13
The Purpose of DNA To make PROTEINS! Proteins give us our traits (ex: one protein gives a person blue eyes, another gives brown Central Dogma of Molecular Biology DNA mRNA Protein How do we get from DNA to proteins? Through RNA! RNA—Ribonucleic Acid Has Ribose sugar instead of Deoxyribose and is single-stranded instead of double stranded mRNA—messenger RNA tRNA—transfer RNA rRNA—ribosomal RNA

The Purpose of DNA To make PROTEINS! Proteins give us our traits (ex: one protein gives a person blue eyes, another gives brown Central Dogma of Molecular

Embed Size (px)

Citation preview

Page 1: The Purpose of DNA To make PROTEINS! Proteins give us our traits (ex: one protein gives a person blue eyes, another gives brown Central Dogma of Molecular

The Purpose of DNA• To make PROTEINS!• Proteins give us our traits (ex: one protein gives a

person blue eyes, another gives brown

Central Dogma of Molecular Biology DNA mRNA Protein

• How do we get from DNA to proteins?– Through RNA!– RNA—Ribonucleic Acid– Has Ribose sugar instead of Deoxyribose and is single-stranded instead of double stranded•mRNA—messenger RNA•tRNA—transfer RNA•rRNA—ribosomal RNA

Page 2: The Purpose of DNA To make PROTEINS! Proteins give us our traits (ex: one protein gives a person blue eyes, another gives brown Central Dogma of Molecular

Transcription

• DNA mRNA

DNA bases mRNA basesAdenine AdenineGuanine GuanineCytosine CytosineThymine Uracil

Page 3: The Purpose of DNA To make PROTEINS! Proteins give us our traits (ex: one protein gives a person blue eyes, another gives brown Central Dogma of Molecular

Write the Complimentary RNA Strand to the DNA strands below

• ATGCGGATACATCCGATCGATGCAAT

• TGACGGACACTTACAGATTCTGTGAG

• GAGCATTAGCAGGACTGCACGATATT

• GTAGTAGTAGTAGTAGTAGTAGTAGT

Page 4: The Purpose of DNA To make PROTEINS! Proteins give us our traits (ex: one protein gives a person blue eyes, another gives brown Central Dogma of Molecular

Transcription Review

• DNA mRNA

Page 5: The Purpose of DNA To make PROTEINS! Proteins give us our traits (ex: one protein gives a person blue eyes, another gives brown Central Dogma of Molecular
Page 6: The Purpose of DNA To make PROTEINS! Proteins give us our traits (ex: one protein gives a person blue eyes, another gives brown Central Dogma of Molecular

Translation

• mRNA Proteins

• mRNA travels to the Ribosomes, where it is translated into AMINO ACIDS

• mRNA is read in groups of 3-nucleotides called Codons– AUG = 1 codon– CAU = 1 codon

Page 7: The Purpose of DNA To make PROTEINS! Proteins give us our traits (ex: one protein gives a person blue eyes, another gives brown Central Dogma of Molecular

• Each codon codes for 1 amino acid, which is matched by a tRNA molecule.

• The tRNA translates the message from mRNA into a specific chain of amino acids

Page 8: The Purpose of DNA To make PROTEINS! Proteins give us our traits (ex: one protein gives a person blue eyes, another gives brown Central Dogma of Molecular

Codon Wheel of Amino Acids

Page 9: The Purpose of DNA To make PROTEINS! Proteins give us our traits (ex: one protein gives a person blue eyes, another gives brown Central Dogma of Molecular

• A chain of amino acids = 1 protein• The order of the amino acids determines the

type of protein created

Page 10: The Purpose of DNA To make PROTEINS! Proteins give us our traits (ex: one protein gives a person blue eyes, another gives brown Central Dogma of Molecular

Amino Acids• Essential Amino Acids—We

have to obtain from food– Isoleucine– Leucine– Lysine– Methionine– Phenylalanine– Threonine– Tryptophan– Valine

• Non-Essential Amino Acids—body produces– Alanine– Aspargine– Aspartic Acid– Cysteine– Glutamic Acid– Glutamine– Glycine– Proline– Serine– Tyrosine– Arginine– Histidine

Page 11: The Purpose of DNA To make PROTEINS! Proteins give us our traits (ex: one protein gives a person blue eyes, another gives brown Central Dogma of Molecular

Construct the amino acid chain from the following mRNA strands

• AUGCGGAUACAUCCGAUCGAUGCAAUCAUGCAU

• AUGCGGACACUUACAGAUUCUGUGAGUCUCAAC

Page 12: The Purpose of DNA To make PROTEINS! Proteins give us our traits (ex: one protein gives a person blue eyes, another gives brown Central Dogma of Molecular

Transcribe the following DNA sequence to mRNA, divide into triplet codons, then translate the sequence to Amino Acids.

TACGATGCCATGCTGAGCTTGACCGCATCTAGGACTATGCA

Page 13: The Purpose of DNA To make PROTEINS! Proteins give us our traits (ex: one protein gives a person blue eyes, another gives brown Central Dogma of Molecular

DNA Mutations

• Point Mutation– Substitution of a single base•AUG CUG GAA CGA CUG UGA•AUG CUG GAG CGA CUG UGA

• Frameshift Mutation– Insertion or deletion of a single base•AUG CUG GAA CGA CUG UGA•AUG CUG AAC GAC UGU GA

»OR•AUG CUG GUA ACG ACU GUG A