricle wall thickness. M-mode echocardiography images representing right ventricle wall thickness of the MCT only rats on day 1 (Panel A) and at day 28 (Panel B) or the MCT + CeO2 nanoparticle treated rats on day 1 (Panel C) and at day 28 (Panel D). The larger arrow in Panel B represents the increases in RV anterior wall thickness.

64

Figure 3-5.CeO2 nanoparticle treatment attenuates MCT-induced cardiac remodeling. Ventricle wall thickness (Panel A) and intra-ventricular septum diameter (Panel B) in the MCT only and MCT treated animals. Data are mean ± SEM, (n= 6 rats/group). In the graphs, grey bars represent the base line and black bars represent the final echocardiography values. * indicates significant difference from base line values of MCT only group and † indicates significant difference from final values of MCT only group (p<0.05).

65

Figure 3-6.PAH associated changes in cardiac function in the MCT only animals. Short-axis view of transthorasic echocardiogram showing right atrium bowing towards the left atrium (Panel A). Dilatation of the RV with septal flattening of the interventricular septum causing the left ventricle to conform into a “D” shape (Panel B). Tricuspid regurgitation (Panel C).

66

Figure 3-7.CeO2 nanoparticle administration attenuates monocrotaline-induced increases in cardiomyocyte cross sectional area and cardiac fibrosis. Dystrophin stained right ventricular sections from control (Panel A), MCT only (Panel B), and MCT + CeO2 nanoparticle treatment animals (Panel C). Quantification of cardiomyocyte cross-sectional area (Panel D). Picrosirius red staining was used to evaluate cardiac fibrosis in the right ventricles of control (Panel E), MCT only (Panel F) and MCT + CeO2 nanoparticle treatment animals (Panel G). Scale bar 50μm. Data are mean ± SEM (n = 3 rats/group). For each group 9 sections were analyzed. * indicates significant difference from the control and † indicates significantly different from the MCT only group (p<0.05).

67

Figure 3-8.MCT induced increases in RV fibronectin and MHC-beta are attenuated with cerium oxide nanoparticle treatment. Protein isolates from the right ventricle of control, MCT only, MCT + CeO2 nanoparticle treated rats were analyzed by immunoblotting for changes in fibronectin (Panel A) and myosin heavy chain-beta (Panel B) protein levels. Protein abundance was normalized to the expression of GAPDH. n=6 for each group. * indicates significant difference from the control and † indicates significantly different from the MCT only group (p<0.05).

68

Figure 3-9.CeO2 nanoparticle treatment decreases the incidence of superoxide levels in MCT-induced RV hypertrophy. Cardiac ROS determined by fluorescence intensity of ethidium bromide – stained nuclei. * Significantly different from control rats, † Significantly different from the MCT only rats (P<0.05).

69

Figure 3-10.Cerium oxide nanoparticle treatment decreases MCT-induced increases in protein nitration and carbonylation. Protein isolates obtained from the right ventricles of control, MCT only and MCT + CeO2 nanoparticle treated rats were analyzed by immunoblotting for alterations in protein nitrosylation (Panel A) and carbonylation (Panel B). * Significantly different from control rats, † Significantly different from the MCT only rats (P<0.05). n= 6 animals / group

70

Figure 3-11.Cerium oxide nanoparticle treatment decreases the MCT-induced increases in AMPK-alpha, ERK1/2 and JNK phosphorylation. Protein isolates obtained from the right ventricles of control, MCT only and MCT + CeO2 nanoparticle treated rats were analyzed by immunoblotting to determine the phosphorylation of AMPK-alpha (Panel A), ERK1/2 (Panel B) and JNK (Panel C). * Significantly different from control rats, † Significantly different from the MCT only rats (P<0.05). n= 6 animals / group.

71

Figure 3-12. Cerium oxide nanoparticle treatment decreases the MCT induced oxidative stress associated phosphorylation of HSP-27 and NF-kB p50. Protein isolates of RV from control, MCT only and MCT + CeO2 nanoparticle treated rats were analyzed by immunoblotting to determine alterations in HSP-27(Panel A) and NF-kB regulation (Panel B). * Significantly different from control rats, † Significantly different from the MCT only rats (P<0.05).n = 6 animals / groups.

72

Figure 3-13. Alterations in serum protein biomarkers with MCT and MCT + CeO2

nanoparticle treatment.

73

Figure 3-14.CeO2 nanoparticles treatment decreases the incidence of TUNEL positive nuclei in MCT induced RV hypertrophy. Immunofluoresence labeling of TUNEL positive nuclei (FITC) in control (Panel A), MCT only (Panel B), MCT + CeO2 nanoparticle treated animals (Panel C). Bar 50 μm. n = 3 animals / group.

74

Figure 3-15.Cerium oxide nanoparticle treatment is associated with diminished pro-apoptotic signaling. Protein isolates obtained from the right ventricles of control, MCT only and MCT + CeO2 nanoparticle treated rats were analyzed by immunoblotting to determine the Bax/Bcl-2 protein levels (Panel A) and caspase-3 cleavage (Panel B).*Significantly different from control rats, †Significantly different from the MCT only rats (P<0.05). n = 6 animals / group.

75

PAPER 3

The following paper corresponds to the specific aim II

76

Curcumin nanoparticles attenuate cardiac remodeling due to pulmonary arterial

hypertension

Key words:

pulmonary arterial hypertension, cardiac hypertrophy, curcumin, nanoparticles

Running title:

Effect of curcumin nanoparticles on cardiac hypertrophy following pulmonary arterial

hypertension.

77

Abstract

Introduction: Pulmonary arterial hypertension (PAH) is a progressive disorder that can

cause right ventricular failure and death. Curcumin is a polyphenol compound that

exhibits anti-inflammatory and antioxidant properties whose clinical application has

been hindered by poor solubility, short biological half-life, and low bioavailability after

oral administration. Herein, we investigate whether curcumin nanoparticles (Cur NP) are

effective for the treatment of monocrotaline (MCT)-induced PAH in the laboratory rat.

Methods: Cur NP was prepared using an emulsion-diffusion-evaporation technique.

Male Sprague Dawley rats (175-200 gm) were randomized into control, MCT only or

MCT + Cur NP groups (n=6 each / group). PAH was induced by a single subcutaneous

injection of MCT (60 mg/kg). MCT + Cur NP treated rats received 50 mg/kg of Cur NP in

0.5 ml of distilled water i.p. daily for seven days while the control and MCT groups

received only distilled water. Echocardiography was done at the start of the study and

twenty eight days after MCT injection. Results: Compared to MCT only animals, Cur

NP administration was associated with diminished pulmonary arterial pressure (71 ± 2

vs. 67 ± 2 mmHg, P<0.05), reduced right ventricular wall thickness (0.27 ± 0.02 cm vs.

0.23 ± 0.01 cm,) and a decreased right ventricle weight/body weight ratio (0.74 ± 0.06

vs. 0.57 ± 0.02 mg/gm, P<0.05). MCT insult elevated the serum TNF-α levels (19%)

which were reduced with Cur NP treatment. Cur NP treatment attenuated cardiac

fibrosis and the development of RV hypertrophy. Conclusions: Taken together, these

data suggest that Cur NP may attenuate MCT-induced pulmonary arterial hypertension

and right ventricle hypertrophy. WC: (261)

78

Introduction

Pulmonary arterial hypertension (PAH) is a debilitating disease characterized by

progressive obstruction of the pulmonary arteries which can cause a rise in pulmonary

vascular resistance (PVR) and right ventricular (RV) hypertrophy [177]. The median

survival rate in PAH patients without treatment is 2.8 years after diagnosis and the

estimated survival rates at 1-, 3- and,5-years is 68%, 48% and 34%, respectively [178].

Not unexpectedly, RV failure is the most common cause of death in PAH patients (~ 30-

50% of deaths) [179]. Current therapeutic treatments, although effective in improving

symptomology, only delay disease progression. As of yet, a cure for PAH has not been

found and long term survival remains poor [180].

Curcumin (diferuloylmethane) is a polyphenolic compound in the curry spice

turmeric that has been used in Indian Ayurvedic medicine for the treatment of

inflammatory diseases [181]. Recent data has shown that curcumin exhibits anti-

inflammatory, anti-oxidant and anti-proliferative activity [28], most likely through its

ability to scavenge free radicals, diminish cytokine expression (e.g, tumor necrosis

factor (TNF)- α, interleukin (IL)-1, and IL-6) and inhibit the activity of nuclear factor

kappa-light-chain-enhancer of activated B cells (NF-kB) [182, 183]. Curcumin has been

used to improve left ventricular function in rabbits subjected to pressure-overload [184]

and inhibit cardiac inflammation and fibrosis in rats [35].

Thus far, the biomedical application of curcumin has been hampered due to its

poor water solubility and short biological half-life [38]. Recent studies, using

79

nanoparticle-based systems, have shown increased curcumin bioavailability [39, 137].

Here, we examine whether the systemic administration of curcumin nanoparticles (Cur

NP) can diminish PAH-induced cardiac hypertrophy in the rat. To induce PAH, rats were

subjected to a single subcutaneous injection of monocrotaline (MCT; 60 mg/kg). MCT is

a macrocylic pyrrolizidine alkaloid that when metabolized by cytochrome P450

(CYP3A4) is converted to dehydromonocrotaline, which selectively injuries the vascular

endothelium of lung causing an increase in pulmonary arterial pressure [185]. Given the

pivotal role that inflammation plays in the development of PAH [10], we hypothesized

that Cur NP treatment would diminish the expression of inflammatory mediators and

that this reduction in inflammation would be associated with decreased right ventricular

hypertrophy.

80

Materials and Methods

PAH model and experimental design

All procedures were approved by the Institutional Animal Care Committee of

Marshall University using the criteria outlined by the American Association of Laboratory

Animal Care (AALAC). Male Sprague Dawley rats (7 weeks old, 175-200 gm) were

obtained from Hilltop laboratories (Scottsdale, PA) and were housed two per cage in an

AALAC approved vivarium at Marshall University. The animal housing facility was

operated with a 12 hour: 12 hour dark – light cycle and maintained at 22 ± 2°C. Rats

were provided with food and water ad libitum and allowed to acclimate to the housing

facilities for at least two weeks before experimentation. Animals were randomly

assigned to one of three experimental groups 1.) Control (n=6), 2.) MCT only (n=6), or

3.) MCT + Cur NP treatment (n=6). PAH was induced by a single injection of MCT (60

mg/kg s.c.) (Sigma-Aldrich, St.Louis, MO) as described previously [149]. Animals

injected with MCT were given either Cur NP (50 mg/kg i.p.) or vehicle (DI water) once

daily for seven days following the MCT injection.

Preparation of curcumin nanoparticles

Curcumin (100 mg) was solubilized in dichloromethane (10 ml), and 1 ml of this

solution was sprayed into deionized water (25 ml) drop wise at a flow rate of 0.2 ml/min

in 5 min under ultrasonic conditions, with an ultrasonic power of 100 W and a frequency

of 30 kHz. After sonication for 10 min, the contents were stirred at 400-800 rpm at room

81

temperature for about 30 min until a clear orange-colored solution was obtained. The

solution was concentrated under reduced pressure at 50°C and then dried at 40°C to

obtain an orange powder.

Scanning Electron Microscopy

Curcumin nanoparticles’ size and morphology were characterized using scanning

electron microscope (SEM) (JEOL’s JSM 7400 SEM). The SEM was operated at 5 kv.

The samples were prepared by fixing the curcumin nanoparticles to a microscope

holder using a conducting carbon strip.

Atomic Force Microscopy

Curcumin nanoparticles (1µg/µl) were deposited on freshly cleaved mica (V1

mica, SPI Inc, West Chester, PA). After a 10 min incubation period, the surface was

gently rinsed with deionized (DI) water to remove any unbound nanoparticles and the

sample was dried under nitrogen. Particles were imaged in noncontact mode at a 319

kHz with a scan speed 0.5 Hz using a Nano-R microscope (Pacific Nanotechnology,

Santa Clara, CA) equipped with a TM300-A probe (Sensa Probes Inc, Santa Clara,

CA.).

82

Echocardiography

Echocardiography was performed using a Philips 5500 ultrasound machine with

an S-12 transducer frequency at the beginning of the study and at 4 weeks to assess

pulmonary and right ventricular structure and function as outlined previously [186].

Briefly, rats were anesthetized with an intraperitoneal injection of ketamine and xylazine

(4:1, 50 mg/kg). Once anesthetized, the ventral thorax area was shaved and covered

with ultrasonic transmission gel. Electrocardiograms were recorded simultaneously to

monitor heart rate. Echocardiography images were obtained in the 2-dimensional

guided M-mode and Doppler M-mode from parasternal long-axis (PLAX) and

parasternal short-axis (PSAX) views. M-mode measurements of the RV, LV and wall

thickness were performed from PSAX image plane. Pulmonary artery flow was

measured at the pulmonary valve level and pulmonary artery diameter was measured at

the level of pulmonary out flow tract during systole using the PSAX view. An apical four-

chamber view was employed to measure end-diastolic right ventricular area. Pulsed-

wave Doppler was used to measure pulmonary artery acceleration time and flow.

Measurements from six rats in each group were obtained for the assessment of cardiac

structure and function.

Tissue processing and immunoblotting

RV cardiac muscles were pulverized in liquid nitrogen using a mortar and pestle

until a fine powder was obtained and homogenized in TPER lysis buffer (Pierce,

Rockford, IL) containing protease (P8340, Sigma-Aldrich, Inc., St. Louis, MO) and

83

phosphatase inhibitors (P5726, Sigma-Aldrich, Inc., St. Louis, MO). After incubation on

ice for 30 min, the homogenate was collected by centrifuging at 12,000 g for 5 min at

4°C. The protein concentration of homogenates was determined in triplicate via the

Bradford method (Fisher Scientific, Rockford, IL). Homogenate samples were boiled in a

Laemmli 2X sample buffer (Sigma-Aldrich, Inc., St. Louis, MO) for 5 min before loading

forty micrograms of total protein from each sample on 10% PAGEr Gold Precast gels

(Lonza, Rockland, ME). Proteins were transferred onto nitrocellulose membranes using

standard conditions [187]. For immunodetection, membranes were blocked for 1 h at

room temperature in blocking buffer (5% non-fat dry milk in TBS-T (20mM Tris-base,

150mM NaCl, 0.05% Tween-20), pH 7.6), serially washed in TBS-T at room

temperature, then probed with primary antibodies for the detection of β-myosin heavy

chain (M 8421, Sigma Aldrich, St. Louis, MO), fibronectin (AB23750, Abcam,

Cambridge, MA), p-AMPK-α (#2535), AMPK-α (#2532), HSP-27 (#2442s), HSP-70

(#4872), Bax (#2772), Bcl2 (#2870s), Caspase-3 (#9662), cleaved caspase-3 (#9661s),

caspase-9 (#9506), ERK1/2 (#9106s), p-ERK1/2 (#4377s), p-p-38 (#9216L), p-38

(#9212), p-JNK (#9251s), JNK (#9252), glyceraldehyde 3-phosphate dehydrogenase

(GAPDH) (#2118), (from Cell Signaling Technology, Inc., Beverly, MA) and 3-

nitrotyrosine (SC-55256) (from Santa Cruz Biotechnology, Inc., Santa Cruz, CA).

Membranes were incubated overnight at 4°C in primary antibody buffer (5% BSA in

TBS-T, pH 7.6, primary antibody diluted 1:1,000), followed by washing in TBS-T (3 x 5

min), and incubation with HRP-conjugated secondary antibody (anti-rabbit ((#7074)) or

anti-mouse ((#7076)), Cell Signaling Technology, Inc., Danvers, MA) in blocking buffer

for 1 h. After removal of the secondary antibody, membranes were washed (3 x 5 min)

84

in TBS-T and protein bands were visualized following reaction with ECL reagent

(Amersham ECL Western Blotting reagent RPN 2106, GE Healthcare Bio-Sciences

Corp., NJ). Target protein levels were quantified by AlphaView SA image analysis

software (Alpha InfoTech, San Leandro, CA) and normalized to GAPDH.

Histology

Picrosirius red staining was used to assess the collagen content deposition in the

right ventricle as detailed elsewhere [188]. Briefly, frozen tissue sections were fixed

with 95% alcohol for 1 min, washed three times with running tap water, and then stained

with hematoxylin for 8 min and picrosirius red for 20 min. After dehydration, sections

were mounted and visualized at 20x or 40x magnification using an Olympus BX51

microscope (Olympus, Center Valley, PA).

Determination of cytokine levels in serum by ELISA method

Serum concentrations of tumor necrosis factor (TNF)-α and interleukin-1β (IL-

1β) were measured using commercially available enzyme-linked immunosorbent assay

(ELISA) kits (BD Bioscience, San Diego, CA) according to the manufacturer’s

instructions [24]. Absorbance measurements for each plate were taken at 450 nm using

ELISA plate reader (BioTek, Winooski, Vermont).

85

Determination of cardiac TNF-α and IL-1βmRNA levels

RV tissue was homogenized in TRI reagent (Ambion, Austin, TX) at a

concentration of 1ml for every 100mg of tissue as detailed elsewhere [189]. Briefly, after

5 minutes of incubation with TRI reagent, the homogenates were centrifuged (12,000 g

for 15 min at 4 °C). The supernatant was collected and mixed with 200 μl of chloroform

(Sigma-Aldrich, Inc., St. Louis, MO). After a 10 min incubation at room temperature, the

aqueous phase of the mixed solution was collected via centrifugation (12,000 g for 15

min at 4 °C) and then mixed with 500 μl of isopropanol (Sigma-Aldrich, Inc., St. Louis,

MO). RNA pellets were precipitated (12,000 x g for 10 min at 4 °C), washed with 75%

ethanol, and then dried under vacuum to remove residual ethanol. RNA pellets were

dissolved in 50 μl of 10mM Tris, pH8.0 and 1mM EDTA. RNA was quantified at 260 nm

using a NanoVue UV-Vis Spectrophotometer (GE Healthcare, Piscataway, NJ), and

RNA integrity was confirmed using a RNA Nanokit and Agilent 2100 Bio-analyzer

(Agilent Technologies, Santa Clara, CA). RNA samples were stored at -80°C until

further use.

Reverse transcription coupled with RT-PCR was used to quantify the relative

abundance of TNF-α and IL-1β mRNA levels in control, MCT and MCT + Cur NP

animals. Complementary DNA (cDNA) libraries were synthesized using a High Capacity

cDNA Reverse Transcription Kit (Applied Biosystems Inc., Foster City, CA) as detailed

elsewhere [189].

86

RT-PCR was performed using the Power SYBER Green PCR Master Mix

(Applied Biosystems Inc., Foster City, CA) as outlined previously [190]. PCR reactions

were run on an ABI 7000 Real-Time PCR system (Applied Biosystems Inc., Foster City,

CA) using the following cycle conditions: 50°C for 2min, 95°C for 10min, followed by 40

cycles at 95°C for 15s and 60°C for 1min as detailed elsewhere [191]. All experiments

were repeated in triplicate. β-actin or glyceraldehyde 3-phosphate dehydrogenase

(GAPDH) were used as internal controls. The forward and reverse primers were

purchased from Integrated DNA technologies (San Diego, CA). TNF-α Gene bank

accession number: NM_012675.3 with forward primer (5'-3') -

CCAGAACTCCAGGCGGTGTC, reverse primer (5'-3')-GGCTACGGGCTTGTCACTCG,

IL-1β Gene bank accession number: NM_031512.2 forward primer (5'-3') -

TGCCCGTGGAGCTTCCAGGA, reverse primer (5'-3')-TCCAGCTGCAGGGTGGGTGT.

The expression of TNF-α and IL-1β mRNA levels were normalized to the geometric

means of β-actin and GAPDH mRNA levels, and the 2-Δct method was used to calculate

the relative mRNA expression levels.

Data analysis

Results are presented as mean ± SEM. Data were analyzed using SigmaPlot

11.0 software. One-way analysis of variance (ANOVA) was used for overall

comparisons. The Student Newman Keuls post hoc test was used where appropriate to

determine differences between groups. The level of significance accepted a priori was P

≤ 0.05.

http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=260166688

http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=158186735

87

Results

Curcumin NP characterization

The particle size analysis of the nanoparticles was performed by scanning

electron microscope (SEM) and atomic force microscope (AFM). The SEM of powdered

sample showed the particle size to be in the range of 300 ± 50 nm (Figure 3-16 A, B)

and AFM of aqueous dispersion showed the particles to be approximately 50 nm in size

(Figure 3-16 C).

Curcumin NP treatment decreases PAH induced right ventricular tissue weight

Compared to control animals, body weight was 19% less in the MCT and MCT +

Cur NP rats, respectively (P<0.05) (Table 3-3). Conversely, the ratio of right ventricle

(RV) weight to body weight ratio was 27% and 10% higher in the MCT and MCT + Cur

NP animals (P<0.05). Similarly, the lung weight to body weight ratio was 356% and

214% higher in the MCT and MCT + Cur NP groups, respectively (P<0.05).

Curcumin NP treatment decreases MCT-induced changes in pulmonary arterial

pressure and cardiac remodeling

Compared to the MCT + Cur NP animals, echocardiographic analysis of

pulmonary arterial flow demonstrated a mid-systolic notch in the MCT animals (Figure

3-17, Panels A-D). Consistent with this finding, pulmonary arterial pressure (PA Pr) was

88

18% and 10% higher in the MCT and MCT + Cur NP animals, respectively (Figure 3-17

E, P<0.05). Likewise, the slope of the pulmonary artery acceleration vector was 200%

and 52% in higher in the MCT and MCT+ Cur NP animals, respectively (Figure 3-17 F,

P<0.05). Similar to our findings at the whole tissue level, echocardiography analysis

demonstrated that Cur NP treatment attenuated MCT-induced increases in RV anterior

free wall thickness (Figure 3-18).

To examine the molecular changes that might accompany PAH-induced changes

in RV thickness we next performed immunoblotting to examine myosin heavy chain

expression. Compared to the control animals, MHC-β expression was 278% and 106%

higher in the MCT and MCT + Cur NP treated animals, respectively (Figure 3-19 A,

P<0.05). Similarly, picrosirius red staining of the right ventricle suggested that the

degree of MCT-induced collagen deposition was less in the Cur NP treated animals

when compared to that in the MCT only treated animals (Figure 3-19, Panel B, C and

D). In an effort to extend these findings, we next examined the effect of Cur NP

treatment on fibronectin expression with MCT treatment. Compared to that observed in

the control animals, fibronectin protein levels were 95% and 57% higher in the MCT and

Cur NP MCT animals, respectively (Figure 3-19, Panel E, P<0.05).

Curcumin nanoparticle treatment decreases serum TNF-α levels

Compared to the control animals, serum TNF-α levels were 19% and 5% higher

in the MCT and MCT + Cur NP animals, respectively (Figure 3-20, Panel A, P<0.05).

89

The amount of serum IL-1βwas not changed in the MCT or MCT + Cur NP animals

(data not shown). At the tissue level, the abundance of TNF-α level was 124% and 2%

higher in the MCT and MCT + Cur NP animals, respectively (Figure 3-20, Panel B,

P<0.05) and IL-1β message level was 227% higher and 7% lower in the MCT and MCT

+ Cur NP animals, respectively (Figure 3-20, Panel C, P<0.05).

Curcumin nanoparticle treatment decreases AMPK alpha phosphorylation but not

MAPK or apoptotic signaling

Compared to the control animals, the amount of p-AMPK alpha was decreased

by 36% and 22% in the MCT and MCT + Cur NP animals, respectively (P<0.05) (Figure

3-21). No differences in the ratio of Bax/Bcl-2, the amount of cleaved caspase-3, p-

ERK1/2, p-p38, or p-JNK1/2 was observed with nanoparticle treatment.

Curcumin nanoparticle treatment decreases MCT-induced increases in oxidative

stress signaling

Compared to the control animals, the amount of HSP 27was 25% and 15%

higher in the MCT and MCT + Cur NP animals (Figure 7, Panel A, P<0.05). Like that

observed for HSP 27, HSP70 protein levels were 42% and 22% higher in the MCT and

MCT + Cur NP animals (Figure 3-22, Panel B, P<0.05). Likewise, 3-nitrotyrosine protein

was 23% higher in the MCT animals and 11% higher in the MCT + Cur NP animals

(Figure 3-22, Panel C, P<0.05).

90

Discussion

Recent studies have suggested that curcumin may be effective for the treatment

of neurodegenerative, pulmonary, autoimmune, and neoplastic diseases [28]. In

addition, other data have demonstrated that curcumin is able to prevent cardiac

hypertrophy and heart failure in a murine model of salt-induced hypertension [35]. In an

effort to extend these findings, the present study investigated whether treatment with

curcumin nanoparticles was able to attenuate the development of monocrotaline-

induced RV hypertrophy following pulmonary arterial hypertension. Herein, we

demonstrate that the administration of curcumin nanoparticles (50 mg/kg /i.p.) for seven

days is capable of diminishing the development of pulmonary arterial pressure and right

ventricular remodeling in the rat MCT model of pulmonary arterial hypertension (Figures

3-17, 3-18, and 3-19). These changes appear to be associated with decreased serum

TNF-α levels and evidence of diminished hypertrophic signaling and oxidative stress in

the heart (Figures 3-20, 3-21, and 3-22). Taken together, these results are consistent

with the possibility that curcumin nanoparticle treatment may be efficacious for the

treatment of pulmonary arterial hypertension.

The most commonly used animal model of PAH utilizes monocrotaline to

selectively injure the pulmonary vasculature, which causes an increase in pulmonary

vascular resistance [70, 192]. Similar to the previous reports [186, 193], our

echocardiography data demonstrated that MCT insult resulted in the obstruction to

pulmonary arterial flow and increases in pulmonary artery pressure (Figure 3-17). These

91

changes in vascular function pressure, in turn, are associated with increased right

ventricular mass and free wall thickness (Table 3-3, Figure 3-18).

In an effort to better understand the nature of RV hypertrophy we next examined

if MCT insult was associated with changes in contractile protein expression and an

increase in non-contractile tissue. Consistent with previous data [161, 194], we found

that MCT-insult was associated with an increase in the amount of slow β-myosin heavy

chain (MHC) isoform, tissue fibrosis and fibronectin protein expression in the pressure

overloaded right ventricle (Figure 3-19, Panels A, B, C). Importantly, we found that the

administration of Cur NP was associated with evidence of diminished cardiac

hypertrophy and tissue fibrosis (Table 3-3, Figures 3-18 and 3-19).

How Cur NP administration may function to diminish cardiac hypertrophy and the

development of fibrosis is currently unclear. Previous reports have suggested that

curcumin can act as an anti-fibrotic agent and that the chronic administration of

curcumin can attenuate the development of pulmonary fibrosis in the rat. It has been

hypothesized that this effect may be related to the ability of curcumin to reduce

inflammation [33]. Consistent with this possibility, and the work of others using bulk

curcumin preparations [195], we found that Cur NP associated decreases in cardiac

fibrosis were associated with diminished serum TNF-α protein and decreased

ventricular TNF-α mRNA expression (Figure 3-20, Panels A, B). Whether these

changes in TNF-α regulation are directly responsible for the changes we see in cardiac

remodeling is unknown and will require further experimentation.

92

The molecular events that govern the development of cardiac hypertrophy are

not entirely clear. Recent data has suggested that the phosphorylation (activation) of α-

AMPK functions to inhibit cardiac hypertrophy following chronic pressure overload [196].

Supporting this contention, we observed that MCT-induced cardiac hypertrophy was

associated with decreases in α-AMPK phosphorylation (Figure 3-21). As expected from

our analysis of cardiac hypertrophy at the tissue level, we noted that Cur NP

administration appeared to up-regulate α-AMPK phosphorylation (Figure 3-21 Panel A).

Whether this up-regulation of α-AMPK phosphorylation is related to decreases in

cellular inflammation or changes in TNF-α expression is unknown and will require

further experimentation.

It has been reported that the increases in tissue inflammation/oxidative stress

seen during pressure-overload induced RV hypertrophy can cause an up-regulation in

heat shock protein expression [197, 198]. Supporting this contention, we observed that

PAH induced cardiac hypertrophy was associated with increased expression of HSP-27

and HSP-70 in the right ventricle (Figure 3-22). Consistent with our hypertrophy data,

we also noted that Cur NP administration was associated with a down-regulation of the

expression of HSP-27 (Figure 3-22 Panel A) and HSP-70 (Figure 3-22 Panel B) and

decreased levels of oxidative stress. In addition to increases in HSP expression,

pressure overload has also been shown to increase tissue oxidative stress [199].

Similar to our HSP data, we found that MCT-insult caused an elevation in 3-nitrotyrosine

levels and that 3-nitrotyrosine levels were diminished with Cur NP administration (Figure

3-22 Panel C). These data are consistent with the previous work of others showing that

93

curcumin treatment prevented diabetes-induced increases in retinal nitro tyrosine levels

[200].

In conclusion, the data of the present study demonstrate that Cur NP treatment

can attenuate the development of RV hypertrophy in the rat MCT model of PAH.

Although the exact mechanism of action is not clear, our data suggest that the

attenuated hypertrophy we observe following Cur NP administration may be related to

decreases in TNF-α levels, the activation of α-AMPK, and diminished oxidative stress.

Although prior work studies have reported that curcumin administration can prevent

cardiac remodeling it should be noted that the curcumin levels used in this study were

much higher (150mg/kg/day for 7 weeks) than those used in the present study [201].

Whether Cur NP treatment is effective in preventing other types of cardiac hypertrophy

will require additional study.

94

Table 3-2. Body and organ weight for control, MCT only and MCT + Cur NP rats collected 4 weeks after injection of MCT (60mg/kg). Values are expressed as mean ± SEM; n=6 for each group. * P<0.05 significantly different from control rats and † P<0.05 significantly different from MCT only rats.

95

Figure 3-16.Optical characterization of curcumin nanoparticles. Curcumin nanoparticles were observed under SEM (Panels A, B) and AFM imaging (Panel C).

96

Figure 3-17.Curcumin nanoparticle treatment improves MCT-induced decreases in pulmonary artery flow. Representative image from a MCT only animal at day 1 (Panel A) and at day 28 (Panel B). Note mid-systolic notch at day 28 (arrow). Images from a MCT + Cur NP treated animal at day 1 (Panel C) and at day 28 (Panel D). Curcumin nanoparticle treatment decreases MCT-induced increases in pulmonary artery flow acceleration (Panel E) and increases the slope of the pulmonary artery acceleration vector (Panel F). Values are expressed as mean ± SEM; n=6 for each group. * P<0.05 vs. the control group; † P<0.05 vs. the MCT + Cur NP group.

97

Figure 3-18.Curcumin nanoparticle treatment attenuates PAH induced increases in RV anterior free wall thickness. M-mode echocardiography images of a MCT only animal at day 1 (Panel A), and at day 28 (Panel B). Images from a MCT + Cur NP treated animal at day 1 (Panel C) and at day 28 (Panel D).Quantification of Doppler echocardiography (Panel E). Values are expressed as mean ± SEM; n=6 for each group. * P<0.05 vs. the base line of MCT only group;

98

Figure 3-19.Curcumin nanoparticle treatment decreases PAH-induced cardiac remodeling. Myosin heavy chain-β abundance in the RV as determined by immunoblotting and normalized to the amount of GAPDH (Panel A). Picrosirius red staining of right ventricular tissue from control (Panel B), MCT only (Panel C) and MCT + Cur NP treated animals (Panel D). Fibronectin protein abundance normalized to the expression of GAPDH (Panel E). Scale bar 50 μm. Graphical data are expressed as mean ± SEM; n=6 for each group. * P<0.05 vs. the control group; † P<0.05 vs. the MCT + Cur NP group.

99

Figure 3-20. Curcumin nanoparticle treatment diminished MCT-induced increases in inflammatory cytokines. Serum protein TNF-α levels (Panel A).Right ventricular mRNA expression levels of TNF-α (Panel B) and IL-1β (Panel C). Values are expressed as mean ± SEM; n=5 for each group. * P<0.05 vs. the control group; † P<0.05 vs. the MCT + Cur NP group.

100

Figure 3-21. Curcumin nanoparticle treatment alters AMPK-α activation but does not change MAPK or apoptotic signaling. Protein expression was determined in RV tissue by immunoblotting and normalized to the expression of GAPDH. Values are expressed as mean ± SE; n=6 for each group. * P<0.05 vs. the control group; † P<0.05 vs. the MCT + Cur NP group.

101

Figure 3-22.Curcumin nanoparticle treatment attenuates PAH-associated increases in heat shock protein and protein nitrosylation. The abundance expression of Hsp-27 (Panel A), Hsp-70 (Panel B) and nitro tyrosine (Panel C) were determined by immunoblotting and normalized to the expression of GAPDH. Values are expressed as mean ± SEM; n=6 for each group. * P<0.05 vs. the control group; † P<0.05 vs. the MCT + Cur NP group.

102

CHAPTER IV

GENERAL DISCUSSION

Pulmonary arterial hypertension (PAH) affects almost 15-52 people per million

people [202]. As of yet, no cure for PAH has been found and the long term survival

remains poor. Even with modern medical therapy, most of the patients experience

progression of their disease and many are referred for lung transplantation [5]. Right

ventricular failure is the leading cause of death in patients with PAH. The exact

molecular mechanisms underlying the structural and functional alterations that lead to

the RV dysfunction are not well understood. Although animal models lack the

development of the classical plexiform lesions seen in human PAH, it is thought that the

rat monocrotaline injury is useful for studying the pathological processes seen in human

PAH.

Recent data suggests that increases in pulmonary artery resistance are the main

causative agent in the development of PAH-induced RV hypertrophy and RV

dysfunction [203]. In addition to increased mechanical loading, other data has

demonstrated that the development of right heart failure may also be mediated, at least

in part, by increases in reactive oxygen species and inflammatory mediators [9].

The primary purpose of this study was to determine the efficacy of CeO2 and

curcumin nanoparticles to attenuate monocrotaline-induced PAH and RV hypertrophy.

To accomplish this goal, we examined the effects of nanoparticle administration on

pulmonary artery pressure/flow, RV thickness as determined by echocardiography, RV

103

mass, RV fibrosis, myocyte cross sectional area, and indices of oxidative stress and

myocardial apoptosis.

Effects of CeO2 nanoparticle administration on monocrotaline-induced RV

hypertrophy in Sprague-Dawley rats

Previous study has shown that CeO2nanoparticles exhibit antioxidant activity

both in vitro and in vivo [106]. Other data has shown that CeO2 nanoparticles may also

exhibit catalytic activities similar to superoxide dismutase and catalase [109]. Recent

work has shown that the administration of CeO2 nanoparticles can inhibit left ventricular

dysfunction and myocardial oxidative stress in the MCP-1 transgenic mouse model of

cardiomyopathy [23]. Similarly, Kong and coworkers demonstrated that CeO2

nanoparticles could inhibit retinal degeneration in tubby mice and that this finding was

associated with diminished oxidative stress and a down-regulation of apoptotic signaling

[109].

Here, we observed that that CeO2 nanoparticle administration is capable of

preventing monocrotaline-induced PAH and RV hypertrophy in male Sprague Dawley

rats (Chapter 3, Paper #1). Specifically, our echocardiography and histological data

demonstrate that CeO2 nanoparticle administration was associated with a lower RV

weight to body weight ratio, decreased cardiomyocyte fiber cross sectional area, and

diminished RV myocardial fibrosis.

104

Other data from this study suggest that CeO2 nanoparticle treatment is able to

diminish monocrotaline-induced increases in cellular ROS and cardiomyocyte apoptosis

(Chapter 3, Paper #1). Specifically, we observed that CeO2 nanoparticle administration

was associated with decreases in superoxide anion, diminished protein nitrosylation, an

attenuation in apoptotic signaling ( Bax/Bcl2 ratio and caspase-3 cleavage), reduced

activation of stress-associated signaling ( p-ERK1/2, p-JNK, HSP-27, and NF-kB p-50)

and the down-regulation of inflammatory cytokines. Whether these changes in cellular

ROS and signaling are directly responsible for the attenuation of monocrotaline-induced

RV hypertrophy will require further investigation.

Effects of curcumin nanoparticle administration on monocrotaline-induced right

ventricular hypertrophy in Sprague Dawley rats

Curcumin (diferuloylmethane) is a polyphenolic compound found in turmeric that

has been used in the ancient Indian Ayurvedic medicine for centuries to treat biliary

disorders, anorexia, cough, diabetic wounds, liver disorders, rheumatism, and

respiratory conditions [116]. Curcumin is a phenolic compound that has been shown to

exhibit anti-oxidant, anti-inflammatory, anti-microbial, and anti-carcinogenic activities

[26, 27, 177]. Recent studies have shown that curcumin administration can prevent

cardiac hypertrophy and heart failure in a murine model of salt-induced hypertension

[201]. In addition, curcumin has been shown to diminish the deleterious effects of

inflammatory cytokines [204], and to inhibit pulmonary fibrosis in rats [33].

105

Similarly, Yao and coworkers demonstrated that curcumin could inhibit the

pressure overload left ventricular hypertrophy in rabbits and that this finding was

associated with diminished tumor necrosis factor-alpha levels, decreased matrix

metalloproteinase-2 expression and the inhibition of collagen remodeling [184].

Here for the first time we observed that Cur NP administration is capable of

preventing monocrotaline-induced PAH and RV hypertrophy in male Sprague Dawley

rats (Chapter 3, Paper #2). Our echocardiography and histological data demonstrate

that Cur NP administration was associated with diminished RV weight to body weight

ratio, decreased RV anterior free wall thickness and diminished RV myocardial fibrosis.

We also observed that Cur NP administration was associated with decreases in protein

expression of cardiac remodeling ( β-MHC and fibronectin), decreases in oxidative

stress associated signaling ( HSP-27, HSP-70, and nitro-tyrosine) and the down-

regulation of inflammatory cytokines. Whether these changes in molecular signaling are

directly responsible for the amelioration of monocrotaline-induced RV hypertrophy will

require further investigation.

SUMMARY

1. Monocrotaline insult is associated with significant increases in pulmonary arterial

pressure and right ventricular hypertrophy in the male Sprague Dawley rats.

106

2. Monocrotaline-induced right ventricular hypertrophy is associated with increases

in indices of oxidative stress (superoxide anion, protein carbonylation) and

protein nitrosylation.

3. The administration of CeO2 nanoparticles appeared to attenuate monocrotaline-

induced increases in pulmonary arterial pressure along with right ventricular

cardiomyocyte cross sectional area and fibrosis.

4. The administration of CeO2 nanoparticles attenuated monocrotaline-induced

increases in oxidative stress.

5. The administration of CeO2 nanoparticles reduced monocrotaline-induced

increases in ERK1/2, JNK, HSP-27 and NF-kB activation.

6. CeO2 nanoparticles treated animals exhibited diminished monocrotaline

associated apoptotic signaling.

7. Curcumin nanoparticle administration attenuated monocrotaline-induced

increases in right ventricular hypertrophy and fibrosis.

8. Curcumin nanoparticle administration was associated with diminished

monocrotaline associated increases in serum TNF-α and decreased cardiac heat

shock protein expression.

107

Figure 4-1. Possible role of CeO2 nanoparticles in attenuation of MCT-induced RV

hypertrophy following pulmonary arterial hypertension.

108

Figure 4-2. Possible role of Cur NP in cardiac remodeling following pulmonary

arterial hypertension.

109

FUTURE DIRECTIONS

The present study investigated the efficacy of using nanoparticles to attenuate

the development of the cardiac hypertrophy seen following pulmonary arterial

hypertension in the male Sprague Dawley rats. Our data suggest that the administration

of CeO2 and curcumin nanoparticles is capable of diminishing MCT-induced increases

in pulmonary arterial pressure and indices of right ventricular hypertrophy, myocardial

oxidative stress, and apoptosis in male Sprague Dawley rats. Although these results are

promising, additional studies are required to determine the exact mechanism(s)

responsible for these findings. Future areas of study could include the following areas of

inquiry.

It is possible that the distribution and accumulation of nanoparticles in the body

may pose deleterious effects on the health of individuals. Determination of

CeO2/curcumin nanoparticles levels in the blood and tissues (pulmonary artery, lung,

heart, liver and kidney) is of interest to determine whether treatment with these

materials is potentially hazardous. Findings from the present study suggest that

treatment with CeO2/curcumin nanoparticles is able to diminish MCT-induced increases

in cardiac oxidative stress in male Sprague Dawley rats. Little is currently known about

how the administration of CeO2/curcumin nanoparticles may provide cardioprotective

effects. Previous reports suggested that CeO2 nanoparticles may act as antioxidant

[107]. Similarly, curcumin has been suggested to exhibit antioxidant and anti-

inflammatory effects [205]. Future studies could be directed at investigating whether the

110

effect of CeO2 or curcumin nanoparticle treatment is due to increased free radical

scavenging or due to the increased expression of antioxidant enzymes.

Previous studies have shown that CeO2 nanoparticles can attenuate the effects

of chronic inflammation by acting as free radical scavengers [15]. To directly assess this

possibility in endothelial cells, bovine pulmonary artery endothelial cells (BPAE) cells

could be exposed to various concentrations of H2O2 with and without CeO2

nanoparticles in the media. Treatment effectiveness could be established with the

measurement of 2’,7’-dichlorfluorescein-diacetate (DCFH-DA) fluorescence intensity or

by assessing cell viability with the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium

bromide (MTT) assay.

Findings from the present study suggest that CeO2/curcumin nanoparticle

treatment may attenuate MCT-induced RV hypertrophy following pulmonary arterial

hypertension. How CeO2/curcumin nanoparticle administration attenuated pulmonary

arterial pressure is not clear. Future studies could explore whether nanoparticle

administration has an effect on MCT-induced pulmonary artery fibrosis and stiffness.

Similarly, other experiments could examine the lungs for changes in inflammatory

markers, oxidative stress levels and cellular apoptosis. Results from such studies will no

doubt help us to better understand the disease process and therapeutic efficiency.

According to the reports from the Center for Disease Control and Prevention the

incidence of PAH is ~4:1 higher in women than men [206]. Why more women suffer

111

from PAH than men is currently not clear. Future studies using female rats could further

our understanding of the influence of sex on the pathophysilogy of monocrotaline-

induced pulmonary arterial hypertension and could be invaluable for helping to

determine whether treatment with CeO2/curcumin nanoparticles is safe.

112

References

1. Suesaowalak, M., J.P. Cleary, and A.C. Chang, Advances in diagnosis and treatment of pulmonary arterial hypertension in neonates and children with congenital heart disease. World J Pediatr, 2010. 6(1): p. 13-31.

2. Galie, N., A. Manes, and A. Branzi, Evaluation of pulmonary arterial hypertension. Curr Opin Cardiol, 2004. 19(6): p. 575-81.

3. Johnson, S.G., et al., Key Articles and Guidelines in the Management of Pulmonary Arterial Hypertension: 2011 Update. Pharmacotherapy, 2012.

4. Barst, R.J., et al., Updated evidence-based treatment algorithm in pulmonary arterial hypertension. J Am Coll Cardiol, 2009. 54(1 Suppl): p. S78-84.

5. Houtchens, J., D. Martin, and J.R. Klinger, Diagnosis and management of pulmonary arterial hypertension. Pulm Med, 2011. 2011: p. 845864.

6. Valko, M., et al., Free radicals and antioxidants in normal physiological functions and human disease. Int J Biochem Cell Biol, 2007. 39(1): p. 44-84.

7. Chandel, N.S., et al., Role of oxidants in NF-kappa B activation and TNF-alpha gene transcription induced by hypoxia and endotoxin. J Immunol, 2000. 165(2): p. 1013-21.

8. Hoshikawa, Y., et al., Generation of oxidative stress contributes to the development of pulmonary hypertension induced by hypoxia. J Appl Physiol, 2001. 90(4): p. 1299-306.

9. Crosswhite, P. and Z. Sun, Nitric oxide, oxidative stress and inflammation in pulmonary arterial hypertension. J Hypertens, 2010. 28(2): p. 201-12.

10. Archer, S.L., E.K. Weir, and M.R. Wilkins, Basic science of pulmonary arterial hypertension for clinicians: new concepts and experimental therapies. Circulation, 2010. 121(18): p. 2045-66.

11. Ghodsi, F. and J.A. Will, Changes in pulmonary structure and function induced by monocrotaline intoxication. Am J Physiol, 1981. 240(2): p. H149-55.

12. Roth, R.A. and J.F. Reindel, Lung vascular injury from monocrotaline pyrrole, a putative hepatic metabolite. Adv Exp Med Biol, 1991. 283: p. 477-87.

13. Wilson, D.W., et al., Progressive inflammatory and structural changes in the pulmonary vasculature of monocrotaline-treated rats. Microvasc Res, 1989. 38(1): p. 57-80.

14. Meyrick, B. and L. Reid, Development of pulmonary arterial changes in rats fed Crotalaria spectabilis. Am J Pathol, 1979. 94(1): p. 37-50.

15. Rzigalinski, B.A., Nanoparticles and cell longevity. Technol Cancer Res Treat, 2005. 4(6): p. 651-9.

16. Korsvik, C., et al., Superoxide dismutase mimetic properties exhibited by vacancy engineered ceria nanoparticles. Chem Commun (Camb), 2007(10): p. 1056-8.

17. E. Mamontov, S.T., Lattice Defects and Oxygen Storage Capacity of Nanocrystalline Ceria and Ceria-Zirconia. J. Phys. Chem. B, 2000. 104 (47): p. 11110–11116.

113

18. Kuiry, S.C., et al., Spontaneous self-assembly of cerium oxide nanoparticles to nanorods through supraaggregate formation. J Phys Chem B, 2005. 109(15): p. 6936-9.

19. Chen, L., et al., Nanoparticle-mediated delivery of pitavastatin into lungs ameliorates the development and induces regression of monocrotaline-induced pulmonary artery hypertension. Hypertension, 2011. 57(2): p. 343-50.

20. Singh, N., C.A. Cohen, and B.A. Rzigalinski, Treatment of neurodegenerative disorders with radical nanomedicine. Ann N Y Acad Sci, 2007. 1122: p. 219-30.

21. Schubert, D., et al., Cerium and yttrium oxide nanoparticles are neuroprotective. Biochem Biophys Res Commun, 2006. 342(1): p. 86-91.

22. Tarnuzzer, R.W., et al., Vacancy engineered ceria nanostructures for protection from radiation-induced cellular damage. Nano Lett, 2005. 5(12): p. 2573-7.

23. Niu, J., et al., Cardioprotective effects of cerium oxide nanoparticles in a transgenic murine model of cardiomyopathy. Cardiovasc Res, 2007. 73(3): p. 549-59.

24. Abrams, J.S., Immunoenzymetric assay of mouse and human cytokines using NIP-labeled anti-cytokine antibodies. Curr Protoc Immunol, 2001. Chapter 6: p. Unit 6 20.

25. Jurenka, J.S., Anti-inflammatory properties of curcumin, a major constituent of Curcuma longa: a review of preclinical and clinical research. Altern Med Rev, 2009. 14(2): p. 141-53.

26. Sharma, O.P., Antioxidant activity of curcumin and related compounds. Biochem Pharmacol, 1976. 25(15): p. 1811-2.

27. Mukhopadhyay, A., et al., Anti-inflammatory and irritant activities of curcumin analogues in rats. Agents Actions, 1982. 12(4): p. 508-15.

28. Aggarwal, B.B. and K.B. Harikumar, Potential therapeutic effects of curcumin, the anti-inflammatory agent, against neurodegenerative, cardiovascular, pulmonary, metabolic, autoimmune and neoplastic diseases. Int J Biochem Cell Biol, 2009. 41(1): p. 40-59.

29. Aggarwal, B.B., et al., Curcumin suppresses the paclitaxel-induced nuclear factor-kappaB pathway in breast cancer cells and inhibits lung metastasis of human breast cancer in nude mice. Clin Cancer Res, 2005. 11(20): p. 7490-8.

30. Hatcher, H., et al., Curcumin: from ancient medicine to current clinical trials. Cell Mol Life Sci, 2008. 65(11): p. 1631-52.

31. Cho, J.W., K.S. Lee, and C.W. Kim, Curcumin attenuates the expression of IL-1beta, IL-6, and TNF-alpha as well as cyclin E in TNF-alpha-treated HaCaT cells; NF-kappaB and MAPKs as potential upstream targets. Int J Mol Med, 2007. 19(3): p. 469-74.

32. Joe, B. and B.R. Lokesh, Role of capsaicin, curcumin and dietary n-3 fatty acids in lowering the generation of reactive oxygen species in rat peritoneal macrophages. Biochim Biophys Acta, 1994. 1224(2): p. 255-63.

33. Punithavathi, D., N. Venkatesan, and M. Babu, Curcumin inhibition of bleomycin-induced pulmonary fibrosis in rats. Br J Pharmacol, 2000. 131(2): p. 169-72.

34. Manikandan, P., et al., Curcumin modulates free radical quenching in myocardial ischaemia in rats. Int J Biochem Cell Biol, 2004. 36(10): p. 1967-80.

114

35. Morimoto, T., et al., The dietary compound curcumin inhibits p300 histone acetyltransferase activity and prevents heart failure in rats. J Clin Invest, 2008. 118(3): p. 868-78.

36. Lao, C.D., et al., Dose escalation of a curcuminoid formulation. BMC Complement Altern Med, 2006. 6: p. 10.

37. Tonnesen, H.H., Solubility, chemical and photochemical stability of curcumin in surfactant solutions. Studies of curcumin and curcuminoids, XXVIII. Pharmazie, 2002. 57(12): p. 820-4.

38. Pathak, N. and S. Khandelwal, Comparative efficacy of piperine, curcumin and picroliv against Cd immunotoxicity in mice. Biometals, 2008. 21(6): p. 649-61.

39. Yallapu, M.M., M. Jaggi, and S.C. Chauhan, Curcumin nanoformulations: a future nanomedicine for cancer. Drug Discov Today, 2012. 17(1-2): p. 71-80.

40. Ganta, S., H. Devalapally, and M. Amiji, Curcumin enhances oral bioavailability and anti-tumor therapeutic efficacy of paclitaxel upon administration in nanoemulsion formulation. J Pharm Sci, 2010. 99(11): p. 4630-41.

41. Bansal, S.S., et al., Advanced drug delivery systems of curcumin for cancer chemoprevention. Cancer Prev Res (Phila), 2011. 4(8): p. 1158-71.

42. Li, L., F.S. Braiteh, and R. Kurzrock, Liposome-encapsulated curcumin: in vitro and in vivo effects on proliferation, apoptosis, signaling, and angiogenesis. Cancer, 2005. 104(6): p. 1322-31.

43. Bisht, S., et al., Polymeric nanoparticle-encapsulated curcumin ("nanocurcumin"): a novel strategy for human cancer therapy. J Nanobiotechnology, 2007. 5: p. 3.

44. Sztrymf, B., et al., Beneficial effects of loxapine on agitation and breathing patterns during weaning from mechanical ventilation. Crit Care, 2010. 14(3): p. R86.

45. Simonneau, G., et al., Updated clinical classification of pulmonary hypertension. J Am Coll Cardiol, 2009. 54(1 Suppl): p. S43-54.

46. Demarco, V.G., et al., Contribution of oxidative stress to pulmonary arterial hypertension. World J Cardiol, 2010. 2(10): p. 316-24.

47. Hirst, S.M., et al., Anti-inflammatory properties of cerium oxide nanoparticles. Small, 2009. 5(24): p. 2848-56.

48. Nazam Ansari, M., U. Bhandari, and K.K. Pillai, Protective role of curcumin in myocardial oxidative damage induced by isoproterenol in rats. Hum Exp Toxicol, 2007. 26(12): p. 933-8.

49. McLaughlin, V.V., et al., ACCF/AHA 2009 expert consensus document on pulmonary hypertension: a report of the American College of Cardiology Foundation Task Force on Expert Consensus Documents and the American Heart Association: developed in collaboration with the American College of Chest Physicians, American Thoracic Society, Inc., and the Pulmonary Hypertension Association. Circulation, 2009. 119(16): p. 2250-94.

50. Tabima, D.M., S. Frizzell, and M.T. Gladwin, Reactive oxygen and nitrogen species in pulmonary hypertension. Free Radic Biol Med, 2012. 52(9): p. 1970-86.

51. Ryan, J.J., et al., The WHO classification of pulmonary hypertension: A case-based imaging compendium. Pulm Circ, 2012. 2(1): p. 107-21.

115

52. Stringham, R. and N.R. Shah, Pulmonary arterial hypertension: an update on diagnosis and treatment. Am Fam Physician, 2010. 82(4): p. 370-7.

53. Hoendermis, E.S., Pulmonary arterial hypertension: an update. Neth Heart J, 2011. 19(12): p. 514-22.

54. Hyduk, A., et al., Pulmonary hypertension surveillance--United States, 1980-2002. MMWR Surveill Summ, 2005. 54(5): p. 1-28.

55. Humbert, M., et al., Pulmonary arterial hypertension in France: results from a national registry. Am J Respir Crit Care Med, 2006. 173(9): p. 1023-30.

56. Badesch, D.B., et al., Pulmonary arterial hypertension: baseline characteristics from the REVEAL Registry. Chest, 2010. 137(2): p. 376-87.

57. Barst, R.J., A review of pulmonary arterial hypertension: role of ambrisentan. Vasc Health Risk Manag, 2007. 3(1): p. 11-22.

58. Runge, M.S., K. Molnar, and N.R. Madamanchi, "Old" hearts and arteries: the role of oxidative stress. Trans Am Clin Climatol Assoc, 2010. 121: p. 52-8; discussion 59-60.

59. Hessel, M., et al., Pressure overload-induced right ventricular failure is associated with re-expression of myocardial tenascin-C and elevated plasma tenascin-C levels. Cell Physiol Biochem, 2009. 24(3-4): p. 201-10.

60. Hessel, M.H., et al., Characterization of right ventricular function after monocrotaline-induced pulmonary hypertension in the intact rat. Am J Physiol Heart Circ Physiol, 2006. 291(5): p. H2424-30.

61. Morkin, E., Regulation of myosin heavy chain genes in the heart. Circulation, 1993. 87(5): p. 1451-60.

62. Cooper, G.t., Load and length regulation of cardiac energetics. Annu Rev Physiol, 1990. 52: p. 505-22.

63. Simonides, W.S., et al., Hypoxia-inducible factor induces local thyroid hormone inactivation during hypoxic-ischemic disease in rats. J Clin Invest, 2008. 118(3): p. 975-83.

64. Joppa, P., et al., Oxidative stress in patients with COPD and pulmonary hypertension. Wien Klin Wochenschr, 2007. 119(13-14): p. 428-34.

65. Takimoto, E. and D.A. Kass, Role of oxidative stress in cardiac hypertrophy and remodeling. Hypertension, 2007. 49(2): p. 241-8.

66. Ray, R. and A.M. Shah, NADPH oxidase and endothelial cell function. Clin Sci (Lond), 2005. 109(3): p. 217-26.

67. Cheng, T.H., et al., Involvement of reactive oxygen species in angiotensin II-induced endothelin-1 gene expression in rat cardiac fibroblasts. J Am Coll Cardiol, 2003. 42(10): p. 1845-54.

68. Tsuruda, T., et al., Brain natriuretic Peptide is produced in cardiac fibroblasts and induces matrix metalloproteinases. Circ Res, 2002. 91(12): p. 1127-34.

69. Kay, J.M., P. Harris, and D. Heath, Pulmonary hypertension produced in rats by ingestion of Crotalaria spectabilis seeds. Thorax, 1967. 22(2): p. 176-9.

70. Wilson, D.W., et al., Mechanisms and pathology of monocrotaline pulmonary toxicity. Crit Rev Toxicol, 1992. 22(5-6): p. 307-25.

71. Faul, J.L., et al., Triptolide attenuates pulmonary arterial hypertension and neointimal formation in rats. Am J Respir Crit Care Med, 2000. 162(6): p. 2252-8.

116

72. Barer, G.R., P. Howard, and J.W. Shaw, Stimulus-response curves for the pulmonary vascular bed to hypoxia and hypercapnia. J Physiol, 1970. 211(1): p. 139-55.

73. Rabinovitch, M., et al., Rat pulmonary circulation after chronic hypoxia: hemodynamic and structural features. Am J Physiol, 1979. 236(6): p. H818-27.

74. Stenmark, K.R., et al., Animal models of pulmonary arterial hypertension: the hope for etiological discovery and pharmacological cure. Am J Physiol Lung Cell Mol Physiol, 2009. 297(6): p. L1013-32.

75. Nauser, T.D. and S.W. Stites, Diagnosis and treatment of pulmonary hypertension. Am Fam Physician, 2001. 63(9): p. 1789-98.

76. Chin, K.M. and L.J. Rubin, Pulmonary arterial hypertension. J Am Coll Cardiol, 2008. 51(16): p. 1527-38.

77. Miyamoto, S., et al., Clinical correlates and prognostic significance of six-minute walk test in patients with primary pulmonary hypertension. Comparison with cardiopulmonary exercise testing. Am J Respir Crit Care Med, 2000. 161(2 Pt 1): p. 487-92.

78. McQuillan, B.M., et al., Clinical correlates and reference intervals for pulmonary artery systolic pressure among echocardiographically normal subjects. Circulation, 2001. 104(23): p. 2797-802.

79. Marcus, J.T., et al., Interventricular mechanical asynchrony in pulmonary arterial hypertension: left-to-right delay in peak shortening is related to right ventricular overload and left ventricular underfilling. J Am Coll Cardiol, 2008. 51(7): p. 750-7.

80. Resten, A., et al., Pulmonary hypertension: CT of the chest in pulmonary venoocclusive disease. AJR Am J Roentgenol, 2004. 183(1): p. 65-70.

81. Rubin, L.J., Diagnosis and management of pulmonary arterial hypertension: ACCP evidence-based clinical practice guidelines. Chest, 2004. 126(1 Suppl): p. 7S-10S.

82. Hrometz, S.L. and K.M. Shields, Role of ambrisentan in the management of pulmonary hypertension. Ann Pharmacother, 2008. 42(11): p. 1653-9.

83. Jones, D.A., C.W. Benjamin, and D.A. Linseman, Activation of thromboxane and prostacyclin receptors elicits opposing effects on vascular smooth muscle cell growth and mitogen-activated protein kinase signaling cascades. Mol Pharmacol, 1995. 48(5): p. 890-6.

84. Barst, R.J., et al., A comparison of continuous intravenous epoprostenol (prostacyclin) with conventional therapy for primary pulmonary hypertension. The Primary Pulmonary Hypertension Study Group. N Engl J Med, 1996. 334(5): p. 296-302.

85. Giaid, A., et al., Expression of endothelin-1 in the lungs of patients with pulmonary hypertension. N Engl J Med, 1993. 328(24): p. 1732-9.

86. Channick, R., et al., Effects of the dual endothelin receptor antagonist bosentan in patients with pulmonary hypertension: a placebo-controlled study. J Heart Lung Transplant, 2001. 20(2): p. 262-263.

87. Oudiz, R.J., et al., Long-term ambrisentan therapy for the treatment of pulmonary arterial hypertension. J Am Coll Cardiol, 2009. 54(21): p. 1971-81.

88. Corbin, J.D. and S.H. Francis, Pharmacology of phosphodiesterase-5 inhibitors. Int J Clin Pract, 2002. 56(6): p. 453-9.

117

89. Francis, S.H. and J.D. Corbin, Molecular mechanisms and pharmacokinetics of phosphodiesterase-5 antagonists. Curr Urol Rep, 2003. 4(6): p. 457-65.

90. Stamm, J.A., M.G. Risbano, and M.A. Mathier, Overview of current therapeutic approaches for pulmonary hypertension. Pulm Circ, 2011. 1(2): p. 138-59.

91. Frey, M.K. and I. Lang, Tadalafil for the treatment of pulmonary arterial hypertension. Expert Opin Pharmacother, 2012. 13(5): p. 747-55.

92. Rich, S., E. Kaufmann, and P.S. Levy, The effect of high doses of calcium-channel blockers on survival in primary pulmonary hypertension. N Engl J Med, 1992. 327(2): p. 76-81.

93. Lachmanova, V., et al., N-acetylcysteine inhibits hypoxic pulmonary hypertension most effectively in the initial phase of chronic hypoxia. Life Sci, 2005. 77(2): p. 175-82.

94. Csiszar, A., et al., Resveratrol prevents monocrotaline-induced pulmonary hypertension in rats. Hypertension, 2009. 54(3): p. 668-75.

95. Kamezaki, F., et al., Gene transfer of extracellular superoxide dismutase ameliorates pulmonary hypertension in rats. Am J Respir Crit Care Med, 2008. 177(2): p. 219-26.

96. Farrow, K.N., et al., Superoxide dismutase restores eNOS expression and function in resistance pulmonary arteries from neonatal lambs with persistent pulmonary hypertension. Am J Physiol Lung Cell Mol Physiol, 2008. 295(6): p. L979-87.

97. Elmedal, B., et al., The superoxide dismutase mimetic, tempol, blunts right ventricular hypertrophy in chronic hypoxic rats. Br J Pharmacol, 2004. 141(1): p. 105-13.

98. Redout, E.M., et al., Antioxidant treatment attenuates pulmonary arterial hypertension-induced heart failure. Am J Physiol Heart Circ Physiol, 2010. 298(3): p. H1038-47.

99. Bawa, R., et al., Protecting new ideas and inventions in nanomedicine with patents. Nanomedicine, 2005. 1(2): p. 150-8.

100. Yokel, R.A. and R.C. Macphail, Engineered nanomaterials: exposures, hazards, and risk prevention. J Occup Med Toxicol, 2011. 6: p. 7.

101. Kagan, V.E., et al., Fantastic voyage and opportunities of engineered nanomaterials: what are the potential risks of occupational exposures? J Occup Environ Med, 2010. 52(9): p. 943-6.

102. Heckert, E.G., et al., The role of cerium redox state in the SOD mimetic activity of nanoceria. Biomaterials, 2008. 29(18): p. 2705-9.

103. Liu, Y., H. Miyoshi, and M. Nakamura, Nanomedicine for drug delivery and imaging: a promising avenue for cancer therapy and diagnosis using targeted functional nanoparticles. Int J Cancer, 2007. 120(12): p. 2527-37.

104. Riehemann, K., et al., Nanomedicine--challenge and perspectives. Angew Chem Int Ed Engl, 2009. 48(5): p. 872-97.

105. Das, M., et al., Auto-catalytic ceria nanoparticles offer neuroprotection to adult rat spinal cord neurons. Biomaterials, 2007. 28(10): p. 1918-25.

106. Chen, J., et al., Rare earth nanoparticles prevent retinal degeneration induced by intracellular peroxides. Nat Nanotechnol, 2006. 1(2): p. 142-50.

118

107. Rzigalinski, B.A., et al., Radical nanomedicine. Nanomedicine (Lond), 2006. 1(4): p. 399-412.

108. Colon, J., et al., Protection from radiation-induced pneumonitis using cerium oxide nanoparticles. Nanomedicine, 2009. 5(2): p. 225-31.

109. Kong, L., et al., Nanoceria extend photoreceptor cell lifespan in tubby mice by modulation of apoptosis/survival signaling pathways. Neurobiol Dis, 2011. 42(3): p. 514-23.

110. Amin, K.A., et al., The protective effects of cerium oxide nanoparticles against hepatic oxidative damage induced by monocrotaline. Int J Nanomedicine, 2011. 6: p. 143-9.

111. Ma, J.Y., et al., Induction of pulmonary fibrosis by cerium oxide nanoparticles. Toxicol Appl Pharmacol, 2012.

112. Lin, W., et al., Toxicity of cerium oxide nanoparticles in human lung cancer cells. Int J Toxicol, 2006. 25(6): p. 451-7.

113. Park, E.J., et al., Oxidative stress induced by cerium oxide nanoparticles in cultured BEAS-2B cells. Toxicology, 2008. 245(1-2): p. 90-100.

114. Ma, J.Y., et al., Cerium oxide nanoparticle-induced pulmonary inflammation and alveolar macrophage functional change in rats. Nanotoxicology, 2011. 5(3): p. 312-25.

115. Nalabotu, S.K., et al., Intratracheal instillation of cerium oxide nanoparticles induces hepatic toxicity in male Sprague-Dawley rats. Int J Nanomedicine, 2011. 6: p. 2327-35.

116. Ammon, H.P., et al., Curcumin: a potent inhibitor of leukotriene B4 formation in rat peritoneal polymorphonuclear neutrophils (PMNL). Planta Med, 1992. 58(2): p. 226.

117. Biswas, T.K. and B. Mukherjee, Plant medicines of Indian origin for wound healing activity: a review. Int J Low Extrem Wounds, 2003. 2(1): p. 25-39.

118. Epstein, J., I.R. Sanderson, and T.T. Macdonald, Curcumin as a therapeutic agent: the evidence from in vitro, animal and human studies. Br J Nutr, 2010. 103(11): p. 1545-57.

119. Chainani-Wu, N., Safety and anti-inflammatory activity of curcumin: a component of tumeric (Curcuma longa). J Altern Complement Med, 2003. 9(1): p. 161-8.

120. Venkatesan, N. and G. Chandrakasan, Modulation of cyclophosphamide-induced early lung injury by curcumin, an anti-inflammatory antioxidant. Mol Cell Biochem, 1995. 142(1): p. 79-87.

121. De, R., et al., Antimicrobial activity of curcumin against Helicobacter pylori isolates from India and during infections in mice. Antimicrob Agents Chemother, 2009. 53(4): p. 1592-7.

122. Deeb, D.D., et al., Chemosensitization of hormone-refractory prostate cancer cells by curcumin to TRAIL-induced apoptosis. J Exp Ther Oncol, 2005. 5(2): p. 81-91.

123. Karunagaran, D., R. Rashmi, and T.R. Kumar, Induction of apoptosis by curcumin and its implications for cancer therapy. Curr Cancer Drug Targets, 2005. 5(2): p. 117-29.

119

124. Srimal, R.C. and B.N. Dhawan, Pharmacology of diferuloyl methane (curcumin), a non-steroidal anti-inflammatory agent. J Pharm Pharmacol, 1973. 25(6): p. 447-52.

125. Rao, C.V., Regulation of COX and LOX by curcumin. Adv Exp Med Biol, 2007. 595: p. 213-26.

126. Basnet, P. and N. Skalko-Basnet, Curcumin: an anti-inflammatory molecule from a curry spice on the path to cancer treatment. Molecules, 2011. 16(6): p. 4567-98.

127. Jagetia, G.C. and B.B. Aggarwal, "Spicing up" of the immune system by curcumin. J Clin Immunol, 2007. 27(1): p. 19-35.

128. Weaver, K.D., et al., Potentiation of chemotherapeutic agents following antagonism of nuclear factor kappa B in human gliomas. J Neurooncol, 2003. 61(3): p. 187-96.

129. Aggarwal, B.B. and S. Shishodia, Molecular targets of dietary agents for prevention and therapy of cancer. Biochem Pharmacol, 2006. 71(10): p. 1397-421.

130. Miriyala, S., M. Panchatcharam, and P. Rengarajulu, Cardioprotective effects of curcumin. Adv Exp Med Biol, 2007. 595: p. 359-77.

131. Goel, A., A.B. Kunnumakkara, and B.B. Aggarwal, Curcumin as "Curecumin": from kitchen to clinic. Biochem Pharmacol, 2008. 75(4): p. 787-809.

132. Cheng, A.L., et al., Phase I clinical trial of curcumin, a chemopreventive agent, in patients with high-risk or pre-malignant lesions. Anticancer Res, 2001. 21(4B): p. 2895-900.

133. Johnson, J.J. and H. Mukhtar, Curcumin for chemoprevention of colon cancer. Cancer Lett, 2007. 255(2): p. 170-81.

134. Clinical development plan: curcumin. J Cell Biochem Suppl, 1996. 26: p. 72-85. 135. Bisht, S. and A. Maitra, Systemic delivery of curcumin: 21st century solutions for

an ancient conundrum. Curr Drug Discov Technol, 2009. 6(3): p. 192-9. 136. Kumar, A., et al., Conundrum and therapeutic potential of curcumin in drug

delivery. Crit Rev Ther Drug Carrier Syst, 2010. 27(4): p. 279-312. 137. Anand, P., et al., Bioavailability of curcumin: problems and promises. Mol Pharm,

2007. 4(6): p. 807-18. 138. Wahlstrom, B. and G. Blennow, A study on the fate of curcumin in the rat. Acta

Pharmacol Toxicol (Copenh), 1978. 43(2): p. 86-92. 139. Holder, G.M., J.L. Plummer, and A.J. Ryan, The metabolism and excretion of

curcumin (1,7-bis-(4-hydroxy-3-methoxyphenyl)-1,6-heptadiene-3,5-dione) in the rat. Xenobiotica, 1978. 8(12): p. 761-8.

140. Shoba, G., et al., Influence of piperine on the pharmacokinetics of curcumin in animals and human volunteers. Planta Med, 1998. 64(4): p. 353-6.

141. Yallapu, M.M., et al., Curcumin induces chemo/radio-sensitization in ovarian cancer cells and curcumin nanoparticles inhibit ovarian cancer cell growth. J Ovarian Res, 2010. 3: p. 11.

142. Yallapu, M.M., et al., Curcumin-loaded magnetic nanoparticles for breast cancer therapeutics and imaging applications. Int J Nanomedicine, 2012. 7: p. 1761-79.

120

143. Shaikh, J., et al., Nanoparticle encapsulation improves oral bioavailability of curcumin by at least 9-fold when compared to curcumin administered with piperine as absorption enhancer. Eur J Pharm Sci, 2009. 37(3-4): p. 223-30.

144. Xie, X., et al., PLGA nanoparticles improve the oral bioavailability of curcumin in rats: characterizations and mechanisms. J Agric Food Chem, 2011. 59(17): p. 9280-9.

145. Wang, D., et al., Liposome-encapsulated curcumin suppresses growth of head and neck squamous cell carcinoma in vitro and in xenografts through the inhibition of nuclear factor kappaB by an AKT-independent pathway. Clin Cancer Res, 2008. 14(19): p. 6228-36.

146. Sztrymf, B., et al., Prognostic factors of acute heart failure in patients with pulmonary arterial hypertension. Eur Respir J, 2010. 35(6): p. 1286-93.

147. Umar, S., et al., Spontaneous ventricular fibrillation in right ventricular failure secondary to chronic pulmonary hypertension. Circ Arrhythm Electrophysiol, 2012. 5(1): p. 181-90.

148. Niu, J., K. Wang, and P.E. Kolattukudy, Cerium oxide nanoparticles inhibit oxidative stress and nuclear factor-kappaB activation in H9c2 cardiomyocytes exposed to cigarette smoke extract. J Pharmacol Exp Ther, 2011. 338(1): p. 53-61.

149. Schermuly, R.T., et al., Reversal of experimental pulmonary hypertension by PDGF inhibition. J Clin Invest, 2005. 115(10): p. 2811-21.

150. Walker, E.M., Jr., et al., Acetaminophen combinations protect against iron-induced cardiac damage in gerbils. Ann Clin Lab Sci, 2009. 39(4): p. 378-85.

151. Katta, A., et al., Impaired overload-induced hypertrophy is associated with diminished mTOR signaling in insulin-resistant skeletal muscle of the obese Zucker rat. Am J Physiol Regul Integr Comp Physiol, 2010. 299(6): p. R1666-75.

152. Van Raamsdonk, J.M. and S. Hekimi, Deletion of the mitochondrial superoxide dismutase sod-2 extends lifespan in Caenorhabditis elegans. PLoS Genet, 2009. 5(2): p. e1000361.

153. McCarthy, J.J., et al., Effective fiber hypertrophy in satellite cell-depleted skeletal muscle. Development, 2011. 138(17): p. 3657-66.

154. Dolber, P.C. and M.S. Spach, Picrosirius red staining of cardiac muscle following phosphomolybdic acid treatment. Stain Technol, 1987. 62(1): p. 23-6.

155. Bao, N., et al., Pravastatin reduces myocardial infarct size via increasing protein kinase C-dependent nitric oxide, decreasing oxyradicals and opening the mitochondrial adenosine triphosphate-sensitive potassium channels in rabbits. Circ J, 2007. 71(10): p. 1622-8.

156. Miller, F.J., Jr., et al., Superoxide production in vascular smooth muscle contributes to oxidative stress and impaired relaxation in atherosclerosis. Circ Res, 1998. 82(12): p. 1298-305.

157. Kakarla, S.K., et al., Chronic acetaminophen attenuates age-associated increases in cardiac ROS and apoptosis in the Fischer Brown Norway rat. Basic Res Cardiol, 2010. 105(4): p. 535-44.

158. van Wolferen, S.A., et al., Prognostic value of right ventricular mass, volume, and function in idiopathic pulmonary arterial hypertension. Eur Heart J, 2007. 28(10): p. 1250-7.

121

159. Paffett, M.L., S.N. Lucas, and M.J. Campen, Resveratrol reverses monocrotaline-induced pulmonary vascular and cardiac dysfunction: a potential role for atrogin-1 in smooth muscle. Vascul Pharmacol, 2012. 56(1-2): p. 64-73.

160. Pagliari, F., et al., Cerium oxide nanoparticles protect cardiac progenitor cells from oxidative stress. ACS Nano, 2012. 6(5): p. 3767-75.

161. Bogaard, H.J., et al., The right ventricle under pressure: cellular and molecular mechanisms of right-heart failure in pulmonary hypertension. Chest, 2009. 135(3): p. 794-804.

162. Harvey, P.A. and L.A. Leinwand, The cell biology of disease: cellular mechanisms of cardiomyopathy. J Cell Biol, 2011. 194(3): p. 355-65.

163. Kogler, H., et al., Mechanical load-dependent regulation of gene expression in monocrotaline-induced right ventricular hypertrophy in the rat. Circ Res, 2003. 93(3): p. 230-7.

164. Redout, E.M., et al., Right-ventricular failure is associated with increased mitochondrial complex II activity and production of reactive oxygen species. Cardiovasc Res, 2007. 75(4): p. 770-81.

165. Ecarnot-Laubriet, A., et al., The activation pattern of the antioxidant enzymes in the right ventricle of rat in response to pressure overload is of heart failure type. Heart Dis, 2003. 5(5): p. 308-12.

166. Son, Y., et al., Mitogen-Activated Protein Kinases and Reactive Oxygen Species: How Can ROS Activate MAPK Pathways? J Signal Transduct, 2011. 2011: p. 792639.

167. Arad, M., C.E. Seidman, and J.G. Seidman, AMP-activated protein kinase in the heart: role during health and disease. Circ Res, 2007. 100(4): p. 474-88.

168. Walshe, T.E. and P.A. D'Amore, The role of hypoxia in vascular injury and repair. Annu Rev Pathol, 2008. 3: p. 615-43.

169. Freund, C., et al., Requirement of nuclear factor-kappaB in angiotensin II- and isoproterenol-induced cardiac hypertrophy in vivo. Circulation, 2005. 111(18): p. 2319-25.

170. McCubrey, J.A., M.M. Lahair, and R.A. Franklin, Reactive oxygen species-induced activation of the MAP kinase signaling pathways. Antioxid Redox Signal, 2006. 8(9-10): p. 1775-89.

171. Dyck, J.R. and G.D. Lopaschuk, AMPK alterations in cardiac physiology and pathology: enemy or ally? J Physiol, 2006. 574(Pt 1): p. 95-112.

172. Russell, R.R., 3rd, et al., AMP-activated protein kinase mediates ischemic glucose uptake and prevents postischemic cardiac dysfunction, apoptosis, and injury. J Clin Invest, 2004. 114(4): p. 495-503.

173. Price, L.C., et al., Inflammation in pulmonary arterial hypertension. Chest, 2012. 141(1): p. 210-21.

174. Carr, M.W., et al., Monocyte chemoattractant protein 1 acts as a T-lymphocyte chemoattractant. Proc Natl Acad Sci U S A, 1994. 91(9): p. 3652-6.

175. Hassoun, P.M., et al., Inflammation, growth factors, and pulmonary vascular remodeling. J Am Coll Cardiol, 2009. 54(1 Suppl): p. S10-9.

176. Yang, D.L., et al., Resveratrol inhibits right ventricular hypertrophy induced by monocrotaline in rats. Clin Exp Pharmacol Physiol, 2010. 37(2): p. 150-5.

122

177. Agarwal, R. and M. Gomberg-Maitland, Current therapeutics and practical management strategies for pulmonary arterial hypertension. Am Heart J, 2011. 162(2): p. 201-13.

178. D'Alonzo, G.E., et al., Survival in patients with primary pulmonary hypertension. Results from a national prospective registry. Ann Intern Med, 1991. 115(5): p. 343-9.

179. Humbert, M., et al., Survival in patients with idiopathic, familial, and anorexigen-associated pulmonary arterial hypertension in the modern management era. Circulation, 2010. 122(2): p. 156-63.

180. Umar, S., et al., Novel approaches to treat experimental pulmonary arterial hypertension: a review. J Biomed Biotechnol, 2010. 2010: p. 702836.

181. Garodia, P., et al., From ancient medicine to modern medicine: ayurvedic concepts of health and their role in inflammation and cancer. J Soc Integr Oncol, 2007. 5(1): p. 25-37.

182. Anand, P., et al., Curcumin and cancer: an "old-age" disease with an "age-old" solution. Cancer Lett, 2008. 267(1): p. 133-64.

183. Begum, A.N., et al., Curcumin structure-function, bioavailability, and efficacy in models of neuroinflammation and Alzheimer's disease. J Pharmacol Exp Ther, 2008. 326(1): p. 196-208.

184. Yao, Q.H., et al., Curcumin ameliorates left ventricular function in rabbits with pressure overload: inhibition of the remodeling of the left ventricular collagen network associated with suppression of myocardial tumor necrosis factor-alpha and matrix metalloproteinase-2 expression. Biol Pharm Bull, 2004. 27(2): p. 198-202.

185. Gomez-Arroyo, J.G., et al., The monocrotaline model of pulmonary hypertension in perspective. Am J Physiol Lung Cell Mol Physiol, 2012. 302(4): p. L363-9.

186. Koskenvuo, J.W., et al., A comparison of echocardiography to invasive measurement in the evaluation of pulmonary arterial hypertension in a rat model. Int J Cardiovasc Imaging, 2010. 26(5): p. 509-18.

187. Katta, A., et al., Altered regulation of contraction-induced Akt/mTOR/p70S6k pathway signaling in skeletal muscle of the obese Zucker rat. Exp Diabetes Res, 2009. 2009: p. 384683.

188. Moe, G.W., et al., Matrix metalloproteinase inhibition attenuates atrial remodeling and vulnerability to atrial fibrillation in a canine model of heart failure. J Card Fail, 2008. 14(9): p. 768-76.

189. Thulluri, S., et al., Regulation of iron-related molecules in the rat hippocampus: sex- and age-associated differences. Ann Clin Lab Sci, 2012. 42(2): p. 145-51.

190. Feng, J., et al., Growth hormone stimulation of serum insulin concentration in cattle: nutritional dependency and potential mechanisms. Domest Anim Endocrinol, 2009. 37(2): p. 84-92.

191. Wu, M., et al., Effect of feeding level on serum IGF1 response to GH injection. J Endocrinol, 2010. 206(1): p. 37-45.

192. Schultze, A.E. and R.A. Roth, Chronic pulmonary hypertension--the monocrotaline model and involvement of the hemostatic system. J Toxicol Environ Health B Crit Rev, 1998. 1(4): p. 271-346.

123

193. Boissiere, J., et al., Doppler tissue imaging in assessment of pulmonary hypertension-induced right ventricle dysfunction. Am J Physiol Heart Circ Physiol, 2005. 289(6): p. H2450-5.

194. Okada, M., et al., Effects of telmisartan on right ventricular remodeling induced by monocrotaline in rats. J Pharmacol Sci, 2009. 111(2): p. 193-200.

195. Fu, Y., et al., Curcumin protects the rat liver from CCl4-caused injury and fibrogenesis by attenuating oxidative stress and suppressing inflammation. Mol Pharmacol, 2008. 73(2): p. 399-409.

196. Li, H.L., et al., Long-term activation of adenosine monophosphate-activated protein kinase attenuates pressure-overload-induced cardiac hypertrophy. J Cell Biochem, 2007. 100(5): p. 1086-99.

197. Faber, M.J., et al., Time dependent changes in cytoplasmic proteins of the right ventricle during prolonged pressure overload. J Mol Cell Cardiol, 2007. 43(2): p. 197-209.

198. Takeuchi, M., et al., Right ventricle of patients undergoing congenital cardiac surgery differentially expresses haem oxygenase-1 and heat shock protein 70 genes. J Int Med Res, 2003. 31(5): p. 413-7.

199. Henderson, B.C., et al., Reversal of systemic hypertension-associated cardiac remodeling in chronic pressure overload myocardium by ciglitazone. Int J Biol Sci, 2007. 3(6): p. 385-92.

200. Kowluru, R.A. and M. Kanwar, Effects of curcumin on retinal oxidative stress and inflammation in diabetes. Nutr Metab (Lond), 2007. 4: p. 8.

201. Ghosh, S.S., et al., Curcumin prevents cardiac remodeling secondary to chronic renal failure through deactivation of hypertrophic signaling in rats. Am J Physiol Heart Circ Physiol, 2010. 299(4): p. H975-84.

202. Kirson, N.Y., et al., Prevalence of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension in the United States. Curr Med Res Opin, 2011. 27(9): p. 1763-8.

203. Matthews, J.C. and V. McLaughlin, Acute right ventricular failure in the setting of acute pulmonary embolism or chronic pulmonary hypertension: a detailed review of the pathophysiology, diagnosis, and management. Curr Cardiol Rev, 2008. 4(1): p. 49-59.

204. Liang, G., et al., Inhibition of LPS-induced production of inflammatory factors in the macrophages by mono-carbonyl analogues of curcumin. J Cell Mol Med, 2009. 13(9B): p. 3370-9.

205. Prasad, S. and B.B. Aggarwal, Turmeric, the Golden Spice: From Traditional Medicine to Modern Medicine. 2011.

206. Pfister, S.L., Role of lipoxygenase metabolites of arachidonic acid in enhanced pulmonary artery contractions of female rabbits. Hypertension, 2011. 57(4): p. 825-32.

124

Appendix

Letter from Institutional Research Board

125

Curriculum Vitae

Madhukar B. Kolli 6133, Country Club Dr, Huntington,WV-25705

E-mail:[email protected] Phone :( 304) 942-5920

CAREER OBJECTIVE: To obtain a position where my scientific and academic knowledge will contribute for the development field of science grow along with the institute. EDUCATION Marshall University, Huntington, WV John C Edward School of Medicine Ph.D in Biomedical sciences Graduated – Aug 2012

GPA-3.47/4. Marshall University, Huntington, WV MS in Biological Sciences Graduated -Aug 2008 GPA-3.9/4.0 Acharya N G Ranga Agricultural University, Hyderabad, India. DVM Graduated - Feb 2004 GPA-4.0/4.0

LICENSURE West Virginia Board of Veterinary Medicine # 22-2012. RESEARCH EXPERIENCE Graduate research Assistant, Center for diagnostic nanosystems, Marshall University, Huntington, WV-25705 (2007- Present) Ph.D Dissertation: The use of nanoparticles as therapeutic agents for the treatment of ventricular hypertrophy following pulmonary arterial hypertension M.S Thesis: Assembly and Function of Myosin II on Ultraviolet/Ozone Patterned Trimethyl-chlorosilane Substrates.

126

RESEARCH SKILLS

Immunohistochemistry

Flourescent and Confocal Microscopy

Differential staining procedures

Sample preparation from Laboratory animals

Protein Quantitation using Bradford assay

SDS gel electrophoresis

Immunoblotting

Immunoprecipitation and Westerns

Quantitation using Densitometry

DNA, RNA and microRNA isolation

DNA and Protein gel electrophoresis

PCR, RT-PCR

Cell culture

Small animal surgery

Handling of Laboratory animals

Protein Identification by MALDI- TOF MS

Cardiac Ischemia-Reperfusion Experiments in Rats and Mice PUBLICATIONS:

1. Intra tracheal instillation of cerium oxide nanoparticles induces hepatic toxicity in male Sprague-Dawley rats. Nalabotu SK, Kolli MB*, Triest WE, Ma JY, Manne ND, Katta A, Addagarla, Rice KM and Blough ER. Int J Nanomedicine. 2011;6:2327-35. Epub 2011 Oct 14.

2. Transport of single cells using an actin bundle-myosin bionanomotor transport system. Takatsuki H, Tanaka H, Rice KM, Kolli MB*, Nalabotu SK, Kohama K, Famouri P and Blough ER. Nanotechnology. 2011 Jun 17;22(24):245101. Epub 2011 Apr 20.

3. Application of poly(amidoamine) dendrimers for use in bionanomotorsystems.Kolli MB*, Day BS, Takatsuki H, Nalabotu SK, Rice KM, Kohama K, Gadde MK, Kakarla SK, Katta A and Blough ER. Langmuir. 2010 May 4;26(9):6079-82.

4. Possible molecular mechanisms underlying age-related cardiomyocyte apoptosis in the F344XBN rat heart.Kakarla SK, Rice KM, Katta A, Paturi S, Wu M, Kolli MB*, Keshavarzian S, Manzoor K, Wehner PS and Blough ER. J Gerontol A BiolSci Med Sci. 2010 Feb;65(2):147-55. Epub 2010 Jan 7.

5. Altered regulation of contraction-induced Akt/mTOR/p70S6k pathway signaling in skeletal muscle of the obese Zucker rat.Katta A, Kakarla S, Wu M, Paturi S,

127

Gadde MK, Arvapalli R, Kolli MB*, Rice KM and Blough ER. Exp Diabetes Res. 2009; Epub 2010 Mar 30.

6. Assembly and Function of Myosin II on Ultraviolet/Ozone Patterned Trimethylchlorosilane Substrates.Takatsuki H, Kolli MB*, Rice KM, Day BS Asano, Shinichi; Rahman, Mashiur; Zhang, Yue; Ishikawa, Ryoki; Kohama K and Blough, ER. Journal of Bionanoscience, Volume 2, Number 1, June 2008 , pp. 35-41(7)

7. Diminished muscle growth in the obese Zucker rat following overload is associated with hyperphosphorylation of AMPK and dsRNA-dependent protein kinase kinase. Katta A, Wu M, Manne N, Kolli MB*, Rice KM and Blough ER J Appl Physiol. 2012 May 31

8. Control of myosin motor activity by the reversible alteration of protein structure for applications in the development of a bio nano device. Nalabotu SK, Takatsuki H, Kolli MB* and Blough, ER (Accepted for publication in Advanced Science Letters. Jan-2012)

MANUSCRIPTS IN PREPARATION:

1. Cerium oxide nanoparticles attenuate Monocrotaline induced pulmonary arterial hypertension and associated right ventricular hypertrophy Kolli MB*, Nalabotu SK, Para RK and Blough ER

2. Antioxidant cerium oxide nanoparticles ameliorates monocrotaline induced right ventricular hypertrophy Kolli MB*, Nalabotu SK, Para RK and Blough ER

3. Curcumin nanoparticles attenuate cardiac remodeling due to pulmonary arterial hypertensionKolli MB*, Para RK, Nalabotu SK and Blough ER

4. Role of Oxidative Stress and Apoptosis in the hepatic Toxicity induced by Cerium Oxide Nanoparticles Following Intratracheal Instillation in Male Sprague-Dawley Rats. Nalabotu SK , Manne DPK, Kolli MB*, Para RK and Blough ER

5. Exposure to cerium oxide nanoparticles is associated with activation of MAPK signaling and apoptosis in the rat lungs. Nalabotu SK , Manne DPK, Kolli MB*, Para RK and Blough ER

ABSTRACTS AND POSTER PRESENTATIONS:

1. Madhukar B. Kolli, Arun Kumar, FerasElbash, Radha Para, Siva K. Nalabotu, Nandini D Manne, GeetaNandyala, Paulette Wehner and Eric R. Blough. Efficacy Of Curcumin Nanoparticles On Monocrotaline Induced Pulmonary Arterial

128

Hypertension And Right Ventricular Hypertrophy. (American Heart Association HBPR, 2011).

2. MadhukarB. Kolli, RadhakirshnaPara,SivaNalabotu, Salah M El Bash, Lucy Dornon, Paulette Wehner, and Eric R. Blough. Cerium oxide nanoparticles ameliorate monocrotaline induced pulmonary arterialhypertension and associated right ventricular hypertrophy in Sprague Dawley rats.CDDC- Research Symposium, Marshall univeristy, March, 2012

3. Siva K. Nalabotu, NandiniManne, MadhukarKolli, GeetaNandyala, Radha K Para, Valentovic Monica, Jane Ma and Eric R. Blough. Evaluation of oxidative stress and apoptosis in the liver following a single intratracheal instillation of cerium oxide nanoparticles in male Sprague dawley rats. (Society of Toxicology Annual Meeting, San Francisco 2012)

4. Siva K. Nalabotu, AshuDhanjal, Lucy Dornon, NandiniManne, Madhukar B. Kolli, Paulette Wehner, and Eric R. Blough. Intratracheal instillation of the cerium oxide nanoparticles may induce cardiac alterations in the male Sprague-Dawley rats. (West Virginia-ACC Annual Meeting 2011)

5. Katta, A, Kundla S, Kakarla S, Wu M, Paturi S, Gadde M.K., Arvapalli R, Madhukar B. Kolli, Siva K. Nalabotu. Rice, Kevin M. and Eric R. Blough. Impaired Overload-induced Hypertrophy Is Associated With Diminished mTOR Signaling In Insulin Resistant Obese Zucker Rat (American College of Sports & Medicine, Baltimore, 2010)

6. Madhukar B. Kolli, Hideyo Takatsuki, Devashish Desai, Kevin M. Rice, Sunil Kakarla, AnjaiahKatta, Sriram P. Mupparaju, SarathMeduru, Anil K. Gutta, SatyanarayanaPaturi and Eric R.Blough. Confinement of myosin motor activity on Trimethylchlorosilane surface by Ultra Violet lightexposure for nano-technology applications.ACSM Conference – May 2008, Indianapolis,IN,USA.

7. Madhukar B. Kolli, Hideyo Takatsuki, Devashish Desai, Kevin M. Rice, Sunil Kakarla, AnjaiahKatta, Sriram P. Mupparaju, SarathMeduru, Anil K. Gutta, SatyanarayanaPaturi and Eric R.Blough. Surface modification of TMCS by Ultra Violet Light exposure for confinement of Myosin motor activity. "Multifunctional Nanomaterials" International Symposium, April 2008,WV.

8. Murali K. Gadde, Hideyo Takatsuki, Madhukar B. Kolli, Kevin M. Rice, Siva K Nalabotu, Kazuhiro Kohama and Eric Blough. Disassembly of fascin bundled actin filaments induced by myosin II motors in an in-vitro motility assay and its applications to nanotechnology. (Sigma Xi Research day, April 2008)

129

PROFESSIONAL MEMBERSHIPS Member- West Virginia Board of Veterinary Medicine Member- Society of Toxicology Member - Veterinary council of INDIA Member - Educational Commission for Foreign Veterinary Graduates(ECFVG) of

American Veterinary Medical Association (AVMA), 2007-present Member - Cell Differentiation and Development Center-2007, Marshall University.

AWARDS AND ACCOMPLISHMENTS

BMS Graduate Student travel award (2010), Marshall University, Huntington, WV-25705

Runner up for the graduate studentsposter presentation at regional CDDC symposium March 24, 2012

Dean's Award for Academic Excellence, ANGRA University, Hyderabad, India (2003)

Acharya NG Ranga merit scholarship, College of Veterinary Science, Tirupati, India (2001)

REFERNCES Dr.EricR.Blough, Ph.D Associate professor Dept. of Pharmaceutical Science& Research School of Pharmacy, Marshall University, Huntington, WV E-mail: [email protected], Phone: (304)696-2708 Dr. Monica Valentovic, Ph.D Professor Dept.Pharmacology, Physiology and Toxicology Joan C. Edwards School of Medicine, Marshall University,Huntington, WV E-mail: [email protected] Phone: (304) 696-7332 Dr. Nalini Santanam, Ph.D Professor, Dept. Pharmacology, Physiology and Toxicology Joan C. Edwards School of Medicine, Marshall University, Huntington, WV E-mail: [email protected] Phone: (304) 696-7321


