www.sciencetranslationalmedicine.org/cgi/content/full/11/482/eaau8680/DC1

Supplementary Materials for

Activin type II receptor signaling in cardiac aging and heart failure

Jason D. Roh, Ryan Hobson, Vinita Chaudhari, Pablo Quintero, Ashish Yeri, Mark Benson, Chunyang Xiao, Daniel Zlotoff,

Vassilios Bezzerides, Nicholas Houstis, Colin Platt, Federico Damilano, Brian R. Lindman, Sammy Elmariah, Michael Biersmith, Se-Jin Lee, Christine E. Seidman, Jonathan G. Seidman, Robert E. Gerszten, Estelle Lach-Trifilieff,

David J. Glass, Anthony Rosenzweig*

*Corresponding author. Email: arosenzweig@partners.org

Published 6 March 2019, Sci. Transl. Med. 11, eaau8680 (2019)

DOI: 10.1126/scitranslmed.aau8680

The PDF file includes:

Fig. S1. Correlation of FSTL3 with activin, GDF8 + GDF11, and TGFβ in AS cohort. Fig. S2. Correlation of GDF8 + GDF11 and TGFβ with age and HF metrics in AS cohort. Fig. S3. Circulating GDF8 inversely correlates with age and skeletal muscle mass. Fig. S4. Increased circulating activin A induces cardiac and skeletal muscle atrophy. Fig. S5. ActRII reagents do not significantly alter blood pressure in young and old mice. Fig. S6. Supplemental GDF11 induces cardiac and skeletal muscle atrophy. Fig. S7. CDD866 increases skeletal muscle mass but not cardiac mass in old mice. Fig. S8. CDD866 reduces cardiac fibrosis-related gene expression in TAC. Fig. S9. RAP-031 prevents and rescues cardiac dysfunction in TAC. Fig. S10. Characterization of CS-ActRIIB-KO mouse. Fig. S11. Activin A effects on CM SERCA2a mRNA expression. Fig. S12. Schematic of activin-ActRII-Smurf1-SERCA2a mechanism. Table S1. Association of circulating FSTL3, activins, GDF8 + GDF11, and TGFβ with female sex. Table S2. Baseline characteristics of AS cohort phenotyped for HF. Table S3. Baseline characteristics of AS cohort phenotyped for frailty. Table S4. Baseline phenotyping of old C57BL/6 mice in GDF11 substudy. Legends for tables S5 to S7 Table S8. Primer sequences used for quantitative PCR analyses. Legends for movies S1 and S2 Legend for data file S1

Other Supplementary Material for this manuscript includes the following: (available at www.sciencetranslationalmedicine.org/cgi/content/full/11/482/eaau8680/DC1)

Table S5. Differential gene expression dataset of CMs exposed to ActRII ligands (Excel file). Table S6. List of pathways up-regulated in CMs by ActRII ligands (Excel file). Table S7. List of pathways down-regulated in CMs by ActRII ligands (Excel file). Movie S1 (.avi format). CM isolated from Ad.GFP-infected mouse. Movie S2 (.avi format). CM isolated from Ad.activin A–infected mouse. Data file S1. Primary datasets from animal and CM studies (Excel file).

Fig. S1. Correlation of FSTL3 with activin, GDF8 + GDF11, and TGFβ in AS cohort. Linear regression of

plasma FSTL3 measurements with Activin, GDF8+GDF11, and TGFβ in adults with severe aortic stenosis and

heart failure (n = 50). Circulating proteins measured with SomaLogic aptamers and displayed as log-

transformed relative fluorescence units (RFU). Protein measurements are both age- and sex-adjusted.

Fig. S2. Correlation of GDF8 + GDF11 and TGFβ with age and HF metrics in AS cohort. (A) Linear

regression of plasma GDF8+GDF11 and TGFβ measurements with age. (B) Linear regression of plasma

GDF8+GDF11 and TGFβ with NT-proBNP. (C) Linear regression and box plots displaying distribution of

plasma GDF8+GDF11 and TGFβ measurements within each NYHA class. Circulating proteins measured with

SomaLogic aptamers and displayed as log-transformed RFU. Protein measurements are sex-adjusted when

plotted against age, otherwise are both age- and sex-adjusted.

Fig. S3. Circulating GDF8 inversely correlates with age and skeletal muscle mass. (A) Plasma GDF8

concentrations in young (4-month-old, n = 6, gray) versus old (28-month-old, n = 9, red) C57BL/6 male mice.

Student’s t-test performed. *** P < 0.001. (B) Pearson correlation of plasma GDF8 concentrations with

gastrocnemius (Gas) and quadriceps (Quad) weights (normalized to tibial length, TL). (n = 15)

Fig. S4. Increased circulating activin A induces cardiac and skeletal muscle atrophy. (A) Percent change in

body weight at ~96 hours post-infection (compared to pre-infection weight). (B) Heart weight (HW) normalized

to tibia length (TL) or body weight (BW). (C) Representative images of Wheat Germ Agglutinin (WGA)-

stained myocardium (20X magnification) and quantification of cardiomyocyte (CM) cross-sectional area. ~250

CMs measured per heart. Data shown as average CM per heart. Scale bar = 50 µm. (D) Relative mRNA

expression of MAFbx and MuRF1 in explanted hearts. (E) Gastrocnemius weight (GW) normalized to TL or

BW. (F) Relative mRNA expression of MAFbx and MuRF1 in explanted gastrocnemius. (G) Relative mRNA

expression of major ActRII ligands and FSTL3 in explanted gastrocnemius. (H) Plasma GDF8 levels ~96 hours

post-infection. For all panels, n = 4/group, black = Ad.GFP, red = Ad.Activin-A, and data shown as means ±

SEM. *P < 0.05, **P < 0.01, ***P < 0.001 using Student’s t-test.

Fig. S5. ActRII reagents do not significantly alter blood pressure in young and old mice. (A) Male (6-

month-old) C57BL/6 mice were infected with Ad.GFP (n = 5, black) or Ad.Activin-A (n = 7, red). Mean

arterial pressure (MAP) measured before infection (time 0) and ~96h post-infection using a CODA non-

invasive tail cuff blood pressure system (Kent Scientific). (B) Young (4-month-old) C57BL/6 male mice treated

with isotype (n = 5, black) or CDD866 (n = 6, blue) Ab. MAP measured before treatment (time 0), 10 days, and

25 days post-treatment. (C) Old (21-23-month-old) C57BL/6 mice (mixed genders) treated with isotype (n = 4,

black) or CDD866 (n = 4, purple) Ab. MAP measured before treatment (time 0), 10 days, and 25 days post-

treatment. No significant differences detected between any groups using 2-way ANOVA with post-hoc Sidak

test.

Fig. S6. Supplemental GDF11 induces cardiac and skeletal muscle atrophy. (A) GDF11 study design. Aged

(24 mo) C57BL/6 males treated with daily i.p. injection of PBS (gray, n = 8) vs. 0.1 mg/kg Peprotech GDF11

(green, n = 8) x 28 days. 2 animals died prior to study completion. (B) Immunoblot and quantification of

relative p-Smad3 and Smad3 expression in NRVM incubated with PBS vs. GDF11 (100 ng/ml) x1 hr. n =

3/group. (C) Relative FSTL3 mRNA expression in NRVM incubated with PBS vs. GDF11 (100 ng/ml) x24 h. n

= 3/group. (D) Serial LV mass by echocardiography. 2-way ANOVA with post-hoc Tukey’s test. n = 6-

8/group/timepoint. (E) Heart weight (HW) normalized to tibia length (TL) or body weight (BW). n = 7/group.

(F) Representative images of Periodic Acid Schiff (PAS)-stained myocardium (20X) and quantification of CM

cross sectional area. ~250 CM/heart. Data shown as average CM/heart. n = 5-6/group. (G) Relative mRNA

expression of MAFbx and MuRF1 in explanted hearts. n = 5-6/group. (H) Representative images and

quantification of myocardium stained with Masson trichrome (MTS, 20X), anti-CD45 (20X), or anti-CD31

(40X). n = 5-7/group. (I) Percent change in BW (compared with pre-treatment BW). n = 7/group. (J)

Gastrocnemius weight (GW) normalized to BW. n = 7/group. Data shown as means ± SEM. Scale bars = 100

μm. Student’s t-test used, except for panel D. *P < 0.05, ** P < 0.01, *** P < 0.001.

Fig. S7. CDD866 increases skeletal muscle mass but not cardiac mass in old mice. (A-D) Old (24-month-

old) C57BL/6 males treated with weekly injections of isotype (n = 6, black) vs. CDD866 (n = 7, purple) Ab x 4

weeks. n = 6-7/group for all analyses. (A) Percent change in body weight (BW) from pre-treatment BW. (B)

Heart weight (HW) normalized to tibia length (TL) or body weight (BW). (C) Gastrocnemius weight (GW)

normalized to TL or BW. (D) Quadriceps weight (QW) normalized to TL or BW. (E-H) Old (21-23-month-old)

MHCF764L mice (mixed genders) treated x 4 weeks with isotype (n = 3, black) vs. CDD866 (n = 5, purple) Ab.

n = 3-5/group for all analyses. (E) Percent change in BW from pre-treatment BW. (F) HW normalized to TL or

BW. (G) GW normalized to TL or BW. (H) QW normalized to TL or BW. Data shown as means ± SEM. *P <

0.05, ** P < 0.01, *** P < 0.001 using Student’s t-test.

Fig. S8. CDD866 reduces cardiac fibrosis-related gene expression in TAC. (A-B) TAC prevention study

with isotype vs. CDD866 intervention. Tissue samples collected 11 weeks post-surgery. (A) Relative mRNA

expression of fibrosis related genes in explanted hearts. n = 6-9/group. 1-way ANOVA with post-hoc Tukey.

(B) Representative images of Masson trichrome stained myocardium with quantification of fibrosis. n = 3/sham

groups. n = 8-9/TAC groups. 1-way ANOVA with post-hoc Tukey. Scale bar = 1000 μm. (C-D) TAC treatment

study with isotype vs. CDD866 intervention. Tissue samples collected 11 weeks post-TAC. (C) Relative mRNA

expression of fibrosis related genes in explanted hearts. n = 5-7/group. Student’s t-test. (D) Representative

images of Masson trichrome stained myocardium with quantification of fibrosis. n = 5-7/group. Student’s t-test.

Scale bar = 1000 μm. Data shown as means ± SEM. *P < 0.05, ** P < 0.01, *** P < 0.001.

Fig. S9. RAP-031 prevents and rescues cardiac dysfunction in TAC. (A-B) Experimental protocols for (A)

TAC prevention study (Sham+Vehicle, n = 5; Sham+RAP-031, n = 5; TAC+Vehicle, n = 7; TAC+RAP-031, n

= 7) and (B) TAC treatment study (Sham+Vehicle, n = 6; Sham+RAP-031, n = 4; TAC+Vehicle, n = 8;

TAC+RAP-031, n = 10). Both studies performed in 4-month-old FVB male mice. (C-D) Serial fractional

shortening measurements by echocardiography in (C) prevention and (D) treatment studies. n = 4-10/group/

timepoint. 2-way ANOVA with post-hoc Tukey’s. Statistical analysis comparing TAC+vehicle versus

TAC+RAP-031 displayed. (E-F) Relative cardiac mRNA expression of pathologic hypertrophy gene profile in

prevention (E) and treatment (F) studies. n = 4-6/group. 1-way ANOVA with post-hoc Tukey’s. (G-H) Heart

weight (HW) and lung weight (LW) normalized to body weight (BW) in (G) prevention and (H) treatment

studies. 1-way ANOVA with post-hoc Tukey’s. n = 4-8/group. Data shown as means ± SEM. *P < 0.05, ** P <

0.01, *** P < 0.001.

Fig. S10. Characterization of CS-ActRIIB-KO mouse. (A) PCR of genomic DNA from various tissues

showing cardiac-specific recombination. Gas = gastrocnemius. Quad = quadriceps. (B) Representative

photomicrograph of myocardium stained with ActRIIB (red), Wheat Germ Agglutinin (WGA, green), and Dapi

(blue). Scale bar = 50 μm. (C) Relative mRNA expression of ActRIIB from whole heart extracts. Student’s t-

test. n = 3/group. (D) Body weight (BW). 2-way ANOVA with post-hoc Tukey’s test. n = 4/group. (E) Heart

weight (HW) normalized to tibia length (TL). 2-way ANOVA with post-hoc Tukey’s. n = 4/group. (F)

Fractional shortening by M-mode echocardiography. Student’s t-test. n = 4/group. Analyses done on 2-3-month-

old mice. Data shown as means ± SEM. *P < 0.05, ** P < 0.01, *** P < 0.001. n.s. = non-significant

Fig. S11. Activin A effects on CM SERCA2a mRNA expression. (A) Relative SERCA2a mRNA expression

in NRVMs incubated with recombinant Activin-A (0-100 ng/ml) x18 h. n = 3/group. (B) Relative SERCA2a

mRNA expression in NRVMs incubated with recombinant Activin-A (0 vs. 100 ng/ml) and CDD866 (0-100

µg/ml). Cells pre-treated with CDD866 for 6 hours prior to 18 hour incubation with Activin-A. n = 3/group.

Data shown as means ± SEM. *P < 0.05, ** P < 0.01, *** P < 0.001 using 1-way ANOVA with post-hoc

Tukey’s test. ns = non-significant

Fig. S12. Schematic of activin-ActRII-Smurf1-SERCA2a mechanism. Heart failure is associated with

increased circulating and cardiac Activin-A, which bind and activate cardiomyocyte Activin type II receptors

(ActRII). Activin-A induced ActRII signaling in cardiomyocytes upregulates expression of the E3 ubiquitin

ligase, Smurf1, which increases ubiquitination and proteasome-mediated degradation of SERCA2a protein,

resulting in impairments in calcium handling and contractility. Targeted inhibition of this process with ActRII

blocking antibodies (CDD866) increases cardiomyocyte SERCA2a content and improves cardiac function in

animal models of heart failure.

Table S1. Association of circulating FSTL3, activins, GDF8 + GDF11, and TGFβ with female sex.

Regression analyses of age-adjusted protein measurements with female sex in both Framingham Heart Study

(FHS) and aortic stenosis (AS) cohorts. In the FHS cohort, protein measurements were additionally adjusted for

individual plate. Positive slope indicates positive association with female sex. Negative slope indicates negative

association with female sex. P < 0.05 was considered significant.

Protein Slope P value

Framingham Heart Study Cohort (n = 899)

FSTL3 0.047 5.46 x 10-5

Activins 0.12 7.14 x 10-9

GDF8+GDF11 -0.15 5.61 x 10-31

TGFß 0.01 0.63

Aortic Stenosis Cohort (n = 50)

FSTL3 0.11 0.23

Activins 0.21 0.18

GDF8+GDF11 -0.144 0.024

TGFß -0.034 0.71

Table S2. Baseline characteristics of AS cohort phenotyped for HF. SOMAscan proteomic platforms were

run on plasma samples on 50 individuals with severe AS and clinical HF. Diabetes was defined as HgbA1c >

6.5%, fasting plasma glucose ≥ 126 mg/dL, or 2-hour plasma glucose ≥ 200 mg/dL during an oral glucose

tolerance test. Chronic lung disease was classified as mild (FEV1 60-75% predicted and/or on chronic

bronchodilator therapy), moderate (FEV1 50-59% predicted and/or on steroid therapy for lungs), or severe

(FEV1 < 50% or room air pCO2 > 50). Coronary artery disease was defined as prior coronary artery bypass

surgery, percutaneous coronary intervention, or any epicardial coronary vessel with > 50% stenosis on

angiogram. Peripheral vascular disease was defined as a history of claudication, amputation for arterio-vascular

insufficiency, vascular reconstruction (excluding dialysis fistula or vein stripping), abdominal aortic aneurysm,

positive noninvasive testing (e.g., ankle brachial index ≤ 0.9, imaging evidence of > 50% stenosis in any

peripheral artery), or >50% stenosis on angiographic imaging. Cardiac and valvular measurements were made

by echocardiography. No. = number. SD = standard deviation.

Baseline Characteristic n = 50

Age, mean (SD), y 73.6 (11.6)

Female, No./total No. (%) 36

Body mass index, mean (SD), kg/m2 29.7 (6.5)

Diabetes, No./total No. (%) 36

Serum creatinine, mean (SD), mg/dL 0.96 (0.26)

NT-proBNP, mean (SD), pg/mL 1899 (3576)

Chronic lung disease

Mild, No./Total No. (%)

Moderate, No./Total No. (%)

Severe, No./Total No. (%)

12

6

8

New York Heart Association (NYHA)

NYHA I, No./Total No. (%)

NYHA II, No./Total No. (%)

NYHA III, No./Total No. (%)

NYHA IV, No./Total No. (%)

22

30

42

6

Coronary artery disease, No./total No. (%) 50

Prior myocardial infarction, No./total No. (%) 14

Peripheral artery disease, No./total No. (%) 30

Left ventricular mass, mean (SD), g 230.6 (74.1)

Left ventricular ejection fraction, mean (SD), % 61.7 (12.8)

Aortic valve area, mean (SD), cm2 0.73 (0.17)

Aortic valve mean gradient, mean (SD), mmHg 45.4 (12.8)

Aortic valve peak gradient, mean (SD), mmHg 75.9 (20.2)

≥ Moderate mitral regurgitation, No./Total No. (%) 8

Table S3. Baseline characteristics of AS cohort phenotyped for frailty. FSTL3 and Activin-A ELISAs were

run on plasma samples on 43 individuals with severe AS who were phenotyped for frailty. Frailty was defined

as walk speed < 0.8 m/s and handgrip strength < 16 kg (female) or < 26 kg (male). Similar definitions for co-

morbidities (e.g. diabetes, coronary artery disease, chronic lung disease, etc) were used as outlined in table S2.

Cardiac structure, function, and valvular measurements were made by echocardiography. CABG = coronary

artery bypass graft surgery. ACE = angiotensin converting enzyme. ARB = angiotensin receptor blocker. E/e’ =

Early mitral inflow velocity(E)/mitral annular early diastolic velocity (e’) (diastolic function assessment).

KCCQ = Kansas City Cardiomyopathy Questionnaire (quality-of-life assessment). STS =Society of Thoracic

Surgeons (perioperative risk assessment). Student’s t-test used. P < 0.05 was considered significant. No. =

number. SD = standard deviation.

Baseline Characteristic Not Frail

(n = 22)

Frail

(n = 21)

P-value

Age, mean (SD), y 76.5 (9.9) 79.5 (6.4) 0.24

Female, No./total No. (%) 45 43 0.87

Body mass index, mean (SD), kg/m2 27.6 (5.6) 30.1 (4.7) 0.11

Diabetes, No./total No. (%) 45 48 0.89

Serum creatinine, mean (SD), mg/dL 1.36 (0.78) 1.24 (1.05) 0.67

Hemoglobin, mean (SD), % 12.6 (1.2) 11.8 (1.5) 0.05

≥ Moderate chronic lung disease, No./Total No (%) 57 32 0.10

≥ NYHA III/IV, No./Total No. (%) 82 90 0.34

Coronary artery disease, No./total No. (%) 95 76 0.08

History of CABG, No./total No. (%) 32 48 0.30

History of atrial fibrillation, No./total No. (%) 45 38 0.63

Peripheral artery disease, No./total No. (%) 52 52 1.0

Medications

Aspirin, No./total No. (%)

Beta blocker, No./total No. (%)

ACE inhibitor or ARB, No./total No. (%)

Aldosterone antagonist, No./total No. (%)

Loop diuretic, No./total No. (%)

68

73

64

5

63

81

57

29

10

67

0.35

0.30

0.02

0.54

0.84

LV mass, mean (SD), g 241.5 (84.4) 226.7 (54.2) 0.51

LV ejection fraction, mean (SD), % 49.9 (17.9) 53.7 (17.3) 0.49

LV global longitudinal strain, mean (SD), % -11.5 (2.2) -12.0 (3.3) 0.67

E/e’, mean (SD) 18.8 (10.5) 19.3 (10.0) 0.88

Aortic valve area, mean (SD), cm2 0.73 (0.14) 0.69 (0.12) 0.32

Aortic valve mean gradient, mean (SD), mmHg 36.8 (9.2) 37.0 (12.1) 0.95

Aortic valve peak gradient, mean (SD), mmHg 60.3 (12.2) 59.9 (18.7) 0.94

≥ Moderate mitral regurgitation, No./Total No. (%). 11 23 0.39

KCCQ score, mean (SD) 58.6 (24.1) 37.8 (19.7) 0.005

STS score, mean (SD) 7.0 (4.5) 10.3 (7.0) 0.07

Five meter walk time, mean (SD), sec 5.12 (0.66) 13.4 (9.8) 0.0009

Handgrip strength, mean (SD), kg 26.1 (5.25) 13.9 (6.4) 4.8x10-8

Table S4. Baseline phenotyping of old C57BL/6 mice in GDF11 substudy. Sixteen old (24-month-old)

C57BL/6 male mice were matched according to body weight, resting cardiac function [% fractional shortening

(FS)], left ventricular (LV) mass (by M-mode cubic method), exercise capacity, and cardiac reserves prior to

assigning to PBS (control) versus GDF11 interventions. Data shown as mean ± SEM. Student’s t-test used. P <

0.05 was considered significant.

Parameter PBS

(n = 8)

GDF11

(n = 8)

P value

Baseline features Gender Male Male NA

Age (months) 24 24 NA

Body weight (g) 36.94 ± 0.82 37.93 ± 1.77 0.37

Cardiac function

(at rest)

% FS (by echo) 54.8 ± 0.76 55.1 ± 1.26 0.90

LV mass (by echo) 135.8 ± 7.0 132.5 ± 4.6 0.76

Exercise capacity Peak lactate (mM) 8.30 ± 0.50 8.28 ± 0.38 0.97

Distance (meters) 188.6 ± 9.7 191.8 ± 12.8 0.93

Work (Joules) 11.97 ± 0.68 12.07 ± 0.65 0.92

Cardiac function

(at peak exercise)

Peak HR (bpm) 696 ± 8 689 ± 10 0.59

% FS augmentation 0.99 ± 2.38 1.31 ± 1.85 0.92

Table S5. Differential gene expression dataset of CMs exposed to ActRII ligands (Excel file). Isolated

NRVMs were incubated with 100 ng/ml of recombinant Activin-A, GDF11, or GDF8 for 18 hours. n = 3/group.

All groups are compared to a control group with no ligand exposure. Differential expression for each gene

displayed as log2(FC) with its adjusted P value after Benjamini-Hochberg correction for multiple hypotheses

testing.

Table S6. List of pathways up-regulated in CMs by ActRII ligands (Excel file). List of all significantly

upregulated pathways (using a false discovery rate (FDR) < 0.25) in NRVMs exposed to 100 ng/ml of

recombinant Activin-A, GDF11, or GDF8 for 18 hours. n = 3/group. All groups are compared to a control group

with no ligand exposure. The KEGG database was used for gene set enrichment analysis. For each pathway, the

enrichment score (E.S.) and FDR adjusted P value are presented for each ligand group.

Table S7. List of pathways down-regulated in CMs by ActRII ligands (Excel file). List of all downregulated

pathways (using a false discover rate (FDR) < 0.25) in NRVMs exposed to 100 ng/ml of recombinant Activin-

A, GDF11, or GDF8 for 18 hours. n = 3/group. All groups are compared to a control group with no ligand

exposure. The KEGG database was used for gene set enrichment analysis. For each pathway, the enrichment

score (E.S.) and FDR adjusted P value are presented for each ligand group.

Table S8. Primer sequences used for quantitative PCR analyses.

Gene Forward Reverse

RPS18 catgcagaacccacgacagta cctcacgcagcttgttgtcta

FSTL3 ctgcctaccatgcaaagattc cggtacatgacgcgcaggt

Activin-A gatgtgcggattgcttgtga tcttcttgcccaggagcacta

GDF8 agtggatctaaatgaggacagt ggagtaccttgtgttttgtctc

GDF11 ctgcgcctggagagcatcaag tctcggtggtagcgtggta

ANP gagcaaatcccgtatacagtgc atcttctaccggcatcttctcc

BNP gctgctggagctgataagagaa gttcttttgtagggccttggtc

αMHC acatcagtcagcagaaca ttcctctagcctctcact

βMHC gctgttattgctgccatt ttatcattccgaactgtc

MAFbx cagcttcgtgagcgacctc ggcagtcgagaagtccagtc

MuRF1 gtgtgaggtgcctacttgctc gctcagtcttctgtccttgga

Smurf1 agcatcaagatccgtctgaca ccagagccgtccacaacaat

SERCA2a gagaacgctcacacaaagacc caattcgttggagccccat

CTGF gggtctcttctgcgacttc atccaggcaagtgcactggta

COL1A1 gctcctcttaggggccact ccacgtctcaccattaggg

TGFβ aagaagtcacccgcgtgcta tgtgtgatgtctttggttttgtca

ActRIIB ggctgctggctagatgactt tacacctgggggttctcct

Movie S1. CM isolated from Ad.GFP-infected mouse.

Movie S2. CM isolated from Ad.activin A–infected mouse.

Data file S1. Primary datasets from animal and CM studies (Excel file).