Upload
irina-blinova
View
216
Download
0
Embed Size (px)
Citation preview
8/8/2019 Supporting Methods and Figures 072010b
1/13
1
Binucleine 2, an isoform-specific inhibitor ofDrosophila Aurora B kinase,
provides insights into the mechanism of cytokinesis
Yegor Smurnyy, Angela Toms, Michael J. Eck and Ulrike S. Eggert
Dana-Farber Cancer Institute and Dept. of Biological Chemistry and Molecular Pharmacology,
Harvard Medical School, Boston, MA
Supporting Methods
Plasmids
Bicistronic pET28-His-DmAurora B1-323-His-DmINCENP654-755 plasmid was generated as follows:
amino acids 654-755 of DmINCENP were amplified from the cDNA template with primers
AAAGAATTCCTTCCGCCGC (5' end, EcoRI site) and TTTCTCGAGTCAGTATTTCGGC (3'
end, XhoI site), digested with EcoRI and XhoI and cloned into pET28a. Then, full-length
DmAurora B was amplified from the cDNA template using primers
AAAGCTAGCATGACGCTTTC (5' end, NheI site), and TTTGTCGACTCAATTTCTGGC (3'
end, SalI site), the PCR product was digested with NheI/SalI and cloned into empty pET28a. At
the final stage, the part of pET28a-His- DmINCENP654-755 encompassing the ribosomal binding
site, 6xHis tag and INCENP insert was amplified with primers AAAGTCCAG
AAATAATTTTGTTTAACTTTAAGA (5', SalI site) and TTTCTCGAGTCAGTATTTCGGC (3',
XhoI site). The PCR product was cloned into previously generated pET28-His-DmAurora B
plasmid. The resulting construct has two independent ORFs, both with N-terminal 6xHis tags.
Full-length DmAurora A was amplified from a cDNA template using primers CACGAATTC
ATGTCCCATCC (5', EcoRI) and TTTCTCGAGTCACTGCGTG (3', XhoI) and cloned into
pET28a, which provides a N-terminal His tag.
Mutagenesis
Bicistronic plasmids expressing DmAurora B with mutated hinge residues were obtained using the
above WT construct and QuikChange II XL kit (Stratagene), following manufacturer's directions.
Mutagenesis primers are summarized below:
8/8/2019 Supporting Methods and Figures 072010b
2/13
2
Mutant Primers
Ile132Tyr 5' CGCATCTATCTGGCCCTGGAATATGCGTCCGAGG
3' CCTCGGACGCATATTCCAGGGCCAGATAGATGCG
Ser134Pro 5' CCTGGAAATTGCGCCCGAGGGCGAGCT
3' AGCTCGCCCTCGGGCGCAATTTCCAGG
Ile132Tyr Ser134Pro 5' CATCTATCTGGCCCTGGAATATGCGCCCGAGGGCGA
3' TCGCCCTCGGGCGCATATTCCAGGGCCAGATAGATG
Protein expression and purification
Aurora B/INCENP were co-expressed from a bicistronic plasmid with two independent ORFs,
both with N-terminal 6xHis tags (see Supporting Methods for details). Expression constructs were
transformed into Rosetta E. coli strain and grown overnight in LB media supplemented with 30
mg/L kanamycin and 34 mg/L chloramphenicol. Seeding culture was diluted 1:100, and induced
with 0.3 mM IPTG upon reaching OD600 ~ 0.4-0.7. Cultures were further grown overnight at 18
C. Bacteria were subsequently pelleted and resuspended in the lysis buffer: 500 mM NaCl, 20
mM Tris pH 7.9, 5 mM BME, 5 mM imidazole, 1mM PMSF, 1x EDTA-free protease inhibitor
cocktail (Sigma). 25 mL of lysis buffer was used per each 1L of culture. Cell were lysed by
sonication, lysates cleared by 1 hour centrifugation at 142,000 g. Cleared lysate was incubated
with 0.25 mL/1L of culture of pre-equilibrated Ni-NTA beads (GE Healthcare) for 1 hour at 4 C.
Beads were washed with 30 volumes of wash buffer: 500 mM NaCl, 20 mM Tris pH 7.9, 5 mM
BME, 30 mM imidazole and the protein was eluted in 1-2 mL of elution buffer: 500 mM NaCl, 20
mM Tris pH 7.9, 5 mM BME, 300 mM imidazole.
Further purification was performed by ion-exchange (MonoQ HR 5/5 column, GE Healthcare) and
size exclusion (Superdex 200, GE Healthcare) chromatography. Chromatography buffers were as
follows: buffer A: 100 mM NaCl, 20 mM Tris pH 7.9, 1 mM DTT; buffer B: 500 mM NaCl, 20
mM Tris pH 7.9, 1 mM DTT; gel-filtration buffer: 300 mM NaCl, 20 mM Tris pH 7.9, 1 mM
DTT.
Synthesis and characterization of Binucleine 2 and its analogs
All of the compounds reported here were synthesized following the same synthetic procedure, as
shown in Supporting Scheme 1: 3 mmol of substituted phenylhydrazine hydrochloride (1) was
8/8/2019 Supporting Methods and Figures 072010b
3/13
3
combined with 3 mmol (440 mg) of ethoxymethylenemalonitrile and 6 mmol (0.84 mL) of
triethylamine and refluxed for 4 hours in 2 mL of ethanol. The reaction product, substituted
phenylpyrazole (2) was recrystallized from ethanol, combined with 10 mmol (1.3 mL) of N,N-
Dimethylformamide dimethyl acetal and catalytic amounts of toluenesulfonic acid. The mixture
was refluxed in ethanol overnight and the final product (3) was recrystallized from ethanol. All
chemicals were purchased from Sigma Aldrich, except for 3,4-difluoro- and 3,4-
dichlorophenyhydrazine hydrochlorides, which were obtained from Alfa Aesar.
Supporting Scheme 1. Synthesis of Binucleine 2 (R = 3-Cl, 4-F and related compounds).
All final products were characterized using 1H and 13C NMR spectroscopy:
Binucleine 2,N-(1-(3-Chloro-4-fluorophenyl)-4-cyano-1H-pyrazol-5-yl)-N,N-
dimethyliminoformamide1H NMR (600 MHz, d6-DMSO): 8.26 (s, 1H), 8.04 (dd, J = 7.2 Hz, 1H), 8.00 (s, 1H), 7.78-7.81
(m, 1H), 7.52 (t, J = 9.6 Hz, 1H), 3.11 (s, 3H), 2.97 (s, 3H);13
C NMR (150 MHz, d6-DMSO):
157.5, 155.7, 143.1, 136.2, 125.5, 124.3, 124.2, 117.8, 117.6, 116.2, 79.0, 41.0, 34.9; MS (m/z):
[M+H]+ calcd. for C13H12ClFN5, 292.06; found, 291.80.
N-(1-Phenyl-4-cyano-1H-pyrazol-5-yl)-N,N-dimethyliminoformamide
1H NMR (600 MHz, d6-DMSO): 8.23 (s, 1H), 7.96 (s, 1H), 7.73-7.74 (m, 2H), 7.44-7.47 (m,
2H), 7.32 (t, J = 9.6 Hz, 1H), 3.08 (s, 3H), 2.95 (s, 3H);13
C NMR (150 MHz, d6-DMSO): 157.3,
155.5, 142.6, 139.2, 129.4, 127.6, 123.9, 116.4, 79.0, 40.8, 34.9; MS (m/z): [M+H]+ calcd. for
C13H14N5, 240.11; found, 240.05.
8/8/2019 Supporting Methods and Figures 072010b
4/13
4
N-(1-(3-Fluoro-phenyl)-4-cyano-1H-pyrazol-5-yl)-N,N-dimethyliminoformamide
1H NMR (600 MHz, d6-DMSO): 8.28 (s, 1H), 8.00 (s, 1H), 7.67-7.69 (m, 2H), 7.51 (q, J = 7.2
Hz, 1H), 7.15-7.18 (m, 1H), 3.11 (s, 3H), 2.99 (s, 3H);13
C NMR (150 MHz, d6-DMSO): 157.5,
155.9, 142.9, 131.0, 119.4, 116.2, 114.3, 114.1, 110.7, 110.5, 79.2, 40.9, 34.9; MS (m/z): [M+H]+
calcd. for C13H13FN5, 258.10; found, 258.02.
N-(1-(4-Fluoro-phenyl)-4-cyano-1H-pyrazol-5-yl)-N,N-dimethyliminoformamide
1H NMR (600 MHz, d6-DMSO): 8.23 (s, 1H), 7.96 (s, 1H), 7.74-7.76 (m, 2H), 7.27-7.31 (m,
2H), 3.09 (s, 3H), 2.94 (s, 3H);13
C NMR (150 MHz, d6-DMSO): 157.4, 155.4, 142.6, 135.6,
126.1, 125.6, 124.2, 116.3, 78.8, 40.8, 34.9; MS (m/z): [M+H]+ calcd. for C13H13FN5, 258.10;
found, 258.02.
N-(1-(3-Chloro-phenyl)-4-cyano-1H-pyrazol-5-yl)-N,N-dimethyliminoformamide1H NMR (600 MHz, d6-DMSO): 8.26 (s, 1H), 7.99 (s, 1H), 7.91 (t, J = 1.8 Hz, 1H), 7.77-7.79
(m, 1H), 7.48 (t, J = 16.2 Hz, 1H), 7.37-7.39 (m, 1H), 3.11 (s, 3H), 2.99 (s, 3H);13
C NMR (150
MHz, d6-DMSO): 157.4, 155.8, 143.0, 140.4, 133.6, 131.1, 127.2, 123.2, 122.0, 116.2, 79.1,
40.9, 34.9; MS (m/z): [M+H]+ calcd. for C13H13ClN5, 274.07; found, 273.96.
N-(1-(4-Chloro-phenyl)-4-cyano-1H-pyrazol-5-yl)-N,N-dimethyliminoformamide
1H NMR (600 MHz, d6-DMSO): 8.25 (s, 1H), 7.98 (s, 1H), 7.77-7.80 (m, 2H), 7.51-7.53 (m,
2H), 3.09 (s, 3H), 2.96 (s, 3H); 13C NMR (150 MHz, d6-DMSO): 157.4, 155.6, 142.9, 138.1,
131.8, 129.4, 125.4, 116.3, 79.0, 40.9, 35.0; MS (m/z): [M+H]+ calcd. for C13H13ClN5, 274.07;
found, 273.96.
N-(1-(3-Bromo-phenyl)-4-cyano-1H-pyrazol-5-yl)-N,N-dimethyliminoformamide
1H NMR (600 MHz, d6-DMSO): 8.26 (s, 1H), 8.07 (t, J = 1.8 Hz, 1H), 8.00 (s, 1H), 7.81-7.82
(m, 1H), 7.51-7.53 (m, 1H), 7.41 (t, J = 16.2 Hz, 1H), 3.11 (s, 3H), 2.98 (s, 3H);13
C NMR (150
MHz, d6-DMSO): 157.4, 155.8, 143.1, 140.5, 131.4, 130.1, 126.0, 122.4, 121.9, 116.2, 79.1,
40.9, 34.9; MS (m/z): [M+H]+ calcd. for C13H13BrN5, 318.03; found, 318.02.
N-(1-(4-Bromo-phenyl)-4-cyano-1H-pyrazol-5-yl)-N,N-dimethyliminoformamide
1H NMR (600 MHz, d6-DMSO): 8.25 (s, 1H), 7.99 (s, 1H), 7.72-7.75 (m, 2H), 7.63-7.67 (m,
2H), 3.10 (s, 3H), 2.96 (s, 3H);13
C NMR (150 MHz, d6-DMSO): 157.4, 155.6, 142.9, 138.5,
8/8/2019 Supporting Methods and Figures 072010b
5/13
5
132.3, 125.7, 120.2, 116.2, 79.1, 40.9, 34.7; MS (m/z): [M+H]+ calcd. for C13H13BrN5, 318.03;
found, 318.02.
N-(1-(3,4-Difluoro-phenyl)-4-cyano-1H-pyrazol-5-yl)-N,N-dimethyliminoformamide
1H NMR (600 MHz, d6-DMSO): 8.26 (s, 1H), 7.99 (s, 1H), 7.87-7.91 (m, 1H), 7.65-7.67 (m,
1H), 7.53 (q, J = 9.4, 1H), 3.11 (s, 1H), 2.98 (s, 1H);13
C NMR (150 MHz, d6-DMSO): 157.5,
155.7, 142.9, 120.4, 120.3, 118.3, 118.1, 116.2, 113.2, 113.0, 79.0, 40.9, 35.0; MS (m/z): [M+H]+
calcd. for C13H12F2N5, 276.10; found, 276.08.
N-(1-(3,4-Dichloro-phenyl)-4-cyano-1H-pyrazol-5-yl)-N,N-dimethyliminoformamide
1H NMR (600 MHz, d6-DMSO): 8.27 (s, 1H), 8.12 (d, J = 2.4 Hz, 1H), 8.00 (s, 1H), 7.82 (dd, J
= 9 Hz, 1H), 7.70 (d, J = 9 Hz, 1H), 3.12 (s, 3H), 2.99 (s, 3H);13
C NMR (150 MHz, d6-DMSO):
157.1, 155.9, 143.2, 138.9, 131.7, 131.4, 129.6, 124.8, 123.3, 116.1, 79.1, 41.0, 35.0; MS (m/z):
[M+H]+ calcd. for C13H12Cl2N5, 308.04; found, 307.95.
N-(1-(3,5-Dichloro-phenyl)-4-cyano-1H-pyrazol-5-yl)-N,N-dimethyliminoformamide
1H NMR (600 MHz, d6-DMSO): 8.29 (s, 1H), 8.03 (s, 1H), 7.95 (d, J = 1.8 Hz, 2H), 7.56 (t, J =
1.8 Hz, 1H), 3.13 (s, 3H), 3.01 (s, 3H); 13C NMR (150 MHz, d6-DMSO): 157.5, 156.2, 143.5,
141.1, 134.8, 126.6, 121.5, 116.0, 79.3, 41.1, 35.0; MS (m/z): [M+H]+ calcd. for C13H12Cl2N5,
308.04; found, 307.95.
N-(1-(2,4-Dichloro-phenyl)-4-cyano-1H-pyrazol-5-yl)-N,N-dimethyliminoformamide
1H NMR (600 MHz, d6-DMSO): 8.22 (s, 1H), 7.98 (s, 1H), 7.82 (d, J = 2.4 Hz, 1H), 7.55 (dd, J
= 8.4 Hz, 1H), 7.51 (d, J = 8.4 Hz, 1H), 3.04 (s, 3H), 2.77 (s, 3H); 13C NMR (150 MHz, d6-
DMSO): 157.2, 156.7, 143.2, 135.4, 135.2, 132.9, 131.0, 130.2, 128.7, 116.2, 77.5, 40.8, 34.6 ;
MS (m/z): [M+H]+ calcd. for C13H12Cl2N5, 308.04; found, 307.95.
N-(1-(4-Methyl-phenyl)-4-cyano-1H-pyrazol-5-yl)-N,N-dimethyliminoformamide
1H NMR (600 MHz, d6-DMSO): 8.21 (s, 1H), 7.93 (s, 1H), 7.58 (d, J = 8.4 Hz, 2H), 7.25 (d, J =
8.4 Hz), 3.07 (s, 3H), 2.93 (s, 3H), 2.31 (s, 3H);13
C NMR (150 MHz, d6-DMSO): 157.3, 155.3,
142.3, 137.0, 136.9, 129.8, 123.9, 116.4, 78.8, 40.8, 34.8, 21.2; MS (m/z): [M+H]+ calcd. for
C14H16N5, 254.13; found, 253.94.
8/8/2019 Supporting Methods and Figures 072010b
6/13
6
N-(1-(3,4-Dimethyl-phenyl)-4-cyano-1H-pyrazol-5-yl)-N,N-dimethyliminoformamide
1H NMR (600 MHz, d6-DMSO): 8.21 (s, 1H), 7.92 (s, 1H), 7.51 (d, J = 1.8 Hz, 1H), 7.41 (dd, J
= 7.8 Hz, 1H), 7.18 (d, J = 7.8 Hz, 1H), 3.07 (s, 3H), 2.93 (s, 3H), 2.23 (s, 3H), 2.22 (s, 3H);13
C
NMR (150 MHz, d6-DMSO): 157.2, 155.2, 142.2, 137.3, 137.1, 135.8, 130.1, 124.9, 121.3,
116.5, 78.7, 40.8, 34.8, 20.1, 19.6; MS (m/z): [M+H]+ calcd. for C15H18N5, 268.15; found, 267.96.
8/8/2019 Supporting Methods and Figures 072010b
7/13
7
Supporting Figures
Supporting Figure 1. Gel-filtration profile of the binary complex of full-length Aurora B and
INCENP654-755. Molecular weights in kDa of protein standards are shown on the left.
8/8/2019 Supporting Methods and Figures 072010b
8/13
8
Supporting Figure 2. Binucleine 2 inhibits WT DmAurora B in a dose-dependent manner. ATP
concentrations were varied from 1 to 500 M. Binucleine 2 concentrations (M) are shown in the
figure legend and were varied between 0.2 and 8.0 M. All measurements were done in duplicates,
error bars represent mean error. Data were fit with the competitive inhibition model, KmATP
= 130
34 M and KiB2
= 0.36 0.10 M (95% confidence interval).
8/8/2019 Supporting Methods and Figures 072010b
9/13
9
Supporting Figure 3. Binucleine does not inhibit human or X. laevis Aurora B kinases. Enzyme
activity was measured in a32
P-ATP spot assay with MBP as the substrate (see Methods for
details). Reactions were run with [ATP] = 50 M, at room temperature, for10 mins. Tested
compounds include the non-specific kinase inhibitor Staurosporine (1 M), the pan-Aurora
inhibitor VX-680 (0.5 M) and three dilutions of Binucleine 2. All measurements were done in
triplicates, error bars represent mean error. Human GST-6xHis-Aurora B2-344 was purchased from
EMD4Biosciences. The full-lengthX. laevis Aurora B/INCENP binary complex is a gift from R.
Ohi (Vanderbilt University).
8/8/2019 Supporting Methods and Figures 072010b
10/13
10
Supporting Figure 4. Detailed kinetic data for the Ile132Tyr Ser134Pro mutant Aurora B kinase.
The enzyme is not inhibited by Binucleine 2 (left panel), but is inhibited by Staurosporine (right
panel). ATP concentrations were varied from 1 to 500 M. Binucleine 2 and Staurosporine
concentrations (M) are shown in the figure legend. All measurements were done in duplicates,
error bars represent mean error. Data were fit with the Michaelis-Menten model, KmATP
= 71 26
M (95% confidence interval).
Supporting Figure 5. Ser134Pro mutantDrosophila Aurora B is inhibited by Binucleine 2 and
Staurosporine in the manner similar to the WT kinase. All measurements were done in duplicates,
error bars represent mean error.
8/8/2019 Supporting Methods and Figures 072010b
11/13
11
Supporting Figure 6. Left: linescan technique was used to quantify the size of the ingressing
furrow in GFP-Anillin cells. A line 10 pixels wide was drawn across the cleavage furrow, for each
point along the line the average intensity of the 10 pixels was calculated in MetaMorph 7.6
software resulting in a one-dimensional profile (shown here is a representative example). Right:
ingression rate was quantified in control and drug-treated (40 M) groups of 5 cells each. In 5-8
minutes, a furrow shrank from the initial diameter of 9-11 m to 1.2-1.5 m, the size of midbody.
Cells we imaged at 1 frame/min, the time points were fit linearly to calculate the ingression rate.
Average rates and mean errors are shown.
8/8/2019 Supporting Methods and Figures 072010b
12/13
12
Supporting Figure 7. Aurora B kinase activity is not required for contractile ring ingression. Top:
quantification of live imaging experiments with Anillin-GFP cell lines, time in minutes is plotted
on the horizontal axis. In small molecule-treated cells, Binucleine 2 was added at the second
minute of imaging, with a final concentration of 40 M. Groups of normally dividing cells are
color-coded in green, abnormally dividing cells in red. Bottom: representative still images from
live imaging experiments.
8/8/2019 Supporting Methods and Figures 072010b
13/13
13
Supporting Figure 8. Localization of GFP-Anillin (top row) and mCherry-Tubulin (bottom row) in
cells treated with 40 M Binucleine 2. Multipolar spindle phenotype.