THE JOURNAL OF BIOLOGIC& CHEMISTRY Vol. 269, NO. 34, Issue of August 26, pp. 21555-21560, 1994 Printed in U.S.A.

Characterization of Class I1 and Class I11 ADP-ribosylation Factor Genes and Proteins in Drosophila melanogas#er*

(Received for publication, March 7, 1994, and in revised form, May 19, 1994)

Fang-Jen S. Lee$, Linda A. Stevens, Linda M. Hall&, James J. Murtagh, Jr., Yvonne L. Kao, Joel Moss, and Martha Vaughan From the ~ b ~ r a t o ~ o f~e l lu~ar Me tabo l i s~ , NHLBI, National I ~ ~ i t u t e s of Health, Bethesda, M a ~ ~ a n d 208.92 and the ~ D e ~ a ~ ~ n t of B ~ o c ~ ~ ~ c a ~ Phar~ucology, State ~ n ~ u e r s ~ ~ ~ of New York at Buffalo, Amherst, New York 14260

ADP-ribosylation factors (ARFs) are ubiquitous -20- kDa guanine nucleotide-binding proteins that enhance the ADP-ribosyltransferase activity of cholera toxin and are involved in intracellular vesicular transport. Based on size, phylogenetic analysis, amino acid identity, and gene structure, mammalian ARFs fall into three classes (class I, D l , -2, and -3; class II, ARF4 and -5; class 111, ARFG). A class I ARF had been identified in Drosophila melunogaster. To search for ARFs of other classes in Drosophila, polymerase chain reaction-based tech- niques were used, resulting in cloning of Drosophila ARF (dARF) I1 and dARF I11 with deduced amino acid sequences similar to those of class I1 and class I11 mam- malian A,€ZFs, respectively. The three Drv8Ophih ARF genes map to different chromosomes and the coding re- gions have different splicing sites. dARF II mRNA, like ARF I mRNA, i s fairly uniformly distributed t~oughout adult flies, whereas dARF III mRNA is significantly more abundant in heads than in legs or bodies. Recom- binant dARF I1 and dARF I11 have biochemical and im- munological properties similar to those of human A R F B (hA.RF5) and hARF6, respectively. These observations are consistent with the conclusion that the three classes of ARFs are present in non-mammalian as well as mam- malian species.

~ P - n b o s y l a t i o n factors (AFtFs)' are a family of -.ZO-kDa guanine nucleotide-binding proteins that participate in intra- cellular vesicular trafficking and, in the presence of GTP, en- hance the ADP-ribosyltransferase activity of cholera toxin (1- 4). ARF proteins, which are highly conserved and ubiquitous in eukaryotic cells (5-lo), have been found associated with Golgi membranes and have been implicated in vesicular transport, including endocytosis and nuclear membrane assembly (3, 11- 13). The different mammalian ARFs appear to have different functions and, likely, different intracellular localizations. Con- sistent with this view, ARF1, -3, and -5 clearly differ in their binding to Golgi (14) as well as i n their dependence on acces- sory proteins for interaction with Golgi and, perhaps, other cellular membranes (15). ARF, an essential protein in Saccha-

* This work was supported in part by National Institutes of Health Grant NS 16204 it0 L. M. H.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must

U.S.C. Section 1734 solely to indicate this fact. therefore be hereby marked "advertisement" in accordance with 18

$ To whom correspondence should be addressed: Rm. 5N-307, BIdg. 10, NIH, Bethesda, MD 20892. Tel.: 301-496-5193; Fax: 301-402-1610.

3 A Jacob Javits Neuroscience Investigator Awardee. ' The abbreviations used are: ARF, ~P-ribosylation factor; hARF,

human ARF dARF, Drosophila ARF; PCR, polymerase chain reaction; CTA, cholera toxin A subunit; PAGE, polyacrylamide gel electrophore- sis; bp, base pairfs); MOPS, 4-morpholinepropanesulfonic acid; kb, ki- lohase(s1; rARF, recombinant ARF; rhARF, recombinant human ARF.

-II

mmyces cereuisiae, is encoded in three genes2 and in mamma- Iian cells is localized to the Golgi (11, 16). Expression of either hARF1, hARF4, hARF5, hARF6, or Giardia ARF (gARF1 was able to rescue the yeast lethal double mutant (arfl- and arf2-) (16-18). Thus, ARF function is apparently conserved among eukaryotic organisms.

The structures of class I ARF genes are highly conserved among its members (ARFs 1-31 and across species f19,ZO). All splice sites within the coding regions of the human, bovine, and Drosophila class I ARF genes occur at identical positions, par- titioning the guanine nucleotide-binding and GTP hydrolysis domains into separate exons, except for the NKQD sequence, which is shared between two exons (19). Locations of introns within the coding regions of the humanAFiF4 and -5 genes were identical but different from those of the mammalian class I genes (21). These data are consistent with the ARFs o n ~ n a t i n g through gene dup~ication events. To determine whether the different classes ofARFs are found

also in lower species, where their functions might perhaps be more readily defined, we looked for class I1 and class 111 ARFs in Drosophila melanogaster. Here, we report the characteriza- tion of two new members of the ARF family in Drosophila, dARF I1 (class 11) and dARF I11 (class 1111, identified in genomic and cDNA libraries by PCR. We describe their tissue distribu- tion, gene structure, chromosome mapping, and the functional properties of the recombinant proteins.

E ~ E R I M E ~ ~ PROCEDURES Materials-GTP, NAD, chicken ovalbumin, and thrombin were pur-

chased from Sigma; dithiothreitol from ICN Biochemicals (Richmond, CAI; cholera toxin A subunit (CTA) from List Biologicals (Campbell, CAI; urea, protein standards, and Tris from Life Technologies, Inc.; Thermus aquaticus DNA polymerase (Taq polymerase), PCR buffer, and deoxynucleotides from Perkin-Elmer; GeneScreen Plus membrane from DuPont NEN, [CU-~~PIATP (6000 Ci/mmoi), and [cx-~~SJ~ATP (1000 CY mmol) were from DuPont NEN; nicotinamide [U-''C]adenine dinucle- otide from Amersham Corp.; and sequence kits for DNA sequencing from U. S. Biochemical Corp. Oligonucleotides were made by automated phosphoramidite chemistry on a 380B DNA synthesizer (Applied Bio- systems, Foster City, CAI and desalted on Sephadex G-50 (Pharmacia Biotech Inc.).

Isolation of Drosophila ARFII and ARFIII cDNA-Unless otherwise specified, PCR amplification consisted of 35 cycles of 1 min of 95 "C, 1 min of 52 "C, 1 min of 72 "C, followed by extension at 72 "C for 10 min (Perkin-Elmer TCI thermal cycler). The PCR mixture contained 50 mM KC1, 10 m M Tris-C1, pH 8.3, 1.5 mM MgCI,, 0.01% gelatin, 20 p~ of each dNTP, 0.1% Tween, amplification primers (25 pmol of each), and 2.5 units of Taq polymerase in a total volume of 100 pl. Samples of reaction mixtures were subjected to electrophoresis in 1.5% agarose gel. All cDNA PCR products were purified, subcloned, and sequenced by the dideoxy chain termination method 122). Oligonucleotides used as prim- ers are listed in Fig. 1. Four PCRs were used to obtain segments of

* Lee, F.-J. S., Stevens, L. A., Kao, Y. L., Moss, J., and Vaughan, M. (1994) J. Biol. Chem., in press.

21555

21556

gil l -F DV I DV2 DV3 DV4 DVGG-Rl ARF6.SR d2-R d2.1 d2.2 d3.1 d3.2 dZF1 d2.F2 d3.F1 d3.F2 d2.NI d2.N2 d3.Nl d3.N2

S'GGTGGCGACGACTCCTGGAGCCCGY SACTATAGGGAGACCGGAATW SCAGAATAAACGCEAACm3' STATCGAAATAATACGACTY 5'GClTGTCTITTTGCAGMGCTY S(CT)TCCrC)TG(AGCT)CC(AGCT)CC(AGCT)AC(GA)TCCCA(AGCT)AC3' S'(GA)T(GA)AACrC)IT(AGCT)AC(AG~~CrC)T(GA)TA(AGCT)GTY SAAAACATATAlTCITATATXY SCGACTATK'ETACAAATAY SCGAGACTGTGGAATATAAGM S C T A T C W T E T K G C Z A A Y S C ~ ~ G ~ A C A A ~ A T A ~ G ~ . S ~ A ~ G A C T A A C A A T A T ~ A G ~ S ~ T ~ ~ ~ , C C T A T ~ A C A A T A T A A G G A Y S%GCCTGGTTCCGCG(iAGAAAGlTACTAXAAAAY S C T G C G C C f C G C G A m A C C i A l T a A T A Y SlTATTACATATGGGACTAACAATATTAG'lY SAACAGCGGATCCTATCITACMTATAAGGAY 5'ATCAGCCATATGGOAAAGlTACTAWAA.U.Y SATAAGAGGATCCTCGAITACGATKTCATAY.

phage sequence; DV1, DV2, DV3, and DV4 correspond to those in plas- FIG. 1. Oligonucleotides used as primers. gtll-F corresponds to

mid. DVGG-R1 corresponds to the consensus amino acid sequence, VWDVGGQD. ARF6.5R corresponds to the amino acid sequence TYKN- VKFN specific for hARF6. d2-R, d2.1, d2.2, d3.1, and d3.2 correspond to internal sequences of dARF I1 and dARF 111. d2.F1, d2.F2, d3.F1, and d3.F2 are primers for fusion proteins. gati ion-independent cloning sequences are u ~ r L i n e ~ . d2.N1, d2.N2, d3.N1, and d3.Nl are primers for non-fusion proteins.

cDNA and to assemble a composite sequence of the full-length coding region (Fig. 2). Purified plasmids from a pNB40 cDNA library and phage from a D. mlanogaster adult cDNA library in hgtll (Clontech) were used as templates for PCR. PCR with a specific primer, similar to RACE-PCR, the rapid amplification of cDNA ends (231, with modifica- tions (24, 251, was used to obtain the 5'-ends of the coding region gene sequences from a Drosophila cDNA library. Template (-500 ng) and primers (125 pmol for degenerate oligonucleotides) were included in the first PCR amplification for five cycles of 1 min of 95 "C, 1 min of 37 "C, 1 min of 70 "C, and 30 cycles of 1 min of 95 "C, 1 min of 42 "C, 1 min of 72 "C, followed by extension at 72 "C for 10 min. Samples (1 111) of the first PCR product served as templates in the one-site-specific PCR used to capture 5'-ends, similarly, to isolate the extreme 3'-ends (Fig. 2). Thus, the complete ARF cDNA sequences were obtained.

Production of Recombinant Drosophila ARF Proteins in Escherichia eo&-A glutathione transferase-dARF fusion protein was synthesized in E. coli as described elsewhere (26). In brief, DNA fragments containing a dARF coding region were generated as shown in PCR 4 of Fig. 2 by amplifying a Drosophila cDNA library with pairs of sequence-specific primers that included ligation-independent cloning (26) sequences (Fig. 1). Primers for the dARF I1 fusion protein were d2.Fl and d2.m and for that of dARF I11 were d3.Fl and d3.F2. PCR products were purified and annealed to expression vector PGEX-~GLIC, yielding pG~XdARF2 and p~EXdARF3, respectively. For nonfusion proteins, specific primers were d2N1 and d2N2 for dARF 11, and d3N1 and d3N2 for dARF I11 (Fig. 1). The PCR products were puriGed and annealed to expression vector pT7, resulting in pT7dARF2 and pT7dARF3, respectively.

E. coli (DH5a) containing expression plasmid were grown overnight in 5 ml of LB broth containing 50 pgml ampicillin. A sample (0.5 ml) was added to 50 ml of LB medium containing ampicillin. After 120 min at 37 "C, isopropyl-a-thiogalactopyranoside was added (final concentra- tion, 0.5 mrd, and cultures were grown for an additional 3 h at 30 "C. Cells containing GST-dARF fusion protein were pelleted, suspended in MTPBS buffer (150 mM NaCl, 16 ITUI Na,HPO,, 4 mM NaW,PO,, pH 7.31, and sonified. The lysate was centrifuged after addition of Triton X-100 to 1%. Fusion protein was purified on glu~thione-agarose beads (Sigma) (27). Purity was assessed by SDS-PAGE and staining with

Rad). Coomassie Blue. Protein was determined by Coomassie Blue assay (Bio-

NADAgmatine ADP-ribosyltransferase Assay-Purified dARF fusion protein was incubated in 50 mM potassium phosphate (pH 7.51, 5 mM MgCl,, 20 mM dithiothreitol, 10 mM agmatine, 100 p~ Il4CINAD (0.05 yCi/reaction), and 30 pg of ovalbumin with 1 pg of activated CTA (i.e. in 70 mM glycine, pH 8, and 30 mM dithiothreitol for 10 min at 30 "C) for 1 h at 30 "C (total volume, 300 pl). Samples (100 pl) of assay mixture were then applied to columns (0.4 x 4.5 cm) of AGl-X2 (Bio-Rad) fol-

A Drosophila ARFli

PCR 1

PCK 2 "c

ATG .c dZ-R

PCR 3

PCR 4 62.Fi * TAA

ATG f jd24

B Drosopnila ARFI~I

PCR 1 D l 4 A

ATG 1" DVGGRl

PCR 2 m-* ATG -t ARF6.5R

P C R B 63.1 "L /d3.L+ T G A " @!!.I

PCR 4 d3.F3 * TGA

ATG + EFA

sophiZa AR.FII (A) and ARFIII ( B ) cDNA and partial gene struc- FIG. 2. PCR cloning strategy used to obtain full-length D m

ture. Four PCRs were used to obtain segments of ARF cDNAs and to assemble a composite sequence of the full-length coding region. Loca- tions of oligonucleotides used in PCR are shown in boxes, with arrows indicating sense (+) or antisense (+-I. Specific PCR cloning procedures are described under "Isolation of DrosophiEa ARFII and ARFIII cDNA."

lowed by five washes, each with 1 ml of KO. Eluates were coliected in sc~nti~ation vials for radioassay. All assays were done in duplicate.

Southern Blot ~ ~ y s ~ s ~ n o m i c DNA was digested with restriction enzymes subjected to electrophoresis in 0.8% agarose in Tris borate buffer, transferred to Genescreen Plus membrane, hybridized with a random-primed 32P-labeled probe for 16 h, washed at high stringency, and autoradiographed (28). The dARF I1 probe was a 872-bp fragment amplified by PCR from genomic DNA that contained a 229-bp intron. The dARF I11 probe was a 1078-bp amplification product containing a 334-bp intron.

Northern Blot Analysis-Heads, bodies, and legs were separated by sieving disrupted frozen adult flies (29). Total RNA was prepared by the ~anidinium isothi~yanate CsCl gradient method, and polyiA)' mRNA was isolated by one passage over an oligo(dT)-cellulose column (30). Ten pg of poly(A)* RNA in TE buffer was added to each lane of a 0.8% agarose gel containing 6.3% formaldehyde, subjected to electrophoresis for 3 h at 100 V using 1 x MOPS buffer according to Sambrook et aL. (30), blotted onto nylon membrane (Schleicher and Schuell), and fixed by W cross-li&ng. Prehybridization was for 6 h a t 42 "C in 50% deionized formamide, 5 x SSPE, 5 x Denhardt's, 0.5% SDS with 100 pgiml salmon sperm DNA before addition of 32P-labeled probe (lo6 cpdmlf and fur- ther incubation (16 h, 42 "C). The blot was washed twice for 15 min each at Mom temperature in 2 x SSC, 0.1% SDS followed by two more washes for 30 min each at 65 OC in 0.1 x SSC, 0.1% SDS. Blots were exposed to x-ray film at -70 "C. Standard solutions (Denhardt's, SSC, SSPE, TE) are described by Sambrook et al. (30). The same blot was probed se- quentially with cDNAs for dARF 11, dARF 111, and RP49 (in that order) with stripping after each by bailing for 3 min in 0.1% SDS.

RP49, a cDNA encoding ribosomal protein 49, which is expressed uniformly throughout the organism, was used to assess differences in loading and/or RNA recovery (31). A Megaprime Kit (Amersham Corp.) was used to label each probe (0.5-1 pg) with ts2P1dCTP using the ran- dom prime method.

Chromosome Mapping-Genes encoding dARF I1 and I11 were iden- tified by in situ hybridization to larval salivary gland chromosomes using the same DNA fragments that were used to probe the Northern blots. Probes were biotin-labeled by nick translation, and mapping was

~ P - r ~ b o s ~ ~ a t i o n Factors in D. melanogaster 21557

A

GA TTmm.mAcT"Mm T - F m TATWXAUTA&A&TmATl'AAAC . A T W X 3 W l " T A V 3 - W O L T I S S L L T R L P G X K Q Y R I

ClTA~tatgCtcaaaatacgatacact baatataagcctttagttcgcgcataattt L W

ttugtacttgcaatcaacgtgcacataat t t t a a a t a t t t t t g t a c g c a w V C L

A-A'PXTGTACA A A T T ~ T l W I " D A A Q X T T I L Y K L X L C E I V T T

T B X A A C X A T A W c T R & k P VXShl'Al'~TATA%%TTTACC@T2" I P ' F I O P N N X T V K Y X N X C P T V

~ ~ ~ T E X C C ~ A T T % C k M k T J U X W D V G C Q D K I R P L W R H Y P Q N T

~ T A l l l V l " ~ ACCOCOA'PCQFAT- Q Q L I F V V D S N D R D R I T E A E R

AACT"Mgtactcattttattta attaaaagtatatacatacptgtcaaccaa L L Q N M

ttccatptttatttttcccacagClC"0 AI3"XUMCTT" L P X D L L R D A V L L

l T r r m c c ~ m ~ m C m ~ C a m c T r ~ A M T V P A N K Q D L P N A W T A A E L T D X

l t x O c a T ~ ~ ~ ~ C A C g tatgtcttaggwtaattgtccuLaaaatg L R L N Q L R N R H

tttacttatatctucccatttttbs%Ql" TATXC&O%TACA%XGCT&X- W P I Q S T C A T Q G H

CXOFCIWA-TPZQCTATC ~ ~ A A M k A T h U A A T A T S C O L Y E O L D W L S A X L A X K '

r n A A A W T ~ CPSATATIUTAMWACBAA- C O T A ~ ~ Z l " ~

B -101

-61 -1

60

-121

ao 1ao 27

240 180

300 360

420 47

400 67

540 87

600 107

660 1a7

m a 119

780 14s

840 169

900 175

960

1000 1140

1260 1320 1300 1339

1020

1aoo

soplrilu ARF 11 and AR.F III genomic DNA and cDNA Combined FIG. 3. Nucleotide and deduced amino acid sequences ofllro-

genomic DNA and cDNA sequences yielded ~rusop~iZu ARF I1 {A) or

-61 -1

60 20

120 22

180 25

240 45

300 65

360 85

420 105

480 110

540 122

600 142

660 152

720 164

780 180

840 868

as described by Engels et al. (32) with mo~fication described by Murtagh et al. (20).

MisceZlaneuus-DNA sequences and multiple protein alignments were analyzed using a Geneworks software package (Intelligenetics, Inc., Mountain View, CA).

RESULTS AND DISCUSSION Isolation of Drosophila ARF2 and ARF3 Genes-The PCR

cloning strategy took advantage of the high degree of amino acid sequence conservation in ARFs (4, 10, 20). An initial PCR using the phage cDNA library as template amplified a segment that encoded an amino-terminal sequence more homologous to humanARF4 and -5 (class 11) than to Drosophila ARF I (Fig. 2). Three subsequent PCRs using the plasmid cDNA library arn- plified overlapping 3'- and 5'-segments of Drosophila ARF I1 cDNA and yielded the complete coding region sequence. The overlapping sequences contained an open reading frame of 540 bases encoding a protein of 180 amino acids, consistent with the size of a Class I1 mammalian ARF protein. Coding region nucleotide sequence was 84% identical to those of class I1 mam- malian ARFs, 80431% identical to those of class I mammalian ARFs, and only 65% identical to that of class I11 mammalian ARF. As further confirmation of the composite sequence of dARF 11, a fourth PCR was used to amplify a full-length coding region cDNA (Fig. 3A). Its sequence matched that of the com- posite derived from the segmental PCRs.

To obtain a class I11 ARF, a similar PCR procedure was used but with a plasmid cDNA library as template and as primers in the second PCR, mixed oligonucleotides derived from a unique sequence of hARF6. This amplified a segment encoding an ami- no-terminal sequence with more similarity to hARF6 (class 111) than to class I or class I1 ARFs (Fig. 4). Amplification of these gene segments was followed by three PCRs to amplify overlap- ping 3'- and 5'-segments of Drosophila AFtF I11 cDNA and thus obtain the complete coding region sequence. The composite of overlapping sequences revealed an open reading frame of 525 bases encoding a 175-amino acid protein (Fig. 3B) with deduced amino acid sequence 96% identical to that of class I11 mamma- lian ARF 6, 66-67% identical to those of class I mammalian ARFs, and 6345% identical to those of class I1 mammalian ARFs.

Com~arison of D~osophiZa and ~ a m ~ l i a n ARF Gene Structures-Coding region gene structures of dARF I1 and dARF I11 were determined by a PCR-based procedure using Drosophila genomic DNA as template and the specific primers indicated in the PCR 4 reaction (Fig. 2). Intron sequences and their locations in dARF 11 and dARF I11 are shown in Fig. 3.

All ARFs contain consensus sequences believed to be in- volved in guanine nucleotide binding (DVGG, NKQD, and CAT sequences) and GTP hydrolysis (GXXXXGKT sequence) (33). Structures of the class I ARF genes are highly conserved among its members (ARFs 1-3), and across species (human, bovine, fly) all splice sites within the coding regions occur at identical positions (Fig. 5). Translation is initiated in exon 2, which con- tains the GXXXXGK sequence; exon 3 contains DVGG, and exon 5, CAT, with NKQD divided between exons 4 and 5. Lo- cations of introns within the coding regions of the hARF4 and -5 class I1 genes are identical but differ from those of the class I genes (1941). Splice sites in the dARF I1 and dARF I11 genes differ from each other as well as from those of the mammalian class I ARF genes (Fig. 5).

ARF I11 ( B ) deduced amino acid sequences shown in single-letter code under the respective codon. Exon nucleotides are in uppercase and intron nucleotides in lowercase letters. Putative adenylation signals are

codon. The GenBank accession number for dARF I1 is L25062 and, for underlined. Numbering of nucleotides begins with "A" of the initiation

dARF 111, L25064. The asterisk indicates in-frame "stop" codons.

21558

CONSENSUS hARFl bARF2 hARF3 dARFI

hARF4 hARF5 dARFI I

hARF6 dARFIII

CONSENSUS hARFl bARF2 hARF3 dARFI

hARF4 hARF5 dARFII

hARF 6 dARFIII

CONSENSUS hARFl bARF2 hARF3 dARF I

hARF4 hARF5 dARFII

hARF 6 dARFIII

1 1 1 1

1 1 1

1 1

71 71 71 71

71 71 71

67 61

141 141 141 141

141 141 141

137 137

ADP-ribosylation Factors in D. melanogaster

MG L LFGKKEMRI LMV-ILYKLKLG EIVTTIPTIG FNVEWYKN I FTVWQUX ..nifan.fk g . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . s . . . . . . . . ..nvfek.fk s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . s . . . . . . . . ..nifgn.lk s.i . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .s . . . . . . . . ..nvfan.fk g . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . s . . . . . . . . ..ltiss.fs r. . . . . q... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .c . . . . . . . . ..ltvsa.fs ri ....q... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .c . . . . . . . . ..ltiss.lt r. ....q... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .c . . . . . . . . ..kvlsk--- -i..n..... .. 1 . . . . . . . . . . . . . . . . . qs. . . . . . v. ...... t. .. vk.n . . . . . . ..kllsk--- -i..n..... .. 1 . . . . . . . . . . . . . . . . . qs . . . . g.v. . . . . . . t... vk.n . . . . . . QDKIRPLWRH YFQNTQGLIF WDSNDRE R EAR EL RM L EDELRDAV LL F-L PNAM EIT ............................ .v n...e..m.. .a . . . . . . . . . . v . . . . . . . . . . . naa... ............................ .v n...e..t.. .a. . . . . . . . . . v.v . . . . . . . . . naa . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .i g...e..m.. .a . . . . . . . . . . i . . . . . . . . . . . naa... . . . . . . . . . . . . . . . . . . . . . . . . . . . . .v n...e..rn.. .a. . . . . . . . . . v . . . . . . . . . . . naa...

. . r . . . . . k. . . . . . . . . . . . . . . . . . . .i q.vad..qk. .lv . . . . . . . . . 1 . . . . . . . . . . . ais.m.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . .v q.sad..qk. .q . . . . . . . . . . v . . . . . . m ....p v s . 1 .

. . . . . . . . . . . . . . . . . . . . . . . . . . . d .i t..er..qn. .q . . . . . . . . . . v. . . . . . . . . . . taa.1.

. . . . . . . . . . .y tg . . . . . . . . . ca..d .i d...q..h.i indr.m ... i i.i . . . . . . . .d..kph..q

.......... . y tg . . . . . . . . . ca..d .i d...t..h.i indr.m ... i i.i . . . . . . . .d..kph..q DKLGL LR R WY QAWSGCGLYEGL DWL SN L K . . . . . hs..h .n..i..... . . . . . . . . . . . . . ..q. rnqk 181 . . . . . hs..q .n..i..... . . . . . . . . . . . . . ..q. .nqk 181 . . . . . hs..h .n..i..... . . . . . . . . . . . . . a.q. .nkk 181 . . . . . hs..n .s..i..... . . . . . . . . . . . . . ..q. .nanr 182

.....q s..n .t..v..... .q. t. . . . . . . . . ..e.s .I 180

... r.nq..n .h.fi.s... .q.h...... . . . .ae.a .k 180

e....tri.d .n..v.ps.. . . . . . . . . . . t.. t..y . s 175 e.. ..tri.d .n..v.ps.. . . . . . . s . . . i.. t..h .1 175

.....q h..s .t..v..... .q.t...d.. ... .he.s .r 180

human ARFl(7); bARF2, bovine ARF2 (6); hARF3, human ARF3 (7); hARF4, human ARF4 (41); M F 5 , human ARF5 (9); hARF6, human ARF6 FIG. 4. Alignment of deduced amino acid sequences of A R F s from Drosophila and other eukaryotes. Sources of sequences are: h A R F l ,

(9). Amino acids identical in at least six of the nine sequences compose the consensus sequence shown at the top. Dots indicate identity with the consensus sequence. Consensus GTP-binding (DVGG, NKQD, TCAT) and hydrolysis (GX,GK) sequences are underlined.

GLDAAGK DVGG NKQ D CAl

Class I h A R F l dARFI {ll

FIG. 5. Structural comparison ofARF genes. Coding exons are represented by black boxes and introns by horizontal lines. Only coding regions of exons are depicted; the coding region begins in exon 2. Exons are drawn to scale; introns with -//- are not. Consensus amino acid sequences for guanine nucleotide binding and GTP hydrolysis are noted above the exons and indicated in other genes by vertical lines. Numbers at the end of the coding exons are the amino acid positions of splicing sites. Data for hARFl and M F l are in Refs. 4 and 20, respectively.

Genomic Southern Analysis-To determine whether dARF 11 and dARF I11 represent single copy genes, genomic DNA was digested with restriction enzymes and subjected to Southern blot analysis after agarose gel electrophoresis. In each digest, the dARF I1 or dARF I11 probe hybridized with a single major fragment (Fig. 6). The two probes hybridized with fragments of different sizes consistent with the existence of dARF I1 and dARF I11 each as a single gene, although the existence of other class I1 or class I11 genes cannot be ruled out.

mRNA Distribution in Adult Body Parts-The dARF I1 tran- script(s) appeared as a very broad band ranging in size from 0.65 to 1 kb. This was not due to mRNA degradation since dARF I11 and the control ribosomal protein 49 appeared as narrower bands on the same gel (data not shown). When the autoradiographic exposure time was reduced, the broad band remained and narrower individual bands still were not distin- guishable. We interpret this to mean that the message may undergo several different types of alternative splicing, with the

splice variants all very similar in size, or that there is alterna- tive polyadenylation similar to some mammalian ARFs (34- 36). Reprobing the stripped blot with the ribosomal protein 49 cDNA, which is uniformly distributed, showed that there was significantly more RNA in the leg lane than in the others. The least RNA was loaded in the body lane. Taking into account differences in loading, the dARF I1 mRNA appears fairly uni- formly distributed throughout adult flies, although it may be somewhat higher in heads (which are enriched in nervous tis- sue). This is in contrast to dARF I mRNA (201, which was slightly more concentrated in legs (which are mostly muscle and neurons).

In contrast to both dARF I and I1 mRNA, dARF I11 mRNA was significantly more abundant in heads than in other body parts, which suggests that this could be the functional equiv- alent of those mammalian ARFs that are most highly expressed in brain. These transcripts were more discrete in size than those for dARF I1 and at 1.4 kb are larger than the largest of

ADP-ribosylation Factors in D. melanogaster 21559

23 - 9.4 - 6.6 - 4.4 - 2.3 - 2.0 - 1.3 - 1.1 - 0.8 - 0.6 - 0.3 -

1 2 3 4 U U

1 2 3 4

A B FIG. 6. Southern blot analysis of genomic DNA from wild-type

flies. Genomic DNA was digested with restriction enzymes before elec- trophoresis in 0.8% (w/v) agarose gel. Blots were hybridized with a "P-labeled 872-bp fragment of dARF I1 (A) or a 1078-bp fragment of dARF I11 ( B ) . Positions of the size markers are on the left. A: lane 1 , DraI; lane 2, AccI; lane 3, SpeI; lane 4, AccI plus SpeI. B: lane I , DraI; lane 2, NsiI; lane 3, SpeI; lane 4, NsiI plus SpeI.

B

SDS + 4-

GTP + + FIG. 8. Effect of detergent and GTP on stimulation of cholera

toxin ADP-ribosyltransferase activity by recombinant Dro- sophila ARF I1 and I11 proteins. Approximately 1.1 pg of purified dARF I1 or dARF 111 fusion protein were assayed for cholera toxin ADP-ribosyltransferase activity with agmatine as substrate. Assays, as described under "Experimental Procedures," contained 0.003% SDS or 100 p~ GTP, or both. Open bars, CTA alone; hatched bars, CTA and Drosophila rARF 11; solid bars, CTA and Drosophila rARF 111.

- 18.4

- 14.3 1 2 3 4 5 6 7 s t d 1 2 3 4 5 6 7

8

0

% 53 '

c 4*.. "

%

FIG. 7. Chromosome mapping of Drosophila ARF 11 and 111 by in situ hybridization. Fragments of dARF I 1 (A) or dARF I11 DNA ( B ) were biotinylated by nick translation and hybridized to larval salivary gland chromosome squashes. Arrows indicate sites of hybridization as detected by the alkaline phosphatase reaction product. The vertical lines in panel B mark the start of the indicated numbered chromosome regions.

the ARF I1 mRNAs. Under the conditions used for Northern analysis, there was no indication that any specific probe was cross-hybridizing with another AFtF mRNA, since non-overlap- ping bands of different sizes were detected with each probe, i.e.

Chromosome Mapping-Each ARF was mapped to a separate chromosome. Using in situ hybridization of biotin-labeled probes to larval salivary gland chromosomes, dARF I1 was mapped to 102F on the small fourth chromosome (Fig. 7A) and dARF I11 to 51F on the right arm of chromosome 2 (Fig. 7B). dARF I was previously mapped to 79F3-6 on the left arm of chromosome 3 (20). Thus, the two genes that are expressed

dARF I, 1.8 kb (20); dARF 11, 0.65-1 kb; dARF 111, 1.4 kb.

- 18.4

- 14.3 1 2 3 4 5 6 7 s t d

FIG. 9. Immunoreactivity of recombinant ARF proteins. 10 pg

ARF2 (lane 2), rhARF5 (lane 3 ) , or rhARF6 (lane 4 ) , 0.2 pg of dA.RF I of crude E. coli lysate BL21 (lane 1),1 pg of purified recombinant bovine

that had been separated from intact fusion protein after cleavage with thrombin (27) (lane 5), and 10 pg of crude E. coli lysate containing dARF I 1 (lane 6) or dARF I11 (lane 7) were subjected to SDS-PAGE in

with antibodies against bovine sARF I1 (A), human rARF5 ( B ) , or 14% polyacrylamide gels, transferred to nitrocellulose, and incubated

human rARF6 ( C ) (4, 14,3739). Following incubation with horserad- ish peroxidase-conjugated goat anti-rabbit IgG, proteins were detected with 4-chloro-1-naphthol and hydrogen peroxidase (2, 37.40). dARF I 1 and dARF I11 synthesized in E. coli as non-fusion proteins were not purified before electrophoresis.

throughout the organism (dARF I and 11) map close to hetero- chromatic regions.

Biochemical and Immunological Comparisons of Drosophila and Mammalian ARF Proteins-To confirm that dARF I1 and dARF I11 have ARF activity, they were synthesized as fusion proteins in E. coli, and their effects on cholera toxin-catalyzed ADP-ribosylagmatine formation and auto-ADP-ribosylation of the toxin A1 protein were assayed (2, 37). Each stimulated auto-ADP-ribosylation of the cholera toxin A1 protein (data not shown). In the presence of GTP, dARF I11 enhanced toxin- catalyzed ADP-ribosylagmatine formation; dARF 11, however, stimulated toxin activity only when SDS as well as GTP was present (Fig. 8).

dARF I1 and dARF I11 synthesized as recombinant proteins in E. coli were immunologically similar to class I1 (hARF5) and class I11 (hARFG), respectively (Fig. 9), although dARF I11 cross-reacted very slightly with anti-rhAFtF 5. Deduced amino acid sequences of these two newly described Drosophila ARFs

21560 ALIP-ribosylation Factors in D. melanogaster

FIG. 10. Evolutionary relationships of ARF cDNA encoding amino acids. The evolutionary tree for known A R F s (see Fig. 4 for abbreviations) was con- structed using the Geneworks program. Branch lengths are proportional to ealcu- lated values.

0.049-

0.031 AARW

hARF5

0.021 r“--- hARF1

I 0.024 j yARF2

O . i f 6

yARFI

I [--- dAflR1I 0.030

hARm

are consistent with the division of ARFs into three classes based on similarities in predicted protein sizes and structures, and in gene structures. Phylogenetic analysis, shown as an evolutiona~ tree structure in Fig. 10, bears out this conclusion.

The mamma~an and yeast ARFs are clearly imp~icate~ in intracellular vesicular transport, perhaps in endocytosis as well as in Golgi and endoplasmic reticulum. Mammalian class I ARFs 1 and/or 3 are required for binding of the macromolecu- lar protein complex termed “coatomer” to membrane that pre- cedes formation of Golgi-derived vesicles and may act similarly at other intracellular membranes. It seems not unlikely that class I1 and 111 ARFs perform analogous functions at different loci, although this remains to be established. The presence of ARFs of all three classes in Drosophila may facilitate elucida- tion of their individual roles in cells.

Acknowledgment-We thank Nancy Bourgeois for excellent technical and photographic assistance.

REFERENCES 1. 2.

3.

Kahn, R. A., and Gilman, A. G. (1984) J. Biol. Chem. 269,62284234 %ai, S.-C., Noda, M., Adamik, R., Chang, P. P., Chen, H.-C., Moss, J., and

Steams, T., Willingham, M. C., Botstein, D., and Kahn, R. A. (1990) Proc. Natl. Vaughan, M. (1988) J. Biol. Chem. 263,1768-1772

4. Serventi, I., Moss, J., and Vaughan, M, (1992) in Current Topics in Microbial- Acad. Sci. U. S. A. 87,1238-1242

ogy and Immunology (Aktories, K., ed) Vol. 175, pp. 43-67, Springer-Verlag, Heidelberg, Germany

5. Sewell, J. L., and Kahn, R. A. (1988) Proc. Natl. dead. Sci. U. S. A. 86,4625-

6. Price, S. R., Nightingale, M., %ai, S.-C., Williamson, K. C., Adamik, R., Chen, 4624

H.-C.. Moss, J.. and Vawhan. M. (1988) Proc. Natl. Acad. Sci. U. S. A. 88. - . 5488-5491

Vaughan, M. (1989) Proc. Natl. Acad. Sei. U. S. A. 86,6101-6105

8287

7. Bohak, D. A,, Nightingale, M. S., Murtagh, J. J., Jr., Price, S. R., Moss, J., and

8. Kahn, R. A,, Goddard, C., and Newkirk, M. (1988) J. RioZ. Chem. 263,8282-

9. Tsuchiya, M., Price, S. R., Tsai, S.-C., Moss, J., andvaughan, M. (1991) J. Biol.

10. Murtagh, J. J., Jr., Mowatt, M. R, Lee, C.-M., Lee, F.-J. S., Mishima, K., Nash,

11. Serafini, T., Orci, L., Amherdt, M., Brunner, M., Kahn, R. A., and Rothman, J.

12. Lenhard, J., Kahn, R. A., and Stahl, P. D. (1992) J. Biol. Chem. 267, 13047-

13. Boman, A. L., Taylor, T. C., Melancon, P., and Wilson, K. L. (19921 Nature 368,

Chem. 266,2772-2777

T. E., Moss, J., and Vaughan, M. (1992) J. Biol. Chcm. 267,9654-9662

E. (1991) Cell 67,239-253

13052

512-514

Class I1

i Class I

Class I11

14. Tsai, S.-C., Adamik, R., Haun, R. S., Moss, J., and Vaughan, M. (1992) P m .

15. %ai, S.-C., Adamik, R., Haun, R. S., Mow, J., and Vaughan, M. (1993) J. Bid. Natl. Acad. Sci. U. S. A. 89,9272-9276

Chem. 268,10820-10825 16. Steams, T., Kahn, R. A, Botetein, D., and Hoyt, M. A, (1990) Mol. Cell. Biol. 10,

6690-6699 17. Kahn, R A., Kern, F. G., Clark, J., Gelmann, E. P., and Rulka, C. (1991)J. Riol.

18. Lee, F.4. S., MOSS, J., and Vaughan, M. (1992) J. Bwl. Chem. 267, 24441- Chem. 266,2606-2614

19. Serventi, I. M., Cavanaugh, E., MOSS, J., and Vaughan, M. (1993) J. Biol. 24445

20. Murtagh, J. J., Jr., Lee, F.J. S., De&, P., Hall, L. M., Monaco, L., Lee, C.-M., Chem. 268, 48654872

Stevens, L. A,, Moss, J., and Vaughan, M. (1993) Biochemistry 32, 6011- 6018

21. Haun, R. S., Serventi, I. M., %ai, S.-C., Lee, C.-M., Csvanaugh, E., Stevens, L., Moss, J., and Vaughan, M. (1992) Clin. Res. 40,148A

22. Sanger, F., Nicklen, S., and Coulson, R. A. (1977) Proc. Natl. Acad. Sci. U. S. A. 74,54634467

23. Frohman, M. A., Dush, M. K., and Martin, G. R. (1988) Proc. Natl. Acad. Sci. U. S. A. 85,8998-9002

24. Lew, A. M., and Kemp, D. J. (1989) Nucleic Acids Res. 17, 5859-5860

26. Haun, R. S., and Moss, J. (1992) Gene (Amst. 112, 3 7 4 3 25. Rosenthal, A., and Johns, D. S. C. (1990) Nucleic Acids Res. 18, 3095-3096

27. Smith, D. B., and Johnson, K. S. (1988) Gene (Amst.) 67,3140 28. Lee, F.-J. S., Moss, J., and Lin, L.-W. (1992) Biolhchniques 13, 844-646 29. Schmidt-Nielsen, B. K., Gepner, J. I., Teng, N. N. H., and Hall, L. M. (1977) J.

30. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Neurochem. 29, 1013-1029

Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

31. OConnell, P. O., and Rosbash, M. (1964) Nucleic Acids Res. 12,5495-5513 32. Engels, W. R., Preston, C. R., Thompson, P., and Eggleston, W. B. (1985)Focus

33. Price, S. R., Barber,A., and Moss, J. (1990) in ADP-rihosylating ‘Ibzins and G (Idaho) 8,-

Proteins: Insights Into Signal Bansduction (Moss, J., and Vaughan, M., eds) pp. 397-424, American Society for Microbiology, Washington, D. C.

34. %ai, SX., Haun. R. S., Tsuchiya, M.. Moss, J., and Vaughan, M. (1991) J. Biol. Chem. 266,23053-23059

35. Lee, C.-M., Ham. R. S., %ai, S.-C., Moss, J., and Vaughan, M. (1992) J. Bioi.

36. Mishima, K., Price, S. R., Nightingale, M. S., Kousvelari, E., MOSS, J., and

37. %ai, S.-C., Noda, EA.,Adamik, R., Moss, J., andvaughan, M, (1987)proC. Natl.

38. Tsai, S.-C., Adamik, R., Tsuchiya, M., Chang, P. P., Moss, J., and Vaughan, M.

39. Price, S. R., Welsh, C. F., Haw, R. S,, Stanley, S. J., Moss, J., and Vaughan, M.

40. Halpern, J., %ai, S.-C., Adamik, R., Kanaho, Y., Bekase, E., Kung, H.-F., Moss,

41. Monaco, L., Murtagh, J. J., Newman, K. B., %ai, S.-C., Moss, J., and Vaughan,

Chem. 267,9028-9034

Vaughan, M. (1992) J. Bid. Cham. 267,24109-24116

&ad. Sei. U. S. A. 84,5139-5142

(1991) J. Biol. Chem. 266,8213-8219

(1992) J. Bid. Chem. 267,17766-17772

J., and Vaughan, M. (1986) Mol. PharmacoE. 29,515-519

M. (1990) Proc. Natl. Acad. Sei. U. S. A. 87,2206-2210