Synaptojanin 2 is a druggable mediator of metastasis and ... · CANCER Synaptojanin 2 is a druggable mediator of metastasis and the gene is overexpressed and amplified in breast cancer

R E S E A R C H A R T I C L E

C A N C E R

Synaptojanin 2 is a druggable mediator ofmetastasis and the gene is overexpressed andamplified in breast cancerNir Ben-Chetrit,1 David Chetrit,2 Roslin Russell,3 Cindy Körner,4 Maicol Mancini,1

Ali Abdul-Hai,5 Tomer Itkin,6 Silvia Carvalho,1 Hadas Cohen-Dvashi,1 Wolfgang J. Koestler,1*Kirti Shukla,4 Moshit Lindzen,1 Merav Kedmi,1 Mattia Lauriola,1† Ziv Shulman,6 Haim Barr,7

Dalia Seger,1 Daniela A. Ferraro,1 Fresia Pareja,1 Hava Gil-Henn,8 Tsvee Lapidot,6

Ronen Alon,6 Fernanda Milanezi,9 Marc Symons,10 Rotem Ben-Hamo,11 Sol Efroni,11

Fernando Schmitt,9 Stefan Wiemann,4 Carlos Caldas,3 Marcelo Ehrlich,2 Yosef Yarden1‡

http:D

ownloaded from

Amplified HER2, which encodes a member of the epidermal growth factor receptor (EGFR) family, is atarget of effective therapies against breast cancer. In search for similarly targetable genomic aberra-tions, we identified copy number gains in SYNJ2, which encodes the 5′-inositol lipid phosphatasesynaptojanin 2, as well as overexpression in a small fraction of human breast tumors. Copy gain and over-expression correlated with shorter patient survival and a low abundance of the tumor suppressor microRNAmiR-31. SYNJ2 promoted cell migration and invasion in culture and lung metastasis of breast tumorxenografts in mice. Knocking down SYNJ2 impaired the endocytic recycling of EGFR and the formation ofcellular lamellipodia and invadopodia. Screening compound libraries identified SYNJ2-specific inhibitorsthat prevented cell migration but did not affect the related neural protein SYNJ1, suggesting that SYNJ2 isa potentially druggable target to block cancer cell migration.

//stke.s
on O
ctober 1, 2020ciencem

ag.org/

INTRODUCTION

Despite progress in early detection and treatment, breast cancer remainsa leading cause of cancer-related death in women. Like other carcinomas,tumors of the mammary gland carry somatic mutations, but only a fractionof these is causally implicated in oncogenesis (1–3). One frequent abnor-mality is copy number aberrations (4). For example, deletions of PTENand INPP4B, which encode phosphoinositol (PI) lipid phosphatases,are detected in many breast tumors (5, 6). Conversely, amplification ofHER2, which encodes a receptor tyrosine kinase (RTK) related to theepidermal growth factor receptor (EGFR), occurs in about 15% of breastcancers (7, 8). Antibodies and kinase inhibitors that inhibit HER2 arewidely used to treat HER2-overexpressing breast cancers (9, 10). Thisexemplifies the therapeutic potential offered by the identification of on-cogenic copy number aberrations.

1Department of Biological Regulation, Weizmann Institute of Science, Rehovot76100, Israel. 2Department of Cell Research and Immunology, George WiseFaculty of Life Sciences, Tel Aviv University, Tel Aviv 69978, Israel. 3Departmentof Oncology andCancer Research UKCambridge Institute, University of Cam-bridge, Li Ka Shing Centre, Cambridge CB2 0RE, UK. 4Division of MolecularGenome Analysis, German Cancer Research Centre (DKFZ), Heidelberg69120, Germany. 5Kaplan Medical Center, Rehovot 76100, Israel. 6Departmentof Immunology, Weizmann Institute of Science, Rehovot 76100, Israel. 7INCPM,Weizmann Institute of Science, Rehovot 76100, Israel. 8Faculty of Medicine,Bar-Ilan University, Safed 13115, Israel. 9IPATIMUP, University of Porto, Porto4200-465, Portugal. 10Center for Oncology and Cell Biology, The Feinstein Insti-tute for Medical Research, Manhasset, NY 11030, USA. 11The Mina and EverardGoodman Faculty of Life Science, Bar Ilan University, Ramat-Gan 52900, Israel.*Present address: Clinical Division of Oncology, Department of Medicine 1 andComprehensive Cancer Center, Medical University of Vienna, Vienna, Austria.†Present address:DepartmentofExperimental,DiagnosticandSpecialtyMedicine,UnitofHistology,EmbryologyandAppliedBiology,BolognaUniversity,Bologna40126, Italy.‡Corresponding author. E-mail: [email protected]

ww

Several reports recently identified copy number gains in genes that en-code proteins involved in vesicular trafficking (11). For example, thegene that encodes cezanne-1 is amplified in a fraction of breast tumors(12). The encoded protein is a deubiquitination enzyme that enhancesEGFR recycling. Likewise, chromosome 8p11–12 is frequently ampli-fied in breast cancer (13). Encoded within this region is RAB-couplingprotein (RCP), which cooperates with mutant p53 to coordinate thetrafficking of integrins and RTKs (14). Another oncogenic copy numbergain is found in the gene that encodes RAB25, a guanosine triphospha-tase (GTPase) that controls vesicle recycling (15). Likewise, recurrentamplifications of the gene encoding RAB23 increase invasion by acceler-ating vesicular trafficking (16). These examples suggest that copynumber aberrations might deregulate trafficking of RTKs and other re-ceptors (17, 18).

Along with RAB family GTPases, PIs play pivotal roles in vesiculartrafficking and cellular motility (19). For example, phosphorylation ofthe D3 position of phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] byphosphatidylinositol 3-kinase (PI3K) generates phosphatidylinositol3,4,5-trisphosphate [PI(3,4,5)P3], which is necessary for the formationof both lamellipodia (20) and invadopodia (21). Moreover, growth fac-tors enhance invadopodia formation (22, 23). Specifically, dephospho-rylation of PI(3,4,5)P3 [generating PI(3,4)P2] causes the recruitment ofan adaptor necessary for invasive growth, TKS5 [also called FISH (fiveSH3 domain–containing protein)], to the plasma membrane (24, 25).The present study was motivated by the identification of a copy numbergain at chromosome 6q25, which affects a group of genes that encodeendocytic proteins, including SYNJ2. Synaptojanin 2 (SYNJ2) is an ef-fector of the Rho family GTPase Rac1 (26) and a homolog to SYNJ1, a5-phosphatase that regulates vesicle recycling and availability at nerveterminals (27). Previous observations linked SYNJ2 to glioma cell inva-sion (26, 28). Here, we used clinical specimens, animal models, and in

w.SCIENCESIGNALING.org 20 January 2015 Vol 8 Issue 360 ra7 1

http://stke.sciencemag.org/


on October 1, 2020


Dow

nloaded from

vitro assays to investigate whether aberrant expression of SYNJ2 is a po-tentially druggable driver of breast cancer.

RESULTS

Copy number gain or overexpression of SYNJ2 anddiminished suppression by miR-31 correlate withshorter survival of breast cancer patientsUsing the database of the Molecular Taxonomy of Breast Cancer Inter-national Consortium (METABRIC) (4), we observed gain of an about 1- to2-megabase region centered at chromosome 6q24 that contains a clusterof genes, some of which have been implicated in vesicle trafficking (suchas SNX9, TULP4, and SYNJ2; fig. S1A). The present study concentrates onSYNJ2 because its gain in 4% of breast cancer patients (76 of 1980) corre-latedwith shorter survival (Fig. 1A). In linewith promoting tumor aggressive-ness, the expression of SYNJ2 correlated with shorter survival of estrogenreceptor (ER)–positive patients (Fig. 1B). Not surprisingly, among ER-positive lesions, the luminal B subtype had the highest abundance (fig. S1B).In addition, tumors expressing high SYNJ2 had a predilection tometastasizeto bones, pleura, and lungs (fig. S1C). These observations were confirmedat the protein level: a survey of 331 mammary specimens found strongerstaining inmalignant cells versus normal tissues (Fig. 1C). Likewise, SYNJ2protein abundance correlated with overexpression of HER2, high tumorgrades, and cell proliferation (Fig. 1D). In conclusion, copy number gainas well as increased mRNA and protein abundance of SYNJ2 correlatedwith poor prognosis and aggressive subtypes of breast cancer.

Althoughweverified that, in general, copy number gain drove the higherSYNJ2 expression (fig. S1A), there were many cases in which over-expression was not driven by copy number gains. Hence, we consideredregulation by microRNAs (miRNAs). Target prediction algorithms sug-gested that miR-31, an miRNA that inhibits metastasis by repressing theexpression of RhoA and integrins (29), recognizes two sites within the3′ untranslated region (3′UTR) of SYNJ2 (Fig. 1E) and could suppressSYNJ2 expression. Consistent with this, high abundance of miR-31 was as-sociatedwith good prognosis in patientswith ER-positive breast cancer (fig.S1D), the putative sites in the 3′UTR are highly conserved, and our analysisof a data set of mammary tumor miRNAs (30) indicated that SYNJ2 abun-dancewas inversely related to the abundance in tumors of both miR-31 andmiR-31*, the secondary molecule transcribed from the opposite arm of theprecursor (Fig. 1F).As expected, transfection ofmimic-miR-31 decreased theabundance of SYNJ2 at both the mRNA and protein levels (Fig. 1G). To ex-clude indirect effects, we cloned the 3′UTR of SYNJ2 into a luciferase re-porter, and found that overexpressionofmiR-31 reduced the luciferase signals(Fig. 1H). In addition, mutating the putative binding sites within the 3′UTRof SYNJ2 reduced the inhibitory effect of mimic-miR-31 (Fig. 1I).

In conclusion, increased SYNJ2 abundance in breast tumors resultsfrom either copy number gain or decreasedmiR-31 abundance. To examinerelevance to other tumor types, we compiled data from 1404 lung cancerpatients and found that high SYNJ2 abundance correlated with shorterpatient survival (fig. S1E). In a sample of brain tumors, we observed aninverse correlation between SYNJ2 and miR-31 abundance and identifiedSYNJ2high/miR-31low as a marker of poorer prognosis (fig. S1F). Thus,SYNJ2 might enhance progression of several types of tumors.

Growth factors increase SYNJ2 expression inassociation with increased cell invasionTo explore outcomes of increased SYNJ2 abundance, we examinedMCF10Amammary cells (31) because they acquire an invasive phenotypeafter stimulation with different EGFR ligands, as shown by increased mi-gration and invasion throughMatrigel (fig. S2, A andB). Using polymerase

ww

chain reaction (PCR), DNA arrays, and immunoblotting, we noted that thisinvolved increased abundance of SYNJ2 (Fig. 2, A and B). As expected,SYNJ2-overexpressing cells displayed enhanced migration (Fig. 2C andfig. S2C). Conversely, SYNJ2 knockdown reduced migration (Fig. 2Dand fig. S2, D and E). Thus, in addition to copy gain and loss of miR-31,growth factors involved in breast cancer metastasis can increase the abun-dance of SYNJ2 (32, 33), and SYNJ2 seems to regulate both migration andinvasion through barriers that represent those within tissues. Notably, in ad-dition to increased protein abundance, growth factors likely stimulate theenzymatic function of SYNJ2 through activation of the kinase SRC (34).

The phosphatase activity of SYNJ2 enhances tumorgrowth and metastasis in miceNext, we surveyed publically available data sets of 56 human breast cancercells to identify a cell line suitable for animal studies. This analysis found thatMDA-MB-231, a basal B-like line, is the second and eighth best in terms ofSYNJ2 and EGFR expression, respectively (fig. S3A). In addition, migrationassays of representative cell lines of different disease subtypes confirmed thatthis line is highly migratory (fig. S3B). Moreover, depletion of EGFR usingspecific small interfering RNAs (siRNAs) substantially inhibited the rela-tively high migration and invasion of these cells (fig. S3C). This further mo-tivated us to use MDA-MB-231 cells for our SYNJ2 functional assays. Wefirst established clones that overexpressed SYNJ2 (fig. S4A) and validatedthat overexpression increased invasion (fig. S4B), whereas knockdown usingsiRNAmarkedlydecreased invasionofMDA-MB-231cells (fig. S4,CandD).

To stably deplete SYNJ2, we screened several different short hairpinRNA (shRNA) particles and selected one, number 37, for the establish-ment of a derivative ofMDA-MB-231 cells (fig. S4E and Fig. 2E).Whenseeded in three-dimensional (3D) basement membranes, control cellsformed clusters that disseminated elongated cells, but SYNJ2 depletioninhibited dissemination (Fig. 2F). This uncovered yet another function ofSYNJ2 that might be relevant to tumor progression. Because SYNJ2 actsas both an enzyme and a scaffold, we addressed the requirement for thecatalytic function. To this end, we reinfected shSYNJ2 cells with lenti-viral particles encoding wild-type SYNJ2 or a catalytically deficientform (D388A/D726A, herein SYNJ2CD) containing mutations in theWXGDXN(F/Y)R motifs (35). Unlike wild-type SYNJ2, reexpressionof the mutant failed to restore invasiveness (Fig. 2, E and G), indicatingthat the catalytic activity of SYNJ2 is essential for motility. Next, weimplanted the cells into mammary fat pads of mice and assessed bothtumor size (Fig. 3A) and metastases (Fig. 3, B and C). Primary tumorsdeveloped faster in mice implanted with control (shCtrl) or reconstituted(shSYNJ2+SYNJ2WT) cells compared with those implanted with knock-down (shSYNJ2) and “inactive rescue” (shSYNJ2+SYNJ2CD) cells. Inaddition, the shSYNJ2 and the “inactive rescue” groups displayed a sta-tistically significant reduction in metastasis to lymph nodes. Moreover,the lungs of mice implantedwith the shSYNJ2 cells or the “inactive rescue”cells showed fewer metastases (Fig. 3C). In conclusion, the phosphatasefunction of SYNJ2 contributes to tumor growth and metastasis in animals.

To circumvent effects on tumor volume, we separately examined intrav-asation and extravasation and normalized the results to primary tumor vol-umes. Cells transfected with either control shRNA or shSYNJ2 orexpressing LacZ (control vector) or SYNJ2 were directly injected into the tailvein and scored for lung colonization (extravasation), or they were im-planted into the fat pad and the blood was analyzed for circulating tumorcells (intravasation). SYNJ2was necessary for both intravasation and extrav-asation, independently of tumor volume (Fig. 3, D to G). Notably, thetwo intravasation experiments, as well as the extravasation experimentusing shSYNJ2, reached statistical significance, but the ability of SYNJ2-overexpressing cells to better extravasate did not, implying that the strong




on October 1, 2020


Dow

nloaded from

Fig. 1. Copy number gain and miR-31 affect SYNJ2 abundance and patient noblotting for mRNA and protein abundance of SYNJ2 in MDA-MB-231 and
survival rates. (A) Survival curves of 1980 breast cancer patients stratifiedaccording toSYNJ2copynumber.Death ratesare indicated inparentheses.(B) Survival curves of ER-positive breast cancer patients stratified accordingto SYNJ2 abundance. (C) Representative images of SYNJ2 immunostaining(magnified, right) of the indicated tumor subtypes. Asterisk: vessel. (D) Im-munohistochemical analysis of tissue microarrays from 331 invasive breasttumors, analyzed for various markers. (E) Schematic of the 3′UTR of SYNJ2and the putative hsa-miR-31 binding sites. (F) Correlative analysis of hsa-miR-31 and SYNJ2 observed in breast cancer patients. (G) PCR and immu-
ww

MCF10A cells transfectedwithmimic-miR-31 for 48 hours and normalized tocontrol cells. Data are means ± SD from three experiments. (H) MCF-7 cellswere cotransfected with the indicated mimic-miRNAs, control empty vector,and a reporter plasmid containing the 3′UTR of SYNJ2. Signals were firstnormalized to firefly luciferase reads and then to the average of two controlmiRNAs.Data aremeans±SDof six biological repeats. (I)MCF-7 cellswerecotransfectedwithwild-type (WT) or single (mut1 ormut2) or double (mut1+2)mutants of the 3′UTR reporter of SYNJ2, and treated as in (H). Data aremeans ± SD from three experiments.




on October 1, 2020


Dow

nloaded from

effects of SYNJ2 on metastasiswere primarily due to enhancedintravasation. Notably, cells de-pleted of SYNJ2 formed small-er primary tumors (Fig. 3A),yetSYNJ2overexpressionweak-ly decreased xenograft growth(Fig. 3G). To try and resolvethis, we used two in vitro cellproliferation assays. There wasweak, if any, effect of depletingSYNJ2 on cell proliferation in
culture (fig.S4,FandG).Nevertheless,when injected into the fat padof femalemice, SYNJ2-depleted cells formed statistically smaller tumors (fig. S4H).In conclusion, SYNJ2 not only accelerates metastasis in animal models butalso positively influences tumor growth, although the latter was undetectablein the shorter-term in vitro experiments we performed.
ww

SYNJ2 localizes to cellular protrusions involved inmigration and matrix invasionUsing electron and fluorescence microscopy, we found that knockingdown SYNJ2 transformed flat and adherent cells into weakly attachedcells that displayed rudimentary lamellipodia and abnormal actin patches

Fig. 2. Transcriptional inductionof SYNJ2 by growth factors andrequirement for the catalytic ac-tivity for invasiveness. (A and B)MCF10A cells were stimulatedwith EGF (20 ng/ml) or calf serum(5%) andassessed formRNA (A)orprotein(B)abundanceofSYNJ2.Data are representative of threeexperiments. (C andD)Migrationand invasion assays assessed at18 hours in MCF10A cells either(C) overexpressing GFP-SYNJ2(SYNJ2-OX) or LacZ (Ctrl) or(D) transfected with control orSYNJ2 siRNA, and either un-treated (NT) or stimulated withEGF (10 ng/ml). Images are rep-resentative of five experiments.Data are means ± SD from threeexperiments. (E) Western blottingin shSYNJ2-expressing MDA-MB-231cells reconstitutedwitheitherWTSYNJ2(shSYNJ2+SYNJ2WT)or acatalytically deficientmutant(shSYNJ2+SYNJ2CD). (F) Invasionby MDA-MB-231 cells express-ing shCtrl or shSYNJ2 throughMatrigelover4days. Insets,mag-nified views of framed areas.The fraction of spheroids thatdisseminated cells into the ma-trix was quantified. Data aremeans ± SD from three experi-ments. Scale bar, 30 mm. (G)Matrigel invasion chamber as-says using the indicated stablederivatives of MDA-MB-231 cellsover 18 hours. Data are means ±SD from three experiments.




http://stke.sciencema

Dow

nloaded from

.

t,

.

on October 1, 2020

g.org/

(fig. S5, A and B), in linewith phenotypesof Saccharomyces cerevisiae after loss ofsynaptojanin-like proteins (36). Time-lapse microscopy confirmed abnormal-ities in lamellipodia and related the patchesto large vesicles (movie S1), implying im-paired vesicular trafficking.Assuming thatthese phenotypeswould relate to the local-ization of SYNJ2, we obtained time-lapseimages of green fluorescent protein (GFP)–tagged SYNJ2. These excluded an overlapbetween clathrin- and SYNJ2-containingpuncta (Fig. 4A) and unveiled two locations(fig. S5C): small and dynamic assembliesat leading edges and larger, perinuclear as-semblies.Notably, shortly after stimulationwith a growth factor, peripheral SYNJ2marked nascent lamellipodia. As discussedhere and later, we infer that the peripheralSYNJ2 assemblies are recruited to nascentlamellipodia, whereas the perinuclear punc-
ta represent invadopodia, actin-filled invasive protrusions (37). According-ly, the assembly of peripheral puncta temporally overlapped focal formationof lamellipodia (movie S2), but unlike these highly dynamic puncta (fig. S6A,upper panel), the perinuclear clusters recruited actin (visualized using life-ACT-RUBY) andpersisted for ~30min (fig. S6A, lower panel, andmovieS3).Moreover, by plating cells on fluorescent gelatin, we noted gradually increas-ing matrix degradation at the perinuclear SYNJ2 sites (Fig. 4B), consistent
ww

with a previous report in glioma cells (28). Together, these observations un-veil dynamic translocations of SYNJ2 as well as implicate the phosphatasein regulating cell shape and actin protrusions.

SYNJ2 promotes recycling of EGFR at lamellipodiaThe mostly bimodal compartmentalization of GFP-SYNJ2 was reinforcedby the synchronous appearance and disappearance of fluorescence signals

Fig. 3. The catalytic activity of SYNJ2supports both metastatic spread and tu-morigenic growth of human cancer xeno-grafts in mice. (A) Volume of tumors formedby the indicated derivatives of red fluores-cent protein (RFP)–expressingMDA-MB-231cells (2 × 106 permouse) at 2 and 6 weeksafter implantation into the fat pad of femalesevere combined immunodeficient (SCID)mice.Dataaremeans±SDfrom10to11miceper group; *P<0.05, **P<0.01, and ***P<0.001. (B andC) Metastases that appeared6 weeks after implantation in axillary anddistant lymph nodeswere quantified, andthe lungs were photographed and quan-tified for small metastases. Data in (A) to(C) are representative of six experiments(D to G) MDA-MB-231–RFP colonizationof the lungs or intravasation into the blood4 weeks after injection into the tail vein(1.5 × 105 cells per mouse) or mammary fapad (2.5×106cells permouse), respectivelyin 5-week-old female SCID mice. Cells ex-pressed either control or SYNJ2 shRNA(D and E) or the control LacZ vector or aSYNJ2 expression vector (F andG). RFP-positive circulating tumor cells were scoredper 1×106 readingsobtainedby cell sortingand normalized to tumor weight (E and G)Statistical parameters are indicated. Eachdot represents an animal.




www.SCIENCESIGNALING.org 2

on October 1, 2020


Dow

nloaded from

in experiments using both epifluorescence(red; relatively insensitive to changes inthe z dimension) and total internal reflectionmicroscopy [TIRF (total internal reflectionfluorescence), green; limited to an approxi-mately 200-nm depth]. Because puncta ap-peared yellow throughout their lifetime(fig. S6B), we concluded that SYNJ2 as-sembles and rapidly disassembles withinthe plane of the ventral membrane of lamel-lipodia. In line with this, an inhibitor of dy-namin [the GTPase permitting invaginationand facilitating migration (38)] inhibited thedisassembly of SYNJ2’s peripheral puncta(fig. S6C and movie S4), indicating that re-cruitment to nascent lamellipodia dependson dynamin. Thus, a dynamin-dependentbut clathrin-independent process mediatesSYNJ2 trafficking to and from lamellipodia.

EGF-mediated migration entails clear-ance of PI(4,5)P2 from the leading edge,potentially by phospholipases and phos-phatases like SYNJ2, and similarly, actin-regulated loading of PI(4,5)P2-depletedendosomes with EGFR molecules is co-ordinated by lamellipodin and endophilin,aSYNJ2binder (39,40).Accordingly,EGFRlocalized to lamellipodia in control cells,but accumulated in shSYNJ2 cells in ab-normal intracellular vesicles surroundedby F-actin (Fig. 4C). This might be due toan inability to disassemble PI(4,5)P2-bindingproteins from the vesicle’s coat or from ac-tin comet tails (41). Consistent with intra-cellular trapping of EGFR, relatively highreceptor abundancewas detected in extractsof siSYNJ2-transfected cells (Fig. 4D), buttwo independent methods indicated reduced,rather than enhanced, surface abundance(Fig. 4E).Vesicular trappingbears functionalconsequences: shSYNJ2 cells severely lostthe ability to migrate upward a gradient ofEGF (Fig. 4F), which suggests impairedchemotaxis, in line with reports linkingEGFR signaling and trafficking to the regu-lation of cofilin and cortactin in actin-filledprotrusions (42, 43). Abnormal vesicular ac-cumulation of EGFR could reflect impairedrecycling or impaired sorting for degrada-tion, a process regulated by ubiquitination(44). Indeed, SYNJ2knockdownsuppressedEGF-induced ubiquitination of EGFR (Fig.4G). Furthermore, despite the fact that EGFRwas tagged for degradation through phos-phorylation of its Tyr1045 residue (fig. S6D),its degradation in shSYNJ2 cells was im-paired (fig. S6E). To assess recycling, wemonitored both EGFR and transferrin re-ceptor. Although transferrin internalizednormally, recycling was markedly decreased

Fig. 4. SYNJ2 localizes to lamellipodia and invadopodia and regulatesendocytosis ofEGFRs. (A)MDA-MB-231cells expressing GFP-SYNJ2 were transfected with an RFP-clathrin plasmid and plated on fibronectin andimagedevery 5 s. Arrowheadsmark recruitment of SYNJ2 to a newly formed leadingedge.Scale bars, 5 mm.(B) Cells expressingGFP-SYNJ2wereplatedona fluorescently labeledgelatin.Photosat10-s intervalswerecollected 5 hours later. Arrowheads mark colocalization of SYNJ2 and areas of degraded gelatin. Bottom,enlarged views of framed areas. Scale bar, 5 mm. (C) Cells were grown on fibronectin and stained for EGFRand F-actin. Scale bar, 20 mm. Insets, enlarged views of framed areas. (D) Immunoblotting (IB) of extractsfrom MDA-MB-231 cells transfected with the indicated siRNAs. (E) Cell sorting (left) and 125I-EGF binding(right) to surface EGFRs of the indicatedderivatives ofMDA-MB-231 cells. (F) Rose plots ofmigratory tracksofMDA-MB-231 cells after exposure to anEGFgradient. Red tracksmarkmigration toward greater EGF. (G)Immunoprecipitation (IP) forEGFRand then immunoblotting in lysates fromMDA-MB-231derivatives treatedwith EGF (10 ng/ml). Data either are representative or are means ± SD of three experiments.

0 January 2015 Vol 8 Issue 360 ra7 6



www.SCIENCESIGNALING.org 2

on October 1, 2020


Dow

nloaded from

in shSYNJ2 cells and, contrariwise, markedlyaccelerated in SYNJ2-overexpressing cells(fig. S6F). Likewise, flow cytometry indi-cated defective recycling of internalizedEGF in SYNJ2-depleted cells (fig. S6G).Thus, in linewith ablation of SYNJ1, whichleads to delayed vesicle reavailability (27),SYNJ2 seems essential both for EGFR re-cycling and for the tightly coupled processof lamellipodia formation (40).

The observed defective vesicular trans-port of EGFR in SYNJ2-depleted cells wascomplemented by results obtained from cellsectopically expressing SYNJ2 (fig. S7A).Using a radioactive form of EGF, we ob-served more rapid recycling of EGFR inSYNJ2-overexpressing cells (fig. S7B). Asexpected, increased recycling translated toreceptor stabilization and more sustainedAKT signaling (fig. S7C). Next, we askedif SYNJ2-mediated recycling applies to twoother receptors, which are widely implicatedin cell migration, namely,MET (hepatocytegrowth factor receptor) and integrin b1. Sim-ilar to that of EGFR, the surface localizationof MET in control cells was decreased, re-placed by localization to inflated endosomesthat were surrounded by actin patches (fig.S8A). Also in similarity to EGFR, matureMET, unlike the larger pro-MET precursor,was stabilized in shSYNJ2 cells, and bothMET autophosphorylation and AKT trans-phosphorylation were strongly diminished(fig. S8B). The pattern assumed by integrinb1 molecules in shSYNJ2 cells was similar-ly characterized by large perinuclear aggre-gates that costained with both F-actin (fig.S8C) and phosphorylated EGFR (fig. S8D).Because the appearance of large intracellularaggregates of signaling and adhesion recep-torswas induced by depleting SYNJ2,we at-tempted rectifying it by introducing eitherthewild-typeor a catalytically defective formof SYNJ2 (fig. S8E). To confirm that SYNJ2reexpressionwas due to functional rescue, weexamined EGFR accumulation and validatedthat wild-type but not mutant SYNJ2 de-creased intracellular trapping of EGFR (fig.S8F).Thus,SYNJ2controls recycling, aswellas sorting of several surface receptors fordegradation, in a way that might affect theirinvolvement in cell migration.

SYNJ2 contributes toinvadopodia formationTo resolve SYNJ2-mediated invasion, weexamined matrix proteases. Zymographyassays demonstrated defective secretionof matrix metalloproteinase 9 (MMP-9)when SYNJ2 was knocked down (fig.

Fig. 5. SYNJ2-depletedcells dis-play defective localization ofPI(3,4)P2andaberrant invadopodia.(A) MDA-MB-231 cells stably ex-pressing GFP-SYNJ2 were platedonto fluorescent gelatin-coatedcoverslips.Threehours later, cellswere probed forGFPandF-actin,and invadopodial structuresweredetected (arrowheads). Scalebars,10mm.(B) Invadopodial struc-tures in cells overexpressing

SYNJ2 or transfected with control or SYNJ2 siRNA cultured on fluorescent gelatin-coated coverslips.Data are means ± SD from three experiments. (C) Invadopodial structures of MDA-MB-231 cells treatedwith the indicated siRNAs were detected by gelatin degradation, as well as by staining for F-actin andTKS5. Arrowheads (z-axis images) mark invadopodia. Scale bar, 10 mm. (D) Confocal microscopy of thecodistribution of F-actin, TKS5, and PI(3,4)P2 (Tapp1) in the indicated cell derivatives transfected with aplasmid encoding a myc-tagged PH domain of Tapp1 and plated on fluorescent gelatin. Scale bar, 10 mm.(E) Colocalization of phalloidin and EGFR phosphorylated at Tyr1068 inMDA-MB-231 cells transfected withcontrol or SYNJ2 siRNA plated on gelatin-coated coverslips. Scale bar, 10 mm. Images are representativeof three experiments.

0 January 2015 Vol 8 Issue 360 ra7 7



on October 1, 2020


Dow

nloaded from

S9A). Conversely, overexpression of SYNJ2increased both MMP9 mRNA and MMP-9activity (fig. S9B). Consistent with our dataon SYNJ2 in lamellipodia (Fig. 4B), matrixproteolysis corresponded to ventral actin-and SYNJ2-containing puncta (Fig. 5A).Notably, SYNJ2 overexpression increasedwhereas knockdown reduced the incidenceof invadopodia (Fig. 5B). Correspond-ingly, we observed physical associationsand colocalization of SYNJ2 and cortac-tin, a marker of invadopodia (fig. S9, Cand D). Probing endogenous TKS5, amarker of invadopodia and a binder ofPI(3,4)P2 (24, 25, 45), we confirmed itslocalization to sites of matrix degradationin control cells; however, siSYNJ2 cellsdisplayed diffuse TKS5 and weaker matrixdegradation (Fig. 5C). Furthermore, becauseinvadopodial TKS5 anchors, via a PX do-main, at ventral PI(3,4)P2, we used a cog-nate domain, the pleckstrin homology (PH)domain of Tapp1, a tandem PH domain–containing adapter. As expected, the PH do-mains colocalized with TKS5 in control butnot siSYNJ2 cells (Fig. 5D). In conclusion,SYNJ2 appears necessary for a functionpreceding the recruitment of TKS5 to nas-cent invadopodia.

Because local activation of PI3KbyRTKsis essential for invadopodia formation (21),and the generatedPI(3,4,5)P3molecules serveas substrates for SYNJ2, we expected that ac-tivated EGFRwould localize to invadopodia.Localization of activated EGFR to sites ofmatrix proteolysis was indeed confirmed(Fig. 5E). Next, we tested amodel proposingthat focal processing of EGFR ligands by acomplex comprising CD44 activates PI3K(46). Congruently, colocalization of CD44in the cores of invadopodia was confirmed(fig. S9E), as previously reported (47), andwe also found that surface CD44 wasdecreased in shSYNJ2 cells (fig. S9F).Recruitment of the matrix metalloproteinaseMT1-MMP is yet another critical step in inva-dopodia maturation (48, 49). Accordingly,we detected MT1-MMP at invadopodia incontrol cells, but MT1-MMP accumulatedin large, actin-decorated vesicles in siSYNJ2cells (fig. S9G), which might correspond toMT1-MMP–positive late endosomes, as re-cently reported (48). Presumably, EGFR-mediated generation of PI(3,4,5)P2 andits dephosphorylation to PI(3,4)P2 bySYNJ2 instigates nascent invadopodia,which later mature to proteolytically active
protrusions. In linewith this model, EGF induced an increase in the numberand size of invadopodia inMCF10A cells, but both parameters were signif-icantly reduced when cells were pretreated with an EGFR-specific kinase
ww

inhibitor, gefitinib (fig. S10). In conclusion, growth factor–induced abun-dance and activation of SYNJ2 might contribute to the assembly and pro-teolytic activities of invadopodia.

Fig. 6. Selection of compounds able to specifically inhibit the 5-phosphatase activity of SYNJ2 and attenuate
cellular invasion. (A) Fluorescence polarization signals to assess the 5-phosphatase activity of a purifiedSYNJ2 in vitro in the presence of the indicated reagents after 8min of incubation at 33°C. Probe: fluorescentPI(3,4)P2; detector: a recombinant PH domain of Tapp1. (B and C) Chemical structures and median inhib-itory concentration (IC50) values (B) and response curves (C) of selectedSYNJ2-specific compounds testedagainst either purifiedSYNJ1or SYNJ2.Data in (A) and (C) aremeans±SD from four experiments. (DandE)3D invasion assay of naïveMDA-MB-231 cells (E) or those expressing control or SYNJ2 shRNA (D) culturedfor 72 hours in a basement membrane extract and then overlaid with an invasion matrix containing the in-dicated compounds listed in (B). Photos were taken 6 days later using ImageJ. Data aremeans and rangesfrom three experiments. Dimethyl sulfoxide (DMSO) was used as a solvent.



on October 1, 2020


Dow

nloaded from

Specific inhibitors of the 5′-phosphatase activity ofSYNJ2 reduce cellular invasionSYNJ2 and its brain-enriched kin, SYNJ1, belong to the dual-functionclass of inositol lipid phosphatases. This class has an N-terminal SAC-likedomain, which encodes a polyphosphoinositide phosphatase activity, anda central 5′-phosphatase domain. The crystal structure of the 5′-phosphatasedomain of yeast synaptojanin revealed that the enzyme adopts the fold ofnucleases with two sheets forming an internal “sandwich” (50). These ob-servations, as well as local amino acid sequence variations presented bySYNJ1 (51), suggested that small compoundsmight dock at the active siteand inhibit SYNJ2 while sparing the critical action of SYNJ1 in synapses.

A homogeneous assay suitable for automation was established on thebasis of the ability of SYNJ2 to dephosphorylate PI(3,4,5)P3 and producePI(3,4)P2. To monitor this reaction, we used the PH domain of Tapp1 as a de-tector and a fluorescent PI(3,4)P2 as a probe. Polarization signals decreasedwhen PI(3,4,5)P3 was incubated with a recombinant SYNJ2 (Fig. 6A).Several compound libraries (in total containing 53,540 molecules) werescreened. To ensure selectivity toward SYNJ2, the inhibitory compoundswere reassayed using a recombinant SYNJ1. This identified four selectiveinhibitors (Fig. 6, B and C). To test effects on cellular invasiveness, weapplied a matrix invasion assay that clearly reflected SYNJ2 activity(Fig. 6D). As expected, all four compounds were found to inhibit invasion(at 10 mM; Fig. 6E). Future studies will test derivatives of these com-pounds in animal models, as a prelude for clinical development.

DISCUSSION

This study was motivated by the prediction that yet unknown gene copynumber gains might contribute to aggressiveness of mammary tumors.Like in the case of the HER2-centered amplicon, such aberrations might

ww

identify patients suitable for treatment using molecular targeted drugsanalogous to trastuzumab and lapatinib, the main HER2-blocking anti-bodies (52). In line with this prediction, SYNJ2 emerges from our studyas a genetically aberrant and potentially druggable driver of tumor pro-gression. Presumably, SYNJ2’s oncogenic activity relates to its ability todephosphorylate critical phosphoinositides acting as signposts of bothinvadopodia and lamellipodia (19). Accordingly, SYNJ2 localizes tothese actin-filled protrusions, and animal studies attributed essentialroles in tumor growth and metastasis to the catalytic activity of SYNJ2.For example, SYNJ2-generated PI(3,4)P2 locally binds TKS5 and nucle-ates a cortactin-centered complex that enables cofilin to generate actinbarbed ends within invadopodia (53). A similar mechanism might occurin the leading edge: locally generated PI(3,4)P2 likely binds lamellipodinand recruits Ena/VASP, an effector of the actin cytoskeleton (54). Ourresults highlight yet another key function of SYNJ2, namely, regulationof vesicular trafficking, in similarity to other lipid phosphatases (55).Although incompletely understood, we propose that the localization ofSYNJ2 at the leading edge depends on dynamin and RAC1, althoughtheir distribution is distinct from that of caveolin-1 and clathrin. Hence,we assume that SYNJ2 controls variants of the clathrin-independent car-riers, known to sustain membrane turnover at the leading edge (56).

Beyond a therapeutic scenario that selects patients for anti-SYNJ2 therapyon the basis of either SYNJ2 copy number or the SYNJ2/miR-31 ratio in thetumor, our findings suggest that carcinoma progression is propelled by suc-cessive processing of phosphoinositides by PI3K and SYNJ2 (25). Alongwith depleting PI(4,5)P2, which regulates endocytosis and the actin cyto-skeleton, SYNJ2 dephosphorylates PI(3,4,5)P3, the product of PI3K, therebygenerating PI(3,4)P2. Conceivably, two tumor suppressor phosphatases,PTEN [a 3-phosphatase that depletes both PI(3,4,5)P3 and PI(3,4)P2] andINPP4B [a 4-phosphatase that depletes PI(3,4)P2; (5)], normally balance theoncogenic alliance formed by PI3K and SYNJ2 (Fig. 7). Along with PI3Kactivatingmutations, the triad of phosphatases is altered in cancer: deletionsofPTEN and INPP4B frequentlyoccur in tumors, and, as shownhere, SYNJ2copy gain and lowmiR-31 abundance are found in carcinomas and glioblas-tomas. Hence, compounds that inhibit SYNJ2, such as those we identified,might effectively block progression of tumors, especially those lacking thecatalytic functions of PTEN and INPP4B. This prediction, along with thepossibility that SYNJ2-generated inositol lipids can enhance tumorgrowth bydirectly or indirectly activating apoptosis-inhibitory kinases, like AKT andPDK, requires further investigation.

MATERIALS AND METHODS

Reagents, antibodies, and compound librariesUnless indicated, human recombinant growth factors and other materialswere purchased fromSigma, and antibodieswere fromCell Signaling Tech-nology. Plates for wound healing assays were from ibidi. Glass-bottomdishes (35 mm) for time-lapse imaging were purchased fromMaTek. Anantibody against EGFR was purchased from Alexis. Antibodies to TKS5,Ras-GAP, AKT, and ERK (extracellular signal–regulated kinase) were fromSanta Cruz Biotechnology. Fluorescein isothiocyanate–conjugated anti-bodies to CD44 were from BD Transduction Laboratories. Antibodiesto phosphorylated EGFR (pTyr1068) and pAKTwere from Cell SignalingTechnology. Antibodies to EGFR (pTyr1068) for immunofluorescence andCD44 were from Epitomics. Antibodies against MMPs were fromMilli-pore. Amonoclonal antibody against SYNJ2was fromAbnova. Second-ary antibodies were from Jackson ImmunoResearch Laboratories.siRNAs were from Dharmacon. Duo-set kits for growth factor assayswere purchased from R&D Systems. Alexa Fluor 488 transferrin and

Fig. 7. A model depicting mechanistic aspects of the oncogenic activity ofSYNJ2 within its two major locales, invadopodia and lamellipodia. SYNJ2
dephosphorylates carbon5of the inositol ring.Oneof its product is PI(3,4)P2,but two phosphatases negate the action of SYNJ2: PTEN dephosphorylatesthe 3′ phosphate of PIs, such as PI(3,4,5)P3, and INPP4B dephosphorylatesthe 4′ phosphate of PI(3,4)P2 and other PIs. According to the model, activeRTKs stimulate class 1 PI3Ks, which phosphorylate carbon 3 of the inositolring, to generate several PIs, including the second messenger PI(3,4,5)P3.The latter can be dephosphorylated by SYNJ2 (or SHIP family members),thereby increasing the PI(3,4)P2 pool. Once locally formed, PI(3,4)P2 recruitsTKS5, which anchors cortactin, nucleates actin polymerization, and instigatesnew invadopodia. In analogy, by dephosphorylating PI(3,4,5)P3 and enablingrecruitment of the PI(3,4)P2-bindingprotein called lamellipodin, SYNJ2mightenable formation of lamellipodia (54). Both INPP4B and PTEN act as tumorsuppressors, whereas PI3K is an established oncogene. We propose thatthe concerted action of PI3K and SYNJ2 is normally balanced by INPP4B andPTEN. In tumors, however, genetic aberrations affecting either PI3K or one ofthe three PI-specific phosphatases might support malignant transformation.



on October 1, 2020


Dow

nloaded from

goat anti-mouse Alexa Fluor 488, Alexa Fluor 555, and Alexa Fluor 647secondary antibodies were from Invitrogen. Compound collections werepurchased from Sigma (LOPAC 1280), Prestwick, Analyticon (MEGxp),and Chembridge (DIVERSet CL). Basement membrane extract was pur-chased from Trivigen. LifeACT-Ruby (from B. Shilo, Weizmann Institute)was used to visualize F-actin. The Dual Luciferase Reporter Assay System(including psiCHECK2 and a Renilla luciferase) from Promega was usedfor miRNA assays. Anti-GFP beads were purchased from Chromotek.

Cell lines, transfections, and RNA interferenceMCF10A cells were grown in Dulbecco’s modified Eagle’s medium/F12(1:1) supplemented with antibiotics, insulin (10 mg/ml), cholera toxin(0.1 mg/ml), hydrocortisone (0.5 mg/ml), heat-inactivated horse serum(5%, v/v), and EGF (10 ng/ml). Human mammary MDA-MB-231 cellswere grown in RPMI-1640 (Gibco BRL) supplemented with 10% heat-inactivated fetal calf serum (Gibco), 1mM sodium pyruvate, and a penicillin-streptomycin mixture (100 U/ml; 0.1 mg/ml; Beit Haemek Ltd.). TheMDA-MB-231–RFP stable cell line was a gift from H. Degani (WeizmannInstitute of Science, Israel). Plasmid transfections were performed usingLipofectamine 2000 according to themanufacturer’s guidelines (Roche).Alternatively, for transient mRNA knockdown experiments using siRNAoligonucleotides, cells were transfected with Oligofectamine (Invitrogen).The following siRNA sequences were used to deplete SYNJ2’s mRNA:GAAGAAACAUCCCUUUGAU and GGACAGCACUGCAGGUGUU.For control, we used siControl ON-TARGET plus (from Dharmacon). Thefollowing shRNA sequences (from Sigma) were used to deplete SYNJ2’smRNA: (i) CCGGCCTACGATACAAGCGACAAATCTCGAAGA-TTTGTCGCTTGTATCGTAGGTTTTTG, (ii) CCGGCGAGAGGAGAT-CATTCGGAAACTCGAGTTTCCGAATGATCTCCTCTCGTTTTTG,and (iii) CCGGCCGGAAGAACAGTTTGAGCAACTCGAGTTGCT-CAAACTGTTCTTCCGGTTTTTG.

Cell migration, invasion, and chemotaxis assaysCellswere plated in triplicates in the upper compartments of aTranswell tray(BDBiosciences) and allowed to migrate through the intervening membranefor 18 hours. Thereafter, cells were fixed in paraformaldehyde (3%), permea-bilized in Triton X-100 (0.05%), and stained with methyl violet (0.02%). Cellsgrowing on the upper side of the filter were removed, andmigrating cells werephotographed. Invasion assays were performed using BioCoat Matrigelchambers. For chemotaxis, we used chambers from ibidi. 3D spheroid cell in-vasion kits were from Trivigen. Briefly, cells (3000) were plated in basementmembrane extract and cultured for 72 hours. Once spheroids were formed, in-vasionmatrixwasadded to induce invasion, and imageswere takenafter 6days.

Gelatin zymographyTo detectMMPactivity, sampleswere separated electrophoretically on 10%polyacrylamide/0.1% gelatin–embedded gels. The gels were washed in2.5% Triton X-100 and incubated at 37°C for 36 hours in 50 mM tris-HCl(pH 7.5) containing 0.2MNaCl, 5 mMCaCl2, 1 mMZnCl2, 0.02%Brij 35,and 1 mM p-aminophenylmercuric acetate.

Quantification of circulating tumor cellsBlood sampleswere purified on a Ficoll gradient. The resultingmiddle layerthat contains mononuclear cells, along with the RFP-positive circulating tu-mor cells, was scored per 1 × 106 FACS (fluorescence-activated cell sorting)readings and normalized to tumor weight.

Metastasis tests in animalsFemale CB-17 SCID mice (Harlan Laboratories; 15 per group) were im-planted in the fat pad withMDA-MB-231 cells (1.4 × 106 cells per mouse).

www

After 2 and 6 weeks, mice were anesthetized, tumor sizes were measured,and metastases in lymph nodes were visualized using a fluorescent binoc-ular. For lungmetastasis, lungswere removed andwashed, and imageswereacquired using a fluorescent binocular.

Lentiviral vectors and virus productionNontargeted shRNAs (control) and shRNAs directed against humanSYNJ2were produced in human embryonic kidney 293T cells followingthe manufacturer’s guidelines (Sigma). Target cells were infected withshRNA-encoding lentiviruses supplemented with polybrene (8 mg/ml)and cultured in the presence of puromycin (2 mg/ml) for 4 days. Stable gene-specific delivery of human SYNJ2was performed using the ViraPower lenti-viral expression system (Invitrogen) following the manufacturer’s guidelines.

Immunofluorescence and image processingCells were grown on fibronectin-coated coverslips for 48 hours. Aftertreatments, cells were washed, permeabilized using 0.02% Triton X-100and 3% paraformaldehyde, and fixed for 20 min. Confocal microscopywas performed using either a Zeiss LSM-710microscope or a spinning discmicroscope (numerical aperture, 1.45; Yokogawa CSU-22; Zeiss, fullyautomated inverted 200M; Photometrics HQ-CCD camera) and solid-statelasers (473, 561, and 660 nm; exposure times: 0.25 to 1 s), under the com-mand of SlideBook. 3D image stacks were acquired every 70 to 300 msalong the z axis by varying the position of the piezoelectrically controlledstage (step size: 0.1 to 0.4 mm). Alternatively, live cell fluorescence micros-copywas carried out using the DeltaVision system (Applied Precision), andimages were processed using Prism software.

Radiolabeling of EGFHuman recombinant EGFwas labeled as follows: EGF (5 mg) was mixedin an Iodogen-coated tube (1 mg of reagent) with Na125I (1 mCi). After15min of incubation at 23°C, albuminwas added to a final concentration of0.1 mg/ml, and the mixture was separated on an Excellulose GF-5 column.

Determination of surface EGFRCells (2 × 104 per well) were seeded in triplicates in 24-well plates, withan additional well plated for control. Thereafter, cells were incubatedwith radiolabeled EGF for 1.5 hours at 4°C and rinsed with bindingbuffer. The control well was incubated with radiolabeled EGFand an ex-cess of unlabeled EGF. Finally, cells were lysed in 1 M NaOH solution,and radioactivity was determined.

Immunoblotting analysisCells were washed briefly with ice-cold saline and scraped in a buffereddetergent solution [25 mM Hepes (pH 7.5), 150 mM NaCl, 0.5% Na-deoxycholate, 1% NP-40, 0.1% SDS, 1 mM EDTA, 1 mM EGTA, 0.2 mMNa3VO4, and a protease inhibitor cocktail diluted at 1:1000]. For equal gelloading, protein concentrations were determined by using the bicinchoninicacid (Pierce) reagent. After gel electrophoresis, proteins were transferred ontoa nitrocellulose membrane. The membrane was blocked in TBST buffer[0.02 M tris-HCl (pH 7.5), 0.15 M NaCl, and 0.05% Tween 20] containing10% low-fat milk, blotted with a primary antibody for 60 min, washed withTBST, and incubated for 30 min with a secondary antibody conjugated tohorseradish peroxidase.

Wound healing (scratch) assaysCells were trypsinized and resuspended in EGF-deprived medium (7.0 ×105 cells/ml), and 70 ml was plated into specific wells (ibidi), resulting inconfluent layers within 24 hours. Thereafter, culture inserts were removedby using sterile tweezers, and cells were allowed to migrate for 15 hours.

.SCIENCESIGNALING.org 20 January 2015 Vol 8 Issue 360 ra7 10



on October 1, 2020


Dow

nloaded from

Electron microscopyCells were fixed in saline supplemented with 4% paraformaldehyde and2% sucrose. Samples were washed and subjected to a second fixative(3% paraformaldehyde and 2.5% glutaraldehyde in 0.1 M cacodylatebuffer supplemented with 1% sucrose and 5 mM CaCl2, pH 7.4). Cellswere washed in 0.1 M cacodylate buffer and postfixed for 60 min with1%osmium tetroxide in cacodylate buffer. For scanning electronmicros-copy, the postfixed samples were washed twice and treated with 1% tannicacid for 5 min followed by another wash and treatment with 1% uranylacetate for 30min. Samples were dehydrated in graded ethanol andmadeconductive by sputtering with a gold-palladium film. The samples were pho-tographed using a scanning electron microscope (Leo Supra 55/Vp Zeiss).

Ligand recycling assaysMDA-MB-231 cellswere preincubated for 30min at 37°CwithAlexa Fluor488–transferrin (25 mg/ml in serum-free medium) or for 10 min with AlexaFluor 488–EGF (40 ng/ml). Surface-bound ligands were detached by incu-bation for 30 min at 4°C in an acidic buffer (150 mMNaCl, 1 mMMgCl2,0.125 mM CaCl2, 0.1 M glycine), before transfer to 37°C for the indicatedtime intervals, to allow for recycling of the internalized ligands. Cells wereanalyzed either by imaging or by FACS.

Immunohistochemical analyses of clinical specimensThe work presented is in accordance with the Portuguese National Reg-ulatory Law of Tumor Bank Accession. Formalin-fixed, paraffin-embeddedbreast tumors were retrieved from the histopathology files of IPATIMUPand Hospital de Săo Joăo in Porto, Portugal. Analysis was performedusing the Envision Detection System (DakoCytomation). Antigen re-trieval was performed by using an EDTA solution (pH 9.0) at 98°Cfor 20 min. The SYNJ2 mouse monoclonal antibody was incubatedovernight at 4°C. After immunostaining, slides were counterstainedwith Mayer’s hematoxylin. Two pathologists independently scored forstaining intensity. Statistical analysis of the data was done using theSPSS suite.

Fluorescence polarization assaysRecombinant SYNJ2 and SYNJ1 were purchased fromOriGene (TP315160and TP315278, respectively). The PH domain of Tapp1 was produced in theIsrael Structural Proteomics Centre. PI(3,4,5)P3, PI(3,4)P2, and PI(3,4)P2–tetramethylrhodamine (TMR) were purchased from Echelon Biosciences.All reagents were prepared in saline containing a lipid cocktail: SOPS(0.01 mg/ml), cholesterol (0.001 mg/ml), and C12E8 (0.005 mg/ml). Thereaction mixture contained SYNJ2 or SYNJ1 (0.8 ng per reaction), MgCl2(2mM), dithiothreitol (5mM), and PI(3,4,5)P3 (2 mM), and it was incubatedat 33°C for 8 min. Reactions were terminated by the addition of a detectorsolution containing EDTA (2 mM), PI(3,4)P2-TMR, and the PH domain ofTapp1. Signals were determined using BMG PHERAstar FS, with a filterset of 540 and 560 nm for parallel and perpendicular emissions. Signalswere then transformed to millipolarization (mP) units.

High-throughput screensThe fluorescence polarization assay was miniaturized to a total volume of24 ml. The SYNJ2 solution was dispensed to black low-volume 384-wellplates with a BioTek EL406 automated dispenser, and compounds fromchemical librarieswere transferred to the plates using a pin tool for approx-imate final concentrations of 15 mM. The reaction was initiated by the ad-dition of 2 mMPI(3,4,5)P3 and 2 mMMgCl2 using a Bravo liquid handler(Agilent). Plates were incubated as above in an automated incubator (LiconicSTX 220), and then the reaction was terminated by the addition of a detectorsolutionwith automated dispenser. Hit compoundswere selected and retested

www

in duplicate five-point dose-response assays to eliminate false-positivesarising from machine errors. Active compounds were then obtained asdry powders, dissolved in DMSO, and tested in duplicate 10-point dose-response. For selectivity, the fluorescence polarization assay was performedusing SYNJ1 instead of SYNJ2. Data representation and curve fitting wereperformed using the Genedata Screener software.

Statistical analysesTwo-sided Fisher’s exact test was used for analysis of lymph nodes. Tumorgrowthmeasurements used the Exact-sig (2 × 1–tailed)Mann-Whitney test.Other experiments were analyzed using one-way analysis of variance.

SUPPLEMENTARY MATERIALSwww.sciencesignaling.org/cgi/content/full/8/360/ra7/DC1Fig. S1. SYNJ2 copy number gain and decreased miR-31 expression in human cancer.Fig. S2. EGF family ligands enhance migration of mammary cells, but SYNJ2 depletionretards migration.Fig. S3. SYNJ2 expression in and migratory behavior of various molecular subtypes ofbreast cancer cells.Fig. S4. SYNJ2 abundance influences migration in vitro and cell proliferation in vivo.Fig. S5. SYNJ2 knockdown influences cytoskeletal organization and cellular morphology.Fig. S6. Subcellular localization and effects of SYNJ2 on receptor endocytosis.Fig. S7. EGFR recycling and signaling to AKT are enhanced by SYNJ2.Fig. S8. SYNJ2 depletion perturbs vesicular transport of the hepatocyte growth factor receptorMET and integrin subunit b1.Fig. S9. SYJN2 is involved in matrix degradation and invadopodia formation.Fig. S10. SYNJ2 facilitates EGFR-induced invadopodia assembly and maturation inMCF10A cells.Movie S1. SYNJ2 knockdown impairs motility in MDA-MB-231 cells.Movie S2. SYNJ2 colocalizes with sites of lamellipodia formation.Movie S3. SYNJ2 localizes to sites of actin polymerization.Movie S4. Dynamin recruits SYNJ2 and its pinching activity is necessary for disassemblyof SYNJ2 puncta.

REFERENCES AND NOTES1. P.J.Stephens,P.S.Tarpey,H.Davies,P.VanLoo,C.Greenman,D.C.Wedge,S.Nik-Zainal,

S. Martin, I. Varela, G. R. Bignell, L. R. Yates, E. Papaemmanuil, D. Beare, A. Butler,A. Cheverton, J. Gamble, J. Hinton, M. Jia, A. Jayakumar, D. Jones, C. Latimer, K.W. Lau,S. McLaren, D. J. McBride, A. Menzies, L. Mudie, K. Raine, R. Rad, M. S. Chapman,J. Teague, D. Easton, A. Langerød, Oslo Breast Cancer Consortium (OSBREAC),M. T. Lee, C. Y. Shen, B. T. Tee, B. W. Huimin, A. Broeks, A. C. Vargas, G. Turashvili,J.Martens,A. Fatima,P.Miron, S. F.Chin,G. Thomas,S.Boyault,O.Mariani, S.R. Lakhani,M. van de Vijver, L. van ’t Veer, J. Foekens, C. Desmedt, C. Sotiriou, A. Tutt, C. Caldas,J. S. Reis-Filho, S. A. Aparicio, A. V. Salomon, A. L. Børresen-Dale, A. L. Richardson,P. J. Campbell, P. A. Futreal, M. R. Stratton, The landscape of cancer genes and mu-tational processes in breast cancer. Nature 486, 400–404 (2012).

2. S. P. Shah, R. D.Morin, J. Khattra, L. Prentice, T. Pugh, A. Burleigh, A. Delaney, K. Gelmon,R.Guliany, J. Senz,C.Steidl, R.A.Holt, S. Jones,M.Sun,G. Leung,R.Moore, T. Severson,G. A. Taylor, A. E. Teschendorff, K. Tse, G. Turashvili, R. Varhol, R. L.Warren, P.Watson,Y. Zhao,C.Caldas, D.Huntsman,M.Hirst,M. A.Marra, S. Aparicio,Mutational evolution ina lobular breast tumour profiled at single nucleotide resolution. Nature 461, 809–813(2009).

3. M. R. Stratton, P. J. Campbell, P. A. Futreal, The cancer genome. Nature 458, 719–724(2009).

4. C. Curtis, S. P. Shah, S. F. Chin, G. Turashvili, O. M. Rueda, M. J. Dunning, D. Speed,A. G. Lynch, S. Samarajiwa, Y. Yuan, S.Gräf, G. Ha, G. Haffari, A. Bashashati, R. Russell,S. McKinney, METABRIC Group, A. Langerød, A. Green, E. Provenzano, G. Wishart,S.Pinder,P.Watson,F.Markowetz, L.Murphy, I.Ellis,A.Purushotham,A.L.Børresen-Dale,J. D. Brenton, S. Tavaré, C. Caldas, S. Aparicio, The genomic and transcriptomicarchitecture of 2,000 breast tumours reveals novel subgroups. Nature 486, 346–352(2012).

5. C. Gewinner, Z. C. Wang, A. Richardson, J. Teruya-Feldstein, D. Etemadmoghadam,D. Bowtell, J. Barretina, W. M. Lin, L. Rameh, L. Salmena, P. P. Pandolfi, L. C. Cantley,Evidence that inositol polyphosphate 4-phosphatase type II is a tumor suppressor thatinhibits PI3K signaling. Cancer Cell 16, 115–125 (2009).

6. J. Li, C.Yen,D. Liaw, K.Podsypanina, S. Bose, S. I.Wang, J. Puc,C.Miliaresis, L. Rodgers,R. McCombie, S. H. Bigner, B. C. Giovanella, M. Ittmann, B. Tycko, H. Hibshoosh,M. H. Wigler, R. Parsons, PTEN, a putative protein tyrosine phosphatase gene mu-tated in human brain, breast, and prostate cancer. Science 275, 1943–1947 (1997).




on October 1, 2020


Dow

nloaded from

7. D. J. Slamon, G. M. Clark, S. G. Wong, W. J. Levin, A. Ullrich, W. L. McGuire, Humanbreast cancer: Correlation of relapse and survival with amplification of the HER-2/neuoncogene. Science 235, 177–182 (1987).

8. F. M. Blows, K. E. Driver, M. K. Schmidt, A. Broeks, F. E. van Leeuwen, J. Wesseling,M.C.Cheang, K.Gelmon, T.O.Nielsen,C.Blomqvist, P.Heikkilä, T.Heikkinen,H.Nevanlinna,L. A. Akslen, L. R. Bégin, W. D. Foulkes, F. J. Couch, X.Wang, V. Cafourek, J. E. Olson,L. Baglietto, G. G. Giles, G. Severi, C. A. McLean,M. C. Southey, E. Rakha, A. R. Green,I. O. Ellis, M. E. Sherman, J. Lissowska,W. F. Anderson, A. Cox, S. S. Cross, M.W. Reed,E.Provenzano,S. J.Dawson,A.M.Dunning,M.Humphreys,D.F.Easton,M.García-Closas,C. Caldas, P. D. Pharoah, D. Huntsman, Subtyping of breast cancer by immunohisto-chemistry to investigate a relationship between subtype and short and long term survival:A collaborative analysis of data for 10,159 cases from12 studies.PLOSMed. 7, e1000279(2010).

9. C. L. Arteaga, M. X. Sliwkowski, C. K. Osborne, E. A. Perez, F. Puglisi, L. Gianni,Treatment of HER2-positive breast cancer: Current status and future perspectives.Nat. Rev. Clin. Oncol. 9, 16–32 (2011).

10. Y. Yarden, G. Pines, The ERBB network: At last, cancer therapy meets systems biology.Nat. Rev. Cancer 12, 553–563 (2012).

11. G. B. Mills, I. Jurisica, Y. Yarden, J. C. Norman, Genomic amplicons target vesiclerecycling in breast cancer. J. Clin. Invest. 119, 2123–2127 (2009).

12. F. Pareja,D. A. Ferraro, C.Rubin, H.Cohen-Dvashi, F. Zhang,S. Aulmann,N. Ben-Chetrit,G. Pines, R. Navon, N. Crosetto, W. Köstler, S. Carvalho, S. Lavi, F. Schmitt, I. Dikic,Z. Yakhini, P. Sinn, G. B. Mills, Y. Yarden, Deubiquitination of EGFR by Cezanne-1 con-tributes to cancer progression. Oncogene 31, 4599–4608 (2012).

13. J. Zhang, X. Liu, A. Datta, K. Govindarajan, W. L. Tam, J. Han, J. George, C. Wong,K. Ramnarayanan, T. Y. Phua, W. Y. Leong, Y. S. Chan, N. Palanisamy, E. T. Liu,K. M. Karuturi, B. Lim, L. D. Miller, RCP is a human breast cancer–promoting genewith Ras-activating function. J. Clin. Invest. 119, 2171–2183 (2009).

14. P. A. Muller, P. T. Caswell, B. Doyle, M. P. Iwanicki, E. H. Tan, S. Karim, N. Lukashchuk,D.A.Gillespie,R.L.Ludwig,P.Gosselin,A.Cromer, J.S.Brugge,O.J.Sansom,J.C.Norman,K. H. Vousden, Mutant p53 drives invasion by promoting integrin recycling. Cell 139,1327–1341 (2009).

15. K. W. Cheng, J. P. Lahad, W. L. Kuo, A. Lapuk, K. Yamada, N. Auersperg, J. Liu,K. Smith-McCune, K. H. Lu, D. Fishman, J. W. Gray, G. B. Mills, The RAB25 smallGTPase determines aggressiveness of ovarian and breast cancers. Nat. Med. 10,1251–1256 (2004).

16. Q. Hou, Y. H. Wu, H. Grabsch, Y. Zhu, S. H. Leong, K. Ganesan, D. Cross, L. K. Tan,J. Tao, V. Gopalakrishnan, B. L. Tang, O. L. Kon, P. Tan, Integrative genomics iden-tifies RAB23 as an invasion mediator gene in diffuse-type gastric cancer. Cancer Res.68, 4623–4630 (2008).

17. Y. Mosesson, G. B. Mills, Y. Yarden, Derailed endocytosis: An emerging feature ofcancer. Nat. Rev. Cancer 8, 835–850 (2008).

18. C. A. Parachoniak, M. Park, Dynamics of receptor trafficking in tumorigenicity. TrendsCell Biol. 22, 231–240 (2012).

19. T. L. Yuan, L. C. Cantley, PI3K pathway alterations in cancer: Variations on a theme.Oncogene 27, 5497–5510 (2008).

20. K. Sossey-Alaoui, X. Li, T. A. Ranalli, J. K. Cowell, WAVE3-mediated cell migrationand lamellipodia formation are regulated downstream of phosphatidylinositol 3-kinase.J. Biol. Chem. 280, 21748–21755 (2005).

21. H. Yamaguchi, S. Yoshida, E. Muroi, N. Yoshida, M. Kawamura, Z. Kouchi, Y. Nakamura,R. Sakai, K. Fukami, Phosphoinositide 3-kinase signaling pathway mediated by p110aregulates invadopodia formation. J. Cell Biol. 193, 1275–1288 (2011).

22. U. Philippar, E. T. Roussos, M. Oser, H. Yamaguchi, H. D. Kim, S. Giampieri, Y. Wang,S. Goswami, J. B. Wyckoff, D. A. Lauffenburger, E. Sahai, J. S. Condeelis, F. B. Gertler,A Mena invasion isoform potentiates EGF-induced carcinoma cell invasion and metas-tasis. Dev. Cell 15, 813–828 (2008).

23. M. A. Eckert, T. M. Lwin, A. T. Chang, J. Kim, E. Danis, L. Ohno-Machado, J. Yang,Twist1-induced invadopodia formation promotes tumor metastasis. Cancer Cell 19,372–386 (2011).

24. C. L. Abram, D. F. Seals, I. Pass, D. Salinsky, L. Maurer, T. M. Roth, S. A. Courtneidge,The adaptor protein fish associates with members of the ADAMs family and localizes topodosomes of Src-transformed cells. J. Biol. Chem. 278, 16844–16851 (2003).

25. T. Oikawa, T. Itoh, T. Takenawa, Sequential signals toward podosome formation inNIH-src cells. J. Cell Biol. 182, 157–169 (2008).

26. N.Malecz, P. C.McCabe, C. Spaargaren, R. Qiu, Y. Chuang,M. Symons, Synaptojanin 2,a novel Rac1 effector that regulates clathrin-mediated endocytosis. Curr. Biol. 10,1383–1386 (2000).

27. M. Mani, S. Y. Lee, L. Lucast, O. Cremona, G. Di Paolo, P. De Camilli, T. A. Ryan,The dual phosphatase activity of Synaptojanin1 is required for both efficient synapticvesicle endocytosis and reavailability at nerve terminals. Neuron 56, 1004–1018(2007).

28. Y. Y. Chuang, N. L. Tran, N. Rusk, M. Nakada, M. E. Berens, M. Symons, Role ofsynaptojanin 2 in glioma cell migration and invasion. Cancer Res. 64, 8271–8275(2004).

www

29. K. Sossey-Alaoui, E. Downs-Kelly, M. Das, L. Izem, R. Tubbs, E. F. Plow, WAVE3, anactin remodeling protein, is regulated by the metastasis suppressor microRNA, miR-31,during the invasion-metastasis cascade. Int. J. Cancer 129, 1331–1343 (2011).

30. H. Dvinge, A. Git, S. Gräf, M. Salmon-Divon, C. Curtis, A. Sottoriva, Y. Zhao, M. Hirst,J. Armisen, E. A. Miska, S. F. Chin, E. Provenzano, G. Turashvili, A. Green, I. Ellis,S. Aparicio, C. Caldas, The shaping and functional consequences of the microRNAlandscape in breast cancer. Nature 497, 378–382 (2013).

31. H. Y. Irie, R. V. Pearline, D.Grueneberg,M.Hsia, P.Ravichandran,N. Kothari, S. Natesan,J. S. Brugge, Distinct roles of Akt1 and Akt2 in regulating cell migration and epithelial–mesenchymal transition. J. Cell Biol. 171, 1023–1034 (2005).

32. P. D. Bos, X. H. Zhang, C. Nadal, W. Shu, R. R. Gomis, D. X. Nguyen, A. J. Minn,M. J. van de Vijver, W. L. Gerald, J. A. Foekens, J. Massagué, Genes that mediatebreast cancer metastasis to the brain. Nature 459, 1005–1009 (2009).

33. A. J. Minn, G. P. Gupta, P. M. Siegel, P. D. Bos, W. Shu, D. D. Giri, A. Viale, A. B. Olshen,W. L. Gerald, J. Massagué, Genes that mediate breast cancer metastasis to lung. Nature436, 518–524 (2005).

34. Y. Chuang, X. Xu, A. Kwiatkowska,G. Tsapraillis, H. Hwang, K. Petritis, D. Flynn, M. Symons,Regulation of synaptojanin 2 5¢-phosphatase activity by Src. Cell Adh. Migr. 6, 518–525(2012).

35. A. B. Jefferson, P. W. Majerus, Mutation of the conserved domains of two inositolpolyphosphate 5-phosphatases. Biochemistry 35, 7890–7894 (1996).

36. C. J. Stefan, S. M. Padilla, A. Audhya, S. D. Emr, The phosphoinositide phosphataseSjl2 is recruited to cortical actin patches in the control of vesicle formation and fissionduring endocytosis. Mol. Cell. Biol. 25, 2910–2923 (2005).

37. H. Paz, N. Pathak, J. Yang, Invading one step at a time: The role of invadopodia intumor metastasis. Oncogene 33, 4193–4202 (2014).

38. A. E. Kruchten, M. A. McNiven, Dynamin as a mover and pincher during cell migrationand invasion. J. Cell Sci. 119, 1683–1690 (2006).

39. J. Chou, D. B. Stolz, N. A. Burke, S. C. Watkins, A. Wells, Distribution of gelsolin andphosphoinositol 4,5-bisphosphate in lamellipodia during EGF-induced motility. Int. J.Biochem. Cell Biol. 34, 776–790 (2002).

40. A. Vehlow, D. Soong, G. Vizcay-Barrena, C. Bodo, A. L. Law, U. Perera, M. Krause,Endophilin, Lamellipodin, and Mena cooperate to regulate F-actin-dependent EGF-receptor endocytosis. EMBO J. 32, 2722–2734 (2013).

41. M. Kaksonen, Y. Sun, D. G. Drubin, A pathway for association of receptors, adaptors,and actin during endocytic internalization. Cell 115, 475–487 (2003).

42. C. C. Mader, M. Oser, M. A. Magalhaes, J. J. Bravo-Cordero, J. Condeelis, A. J. Koleske,H. Gil-Henn, An EGFR–Src–Arg–cortactin pathway mediates functional maturation ofinvadopodia and breast cancer cell invasion. Cancer Res. 71, 1730–1741 (2011).

43. J. van Rheenen, X. Song, W. van Roosmalen, M. Cammer, X. Chen, V. Desmarais,S. C. Yip, J. M. Backer, R. J. Eddy, J. S. Condeelis, EGF-induced PIP2 hydrolysis releasesand activates cofilin locally in carcinoma cells. J. Cell Biol. 179, 1247–1259 (2007).

44. L. K. Goh, F. Huang, W. Kim, S. Gygi, A. Sorkin, Multiple mechanisms collectivelyregulate clathrin-mediated endocytosis of the epidermal growth factor receptor. J. CellBiol. 189, 871–883 (2010).

45. S. A. Courtneidge, E. F. Azucena, I. Pass, D. F. Seals, L. Tesfay, The SRC substrateTks5, podosomes (invadopodia), and cancer cell invasion. Cold Spring Harb. Symp.Quant. Biol. 70, 167–171 (2005).

46. W. H. Yu, J. F. Woessner Jr., J. D. McNeish, I. Stamenkovic, CD44 anchors theassembly of matrilysin/MMP-7 with heparin-binding epidermal growth factor precursorand ErbB4 and regulates female reproductive organ remodeling. Genes Dev. 16,307–323 (2002).

47. L. Y. Bourguignon, Z.Gunja-Smith, N. Iida, H. B. Zhu, L. J. Young,W. J.Muller, R. D. Cardiff,CD44v3,8–10 is involved in cytoskeleton-mediated tumor cell migration and matrix metallo-proteinase (MMP-9) association in metastatic breast cancer cells. J. Cell. Physiol. 176,206–215 (1998).

48. P. Monteiro, C. Rossé, A. Castro-Castro, M. Irondelle, E. Lagoutte, P. Paul-Gilloteaux,C. Desnos, E. Formstecher, F. Darchen, D. Perrais, A. Gautreau, M. Hertzog, P. Chavrier,Endosomal WASH and exocyst complexes control exocytosis of MT1-MMP at invadopodia.J. Cell Biol. 203, 1063–1079 (2013).

49. D. A. Murphy, S. A. Courtneidge, The “ins” and “outs” of podosomes and invadopodia:Characteristics, formation and function. Nat. Rev. Mol. Cell Biol. 12, 413–426 (2011).

50. Y. Tsujishita, S. Guo, L. E. Stolz, J. D. York, J. H. Hurley, Specificity determinants inphosphoinositide dephosphorylation: Crystal structure of an archetypal inositol poly-phosphate 5-phosphatase. Cell 105, 379–389 (2001).

51. Y. Nemoto, M. Arribas, C. Haffner, P. DeCamilli, Synaptojanin 2, a novel synaptojaninisoform with a distinct targeting domain and expression pattern. J. Biol. Chem. 272,30817–30821 (1997).

52. M. Ignatiadis, C. Desmedt, C. Sotiriou, E. de Azambuja, M. Piccart, HER-2 as a targetfor breast cancer therapy. Clin. Cancer Res. 15, 1848–1852 (2009).

53. M.Oser, H. Yamaguchi, C. C.Mader, J. J. Bravo-Cordero, M. Arias, X. Chen, V. Desmarais,J. van Rheenen, A. J. Koleske, J. Condeelis, Cortactin regulates cofilin and N-WASpactivities to control the stages of invadopodium assembly and maturation. J. Cell Biol.186, 571–587 (2009).




54. M. Krause, J. D. Leslie, M. Stewart, E. M. Lafuente, F. Valderrama, R. Jagannathan,G. A. Strasser, D. A. Rubinson, H. Liu, M. Way, M. B. Yaffe, V. A. Boussiotis, F. B. Gertler,Lamellipodin, an Ena/VASP ligand, is implicated in the regulation of lamellipodial dynamics.Dev. Cell 7, 571–583 (2004).

55. C. Cao, J. M. Backer, J. Laporte, E. J. Bedrick, A. Wandinger-Ness, Sequentialactions of myotubularin lipid phosphatases regulate endosomal PI(3)P and growthfactor receptor trafficking. Mol. Biol. Cell 19, 3334–3346 (2008).

56. M. T. Howes, M. Kirkham, J. Riches, K. Cortese, P. J. Walser, F. Simpson, M. M. Hill,A. Jones, R. Lundmark, M. R. Lindsay, D. J. Hernandez-Deviez, G. Hadzic, A. McCluskey,R. Bashir, L. Liu, P. Pilch, H.McMahon, P. J. Robinson, J. F. Hancock, S.Mayor, R.G. Parton,Clathrin-independent carriers form a high capacity endocytic sorting system at the leadingedge of migrating cells. J. Cell Biol. 190, 675–691 (2010).

Acknowledgments: This work was performed at the Marvin Tanner Laboratory for CancerResearch. We thank L. Rameh, T. Takenawa, S. Lavi, M. Katz, I. Amit, A. Citri, Y. Peleg,S. Albeck, Y. Jacobovitch, A. Plotnikov, C. Wirth, and E. Muenstermann for their kind help.Funding: Our research is supported by the National Cancer Institute, the EuropeanResearch Council, the Seventh Framework Program of the European Commission, theGerman-Israeli Project Cooperation (DIP), the Israel Cancer Research Fund, and theDr. Miriam and Sheldon G. Adelson Medical Research Foundation. Y.Y. is the incumbent

www

of the Harold and Zelda Goldenberg Professorial Chair. Author contributions: N.B.-C.,D.C., M.E., and Y.Y. conceived the study. N.B.-C., D.C., C.K., M.M., A.A.-H., T.I., S.C.,H.C.-D., W.J.K., K.S., M. Lauriola, M.K., M. Lindzen, Z.S., H.B., D.S., D.A.F., F.P., and F.M.performed experiments. R.R., R.B.-H., S.E., F.S., and C.C. analyzed patient data. H.G.-H.,T.L., R.A., S.W., M.E., and Y.Y. supervised experiments. M.S. provided reagents. N.B.-C.,M.E., and Y.Y. wrote the manuscript. Competing interests: The authors declare that theyhave no competing interests. Data and materials availability: The results of our screen ofcompounds are available at PubChem (ID: 22074).

Submitted 29 May 2014Accepted 30 December 2014Final Publication 20 January 201510.1126/scisignal.2005537Citation: N. Ben-Chetrit, D. Chetrit, R. Russell, C. Körner, M. Mancini, A. Abdul-Hai, T. Itkin,S. Carvalho, H. Cohen-Dvashi, W. J. Koestler, K. Shukla, M. Lindzen, M. Kedmi, M. Lauriola,Z. Shulman, H. Barr, D. Seger, D. A. Ferraro, F. Pareja, H. Gil-Henn, T. Lapidot, R. Alon,F. Milanezi, M. Symons, R. Ben-Hamo, S. Efroni, F. Schmitt, S. Wiemann, C. Caldas,M. Ehrlich, Y. Yarden, Synaptojanin 2 is a druggable mediator of metastasis and the geneis overexpressed and amplified in breast cancer. Sci. Signal. 8, ra7 (2015).


on October 1, 2020


Dow

nloaded from


amplified in breast cancerSynaptojanin 2 is a druggable mediator of metastasis and the gene is overexpressed and

Rotem Ben-Hamo, Sol Efroni, Fernando Schmitt, Stefan Wiemann, Carlos Caldas, Marcelo Ehrlich and Yosef YardenDalia Seger, Daniela A. Ferraro, Fresia Pareja, Hava Gil-Henn, Tsvee Lapidot, Ronen Alon, Fernanda Milanezi, Marc Symons,Cohen-Dvashi, Wolfgang J. Koestler, Kirti Shukla, Moshit Lindzen, Merav Kedmi, Mattia Lauriola, Ziv Shulman, Haim Barr, Nir Ben-Chetrit, David Chetrit, Roslin Russell, Cindy Körner, Maicol Mancini, Ali Abdul-Hai, Tomer Itkin, Silvia Carvalho, Hadas

DOI: 10.1126/scisignal.2005537 (360), ra7.8Sci. Signal.

matrix, suggesting that targeting SYNJ2 may prevent metastasis in breast cancer patients.and lung metastasis in mice. A chemical screen identified SYNJ2 inhibitors that reduced cell invasion through a 3D cells. Expressing a phosphatase-deficient mutant of SYNJ2 in xenografted breast cancer cells suppressed tumor growthinhibited recycling of the EGF receptor to the cell surface and decreased the invasive behavior of cultured breast cancer lamellipodia and invadopodia, which are cellular protrusions associated with invasive behavior. Knocking down SYNJ2synaptojanin 2. In cultured breast cancer cells, epidermal growth factor (EGF) triggered the localization of SYNJ2 to

, which encodes the lipid phosphataseSYNJ2aggressive breast cancer have tumors with increased expression of . found that many patients withet alBlocking cancer cell metastasis can prolong patient survival. Ben-Chetrit

Blocking Receptor Recycling to Prevent Metastasis

ARTICLE TOOLS http://stke.sciencemag.org/content/8/360/ra7

MATERIALSSUPPLEMENTARY http://stke.sciencemag.org/content/suppl/2015/01/15/8.360.ra7.DC1

CONTENTRELATED

http://stke.sciencemag.org/content/sigtrans/9/415/eg2.fullhttp://stke.sciencemag.org/content/sigtrans/7/339/ra78.fullhttp://stke.sciencemag.org/content/sigtrans/7/330/ra58.fullhttp://stke.sciencemag.org/content/sigtrans/7/329/pc16.fullhttp://stke.sciencemag.org/content/sigtrans/7/355/ra116.fullhttp://stke.sciencemag.org/content/sigtrans/7/329/ra56.full

REFERENCES

http://stke.sciencemag.org/content/8/360/ra7#BIBLThis article cites 56 articles, 23 of which you can access for free

PERMISSIONS http://www.sciencemag.org/help/reprints-and-permissions

Terms of ServiceUse of this article is subject to the

is a registered trademark of AAAS.Science SignalingYork Avenue NW, Washington, DC 20005. The title (ISSN 1937-9145) is published by the American Association for the Advancement of Science, 1200 NewScience Signaling

Copyright © 2015, American Association for the Advancement of Science

on October 1, 2020


Dow

nloaded from

http://stke.sciencemag.org/content/8/360/ra7

http://stke.sciencemag.org/content/suppl/2015/01/15/8.360.ra7.DC1

http://stke.sciencemag.org/content/sigtrans/7/329/ra56.full


http://stke.sciencemag.org/content/sigtrans/7/329/pc16.full



http://stke.sciencemag.org/content/sigtrans/9/415/eg2.full

http://stke.sciencemag.org/content/8/360/ra7#BIBL

http://www.sciencemag.org/help/reprints-and-permissions

http://www.sciencemag.org/about/terms-service


Documents

Synaptojanin 2 is a druggable mediator of metastasis and ... · CANCER Synaptojanin 2 is a druggable mediator of metastasis and the gene is overexpressed and amplified in breast cancer