Original Full Length Article

The effect of CCL3 and CCR1 in bone remodeling induced by mechanical loadingduring orthodontic tooth movement in mice

Silvana R. de Albuquerque Taddei a,b, Celso M. Queiroz-Junior a,b, Adriana P. Moura a,b, Ildeu Andrade Jr. c,⁎,Gustavo P. Garlet d, Amanda E.I. Proudfoot e, Mauro M. Teixeira a, Tarcília A. da Silva b

a Laboratory Immunopharmacology, Department of Biochemistry and Immunology, Institute of Biological Sciences, Federal University of Minas Gerais, ICB/UFMG,Avenida Presidente Antônio Carlos 6627, 31.270-9010, Belo Horizonte, MG, Brazilb Department of Oral Pathology, Faculty of Dentistry, Federal University of Minas Gerais, FO/UFMG, Avenida Presidente Antônio Carlos 6627, 31.270-901, Belo Horizonte, MG, Brazilc Department of Orthodontics, Faculty of Dentistry, Pontifical Catholic University of Minas Gerais, PUC Minas, Avenida Dom José Gaspar 500, 30535-901, Belo Horizonte, MG, Brazild Department of Biological Sciences, School of Dentistry of Bauru, São Paulo University, FOB/USP, Al. Octávio Pinheiro Brisola 9-75, CEP 17012-901, Bauru, SP, Brazile Merck Serono Geneva Research Centre, 9, Chemin des Mines, CH-1211 Geneva, Switzerland

a b s t r a c ta r t i c l e i n f o

Article history:Received 28 May 2012Revised 26 September 2012Accepted 29 September 2012Available online 8 October 2012

Edited by: J. Aubin

Keywords:CCL3CCR1Bone remodelingMechanical loading

Bone remodeling is affected by mechanical loading and inflammatory mediators, including chemokines. Thechemokine (C–C motif) ligand 3 (CCL3) is involved in bone remodeling by binding to C–C chemokine receptors 1and 5 (CCR1 and CCR5) expressed on osteoclasts and osteoblasts. Our group has previously demonstrated thatCCR5 down-regulates mechanical loading-induced bone resorption. Thus, the present study aimed to investigatethe role of CCR1 and CCL3 in bone remodeling induced bymechanical loading during orthodontic toothmovementinmice. Our results showed that bone remodelingwas significantly decreased inCCL3!/! andCCR1!/!mice and inanimals treated with Met-RANTES (an antagonist of CCR5 and CCR1). mRNA levels of receptor activator of nuclearfactor kappa-B (RANK), its ligand RANKL, tumor necrosis factor alpha (TNF-α) and RANKL/osteoprotegerin (OPG)ratio were diminished in the periodontium of CCL3!/! mice and in the group treated with Met-RANTES.Met-RANTES treatment also reduced the levels of cathepsin K andmetalloproteinase 13 (MMP13). The expressionof the osteoblast markers runt-related transcription factor 2 (RUNX2) and periostin was decreased, whileosteocalcin (OCN) was augmented in CCL3!/! and Met-RANTES-treated mice. Altogether, these findings showthat CCR1 is pivotal for bone remodeling induced by mechanical loading during orthodontic tooth movementand these actions depend, at least in part, on CCL3.

© 2012 Elsevier Inc. All rights reserved.

Introduction

Osteoimmune response and mechanical loading are intimatelyrelated to the activity of osteoclasts and osteoblasts, and consequentlybone remodeling [1,2]. Several in vitro studies have identified possiblemechanisms throughwhichmechanical loading is converted to biologicalresponses [3,4]. Nevertheless, there is a lack of data regarding the evalu-ation of in vivo consequences triggered by mechanical strain.

Compression by mechanical strain induces necrosis, hypoxia, celldamage and bone resorption. In contrast, tension forces promote angio-genesis, stretch of matrix and bone formation [5,6]. During orthodontic

tooth movement (OTM), the mechanical strain-induced inflammatoryresponse is characterized by the early release of specific mediators inperiodontium [5,6]. These molecules induce bone resorption orformation around the teeth, depending on the type of strain applied[5,6].

Chemokines have a pivotal role in strain-managed bone remodeling[7–10]. For example, it has been shown that the expression of CCL3 andits receptor CCR1 is increased in bone and soft periodontal tissues undermechanical loading [8,9]. Although the function of CCL3 and CCR1 forbone remodeling is not known, CCL3may recruit and activate osteoclastprecursor cells and osteoblasts, hence potentially leading to boneremodeling [11,12]. Furthermore, CCL3 binding to CCR1 and CCR5seems to exert significant pro-resorptive effects in bone loss-associatedinfectious conditions, including periodontal disease [13,14]. Interestingly,CCR5 controlled resolution of inflammation in experimental arthritis [15]and reduced bone resorption during OTM [9], suggesting that the majoreffects of CCL3 on bone remodeling may be via CCR1. Therefore, thepresent study aimed to investigate the role of CCL3 and CCR1 on alveolarbone remodeling and tooth movement triggered by application ofmechanical loading.

Bone 52 (2013) 259–267

⁎ Corresponding author at: Departamento de Clínica, Patologia e Cirurgia Odontológicas,Faculdade de Odontologia, Universidade Federal de Minas Gerais, Av. Antônio Carlos 6627,CEP 31.270-901, Belo Horizonte, Minas Gerais, Brazil. Fax: +55 31 3499 2430.

E-mail addresses: silvana.albuquerque@gmail.com (S.R. de Albuquerque Taddei),cmqj@yahoo.com.br (C.M. Queiroz-Junior), adrianamoura@hotmail.com (A.P. Moura),ildeu_andrade@yahoo.com.br (I. Andrade), garletgp@usp.br (G.P. Garlet),amanda.proudfoot@merckserono.net (A.E.I. Proudfoot), mmtex.ufmg@gmail.com(M.M. Teixeira), silva.tarcilia@gmail.com, tarcilia@ufmg.br (T.A. da Silva).

8756-3282/$ – see front matter © 2012 Elsevier Inc. All rights reserved.http://dx.doi.org/10.1016/j.bone.2012.09.036

Contents lists available at SciVerse ScienceDirect

Bone

j ourna l homepage: www.e lsev ie r .com/ locate /bone

Materials and methods

Experimental animals

Ten-week-old wild-type mice (WT) (50 C57BL6/J mice) and CCL3deficientmice (40 CCL3!/!mice) obtained from the Jackson Laboratory(Bar Harbor, ME, USA), CCR1 deficient mice (10 CCR1!/! mice) fromTaconic Farms (New York, USA), vehicle- (PBS) treated mice (groupVehicle, n=25 mice) and Met-RANTES- (an antagonist of CCR1 andCCR5) treated (s.c., 0.5 mg/kg/day) mice (group Met, n=25 mice)were used in this study. All animals were treated under the ethicalregulations for animal experiments, defined by the InstitutionalEthics Committee. Each animal's weight was recorded throughout theexperimental period, and there was no significant loss of weight.

Experimental protocol

Induction of tooth movement was performed as described pre-viously [10]. Briefly, an orthodontic appliance consisting of a Ni-Ti0.25!0.76 mm coil spring (Lancer Orthodontics, San Marcos, CA,USA) was bonded between maxillary right first molar and the incisorsof each mouse, exerting a force of 0.35 N in the mesial direction.There was no reactivation during the experimental period. Forhistomorphometric analysis, the left side ofmaxilla (without appliance)was used as control and mice were euthanized after 6 and 12 days. Formolecular analysis, the groups were euthanized at 0, 12 and 72 h. Forevery set of experiments, 5 mice were used for each time-point.

Histopathological analysis

The right and the left maxillary halves were dissected and fixed in10% buffered formalin (pH 7.4). Afterward, each hemimaxilla wasdecalcified in 14% EDTA (pH 7.4) for 20 days and embedded in paraffin.Sampleswere cut into sagittal sections of 5 μmthickness and stained fortartrate resistant acid phosphatase (TRAP; Sigma-Aldrich, Saint Louis,MO, USA). The mesial side of the first molar distal-buccal root wasused for the TRAP positive osteoclast counts, on 5 sections per animal.The slides were counted by two examiners blind to group status.

The quantification of the amount of tooth movement was performedas described previously [10]. Toothmovement was obtained through thedifference between the distance of the cementum–enamel junction of thefirst molar and the second molar of the experimental side in relation tothe control side of the same animal. Five vertical sections per animalwere evaluated under a microscope Axioskop 40 (Carl Zeiss, Göttingen,Niedersachsen, Germany) adapted to a digital camera (PowerShotA620, Canon, Tokyo, Honshu, Japan).

RNA extraction and real-time PCR

Periodontal ligament and surrounding alveolar bone sampleswere extracted from the upper first molars using a stereomicroscope.Gingival tissue, oral mucosa and tooth were discarded. Besides wholealveolar samples, periodontal tissues and alveolar bone extractedfrom the distal area of the distal-buccal root of the first maxillarymolar were also collected in a separate set of experiments and consid-ered samples preferentially subjected to tension forces. Similarly, themedial region of the mesial root of the first upper molar was collectedseparately, corresponding to a region of pressure strain. These tissueswere submitted to RNA extraction using TRIZOL reagent (Invitrogen,Carlsbad, CA, USA). Complementary DNA (cDNA) was synthesizedusing 2 μg of RNA (Superscript II, Invitrogen). Real-time PCR analysiswas performed in MiniOpticon (BioRad, Hercules, CA, USA) usingSYBR-green fluorescence quantification system (Applied Biosystems,Foster City, CA, USA). Standard PCR conditions were 95 °C (10 min),and then 40 cycles of 94 °C (1 min), 58 °C (1 min) and 72 °C (2 min),followed by the standard denaturation curve. Primer sequences are

described in Table 1. The mean Ct values from duplicate measurementswere used to calculate the expression of the target gene, with normali-zation to a housekeeping gene (β-actin) using the 2!ΔΔCt formula.

Statistical analysis

Results of each group were expressed as the mean±standard devia-tion (SD). The differences among the groups were analyzed by one-wayanalysis of variance (ANOVA) followed byNewman–Keulsmultiple com-parison test. Pb0.05 was considered statistically significant.

Results

Strain-induced alveolar bone remodeling and osteoclast recruitment arepositively modulated by CCL3

To know the functions of CCL3 in bonemetabolism,we used amodelof bone remodeling induced by mechanical loading during OTM inCCL3!/! mice. Our first step was to analyze the OTM phenotype inWT and CCL3!/! mice. The amount of tooth movement (Fig. 1A) andnumber of TRAP-positive osteoclasts (Fig. 1B) were significantlyincreased after 6 and 12 days in both groups. However, CCL3!/! miceshowed less tooth movement (Fig. 1A) and fewer TRAP-positive osteo-clasts (Fig. 1B) at the same time points.

Alveolar bone morphology of control side (without orthodonticappliance) had increased TRAP activity on the distal alveolar bonesurface (representing physiological toothmovement), while no activitywas noted in the mesial region of this group (Figs. 1C and F). On theother hand,mechanical loading applied on the tooth in themesial direc-tion induced increased TRAP activity in the mesial site after 6 days. Onday 12, WT mice presented a greater alveolar bone resorption areaand TRAP activity (Figs. 1D and G) than CCL3!/! mice (Figs. 1E and H).

CCL3 affects osteoclast and osteoblast markers during bone remodelinginduced by orthodontic force

In view of the altered phenotype of alveolar bone microscopyobserved in CCL3!/!mice subjected tomechanical force, we character-ized the expression of markers involved in bone resorption. Mechanicalloading induced increased expression of receptor activator of nuclearfactor kappa-B (RANK) (Fig. 2A), receptor activator of nuclear factorkappa-B ligand (RANKL) (Fig. 2B) and tumor necrosis factor alpha

Table 1Primer sequences and reaction properties.

Target Sense and anti-sense sequences At (°C) Mt (°C) Bp

IL-10 AGATCTCCGAGATGCCTTCACCGTGGAGCAGGTGAAGAAT

58 85 307

RUNX2 AACCACAGAACCACAAGTGCGAAATGACTCGGTTGGTCTCGG

58 80 119

OCN AAGCCTTCATGTCCAAGCAGGTTTGTAGGCGGTCTTCAAGCC

60 78 170

Periostin AAACCTCAGCAGGCGCTTTCCCCTGGATTACCCTTGAGAA

58 79 58

OPG GGAACCCCAGAGCGAAATACACCTGAAGAATGCCTCCTCACA

57 77 225

RANKL CAGAAGATGGCACTCACTGCACACCATCGCTTTCTCTGCTCT

65 73 203

RANK CAAACCTTGGACCAACTGCACGCAGACCACATCTGATTCCGT

60 84 76

Cathepsin K CTCCCTCTCGATCCTACAGTAATGATCAGAGTCAATGCCTCCGTTC

58 80 307

MMP13 AGAGATGCGTGGAGAGTCGAAAAGGTTTGGAATCTGCCCAGG

65 85 162

TNF-α TGT GCT CAG AGC TTT CAA CAACTT GAT GGT GGT GCA TGA GA

58 80 124

β-Actin ATGTTTGAGACCTTCAACACACGTCAGACTTCATGATGG

56 75 495

At: annealing temperature; Mt: melting temperature; Bp: base pairs of amplicon size.

260 S.R. de Albuquerque Taddei et al. / Bone 52 (2013) 259–267

(TNF-α) (Fig. 2C) in WT and CCL3!/! groups, being these effects morepronounced in the pressure sides of the samples (Figs. 2A–C, inserts).However, the expression of these molecules was reduced in CCL3!/!

when comparedwithWTmice (Figs. 2A–C). Therewas no significant dif-ference in themRNA levels of cathepsin K (Fig. 2D) andmetalloproteinase13 (MMP13) (Fig. 2E) between the groups.

In addition, we further investigated if the absence of CCL3 couldinterfere with the expression of osteoblast markers and negative regula-tors of bone resorption. The expressionof runt-related transcription factor2 (RUNX2) (Fig. 3A) and periostin (Fig. 3C) was augmented in theperiodontium of both groups, but this increase was less pronounced inthe tension side of the samples of CCL3!/! mice when compared withWTmice after 72 h (Figs. 3A and C inserts). In contrast, there was no dif-ference in the levels of osteocalcin (OCN) (Fig. 3B), interleukin 10 (IL-10)(Fig. 3D) and osteoprotegerin (OPG) (Fig. 3E) in both groups. Moreover,the RANKL/OPG ratio was decreased in CCL3!/! mice, confirming thepro-resorptive role of CCL3 in this process (Fig. 3F).

The blockade of CCR1 and CCR5 reduces bone resorption after mechanicalloading

Given that CCL3 may bind to CCR1 and CCR5, our next step was toblock these receptors with Met-RANTES treatment. In animals treated

with the compound, there was reduction in the amount of OTM(Fig. 4A) and number of TRAP-positive osteoclasts (Fig. 4B). Overall,Met-RANTES-treated mice presented a more pronounced decreasein OTM (CCL3!/! 6 d: 58% reduction versusMet-RANTES 6 d: 65% re-duction; CCL3!/! 12 d: 36% reduction versusMet-RANTES 12 d: 42% re-duction) and number of TRAP-positive cells (CCL3!/! 6 d: 52% reductionversus Met-RANTES 6 d: 35% reduction; CCL3!/! 12 d: 29% reductionversusMet-RANTES 12 d: 61% reduction) than CCL3!/!mice. Qualitativeanalysis of alveolar bone confirmed diminished TRAP activity and boneresorption caused by Met-RANTES treatment (Figs. 4E and H).

Distinct expression of bone remodeling-related markers in mice treatedwith Met-RANTES

In accordance with the observed phenotype, treatment withMet-RANTES reduced the expression of RANK (Fig. 5A), RANKL(Fig. 5B), TNF-α (Fig. 5C), cathepsin K (Fig. 5D) and MMP13 (Fig. 5E) inthe periodontium of mice subjected to orthodontic force. Met-RANTESinduced a reduction in the expression of bone resorptionmarkers greaterthan the phenotype observed in CCL3!/! mice (RANK 72 h: CCL3!/!:52% reduction versus Met-RANTES: 67% reduction; RANKL 72 h:CCL3!/!: 48% reduction versus Met-RANTES: 66% reduction; TNF-α72 h: CCL3!/!: 24% reduction versus Met-RANTES: 69% reduction;

Fig. 1. (A) Time course changes in the amount of toothmovement inWT and CCL3!/! mice. (B) Number of TRAP-positive osteoclasts. (C–H) Histological changes related to orthodontictooth movement inWT and CCL3!/! mice. Sections of the periodontium around the disto-buccal root of the first molar were stained with TRAP. (C) Control group (without mechanicalloading). (D)WT and (E) CCL3!/! experimental group (12 days after mechanical loading). Panels (F), (G) and (H) represent the higher view of the identified area in (C), (D) and(E), respectively. Small arrows indicate TRAP-positive osteoclasts. MB, mesial alveolar bone; DB, distal alveolar bone; PL, periodontal ligament; R, root. Large arrows indicate thedirection of physiological and/or orthodontic tooth movement. Five mice were used for each time-point. Data are expressed as the mean±SD. *Pb0.05 comparing the controlgroup to the respective experimental group. #Pb0.05 comparing WT and CCL3!/! experimental groups. One-way ANOVA and Newman–Keuls multiple comparison test.

261S.R. de Albuquerque Taddei et al. / Bone 52 (2013) 259–267

cathepsin K 72 h: CCL3!/!: 24% reduction versus Met-RANTES: 58% re-duction; MMP-13 72 h: CCL3!/!: 11% reduction versus Met-RANTES:43% reduction). Also, the level of RUNX2 (Fig. 6A) was reduced inMet-RANTES-treated mice after 72 h of mechanical loading, whereasthis treatment induced increased expression of OCN after 12 and 72 h(Fig. 6B). On the other hand, the expression of periostin (Fig. 6C), IL-10(Fig. 6D) and OPG (Fig. 6E) was decreased after treatment withMet-RANTES, although the RANKL/OPG ratio (Fig. 6F) was reduced inmice treated with Met-RANTES, confirming the overall anti-resorptiveaction of this drug.

Deletion of CCR1 reduces OTM-induced bone resorption

Considering the previously demonstrated role of CCR5 as negativeregulator of bone resorption [9] and the lower amount of OTM and os-teoclasts after blockade of both CCR1 and CCR5, our next step was toconfirm whether CCR1 was the key receptor for the pro-resorptiveeffects of CCL3. This was investigated using CCR1!/! mice. Theamount of OTM (Fig. 7A) and numbers of TRAP-positive osteoclasts(Fig. 7B) were lower in CCR1!/! than inWTmice. These quantitative

results were confirmed by histomorphologic analysis, showing re-duced TRAP activity and bone resorption in CCR1!/! mice (Figs. 7Eand H).

Discussion

Bone remodeling is a lifelong process, which involves the equilibri-um between bone resorption and formation. This process might bemodulated by osteoimmune response and mechanical loading [1,2]. Inthis context, chemokines have a pivotal role in strain-induced bone re-modeling [7,9,10]. As the levels of CCL3 and CCR1 were increased inperiodontium after orthodontic force [8,9], the aim of the presentstudywas to evaluate the role of this ligand/receptor pair in this scenario.Our findings demonstrated that the CCL3/CCR1 axis plays an importantrole in osteoclast recruitment, differentiation and activity during boneremodeling induced by mechanical loading during OTM.

In accordance with our findings, previous studies demonstrated theeffect of CCL3 in osteoclast recruitment [11], differentiation [11,16,17]and activity [16]. In contrast, CCL3 did not affect bone loss associatedwith periodontal disease [13]. Therefore, it is important to note that

Fig. 2. mRNA expression of the osteoclast-related markers (A) RANK; (B) RANKL; (C) TNF-α; (D) cathepsin K; and (E) MMP13 in WT and CCL3!/! whole alveolar bone andperiodontium samples after 12 and 72 h of mechanical loading. The inserts show the expression of these markers in the respective tension and pressure sample sides. Ten mice wereused for each time-point. Data are expressed asmean±SD. *Pb0.05 comparing control to the respective experimental group. #Pb0.05 comparingWT and CCL3!/! experimental groups.One-way ANOVA and Newman–Keuls multiple comparison test.

262 S.R. de Albuquerque Taddei et al. / Bone 52 (2013) 259–267

the triggering factors (i.e., microbial factors vs.mechanical loading) andthe nature of inflammatory processes (i.e., chronic vs. transitory inflam-mation) can change the functions of some inflammatory mediators inbone remodeling processes [14]. Reinforcing this hypothesis, recentstudies demonstrated that CCR5 up-regulates infectious-related boneloss in periodontal diseases [13,14], while this same receptor inhibitsbone resorption induced by mechanical loading [9].

Levels of pro-resorptive markers, including RANK, RANKL andTNF-α, were decreased in CCL3!/! mice after mechanical loading,which is consistent with reduced bone resorption. In vitro studiesdemonstrated that CCL3 increases the expression of RANKL by osteo-blasts and induces osteoclast–osteoblast interaction, increasing osteo-clast differentiation and consequently bone resorption [17,18]. Inparallel, TNF-α is widely known to stimulate the progression of disor-ders associated with bone loss [19] and mechanical loading-inducedbone resorption [20]. It also triggers the release of other inflammatorymediators in stimulated tissues, including chemokines [11,21]. In thiscontext, TNF-α has already been demonstrated to stimulate CCL3production by osteoblasts [11]. Our findings showed that the tran-scription of TNF-α can also be up-regulated by CCL3, pointing a

possible mechanism by which CCL3 contributes to strain-inducedbone resorption.

To further strengthen our data, we used a pharmacological strategywith Met-RANTES, a CCL5 recombinant molecule, which binds to CCR1and CCR5, impairing the subsequent signaling and cellular response[22]. We verified that the blockade of both receptors resulted in attenu-ation of bone resorption phenotype aftermechanical loading associatedto OTM. In this context, Met-RANTES treatment reduced the levels ofthe RANK/RANKL axis and TNF-α in bone resorption scenario as ob-served in CCL3!/! mice. Accordingly, Met-RANTES treatment resultsin reduced TNF-α and RANKL expression and osteolysis in bone lyticdiseases, such as rheumatoid arthritis and periodontal disease [23,24].In addition, Met-RANTES treatment also decreased expression ofcathepsin K and MMP13 (proteases that degrade bone matrix), in con-trast to the expression observed in CCL3!/!mice. Indeed, some studiessuggest that other chemokines along with CCL3, including CCL4 andCCL5,might act cooperatively in the interactionwith CCR1 and CCR5 re-ceptors to induce bone resorption [13]. As these receptors are availablefor interacting with their ligands in CCL3!/! mice but not afterMet-RANTES treatment, this may account for the detection of some

Fig. 3.mRNA expression of osteoblast-relatedmarkers (A) RUNX2, (B) OCN and (C) periostin; down-regulators of bone resorption-relatedmarkers (D) IL-10 and (E)OPG; and (F) RANKL/OPG ratio in whole alveolar bone and periodontium samples of WT and CCL3!/! mice after 12 and 72 h of mechanical loading. The inserts show the expression of these markers in therespective tension and pressure sample sides. These samples are the same used for the evaluation of bone resorption markers. Data are expressed as mean±SD. *Pb0.05 comparing controlgroup to the respective experimental group. #Pb0.05 comparing WT and CCL3!/! experimental groups. One-way ANOVA and Newman–Keuls multiple comparison test.

263S.R. de Albuquerque Taddei et al. / Bone 52 (2013) 259–267

final mediators of matrix destruction, including cathepsin K andMMP13.Nevertheless, the significant reduction in the expression of bone resorp-tion and inflammatory markers in the periodontium of CCL3!/! miceresulted in an overall biological effect of reduced bone resorption, similarto the treatment with Met-RANTES.

Osteoblasts, in addition to osteoclasts, also express CCR1 and CCR5receptors [12]. As differentiation and function of osteoblasts are essen-tial to bone remodeling, we investigated the expression of osteoblastmarkers, RUNX2 (a transcription factor considered to be an early markerof osteoblast differentiation), periostin and OCN (late markers of osteo-blast differentiation and activity) [25]. We observed a reduction in thelevels of RUNX2 and periostin in CCL3!/! and Met-RANTES-treatedmice. In contrast, the expression of OCN was not different when com-paring WT and CCL3!/! mice, and it even increased after treatmentwith Met-RANTES. Therefore, our findings suggested that the blockadeof both CCR1 and CCR5 receptors and absence of CCL3 affect the expres-sion of osteoblast differentiation markers. However, as there was nostrong trend in effects (either overall increase and decrease, especiallyin the tension sites of the samples), the meanings of these findings arenot certain and further studies are necessary to understand howchemokines may affect osteoblast differentiation and function in vivoduring OTM.

Our results also showed a reduction in the expression of IL-10 andOPG after Met-RANTES treatment, which was not observed inCCL3!/! mice. These findings indicate that in the absence of CCL3,bone resorbing inhibitors (such as IL-10) are not affected, which isconsistent with the cooperative role of chemokines suggested in aprevious study [13]. This could also counterbalance the less pronouncedreduction of bone resorbing markers observed in CCL3!/! mice, giventhat IL-10 suppresses osteoclast differentiation and function by selec-tively inhibiting calcium signaling associated with RANK and byinhibiting osteoclast co-stimulatory molecules [29]. In contrast, thereduction of IL-10 and OPG in Met-RANTES treated mice did nottranslate in increased bone resorption, likely because the expressionof pro-resorptive mediators (RANKL, RANK, TNF-α) was also impaired,concomitantly with the reduced RANKL/OPG ratio. Altogether, thesedata are indicative of an anti-resorptive scenario after CCR1 blockade.

With these results, we hypothesize that CCR1 may positively modu-late bone resorption, given that previous data from our group [9] andothers [26] indicated that CCR5 is a down-regulator of bone resorption.Confirming this hypothesis, it was observed a diminished amount ofOTM and number of osteoclasts in CCR1!/! mice. Thus, it seems thatthe interaction between CCL3 and CCR1 is one of the responsible axesfor inducing bone resorption during mechanical loading induced by

Fig. 4. (A) Time course changes in the amount of tooth movement in vehicle- and Met-RANTES-treated mice. (B) Number of TRAP-positive osteoclasts. (C–H) Histological changesrelated to orthodontic tooth movement in vehicle- and Met-RANTES-treated mice. Sections of the periodontium around the disto-buccal root of the first molar were stained withTRAP. (C) Control group (without mechanical loading). (D) Vehicle and (E) Met-RANTES experimental group (12 days after mechanical loading). Panels (F), (G) and (H) represent thehigher view of the identified area in (C), (D) and (E), respectively. Small arrows indicate TRAP-positive osteoclasts. MB, mesial alveolar bone; DB, distal alveolar bone; PL, periodontalligament; R, root. Large arrows to the left indicate the direction of physiological and/or orthodontic tooth movement. Five mice were used for each time-point. Data are expressed asthe mean±SD. *Pb0.05 comparing the control group to the respective experimental group. #Pb0.05 comparing vehicle and Met-RANTES experimental groups. One-way ANOVA andNewman–Keuls multiple comparison test.

264 S.R. de Albuquerque Taddei et al. / Bone 52 (2013) 259–267

OTM. This is in line with the role of CCR1 in physiologic bone remodeling[27], in bone loss associated with multiple myeloma metastasis [28] andperiodontal disease [13].

In summary, CCR1 is a pivotal receptor involved in osteoclast re-cruitment, differentiation and activity, resulting in development of a

pro-resorptive bone scenario induced by mechanical loading duringOTM. These actions are dependent, at least in part, on CCL3. Moreover,the blockade of CCR1 and CCR5, using Met-RANTES, might be a thera-peutic strategy for reducing bone resorption, without affecting bonehomeostasis. Therefore, an adequate pharmacological therapy coupled

Fig. 5. mRNA expression of the axis (A) RANK/(B) RANKL; (C) TNF-α; and osteoclast-related markers (D) cathepsin K and (E) MMP13 in the periodontium of vehicle- andMet-RANTES-treated mice after 12 and 72 h of mechanical loading. Five mice were used for each time-point. Data are expressed as mean±SD. *Pb0.05 comparing control tothe respective experimental group. #Pb0.05 comparing vehicle and Met-RANTES experimental groups. One-way ANOVA and Newman–Keuls multiple comparison test.

Fig. 6.mRNA expression of osteoblast-relatedmarkers (A) RUNX2, (B) OCN and (C) periostin; down-regulators of bone resorption-relatedmarkers (D) IL-10 and (E)OPG; and (F) RANKL/OPG ratio in the periodontium of vehicle- andMet-RANTES-treated mice after 12 and 72 h of mechanical loading. These samples are the same used for the evaluation of bone resorptionmarkers. Data are expressed as mean±SD. *Pb0.05 comparing control group to the respective experimental group. #Pb0.05 comparing vehicle and Met-RANTES experimental groups.One-way ANOVA and Newman–Keuls multiple comparison test.

265S.R. de Albuquerque Taddei et al. / Bone 52 (2013) 259–267

with mechanical loading-based treatments may modulate osteoclastand osteoblast activity and, thus, enhance the effectiveness of boneremodeling therapies.

Acknowledgments

We are grateful to Fundação de Amparo a Pesquisas do Estado deMinas Gerais (FAPEMIG, Brazil), Coordenação de Aperfeiçoamentode Pessoal de Nível Superior (CAPES), Conselho Nacional deDesenvolvimento Científico e Tecnológico (CNPq, Brazil) andPró-Reitoria de Pesquisa (PRPq-UFMG) for financial support.

References

[1] Jones D, Glimcher LH, Aliprantis AO. Osteoimmunology at the nexus of arthritis,osteoporosis, cancer, and infection. J Clin Invest 2011;121(7):2534-42.

[2] Papachroni KK, Karatzas DN, Papavassiliou KA, Basdra EK, Papavassiliou AG.Mechanotransduction in osteoblast regulation and bone disease. Trends MolMed 2009;15(5):208-16.

[3] Cheung WY, Liu C, Tonelli-Zasarsky RM, Simmons CA, You L. Osteocyte apoptosis ismechanically regulated and induces angiogenesis in vitro. J Orthop Res 2011;29(4):523-30.

[4] Al-Dujaili SA, Lau E, Al-Dujaili H, Tsang K, Guenther A, You L. Apoptotic osteocytesregulate osteoclast precursor recruitment and differentiation in vitro. J CellBiochem 2011;112(9):2412-23.

[5] Krishnan V, Davidovitch Z. Cellular, molecular, and tissue-level reactions toorthodontic force. Am J Orthod Dentofacial Orthop 2006;129(4):469.e1–469.e32.

[6] Krishnan V, Davidovitch Z. On a path to unfolding the biological mechanisms oforthodontic tooth movement. J Dent Res 2009;88(7):597-608.

[7] Alhashimi N, Frithiof L, Brudvik P, Bakhiet M. Chemokines are upregulated duringorthodontic tooth movement. J Interferon Cytokine Res 1999;19(9):1047-52.

[8] Garlet TP, Coelho U, Repeke CE, Silva JS, Cunha FQ, Garlet GP. Differential expression ofosteoblast and osteoclast chemoattractants in compression and tension sides duringorthodontic movement. Cytokine 2008;42(3):330-5.

[9] Andrade Jr I, Taddei SRA, Garlet GP, Garlet TP, Teixeira AL, Silva TA, et al. CCR5down-regulates osteoclast function in orthodontic tooth movement. J Dent Res2009;88(11):1037-41.

[10] Taddei SRA, Andrade Jr I, Queiroz-Junior CM, Garlet GP, Garlet TP, Cunha FQ, et al.Role of CCR2 in orthodontic tooth movement. Am J Orthod Dentofacial Orthop2012;141(2):153-60.

[11] Yu X, Huang Y, Collin-Osdoby P, Osdoby P. CCR1 chemokines promote the chemotacticrecruitment, RANKL development, andmotility of osteoclasts and are induced by in-flammatory cytokines in osteoblasts. J Bone Miner Res 2004;19(12):2065-77.

[12] Yano S, Mentaverri R, Kanuparthi D, Bandyopadhyay S, Rivera A, Brown EM, et al.Functional expression of beta-chemokine receptors in osteoblasts: role of regulatedupon activation, normal T cell expressed and secreted (RANTES) in osteoblasts and reg-ulation of its secretion by osteoblasts and osteoclasts. Endocrinology 2005;146(5):2324-35.

[13] Repeke CE, Ferreira Jr SB, ClaudinoM, Silveira EM, deAssis GF, Avila-CamposMJ, et al.Evidences of the cooperative role of the chemokines CCL3, CCL4 and CCL5 and its re-ceptors CCR1+ and CCR5+ in RANKL+ cell migration throughout experimentalperiodontitis in mice. Bone 2010;46(4):1122-30.

[14] Ferreira Jr SB, RepekeCE, Raimundo FM,Nunes IS, Avila-CamposMJ, Ferreira BR, et al.CCR5 mediates pro-osteoclastic and osteoclastogenic leukocyte chemoattraction.J Dent Res 2011;90(5):632-7.

[15] Doodes PD, Cao Y, Hamel KM, Wang Y, Rodeghero RL, Kobezda T, et al. CCR5 is in-volved in resolution of inflammation in proteoglycan-induced arthritis. ArthritisRheum 2009;60(10):2945-53.

Fig. 7. (A) Time course changes in the amount of tooth movement inWT and CCR1!/! mice. (B) Number of TRAP-positive osteoclasts. (C) Control group (without mechanical loading).(D)WT and (E) CCR1!/! experimental group (12 days aftermechanical loading). Panels (F), (G) and (H) represent the higher view of the identified area in (C), (D) and (E), respectively.Small arrows indicate TRAP-positive osteoclasts. MB, mesial alveolar bone; DB, distal alveolar bone; PL, periodontal ligament; R, root. Large arrows to the left indicate the directionof physiological and/or orthodontic toothmovement. Five mice were used for each time-point. Data are expressed as themean±SD. *Pb0.05 comparing the control group to the respec-tive experimental group. #Pb0.05 comparing WT and CCR1!/! experimental groups. One-way ANOVA and Newman–Keuls multiple comparison test.

266 S.R. de Albuquerque Taddei et al. / Bone 52 (2013) 259–267

[16] Okamatsu Y, Kim D, Battaglino R, Sasaki H, Spate U, Stashenko P. MIP-1 gammapromotes receptor-activator-of-NF-kappa-B-ligand-induced osteoclast formationand survival. J Immunol 2004;173(3):2084-90.

[17] Tsubaki M, Kato C, Manno M, Ogaki M, Satou T, Itoh T, et al. Macrophage inflam-matory protein-1alfa (MIP-1a) enhances a receptor activator of nuclear factorkappaB ligand (RANKL) expression in mouse bone marrow stromal cells and oste-oblasts through MAPK and PI3K/Akt pathways. Mol Cell Biochem 2007;304(1–2):53-60.

[18] Watanabe T, Kukita T, Kukita A, Wada N, Toh K, Nagata K, et al. Direct stimulationof osteoclastogenesis by MIP-1alpha: evidence obtained from studies usingRAW264 cell clone highly responsive to RANKL. J Endocrinol 2004;180:193-201.

[19] Queiroz-Junior CM, Madeira MF, Coelho FM, Costa VV, Bessoni RL, Sousa LF, et al.Experimental arthritis triggers periodontal disease in mice: involvement of TNF-αand the oral microbiota. J Immunol 2011;187:3821-30.

[20] Andrade Jr I, Silva TA, Silva GA, Teixeira AL, Teixeira MM. The role of tumor necro-sis factor receptor type 1 in orthodontic tooth movement. J Dent Res 2007;86:1089-94.

[21] Silva TA, Garlet GP, Fukada SY, Silva JS, Cunha FQ. Chemokines in oral inflammatorydiseases: apical periodontitis and periodontal disease. J Dent Res 2007;86:306-19.

[22] Proudfoot AEI, Power CA, Hoogewerf AJ, Montjovent MO, Borlat F, Offord RE, et al.Extension of recombinant humanRANTES by the retention of the initiatingmethionineproduces a potent antagonist. J Biol Chem 1996;271:2599-603.

[23] Shahrara S, Proudfoot AE, Woods JM, Ruth JH, AminMA, Park CC, et al. Amelioration ofrat adjuvant-induced arthritis by Met-RANTES. Arthritis Rheum 2005;52(6):1907-19.

[24] Repeke CE, Ferreira Jr SB, Vieira AE, Silveira EM, Ávila-Campos MJ, da Silva JS, et al.Dose–response Met-RANTES treatment of experimental periodontitis: a narrowedge between the disease severity attenuation and infection control. PLoS One2011;6(7):e22526.

[25] Liu W, Toyosawa S, Furuichi T, Kanatani N, Yoshida C, Liu Y, et al. Overexpressionof Cbfa1 in osteoblasts inhibits osteoblast maturation and causes osteopenia withmultiple fractures. J Cell Biol 2001;155(1):157-66.

[26] De Rossi A, Rocha LB, Rossi MA. Interferon-gamma, interleukin-10, intercellularadhesion molecule-1, and chemokine receptor 5, but not interleukin-4, attenuatethe development of periapical lesions. J Endod 2008;34:31-8.

[27] Hoshino A, Iimura T, Ueha S, Hanada S, Maruoka Y, Mayahara M, et al. Deficiency ofchemokine receptor CCR1causes osteopenia due to impaired functions of osteoclastsand osteoblasts. J Biol Chem 2010;285(37):28826-37.

[28] Vallet S, Raje N, Ishitsuka K, Hideshima T, Podar K, Chhetri S, et al. MLN3897, anovel CCR1 inhibitor, impairs osteoclastogenesis and inhibits the interaction ofmultiple myeloma cells and osteoclasts. Blood 2007;110(10):3744-52.

[29] Park-Min KH, Ji JD, Antoniv T, Reid AC, Silver RB, Humphrey MB, et al. IL-10 sup-presses calcium-mediated costimulation of receptor activator NF-kappa B signalingduring humanosteoclast differentiation by inhibiting TREM-2 expression. J Immunol2009;182:2444-55.

267S.R. de Albuquerque Taddei et al. / Bone 52 (2013) 259–267