Supplementary Information A de novo gain-of-function mutation in SCN11A causes loss of pain perception

Enrico Leipold1, Lutz Liebmann2, G. Christoph Korenke3, Theresa Heinrich2, Sebastian Gießelmann2, Jonathan Baets4,5,6, Matthias Ebbinghaus7, R. Oliver Goral1, Tommy Stödberg8, J. Christopher Hennings2, Markus Bergmann9, Janine Altmüller10, Holger Thiele10, Andrea Wetzel11, Peter Nürnberg10,12,13,14, Vincent Timmerman4,15, Peter De Jonghe4,5,6, Robert Blum11, Hans-Georg Schaible7, Joachim Weis16, Stefan H. Heinemann1, Christian A. Hübner2 & Ingo Kurth2 1Center for Molecular Biomedicine, Department of Biophysics, Friedrich Schiller University Jena & Jena University Hospital, Jena, Germany 2Institute of Human Genetics, Jena University Hospital, Jena, Germany 3Department of Neuropediatrics, Pediatric Center, Oldenburg Hospital, Oldenburg, Germany 4Neurogenetics Laboratory, Institute Born-Bunge, University of Antwerp, Antwerp, Belgium 5Neurogenetics Group, Department of Molecular Genetics, VIB, University of Antwerp, Antwerp, Belgium 6Department of Neurology, Antwerp University Hospital, Antwerp, Belgium 7Institute of Physiology I / Neurophysiology, Jena University Hospital, Jena, Germany 8Department of Neuropediatrics, Karolinska University Hospital, Stockholm, Sweden 9Institute for Neuropathology, Hospital Bremen-Mitte, Bremen, Germany 10Cologne Center for Genomics (CCG), University of Cologne, Cologne, Germany 11Institute for Clinical Neurobiology, University of Würzburg, Würzburg, Germany 12Cologne Excellence Cluster on Cellular Stress Responses in Aging-Associated Diseases (CECAD), University of Cologne, Cologne, Germany 13ATLAS Biolabs GmbH, Berlin, Germany 14Center for Molecular Medicine Cologne (CMMC), University of Cologne, Cologne, Germany 15Peripheral Neuropathy Group, Department of Molecular Genetics, VIB, University of Antwerp, Antwerp, Belgium. 16Institute of Neuropathology, RWTH Aachen University Hospital and JARA Brain Translational Medicine, Aachen, Germany Corresponding Author: Ingo Kurth ingo.kurth@med.uni-jena.de

Nature Genetics: doi:10.1038/ng.2767

Supplementary Fig. 1 Generation of Scn11a+/L799P knockin mice. (a) Genomic structure of the mouse Scn11a locus (top). Dashed gray line represents the extent of the homology region of the targeting construct. A neomycin selection cassette (Neo) flanked by loxP sites (gray arrowheads) was inserted into intron 15 (middle). The missense mutation p.L799P (green asterisk), corresponding to human p.L811P, was introduced by PCR-based mutagenesis (c.2396T, NM_011887.3). Correctly targeted ES-cell clones were identified by two independent long-range PCRs (LR1/LR2 and LR3/LR4, for primer sequences see Supplementary Table 1), each with one primer outside of the targeting vector to verify homologous integration at the Scn11a locus. The 6.1-kb product (green) was sequenced to confirm the presence of the point mutation. Chimeric mice derived from the ES-cell clones were mated with cre-deleter mice to remove the Neo cassette (bottom). (b) Verification of homologous integration in ES-cell derived DNA (asterisk) by long-range PCR. (c) Sequence of the LR3/LR4 amplicon in DNA from ES cells. (d) Verification of the three genotypes from genomic DNA derived from tissue samples of the mice by direct sequencing

!"#! $%&!

E16 E17 E15 E18 E19 E1 E27

E16 E17 E15 E18 E19 E1 E27

"

"Neo

targeting vector

homologous recombination

E16 E17 E15 E18 E19 E1 E27

"

3.7 kb l

cre expression 3.7 kb

3.7 kb

6.1 kb

6.1 kb

"

a

b c

d

LR1

LR2 LR3 LR4LR1

LR2 LR3 LR4

ES-cell clone

+/L799P L799P/L799P Scn11a

+/+

Supplementary Fig. 1

Scn11a Scn11a

Nature Genetics: doi:10.1038/ng.2767

Supplementary Fig. 2 Expression analysis in knockin mice. (a) mRNA was prepared from isolated DRGs (indicated) from mice of each genotype. cDNA libraries were generated followed by a Scn11a locus-specific PCR. Primer “a” is located in exon 14, “b” is located 3´ of the p.L799P-mutation (red bar), “c” is located 5´ of the mutation, “d” is located in exon 20. Exons that were replaced by homologous recombination are shown in blue (E15-E19), flanking exons in green (E14, E20). (b) Sequencing of the amplicons from PCRs with a/b and c/d confirmed the presence of the L799P mutation in the genotypes as expected. No additional mutation in E15-E19 was present as compared to the reference sequence (NM_011887.3), and E14-E20 were correctly spliced (not shown). For primer sequences see Supplementary Table 1. (c) Transcript abundance assayed using quantitative real-time PCR, normalized to Hprt expression and shown as an x-fold change compared to the wild-type abundance (Scn11a+/+: 1.0 ± 0.12). Note that the mRNA levels for Scn11a in DRGs from Scn11a+/L799P mice are decreased by roughly 50% (0.51 ± 0.06), but do not decrease further in homozygous knockin animals (Scn11aL799P/L799P: 0.62 ± 0.14). Thus, this might rather indicate transcriptional regulation of Scn11a in the presence of the mutant and not decreased expression of the mutant allele. Value for Scn11a–/–: 0.14 ± 0.04. Values are means ± SEM (n = 5 animals per genotype).

E14 E15 E16 E17 E18 E19 E20

Scn11a transcriptL799P

a

dc

b

Scn11a +/L799P

Scn11a L799P/L799P

Scn11a +/+

Dorsal root ganglion (DRG)

mRNA

a

b

Skin

0.6

0.4

0.2

0.0

+/+

+/L799P

L799P/L799P

0.8

1.0

Fold

cha

nge

c

Scn11a

/

Nature Genetics: doi:10.1038/ng.2767

Supplementary Fig. 3 Histological analysis of wild-type and knockin mice. (a-b) Semithin section of the sensory nerve distal to L4 comparing Scn11a+/+ and Scn11a+/L799P mice. Scale bar, 15 µm. (c-d) Anti-PGP9.5 staining in the skin of Scn11a+/+ and Scn11a+/L799P mice did not show aberrant innervation of small fibers in the epidermis of knockin mice. Blue: DAPI; dotted line marks the Stratum corneum. Scale bar, 15 µm.

PGP9.5 DAPI

PGP9.5 DAPI

Scn11a+/+

Scn11a+/L799P

c d

a b

Nature Genetics: doi:10.1038/ng.2767

Supplementary Fig. 4 Current-voltage relationships. (a) Superposition of representative current traces obtained from DRG neurons of the indicated mouse strains using extracellular solutions with 500 nM tetrodotoxin (TTX) and 100 µM Cd2+ to block TTX-sensitive sodium channels and calcium channels, respectively. Holding voltage was –127 mV and test pulses ranged between –107 and –27 mV. Only traces from voltages up to –67 mV (colored) were used for the analysis of NaV1.9 currents (see Fig. 4) because NaV1.8 channels start to activate at stronger depolarization. (b) Peak currents from the same traces shown in (a) as a function of test voltage; filled data points correspond to colored sweeps in (a) and represent the NaV1.9-specific current component; straight lines connect the data points.

Nature Genetics: doi:10.1038/ng.2767

name sequence (5´- 3´)

long-range PCRs

LR1 tcctacttgcctgtgtctc LR2 acgtgctacttccatttgtc LR3 tgttgggagagagcaggaag LR4 ccctttccttacctccctct

genotyping

geno-for gcagtccccatcaaaattcc geno-rev gaatcgatcctagagaattccg

qPCR

Scn11a-for cccttgtgagtctcgctgac Scn11a-rev ggagtggccgatgatcttaaat Hprt-for gttctttgctgacctgctgga Hprt-rev tcccccgttgactgatcatt

cDNA analysis

a gtgctcttccacaaactgtc b gttttgcctcctgcatctc c tgcttaacctcttcattgcc d cacccacttcaaaatcatttcc

Supplementary Table 1. Primer sequences.

Nature Genetics: doi:10.1038/ng.2767