ACTAUNIVERSITATIS

UPSALIENSISUPPSALA

2016

Digital Comprehensive Summaries of Uppsala Dissertationsfrom the Faculty of Medicine 1195

Studies of Spotted Fever Rickettsia -Distribution, Detection, Diagnosisand Clinical Context

With a Focus on Vectors and Patients in Sweden

KATARINA WALLMÉNIUS

ISSN 1651-6206ISBN 978-91-554-9512-1urn:nbn:se:uu:diva-280667

Dissertation presented at Uppsala University to be publicly examined in Hörsalen, KliniskMikrobiologi, Akademiska sjukhuset, Ing D1, Dag Hammarskjöldsväg 17, Uppsala,Wednesday, 4 May 2016 at 09:15 for the degree of Doctor of Philosophy (Faculty ofMedicine). The examination will be conducted in Swedish. Faculty examiner: ProfessorFredrik Elgh (Umeå University, Faculty of Medicine).

AbstractWallménius, K. 2016. Studies of Spotted Fever Rickettsia - Distribution, Detection,Diagnosis and Clinical Context. With a Focus on Vectors and Patients in Sweden. DigitalComprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 1195.77 pp. Uppsala: Acta Universitatis Upsaliensis. ISBN 978-91-554-9512-1.

The spotted fever rickettsia, Rickettsia helvetica, is an endemic tick-borne bacteria in Sweden. Itcauses infections in humans, manifested as aneruptive fever, headache, arthralgia and myalgia,and sometimes an inoculation eschar or a rash. There have also been two known cases of humaninfections with R. felis in Sweden.

The present thesis starts by investigating dispersal of ticks and Rickettsia spp. by migratingbirds flying from Africa to Europe. Almost 15,000 birds were searched and 734 ticks collected,mainly of the species Hyalomma marginatum complex. Almost half (48%) of the ticks wereinfected with Rickettsia spp., 96% of which was R. aeschlimannii, the remaining R. africae andundefined species.

The next study focused on questing ticks over a large area in Sweden and determining theprevalence of Rickettsia spp., Anaplasma spp. and Coxiella burnetii. Rickettsia spp. was foundin 9.5-9.6% of the ticks and A. phagocytophilum in 0.7%; no C. burnetii was found.

The last three papers in the thesis focused on the clinical presentation of rickettsiosis,the symptoms associated with the infection in general and particularly in patients withneurological complications. A tick-exposed population in Sweden was investigated to gain abetter understanding of symptoms due to rickettsioses, also in relation to co-infections with othertick-borne bacteria. Based on symptoms, it was not possible to distinguish what pathogen causedthe infections. Most patients had erythema migrans, some had serological reactions to Rickettsiaspp., Borrelia spp. or co-infections by Rickettsia spp., Borrelia spp. and/or Anaplasma spp. Inthe fourth and fifth papers, we found associations between antibodies against Rickettsia spp.and sudden deafness (in 10-24% of patients) and facial nerve paralysis (in 8.3-25% of patients).In three patients R. felis was detected in the cerebrospinal fluids.

Briefly, the thesis helps to clarify our knowledge about tick dispersal, shows a narrowerprevalence estimate of Rickettsia spp. in Swedish ticks, and illuminates symptoms ofrickettsioses and co-infections with other tick-borne infections. It also shows that presenceof erythema migrans may be explained by more than Lyme disease and indicates a possibleassociation between rickettsiosis and sudden deafness and facial nerve paralysis.

Keywords: tick-borne infections, co-infections, ticks, Ixodes ricinus, zoonosis, Rickettsiahelvetica, migrating birds, Bell’s pares, erythema migrans, Rickettsia aeschlimannii, suddendeafness, facial nerve paralysis, Hyalomma marginatum, Rickettsia africae, western blot,PCR, serology

Katarina Wallménius, Department of Medical Sciences, Akademiska sjukhuset, UppsalaUniversity, SE-75185 Uppsala, Sweden.

© Katarina Wallménius 2016

ISSN 1651-6206ISBN 978-91-554-9512-1urn:nbn:se:uu:diva-280667 (http://urn.kb.se/resolve?urn=urn:nbn:se:uu:diva-280667)

In nature there are neither rewards norpunishments; there are only conse-quences

Robert Green Ingersoll

Stop bugging me…

List of Papers

This thesis is based on the following papers, which are referred to in the text by their Roman numerals.

I Wallménius K., Barboutis C., Fransson T., Jaenson T.G.T.,

Lindgren P-E., Nyström F., Olsen B., Salaneck E., Nilsson K. (2014) Spotted fever Rickettsia species in Hyalomma and Ix-odes ticks infesting migratory birds in the European Mediterra-nean area. Parasites & Vectors, 10(7):318

II Wallménius K.*, Pettersson J.H.-O.*, Jaenson T.G.T., Nilsson K. (2012) Prevalence of Rickettsia spp., Anaplasma phago-cytophilum, and Coxiella burnetii in adult Ixodes ricinus ticks from 29 study areas in central and southern Sweden. Ticks and Tick-borne Diseases, 3(2):100-106

III Lindblom A.*, Wallménius K.*, Norberg M., Forsberg P., Eli-

asson I., Påhlson C., Nilsson K. (2013) Seroreactivity for spot-ted fever rickettsiae and co-infections with other tick-borne agents among habitants in central and southern Sweden. Euro-pean Journal of Clinical Microbiology, 32(3):317-23

IV Nilsson K., Wallménius K., Hartwig S., Norlander T., Påhlson

C. (2014) Bell’s palsy and sudden deafness associated with Rickettsia spp. infection in Sweden. A retrospective and pro-spective serological survey including PCR findings. European Journal of Neurology, 21(2):206-214

V Wallménius K., Påhlson C., Nilsson K. Immunofluorescence and Western Blot analysis for presence of antibodies against Rickettsia spp. and Borrelia spp. in serum from patients diag-nosed with peripheral facial palsy. A retrospective serological survey. Preliminary manuscript

*Authors have contributed equally and share first authorship.

Reprint of Paper II was made with permission from Elsevier GmbH.

Related Papers

Nilsson K., Wallménius K., Påhlson C. (2011) Coinfection with Rickettsia helvetica and Herpes Simplex Virus 2 in a Young Woman with Meningoen-cephalitis. Case Rep Infect Dis. doi: 10.1155/2011/469194

Madsen K., Wallménius K., Fridman Å., Påhlson C., Nilsson K. Uveitis associated with Rickettsia species infection in Sweden. A prospective sero-logical survey. Submitted

Contents

Introduction ................................................................................................... 11 Emerging zoonotic infections ................................................................... 11

Tick-borne infections in humans ......................................................... 13 Rickettsia .................................................................................................. 14

Genetic characteristics ......................................................................... 14 Vectors ................................................................................................. 16 Reservoirs ............................................................................................ 19 Distribution .......................................................................................... 21 Rickettsioses ........................................................................................ 24 Rickettsia helvetica .............................................................................. 28 Rickettsia felis ...................................................................................... 29 Diagnostic tools ................................................................................... 30 Treatment ............................................................................................. 34

Aims .............................................................................................................. 36

Material and methods .................................................................................... 37 Samples .................................................................................................... 37 DNA analysis ........................................................................................... 38 Serological methods ................................................................................. 42

Results and discussion .................................................................................. 45 Migrating birds as carriers of ticks infected with Rickettsia species over large geographical distances ............................................................. 45 Prevalence of Rickettsia spp. and Anaplasma spp. in Ixodes ricinus ticks in Sweden ......................................................................................... 47 Seroreactivity for spotted fever rickettsia and co-infections with other tick-borne agents among tick exposed people in central and southern Sweden ..................................................................................................... 48 Bell’s palsy and sudden deafness may be associated with rickettsiosis in some patients ........................................................................................ 50

Concluding remarks ...................................................................................... 52

Acknowledgments......................................................................................... 54

Sammanfattning på svenska .......................................................................... 56

References ..................................................................................................... 59

Abbreviations

17kDa 17 kilo Dalton surface antigen bp base pair BLAST Basic local alignment search tool CCHF Crimean-Congo hemorrhagic fever DEBONEL Dermacentor-borne necrosis erythema lymphadenopa-

thy DMEM Dulbecco’s modified Eagle’s medium DNA Deoxyribonucleic acid ELISA Enzyme-linked immunosorbent assay EM Erythema migrans EMEM Eagle’s minimum essential medium FBS Foetal bovine serum FNP Facial nerve palsy gltA Citrate synthase gene IFA Immunofluorescence assay IgG Immunoglobulin G IgM Immunoglobulin M LAR Lymphangitis-associated rickettsiosis LPS Lipopolysaccharide OmpA Outer membrane protein A OmpB Outer membrane protein B PBS Phosphate buffered saline PCR Polymerase chain reaction RF Rheumatoid factor RT-PCR Reverse transcriptase polymerase chain reaction SDS-PAGE Sodium dodecyl sulphate polyacrylamide gel electro-

phoresis SFG Spotted fever group s.l. Sensu lato sp. Species, singular spp. Species, plural TBE Tick-borne encephalitis TBEV Tick-borne encephalitis virus TG Typhus group

Introduction

The bacterial genus Rickettsia is among the oldest known arthropod-borne diseases, recognized since the end of the 19th century (1,2). Additionally, Rickettsia contains some of the most recently described infections (3).

The genus is named after Howard Taylor Ricketts who, in 1906, de-scribed the transmission of Rocky Mountain spotted fever (RMSF) by the tick, Dermacentor occidentalis (4). The agent of RMSF was later identified and named Rickettsia rickettsii.

Originally Rickettsia was classified as a virus or an organism somewhere between viruses and bacteria (2). Much later, it was established to be an intracellular bacteria (5,6).

Despite the early recognition of the diseases caused by Rickettsia and lat-er the pathogen itself, many of the species are labelled as agents causing emerging, re-emerging and/or neglected infections. The apparent increase of infections caused by Rickettsia spp. may have a number of explanations: changes in factors concerning the environment, vegetation and the increased movement of humans and animals. It may also be explained by the previous lack of knowledge owing to difficulties studying intracellular bacteria, the fact that the general symptoms of infections with Rickettsia spp. make them difficult to distinguish from other infections, as well as the possible changes in prevalence of other infectious diseases (7–10).

Though more knowledge is available today, the whole picture is still far from clear regarding Rickettsia, and more knowledge is needed if we are to be able to monitor emerging species, perform accurate and prompt diagnoses and develop better tools to study the bacteria and their pathological effects on humans and animals.

The first documentation of Rickettsia spp. (Rickettsia helvetica) in Swe-dish ticks occurred 20 years ago (11), since then awareness of the risk of infection for humans and wild and domestic animals has increased. Still, in Sweden, rickettsioses have not received anywhere near the public recogni-tion Lyme borreliosis and tick-borne encephalitis (TBE) have.

Emerging zoonotic infections A zoonosis is an infection caused by viruses, bacteria, protozoa, helminths or fungi that is spread between animals and humans (here the term zoonosis is

11

referring to infections spreading from animals to humans (12)). Of all known human infections, 61% are classified as zoonoses (13), for example: avian influenza, campylobacteriosis, salmonellosis, Ebola, dengue fever, toxo-plasmosis, and bovine spongiform encephalopathy (BSE). Together they have a great impact on both human and animal health, and large economic consequences (14,15).

Among the zoonoses many are vector-borne infections, which mean they need a vector to spread from animals to humans. A vector is usually an in-sect or an arachnoid. The most common vectors are mosquitoes and ticks, but fleas, lice, mites, flies or leeches can also be vectors.

Many Rickettsia spp. are emerging zoonotic infections. Since 1984 the number of defined pathogenic Rickettsia spp. has increased greatly, from R. prowazekii, R. typhi, R. rickettsii, R. conorii, R. akari, R. sibirica and R. australis to more than 20 species, with many still waiting to be defined as new strains or proven to be pathogenic species (3,16–18). WHO, together with Food and Agriculture Organization and World Organisation for Animal Health, defines an emerging zoonosis as “a zoonosis that is newly recog-nized or newly evolved, or that has occurred previously but shows an in-crease in incidence or expansion in geographical, host or vector range” (19). Among the emerging infections, 75% are estimated to be zoonoses, and zo-onoses from wildlife are predicted to be the most serious, growing threats to global health of all the emerging infectious diseases (13,20). The emergence of Rickettsia spp. may be due to climate changes, reforestation or deforesta-tion, urbanization, movement of host animals and other factors affecting tick survival, behaviour and habitats (20–23). Another possible explanation for emerging rickettsioses is the growing awareness of such infections. For in-stance, the successful reduction of malaria transmission, better treatment coverage and diagnostics have revealed the occurrence of other febrile ill-nesses in need of attention (8,24–27). The constant advancement of biomed-ical research tools also contributes to increasing our knowledge about patho-gens and the infections they cause, and it enables definition of new species (28).

Both researchers aiming to explain future trends in infectious diseases and agencies trying to prevent emerging infections from having devastating con-sequences face many challenges (20,29). In order to control emerging zoon-oses, with proper monitoring and tools to combat a rising threat, a “one health” approach could be beneficial in dealing with these complex issues. This would entail researchers and professionals in the veterinary, ecological, climatologic, agricultural and medical sciences working together with politi-cians and policymakers, and doing so in all parts of the world (21,30,31).

12

Tick-borne infections in humans Ticks can transmit a number of different types of pathogens – bacteria, vi-ruses and protozoa – and they are present in most geographical areas over the world. Ticks are the second most disease spreading group of arthropods after mosquitoes. Although ticks transmit a wider variety of pathogens, the total damage and severity of damage caused by mosquito-borne pathogens are greater (32).

In Europe, the sheep tick, Ixodes ricinus, is the most widespread tick spe-cies, distributed from northern Africa to northern Scandinavia. In Europe, it is also the most important tick-vector for the spread of several pathogens like Borrelia burgdorferi sensu lato complex, tick-borne encephalitis (TBE) vi-rus, Babesia spp., and among the Rickettsiales, Anaplasma phagocytophi-lum, “Candidatus Neoehrlichia mikurensis”, R. helvetica and R. monacensis. R. conorii and Bartonella spp. are thought to be spread by I. ricinus, and Francisella tularensis, the agent of tularaemia, and Coxiella burnetii, the agent of Q-fever, have both been detected in I. ricinus (21,33,34). However, Q-fever is most often an infection contracted by aerosol dissemination from contact with infected animal tissue at the lambing or slaughter of sheep or other farm animals (35).

One of the most widely spread and important human tick-borne viruses is the Crimean-Congo haemorrhagic fever virus. It causes a mild to severe disease and occurs in Africa, Asia and southern Europe. The main vectors are ticks of the genus Hyalomma (36).

Figure 1. Scanning electron micrograph (SEM) of an Ixodes ricinus nymph; natural body length 1.5 mm. Photo and Copyright © Gary Wife & Thomas G.T. Jaenson, Uppsala University.

13

Rickettsia Rickettsia are Gram-negative pleomorphic coccobacilli -proteobacteria. Like a few other bacteria pathogenic to humans (Chlamydia, Coxiella, Anaplasma and Mycobacterium leprae), Rickettsia spp. are strictly intracellular bacteria. This affects the analysis methods available, because cultivation must take place in living cells and cannot be carried out on agar plates or in broth (37–40). The bacteria are small, 1.5-2 μm in length and 0.3-0.7μm in diameter, and have a typical Gram-negative cell wall on the outside of a thin cytoplasmic membrane. Outside the cell wall is a slime layer or capsule built up by lipopolysaccharide, characterized as a halo around the bacterium when imaged by electron microscopy. Rickettsia spp. multiply by transverse binary fission, and when the bacteria are starved the division is halted and the bacteria become abnormally long rods (6,41,42).

Figure 2. Rickettsia helvetica intracellular and intranuclear growth in Vero cells (left image). Close up on several R. helvetica (right image). Imaged by transmission electron microscopy.

Genetic characteristics The genus Rickettsia belongs to the order Rickettsiales and the family Rick-ettsiaceae, and is further divided into four groups containing more than 30 defined species and subspecies. Previous classification in groups was based on type of vector and antigenic properties, but since the breakthrough of molecular methods, the classification has also been based on genetic traits. The largest group is the spotted fever group (SFG), named after the rash seen in RMSF. The SFG includes R. aeschlimannii, R. africae, R. akari, R. rick-ettsii, R. conorii, R. helvetica, R. felis, R. slovaca, R. sibirica, R. monacensis, R. japonica, R. massiliae, R. montanensis, R. australis, R. peacockii, R. phil-ipi and R. parkeri. The typhus group (TG) contains the two species R.

14

prowazekii, the causative agent of louse-borne epidemic typhus, and R. typhi, the causative agent of flea-borne endemic typhus. There are also the Rickettsia belli group and the Rickettsia canadensis group, including only one species each (18,28,43). Rickettsia has a small genome, spanning from 1.1 Mb to 2.1 Mb over the genus, the smallest being R. typhi and the largest “Rickettsia endosymbiont of Ixodes scapularis” (18,44). Rickettsia DNA has a low G+C content (29-33%) with an approximately 75% coding sequence (28,45–47). The genome seems to be in constant reduction, as the intracellu-lar lifestyle enables use of the host cell machinery and it is possible that re-dundant genes are degraded. This is thought to reduce the bacteria’s fitness in relation to their arthropod host and to cause them to become more virulent for both arthropods and humans. The underlying mechanism is still un-known, but has been suggested to involve loss of regulatory genes (46–48).

In 2005, the first rickettsial plasmid was discovered in R. felis (49). Since then, the number of Rickettsia spp. reported to have plasmids has increased rapidly, including R. helvetica, R. monacensis, R. massiliae, R. akari and R. africae (47,50–53). However, high passaged strains might lose their plas-mids, which could explain the long-held belief that Rickettsia spp. lack plasmids. The plasmids are thought to code for a type IV secretion system, a heat chock protein and an antigenic cell surface protein. Plasmids could be an explanation for the genetic diversity and adaptability of the genus, despite rickettsia’s reduced genome (49–51,53).

When 16S rRNA sequencing was starting to be used as a tool for phylo-genetical studies of bacteria, many of the species previously included in the Rickettsiales could be reclassified. Nevertheless, the genus Rickettsia could not be divided into species due to its highly similar 16S rRNA sequence (54,55). The common approach to differentiating species among the rickett-siae is instead to perform multi-locus sequencing including at least five genes. Fournier et al. (56) established the criteria of sequencing the genes coding for outer membrane protein A (ompA) and B (ompB), the citrate syn-thase (gltA), gene D encoding the PS120 protein and the 16S rRNA (rrs). Later the 17kDa protein gene has also been included to the list of suitable genes for rickettsiae differentiation (55–62).

It has been thought that R. helvetica, like the members of the TG, lack OmpA, as no PCR product can be amplified with primers that amplify ompA for other Rickettsia spp. (60), although specific monoclonal antibodies against OmpA have shown specific reactions to a 145 kDa band in Western blot, where the same antibody specifically reacted to a 190 kDa band in R. rickettsii. These results indicate a smaller OmpA in R. helvetica which could explain the inability to amplify this gene with primers universal for the ge-nus ompA (34).

15

Figure 3. Schematic overlook of the order Rickettsiales, with a focus on the Rickett-sia spp. TG= typhus group, SFG= spotted fever group. The R. akari cluster also includes R. felis and R. australis. The R. helvetica cluster includes R. asiatica and R. tamurae, in the R. massiliae cluster R. aeschlimannii, R. raoultii, R. rhipicephali and R. montanensis are included. And included in the R. rickettsii cluster are R. conorii, R. japonica, R. africae, R. peacockii, R. honei, R. parkeri, R. sibirica, R. slovaca and R. heilongjiangensis. Image is based on, Fournier and Raoult 2009, Dumler et al. 2001 and Tamura et al. 1995 (54,63,64).

Today many of the Rickettsia spp. have been whole genome sequenced, which has led to a vast amount of data not only on protein coding genes, but also on all genetic information including the discovery of plasmids. This new genomic era has a huge potential, though there is a lot of work to be done before the information can be used to unravel the complete genetic relationship as well as the different characteristics of the Rickettsia spp. (28).

Vectors Except for the two closely related R. felis and R. akari, which are transmitted by the cat flea (Ctenocephalides felis) and the house-mouse mite (Lipony-ssoides sanguineus), respectively, the main vectors of SFGR are ticks (65–67).

All vectors of Rickettsia spp. – ticks, fleas, mites and lies – are hematoph-agous ectoparasites. The vectors are included in the phylum arthropods. Ticks and mites belong to the class Arachnid, subclass Acari; fleas and lice are insects (Hexapoda). Ticks spend most, >90%, of their lives separated from their hosts, but different species spend their time very differently, some living freely in nature, others living within or close to their hosts’ nests and habitats, all depending on their host-seeking strategy. The house-mouse mite (the vector of R. akari) feed from their hosts at night and hide close to the

16

host during daytime, while the cat flea (the vector of R. felis) and most lice spend their whole lives on a single host (32,68–70).

There are around 900 defined tick species in three families: the Ixodidae (hard-bodied ticks) including almost 700 species, the Argasidae (soft-bodied ticks) and the Nuttalliellidae, representing only one species, Nuttalliella na-maqua distributed in eastern and southern Africa (32,71,72).

The SFGR and many of the tick-borne pathogens are transmitted by ticks in the Ixodidae family, which is divided further into two groups, the Metastriata with 11 genera (e.g., Hyalomma, Haemaphysalis, Rhipicephalus, Dermacentor and Amblyomma) and the Prostriata with the single genus Ix-odes (32).

The Ixodidae ticks have four life stages: the egg and the three active stag-es larva, nymph and adult. When ticks feed from a host animal in the active stages, the blood meal enables them to moult into the next stage in their life cycle, or enables the females to lay eggs. Most Ixodidae ticks are three-host ticks, meaning they drop off the host after feeding, moult into a new stage and then quest for a new host for their next blood-meal. Some ticks, like the Hyalomma marginatum complex, are two-host ticks and can moult into a new stage on the host and then re-attach for a second blood-meal (32).

Figure 4. The four developmental stages of Ixodidae ticks, the females often lay thousands of eggs but it varies between species and the level of engorgement of the female. A tick’s life cycle can last between a few months to several years. Image is based on Sonenshine and Roe (32).

Ticks feed on all terrestrial vertebrates, mammals, birds and reptiles (32,73), though some are more host specific, like I. frontalis, the ornitophilic tick which prefers birds, and I. uriae, which has specialized in sea-birds. Others, like I. ricinus, have a wide host range and seem to have no specific prefer-ences for hosts. The larva and nymph parasitize small mammals, birds and reptiles, whereas all stages parasitize large and medium size mammals.

17

Adults are more host specific than nymphs and larvae, which is why it is more common for the immature stages to feed on humans (32,74).

In Sweden, there are around ten naturally occurring tick species, most of them belonging to the Ixodidae family, and the vast majority of human bites are caused by I. ricinus (74).

The SFG rickettsiae can be detected in many of the tick organs, the hemo-lymph, salivary glands and ovaries. The presence of rickettsiae in the sali-vary glands is essential for spread to hosts during feeding (75–77), and pres-ence in the ovaries of adult females enables transovarial transmission of SFGR, from the female to her eggs. However, the percentage of eggs infect-ed by transovarial transmission can vary. When the egg hatches into an in-fected larva, the tick will stay infected throughout its life. This mode of transmission of SFGR, from one life stage to the next, is called transstadial transmission (78–81). Apart from transovarial and transstadial transmission, ticks can also become infected by pathogens from their blood meals. Hori-zontal transfer is when the host has an infection that the tick ingests through the blood (80), but transmission can also take place during a blood meal on an uninfected host. This is called co-feeding transmission and occurs when two ticks feed in close proximity or subsequently to each other and transmit pathogens without any systemic infection of the host (82–84). There is also sexual transmission of Rickettsia spp. between adult ticks. Whether this in-fection can enter the female’s eggs and helps to spread SFGR to subsequent generations of ticks is unclear (85,86).

Co-infections Many tick species can transmit several pathogens, such as Rhipicephalus sanguineus, which transmits Anaplasma spp., Babesia spp., C. burnetii, R. conorii, R. rickettsii and R. massiliae (23,87). Individual ticks can also be infected by multiple pathogens and cause co-infections in the host they feed on (88–92). Most research reports focus on only one tick-borne infection at a time, yet a shift towards evaluating the occurrence of co-infections in ticks and patients is apparent, and such an approach is important for physicians seeing patients with confirmed or suspected tick bites. Symptoms in patients with tick-borne co-infection may differ from infections due to only one type of pathogen, and the disease caused by two or more pathogens may be pro-longed and more severe (93,94). In Sweden, studies have reported both pa-tients and ticks with different combinations of co-infections, including B. burgdorferi sensu lato, A. phagocytophilum, TBEV, R. helvetica and ‘Can-didatus Neoehrlichia mikurensis’ (95–97).

Apart from pathogenic microorganisms, ticks also harbour endosymbi-onts, which are bacteria, living in a commensal, mutualistic or parasitic symbiosis with their arthropod host (98). R. peacockii is an endosymbiont in Dermacentor andersoni ticks, and this rickettsial species genetically belongs to the SFG, but has some distinctive characteristics separating it from many

18

of the other SFGR. R. peacockii is only found in the ticks’ ovaries and Mal-pighian tubes and is transovarially and transstadially transmitted, but it does not infect the salivary glands and it does not evoke immunological reactions in tick cells (99–101). R. montanensis, another probably non-pathogenic rickettsia, is also characterized as a symbiont of D. andersoni ticks (102).

In contrast, the two most pathogenic SFGR, R. rickettsii and R. conorii, cause high mortality in experimentally infected D. andersoni (83,103) and Rh. sanguineus ticks, respectively (80,104). Naturally infected Rh. san-guineus are more sensitive to extreme temperatures (low and high) than non-infected ticks, possibly limiting their survival during winter (105). When comparing D. andersoni, Haemaphysalis leporispalustris and Amblyomma americanum ticks naturally and experimentally infected with R. rickettsii, Burgdorfer and Brinton saw high levels of transovarial and transstadial transmission, but higher mortality and problems producing viable eggs as well as oviposition in both the naturally and experimentally infected ticks (106). For the tick-pathogenic rickettsiae, transovarial and transstadial transmission would then be of less importance than other transmission routes to keep the pathogens in a life-cycle (81), and this would explain why R. conorii and R. rickettsii have a low prevalence in nature (103,105), though transovarial and transstadial transmission are almost 100% in naturally in-fected Rh. sanguineus (78).

R. parkeri, on the other hand, has high transovarial and transstadial transmission in Amblyomma maculatum and a high prevalence in nature (56%), which has been used to suggest that R. parkeri is an endosymbiont (103). However, R. parkeri is still transmitted and pathogenic to humans (16,102).

Understanding the ecology of tick microorganisms is important if we are to evaluate the risk of transmission and to understand emerging infection patterns. For instance, the ability of one individual tick to transmit both R. peacockii and R. rickettsii transovarially seems impossible under laboratory conditions (81). This area requires more investigation, which could possibly reveal what makes some bacteria pathogenic while others, closely related, are not. Whole-genome sequencing of tick microbiome could be a new tool for investigating this field from a new angle (107).

Reservoirs A reservoir host for an infectious agent is defined in relation to a target pop-ulation. In the case of a rickettsiosis, the target population is often a human population. The reservoir may be one or many species, but includes every population that is needed for sustaining the infection in nature and that, by direct or indirect contact, infects the target population (108).

19

Figure 5. Wood mouse (Apodemus sylvaticus), is this a possible reservoir for Rick-ettsia? Photo: Thomas G.T. Jaenson ©, Uppsala University. The longest standing hypothesis of a reservoir host for the SFGR is the tick vector population itself (79,109). Because ticks can transovarially and transstadially transmit the bacteria, no other host seems to be needed to complete the life cycle, maintain and transfer the infection (103,110). Sprong et al. found a stable prevalence of R. helvetica over several years and in all stages of I. ricinus in a study area. This contrasts to the level of Borrelia infection, which fluctuated over seasons and tick stages in the same area. This finding indicates the ability of I. ricinus to maintain the infection within the vector, whereas for Borrelia, depending on its reservoir hosts, the infec-tion prevalence fluctuates (111).

The other hypothesis focuses on mammals as potential reservoir hosts. Many wild and domestic animals have been reported to have antibodies to Rickettsia spp. (112–114), thus providing evidence of natural exposure to rickettsia-infected ticks. Also Rickettsia spp. have been isolated or detected in blood from cats, dogs with febrile illness, birds, voles, mice, roe deer and wild boars (111,115–118), suggesting that they could be reservoir hosts. Dogs have been proven to be competent reservoirs of R. conorii, spreading infection to uninfected ticks in experimental settings. Surprisingly, one dog without any signs of infection, PCR negative blood and a low serum titre was able to infect uninfected ticks feeding from it. This finding, according to Levin et al., highlights that a good reservoir host is an animal that is not se-verely affected by the infection, thereby not reducing the host’s activity and their capability of exposing the infection to new susceptible vectors. This would, according to Levin et al. (119), seem to question the role of ticks as reservoirs as some Rickettsia spp. infections reduce the viability and increase the mortality of ticks (83,104,106). However, according to Haydon et al., this reasoning has no bearing on whether or not a species should be classi-fied as a reservoir. As long as the infection persists in the population, patho-genicity has no influence on reservoir competence (108).

Humans are accidental or a dead-end host for rickettsiae, with the excep-tion of the epidemic typhus agent, R. prowazekii, which has humans as at least one of its reservoirs. After an infection with R. prowazekii patients can

20

retains an amount of Rickettsia organisms in the body, which can flare up and cause a milder form of typhus, Brill-Zinsser disease, thereby enabling spread of the bacteria to uninfected human body lice, and the possible out-break of a new epidemic (3).

Distribution The SFG rickettsiae occur on all continents except Antarctica (18,120). The distribution of Rickettsia spp. follows the spread of their respective vector or vectors, which means that the mite and flea-borne R. akari and R. felis are distributed world-wide (121,122), whereas the tick-borne SFGR are more geographically restricted due to the specific habitats of their tick vectors. For R. helvetica the distribution follows the habitats of I. ricinus in Europe and North Africa and I. persulcatus, I. ovatus and I. monospinosus in Asia (18). In contrast the brown dog tick, Rh. sanguineus has a worldwide distribution present within latitudes 35°S and 50°N due to its specialization on domestic dogs as hosts. Rh. sanguineus is the vector of R. conorii (Mediterranean spotted fever) distributed in Europe, Africa and Asia, R. rickettsii in North and Central America and R. massiliae distributed worldwide (18,23,87).

Figure 6. Geographical distribution of tick-borne Rickettsia spp. in the world. Pic-ture by Parola and Raoult 2001 (70), Clinical Infectious Diseases, ©Infectious Dis-eases Society of America.

Spread to new geographical areas For SFG rickettsiae to be able to spread to new areas, their respective tick vector must first be dispersed. Ticks themselves cannot move long distances, not more than a few meters. However, some of their host animals, like roe deer, can move over larger geographical areas and transport feeding ticks (32,70). The hosts with the greatest potential to transport ticks to new distant

21

Figure 7. Tick on redstart (Phoenicurus phoenicurus) captured on Capri, Italy. Pho-to: Björn Olsen.

areas are birds. It has been recognized since the 1960s that migrating birds are frequently fed on by ticks, and that they bring ticks and their tick-borne pathogens over long distances, crossing continents (123,124). However, it is not until recent years that this potential dissemination of tick-borne patho-gens by birds has received increasing research attention and recognition (92,125).

It is conceivable that a tick transported by migrating birds can survive the summer in a new area where it can transmit infections to susceptible hosts. When ticks, endemic to the area, feed on the same host, they might be hori-zontally infected with the new pathogen. Migrating birds have been demon-strated to be bacteraemic with Rickettsia spp., which further implicates their likely involvement and significance in the rickettsia infection cycle, as agents of distribution, reservoir hosts or amplifying hosts (115,125,126). However, there is still no compelling evidence of the role of migrating birds. None of the hypotheses has been proven, and it may be that it is more critical to establish new endemic pathogens than we can hypothesize (127). One indication that ticks feeding on migrating birds can spread Rickettsia spp. is the description of a H. marginatum tick, endemic to Africa and southern Europe with birds as preferred host, that was found feeding on cattle in Italy. This tick was infected with R. africae, a species not recognized as endemic to Europe (128).

Another mode of tick dispersal over large geographical regions is caused by human activities, like international travel and trade. The introduction of R. africae and its vector Amblyomma variegatum to the Caribbean Islands is thought to have been caused by ticks feeding on cattle being shipped from West Africa to Guadeloupe in the 18th-19th century. The climate is optimal to the ticks, so they survived well in their new habitat, giving R. africae a somewhat patchy distribution (129,130).

22

There seems to be little dispute that the climate change is causing in-creased average temperatures and in some areas leading to decrease in rain-fall while other areas will have increase in rainfall. These changes will ex-pand the habitable areas for ticks and also alter their distribution. For in-stance, it is likely that I. ricinus will expand north in Europe and decrease its population in southern Europe when it becomes warmer and dryer. On the other hand, southern Europe will be more preferred by ticks like Amblyom-ma spp. that today are more abundant in Africa.

However, there has been some debate as to whether the past decade’s in-crease in Lyme borreliosis and TBE cases, especially the new risk areas in Europe (131–134), is an effect of climate change (135–138). Direct changes in climate influence the areas that are suitable as habitats for ticks. I. ricinus has been seen to be active during winter in Europe, which increases tick exposure to the public and decreases the life-cycle time for ticks, leading to a more rapid expansion of the population. The northern boundary has been pushed further north in Scandinavia, and the altitude of tick habitats has increased in central Europe’s mountain areas (127,137,139). A specific ef-fect on tick behaviour can be seen in Rh. sanguineus, which rarely feeds on humans even though its habitat is in close proximity, given its specialization on domestic dogs as hosts (87). However, warmer temperatures will increase Rh. sanguineus’ attacks on humans (23). On the other hand, the abundance of ticks also coincides with an increase in the roe deer population, one of the most important hosts for adult I. ricinus (74,136,140). Another important aspect of increased tick-borne infections is socio-political, with changes in agriculture, human contact with nature and the use of TBE vaccine. Alt-hough some of these indirect effects could also be due to climate changes, human migration and altered agricultural practices will most likely be a con-sequence of climate change (135–138).

Rickettsia spp. in Sweden and neighbouring countries Since the first detection of Rickettsia spp. in Scandinavia, in Sweden 1997 (11), more reports have followed from feeding and questing I. ricinus ticks infected with Rickettsia. R. helvetica is the only documented Rickettsia spp. found in ticks in Sweden, with the exception of one finding of R. sibirica. However, a few cases of human infections with the flea-borne R. felis have been found, but no vector has been demonstrated to be infected with R. felis in Sweden (141,142).

The prevalence of Rickettsia spp. in ticks in Sweden is between 1.5% and 37% (143,144), in our neighbouring country Norway the prevalence is be-tween 0.2-3.5% (145,146) and in Denmark 4-13% have been reported (147–149). In the east, on the opposite side of the Baltic Sea, Estonia’s tick popu-lation (I. ricinus and I. persulcatus) has a Rickettsia prevalence of 5.1%, mainly consisting of R. helvetica and one documented case of R. monacensis (150). Elfving et al. showed that migrating birds passing the Swedish bird

23

observatory Ottenby carry ticks, mainly I. ricinus, with a Rickettsia spp. prevalence of 11.3%. Most ticks were infected with R. helvetica, but nine I. ricinus ticks were infected with R. monacensis (151). These findings are in accordance with a recent report from Slovakia, where only I. ricinus was collected from migrating birds and found positive for R. helvetica, and to a lesser extent for R. monacensis (126).

Rickettsioses Rickettsioses have many general symptoms, such as a flu-like infection with fever, headache, rash, myalgia and arthralgia. Clinically, the same species can cause different symptoms from case to case, and different species can cause the same complex of symptoms. The rickettsiosis may also be hard to distinguish from other infections (3,152). However, some of the symptoms are more specific and can give some clinical guidance. An inoculation eschar at the bite site of the tick is relatively common, but it does not appear for all species or in all cases (18). In African tick-bite fever, multiple eschars can be seen due to the aggressive vector of R. africae, the Amblyomma ticks that often attack a single host in group (153). A cutaneous rash often develops a few days after fever onset and can be maculopapular, petechial or vesicular and frequently involves the soles of the feet and palms of the hands (122,154).

Incubation time from tick bite until symptoms appear is usually 4-8 days, but can sometimes be as long as 10 days (153,155).

Some rickettsial infections cause more distinctive syndromes, like the condition tick-borne lymphadenopathy (TIBOLA), which is also called Dermacentor-borne necrosis erythema lymphadenopathy (DEBONEL) or scalp eschar and neck lymphadenopathy after tick bite (SENLAT). TI-BOLA/DEBONEL/SENLAT is a regional lymphadenopathy, often painful and seen with a larger inoculation eschar surrounded by erythema migrans (EM). The tick bite is predominantly found on the scalp. Patients are pre-dominantly women and children, and 26% of patients have fever while rash and myalgia are relatively rare symptoms. In some areas, the syndrome is more common than Mediterranean spotted fever (MSF), and despite the ac-ronym DEBOLA the vector is not always Dermacentor ticks (152,156–158). The main causative agent is R. slovaca, but it is also associated with infec-tions by R. raoultii, R. philipii, Candidatus Rickettsia rioja, R. massiliae and can also be caused by other bacteria such as Bartonella spp. (152,158–160). Another condition called lymphangitis-associated rickettsiosis (LAR) is an inflammation of the lymphatic vessel closest to the eschar and is associated with R. sibirica mongolitomonae, R. africae and R. heilongjiangensis infec-tion. LAR is often the main symptom of R. sibirica mongolitomonae infec-tion, though one patient experienced septic shock due to the infection (152,161,162). In practice, MSF is also a syndrome. Because R. conorii was

24

Figure 8. Transmission cycle of Rickettsia spp. Picture by John Pettersson (168) based on the work of Socolovschi et al. 2009 (109) and Parola et al. 2005 (16).

the only recognized rickettsia in the area, before the breakthrough of mo-lecular methods all spotted fevers were diagnosed as the same disease. In reality the disease is probably caused by all rickettsial species endemic to the Mediterranean: R. conorii subspec. conorii (the main causative agent) sub-spec. caspia and subspec. isrealensis, R. monacensis, R. slovaca, R. aeschli-mannii and R. massiliae (122,152,162). Another symptom that is relatively often reported in rickettsioses is eye- involvement, for example, acute visual loss with chorioretinitis (posterior uveitis) due to R. massiliae and R. conorii (23), conjunctivitis caused by R. slovaca (163) and acute visual loss due to anterior ischemic optic neuropathy caused by R. conorii (164). Despite the common occurrence of infection involving the eye, visual impairment has often been overlooked, misdiagnosed and not included in the clinical symp-toms used to characterize a rickettsiosis (23,165), however awareness is growing (18,152). In some cases, the main or only symptom of a rickettsiosis has been visual impairment (165–167).

The severity of rickettsioses varies, the highly severe RMSF has a report-ed mortality between 25 and 70% when untreated (18,169). In Arizona, U.S.A, the mortality rate is still 7% in the post-antibiotic era (170). Epidemic typhus, caused by R. prowazekii, is said to have caused most deaths during

25

many historical wars and is emerging in the refugee camps of present-day wars, with a case fatality of 10-30% (3,171). MSF is not as fatal as RMSF or epidemic typhus, although a fatality rate of 2.5% has been reported and the severity of the disease is frequently reported (154,172). Other rickettsial infections cause a milder and self-limiting disease, like African tick-bite fever (R. africae), for which there are no reports of life-threatening compli-cations or deaths (153).

Analyses of risk factors related to fatal outcome due to rickettsiosis have revealed associations with old age, diabetes, vomiting, dehydration, high fever, and treatment delay, when patients have been diagnosed with Mediter-ranean or Rocky Mountain spotted fever (172–174). A delay in treatment is often seen when symptoms are general; lack of a rash in the risk area for RMSF is associated with treatment delay and, consequently, a higher mortal-ity rate (170,174,175).

Pathogenesis When bitten by an infected tick, the sali-vary glands of the tick transmit rickettsia bacteria to the mammalian host, or in the case of fleas and lice it is the faeces that infect the bite site when the host scratches the itching bite. Infections with Rickettsia spp. in the skin, after the bite of the vec-tor, can cause eschars, as mentioned pre-viously, and there is a good correlation between the species causing the eschars and the severity of the infection. To gen-eralize, milder infections, like African tick-bite fever, cause eschars, while more severe infections, like RMSF or epidemic typhus, rarely do. The eschar formation is due to a perivascular infiltration of leukocytes, lymphocytes and phagocytes causing vasculitis, and the for-mation of vascular thrombosis causes the cutaneous necrosis and hence the eschar. It is likely that the local inflammation around the bite protects the host from a bacteraemic spread of bacteria (176).

Rickettsia has a preference for the vascular endothelial cells of small and medium sized blood vessels, but they can also infect the lymphatic vessels, neurons and to some extent invade phagocytes (177,178). Well inside the host’s circulation, rickettsia adheres to the host’s endothelial cells. At pre-sent four proteins have been identified as conservative for the SFGR and active during adherence to the host cells: surface cell antigen (Sca) 0, 1, 2 and 5, where Sca0 and Sca5 are the rickettsial outer membrane proteins Om-pA and OmpB (179–182). The Sca proteins are a family of autotransporters,

Figure 9. Adherence and initiation of internalization of Rickettsia by host cell, Sca1 not included. Image from Cardwell & Martinez, Infection and Immunity 2009 (179).

26

common in Gram-negative bacteria, and the Rickettsia spp. have 17 Sca genes, most of which are degraded and non-functioning (181).

The attachment is followed by invasion through inductive phagocytosis by endothelial cells. The OmpB and Sca2 proteins play active roles in induc-ing internalization of the bacteria (179,183).

The only known cell receptor that rickettsia adhere to is the OmpB recep-tor Ku70 protein, which is present on the surface of some mammalian cells, especially endothelial cells. Binding of Ku70, and unidentified receptors, initiates bacterial internalization by activating clatherin- and caveolin-mediated endocytosis, and rearranging of the actin cytoskeleton (183). Once inside the cell, rickettsia quickly escapes the phagosome and when free in-side the cytoplasm of the host cell, the bacteria can make use of the cell’s nutrients and machinery to grow and spread (177). Rickettsia, together with some other intracellular bacteria, can high-jack the host cells actin polymeri-zation and use it as a mechanism of intra and intercellular spread. The actin polymerization is the way rickettsia move in to the cell nucleus and also intercellularly to reach neighbouring cells, thus spreading the infection (184). There are two mechanisms through which rickettsia polymerizes ac-tin, one early in the initial infection phase, which produces shorter curved actin tails (probably for intracellular movement) where the RickA protein recruits and activates the host cell’s actin-related protein (Arp) 2/3 complex, which in turn initiates polymerization of actin. Later in the infection, after rickettsial replication, there is a formation of longer and straighter actin tails (probably for intercellular movement) governed by the Sca2 protein through an unknown pathway (185). In comparison, R. prowazekii, which has a dis-rupted RickA gene and is unable to polymerize actin, multiplies exponential-ly until the host cell burst, causing necrosis, and then infects new host cells.

Figure 10. Actin tails formed by Rickettsia rickettsii, imaged by dual fluorescent staining. Modified image from Van Kirk et al. Infection and Immunity 2000 (186).

27

The most common complications caused by rickettsial infections are due to the damage and dysfunction of the vascular endothelial layer, which leads to vasculitis and may cause CNS complications, respiratory and multi-organ failure (177).

Neurological involvement Many of the Rickettsia spp. have documented effects on neurological func-tions as a consequence of infections of the CNS, such as meningitis, menin-goencephalitis and confusion (23,187–189). In vitro experiments have shown a clear destruction of neuron cells’ integrity due to infection by R. helvetica and R. slovaca (190).

Paralysis of a cranial nerve, for example facial nerve palsy (FNP), is a re-sult of inflammatory swelling of the nerve, causing paralysis. The aetiology is often unknown, but might be brain tumours, stroke and a number of infec-tious agents. Rickettsiosis is often not considered to be a cause of FNP, but some clinical cases have been documented. In India, a case of palsy of the third cranial nerve was reported, manifested as drooping eyelid and double vision caused by a Rickettsia infection, probably a SFG rickettsia (191). In two other cases of facial palsy, where one of the patients had one-sided hear-ing loss, the cause was reported to be R. conorii (192). Hearing loss has also been occasionally reported as a complication of R. conorii and R. felis infec-tions (193–195).

Rickettsia helvetica The main vector of R. helvetica is I. ricinus, even though it has been fre-quently reported in other tick species such as I. persulcatus, which is proba-bly the main vector in Asia (18). R. helvetica has also been detected in I. hexagonus (the hedgehog tick), I. ovatus and H. flava in Japan and Derma-centor reticulatus (196–198). On some occasions other ectoparasites like mites from rodents (Laelaps agilis, Haemogamasus nidi, and Hirsutiella zachvatkini) (199), fleas (Archaeopsylla erinacei) caught from urban hedge-hogs in Hungary (200) and a bat flea (Nicteridopsylla eusarca) have also been found to be infected with R. helvetica (201).

R. helvetica was first isolated from I. ricinus ticks collected in Switzer-land in 1979 (202). Since then, several cases of human infection with R. helvetica have been reported from numerous countries in Europe – France, Sweden, Denmark, Slovakia, Italy (147,203–206) – and from Asia – Thai-land and Laos (206,207) – and possibly in a traveller returning to Japan from Australia (208). Patients typically experience mild aneruptive fever, head-ache, myalgia and arthralgia (203,206,207). In some cases an inoculation eschar, rash, cough and pulmonary symptoms, vomiting and diarrhoea, pal-pable liver and unilateral conjunctivitis have been reported (206,207).

28

In serosurveys of healthy individuals, 9.2% of tested forest workers in France, forest workers in Italy and blood donors in Austria had IgG antibod-ies against R. helvetica (203,204,209,210). These studies indicate an endem-ic occurrence of R. helvetica in Europe that is important to be aware of, but we can also assume that many infections are asymptomatic, mild and self-limiting.

However, some case reports have found an association between R. helvet-ica and more severe illness such as fatal perimyocarditis in two patients (211), pathological aortic valves (212), and a case of acute febrile illness, presented with bacteraemia, headache and muscle weakness followed by a slow recovery, lasting 7-8 months (213). Other patients have presented with CNS symptoms like subacute meningitis (214), meningitis as a co-infection with reactivated herpes simplex virus II (215) or forgetfulness and aphasia clinically diagnosed as fronto-temporal dementia (189).

Rickettsia felis R. felis is another emerging SFGR, first characterized in 1990 (216) and recognized as a human pathogen in 1994 (10). R. felis is, as previously men-tioned, not transmitted by ticks. The main vector is the cat flea, C. felis, however R. felis has been detected in other fleas (Echidnophaga gallinacea and Xenopsylla cheopis (217)), as well as in ticks (I. ovatus, H. flava and H. kitasatoe (196), Rhipicephalus sanguineus (218)), Mesostigmata mites (219), the common household pest booklouse (Liposcelis bostrychophila (220)) and recently in mosquitoes (Aedes albopictus (221) and Anopheles gambiae (222)). Despite the various findings on different potential vectors, the only proven vector that manages to maintain an infection of R. felis for generations through transovarial and transstadial transmission is the C. felis flea (67,223).

R. felis has been reported all over the world, along with the distribution of its vector. Nonetheless, only a limited number of so-called “flea-borne spot-ted fever” infections have been described. Around 100 human cases are doc-umented from Africa, Asia, Europe, the Middle East, North and South America and probably Australia (10,25,224–231).

The symptoms and course of the disease are very difficult to distinguish from other rickettsioses with fever, maculopapular rash, eschar, abdominal manifestations, cough and sometimes neurological symptoms (231). Some patients diagnosed with murine typhus, R. typhi, have been reinvestigated and shown to have been infected with R. felis (10,25), which could explain the low number of reported cases of R. felis, despite it being widely distrib-uted around the world (231). In some cases, infections with R. felis have a more severe manifestation similar to hepatitis, severe respiratory insufficien-cy (228) or subacute meningitis, which was reported in two cases from Swe-den (141).

29

Diagnostic tools To diagnose rickettsioses, several aspects need to be considered: the clinical symptoms, epidemiological information and laboratory findings.

Serological methods Usually diagnoses of Rickettsia infection are based on serological methods such as immunofluorescence assay (IFA) and enzyme-linked immunosorbent assay (ELISA). At some reference laboratories, Western blot and cross-absorption assays are also used. Within the genus Rickettsia, many species cross-react serologically, which is why species definition using these meth-ods may be difficult and time-consuming (155). Detectable antibody titres usually take several days to develop, and the serological methods are there-fore more confirmative of rickettsiosis than they are useful for diagnosing acute illness, though such methods may be the only available option.

The advantages of the serological methods are, for diagnostics, the easy and relatively non-intrusive sampling of blood and, for epidemiological in-vestigations, the ability to estimate prevalence, rather than incidence, which is very useful (155,232).

Immunofluorescent assay IFA is accepted as the reference method for diagnosing rickettsioses (18,233,234). Whole bacteria antigen is fixated onto a glass slide and incu-bated with patient serum in dilutions. Serum is washed off and the slide in-cubated with fluorescein-labelled anti-human antibodies, which bind the rickettsia-specific antibodies from the patient’s serum and make them visible in a fluorescence microscope. A rickettsiosis is judged as ongoing or recent if the antibody titre shows a fourfold increase from the acute-sera (taken day 0-14 of illness) to the follow-up (convalescent) sera taken 2-6 weeks after disease onset. The cut-off titre is dependent on SFGR and can differ between IgG and IgM; the cut-off is usually set between 1:32 and 1:128 (233,235).

Figure 11. IFA, fluorescein labeled antibodies binding to specific antibodies bound to the bacteria surface (to the left). Western blot image using fluorescently labeled antibodies with Amersham™ WB System (GE Healthcare) (to the right).

30

The level of antibodies can show a fourfold rise within a few days, or for some SFG rickettsia this can take up to seven weeks. This factor, together with early treatment with antibiotics which can prevent development of strong antibody production, makes diagnosis using serology difficult and sometimes impossible (235).

IFA results are subjective evaluations which can be biased, but the visual-ization of antibodies binding to surface antigen is an advantage (234), alt-hough separating unspecific from specific binding is not possible using mi-croscopic evaluation alone. The wide cross-reactivity between the SFGR species makes IFA too nonspecific and therefore unsuitable for distinguish-ing between species (236), however using multiple antigens and comparing the titres can provide guidance in identifying which species a patient has the strongest reaction to (234,237,238).

Enzyme-linked immunosorbent assay The ELISA method, like IFA, detects the binding of specific antibodies in a serum sample to an antigen. When secondary antibodies, anti-human-antibodies conjugated with an enzyme, are bound to antibodies from a serum sample and subjected to a substrate, an enzymatic reaction will be measura-ble in a positive sample (239).

The advantages of the ELISA method are the ability to analyse large numbers of samples, the possibility to study antibody reactions to separate protein antigens and, compared to IFA, the absorbance of the enzyme reac-tion is measured with a spectrophotometer, eliminating the subjective evalu-ation. The ELISA was adopted early on for analysing serological reactions to Rickettsia spp. and has been shown to be a specific and sensitive tool (240–242).

Western Blot and Cross-absorption Western blot and cross-absorption tests are research and reference laboratory methods, given the need for large amounts of antigen, which requires culti-vation of Rickettsia. With Western blot and cross-absorption, it is possible to distinguish between the different Rickettsia spp. When a serum, positive for rickettsia antibodies, is incubated with the bacteria that the antibodies are reactive to, they will bind to the bacteria, and after centrifugation the specific antibodies in the serum will be absorbed. After absorption, the serum super-natant will show little or no reaction to the specific Rickettsia spp. (243). If the serum is absorbed with a cross-reacting Rickettsia sp., the antibody titre can decrease by partial binding, but the titre will not decrease as much as when the Rickettsia species causing the infection is used, which is a way to identify the infective agent (237,238).

In the Western blot assay, an antibody reaction to individual proteins or the lipopolysaccharide (LPS) of the cell wall can be identified and useful in demonstrating cross-reactions within the SFGR, usually caused by LPS,

31

while the antigenic surface proteins are more species specific (244–246). However, Uchiyama et al. showed that the rickettsia protein OmpB causes production of antibodies that do cross-react between the SFG and the TG, which has been supported by Xu et al., who showed that the OmpB has more general antigenic epitopes among the SFGR compared to OmpA, which has more strain-specific epitopes (247,248). LPS, OmpA and OmpB are all strongly antigenic, though the antigenicity differs in protection ability, where OmpA and OmpB have vaccine-like protection in laboratory animals and LPS does not (246,249–251). Antibodies to the 60 kDa HSP protein have been detected in severe cases of R. conorii infection (252) and hyper-immunized animals (246).

It has been suggested that Western blot can detect antibodies to Rickettsia spp. earlier in the infection than the IFA test can, although the early response is mainly IgM antibodies directed against LPS and the unspecific reactions are likely to be due to LPS reactions, which are possible to identify with Western blot. Therefore, the benefit of earlier detection by Western blot is lost, because much of the early response is against LPS and hence unspecific (237,244,252).

Today, Western blot is used mostly as a method to confirm serological re-sponses to rickettsiosis, though it is reported to be more sensitive than the IFA (238). Thanks to the development of automatic, faster and more repro-ducible Western blot systems that require far less antigen, for instance the Amersham Western blot system (GE Healthcare), Western blot may come to be of more importance in diagnostics.

Weil-Felix test The agglutination method – Weil-Felix test – is the oldest diagnostic tool for rickettsial infection, described already in 1916 (253). The test is based on cross-reaction between two Proteus vulgaris antigens, one Proteus mirabilis antigen and Rickettsia spp. antibodies. The three Proteus antigens can help distinguish between the scrub typhus (O. tsustsugamushi – no longer a member of the genus Rickettsia (64)), the TG and the SFG of the family Rickettsiaceae, and the agglutination is suggested to be due to LPS cross-reactivity (254–256). However, this method has both low sensitivity and low specificity (257), where sensitivity as low as 33% and specificity as low as 46% have been reported (258). The method has been replaced as a diagnostic tool where resources are available. Unfortunately, it is the only instrument accessible in many low-income settings, where the burdens of rickettsioses and scrub typhus are among the highest (259,260).

Molecular methods Molecular methods like PCR (261) are important diagnostic and research tools that can be performed on DNA extracts from eschar swabs, skin biop-sies, cerebrospinal fluid (CSF) and whole blood or serum samples (189,262).

32

Using PCR-based methods followed by DNA sequencing (263,264) is the easiest way to differentiate between the various Rickettsia spp. and to gain knowledge about the genomic differences within the genus (57). For diag-nostics and screening, the real-time PCR is quick, sensitive and specific (265,266). Molecular methods are also useful in “diagnosing” the vectors (225).

Figure 12. Real-time PCR curves, using Corbett 3000, Qiagen (left image) and gelelectrophoreses results from nested ompB PCR-products (right image).

However, the drawback of the method is the risk of contamination due to the large amounts of produced PCR-products, possibly giving false-positive results. Moreover, the sampling is not as easy as for serology; if infections present without eschar or CNS involvement, swabs, biopsies and CSF sam-ples are not an option for diagnosis. And unfortunately, PCR on blood and serum has quite low sensitivity (266).

In contrast to serology, PCR is an appropriate diagnostic tool for acute in-fection. A sample taken early at disease onset, before development of anti-bodies, is more likely to produce a positive result in the PCR assays. How-ever, when antibody production has increased to detectable levels, bacteria are rarely found in the circulation or at inoculation sites, and if antibiotic treatment has been initiated, the sensitivity of PCR assays decreases for the same reasons (225,266).

Cell culture isolation In order to confirm, without doubt, that a sample contains live Rickettsia bacteria, the bacteria need to be isolated and grown in cell cultures. This method is not used for routine diagnostics, as it is time consuming, the suc-cess rate is low, the amount of bacteria available for inoculated is critical, and growth is slow. Moreover, some Rickettsia spp. like R. rickettsii, require biosafety level 3 laboratories for cultivation. Thus, using this method as a routine diagnostic tool means that biosafety laboratories need to be available in order to handle samples from patients who have visited areas endemic for the more serious Rickettsia spp. Taken together, isolation is inappropriate for routine diagnostics (19,267–269). However, to be able to isolate new strains,

33

study their bacteriological features and define a Rickettsia sp. as pathogenic, cell culture techniques are of the utmost importance (34,214). To overcome some of these difficulties, the shell-vial centrifugation technique has been adapted to isolation of Rickettsia (268).

Rickettsia can be grown in most cells: mammalian (270,271), amphibian (229), insect (272,273) and tick cell lines (34,274). The Rickettsia is a fastid-ious bacterial genus that requires cultivation in 5% CO2 and temperatures between 32 and 35 °C (269,275), but lower (25- R. felis depending on the type of cell line (229,273).

In order to visualize the cultivated small intracellular Rickettsia, the bac-teria need to be labelled by fluorescent antibodies or stained by the specific Rickettsia dye protocol: Gimenez staining. This staining method was devel-oped in the 1960s (276) to stain Rickettsia spp. grown in yolk sack or cell cultures because of the bacteria’s poor Gram staining. Rickettsia ultrastruc-ture in cell cultures can also be studied using an electron microscope (277,278).

MALDI-TOF MS A new application for using the matrix assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) has been published by Yssouf et al., who were able to diagnose ticks infected with Rickettsia spp. using protein preparations from tick legs. The analysis identified both tick and rickettsia species. This enables fast identification of ticks removed from humans or animals, allowing a physician or veterinarian to determine wheth-er there is a need for prophylactic treatment or prompt treatment if symp-toms occur. With this methodological approach, screening tick populations in order to monitor prevalence of tick-borne infections can be performed more effectively then with molecular methods (279). The same approach has been successfully used with Borrelia-infected Argasidae ticks (280).

Treatment Even though much of this thesis introduction has problematized the difficul-ty of differentiating between the Rickettsia spp., treatment strategies are gen-erally the same regardless of species.

Doxycycline is the treatment of choice and effective against most rickett-sial strains, including R. helvetica and R. felis (281–283). The recommended dose is 100mg twice a day for five to seven days for SFGR or until fever has been absent for three days. In the event of complicating conditions, such as meningitis, a longer treatment course is required (165,284,285). Doxycycline is a tetracycline antibiotic that inhibits the ribosomal protein synthesis, but is contraindicated in children younger than 8 years and pregnant women. The tetracycline group is contraindicated because it causes deposits in growing bones and tooth enamel, leading to growth retardation, enamel hypoplasia

34

and discoloration of children’s permanent teeth (286,287). Apart from the tetracyclines, the macrolides such as josamycin, clarithromycin and azithro-mycin also show effects against Rickettsia spp. in vitro (281,288) and clini-cal trials have found them to be suitable options for treating children with MSF (R. conorii) (289,290). However, a recent systematic review has called into question the contraindication for doxycycline, as it lacks support in the scientific literature. The authors’ hypothesis is that the reason doxycycline was considered contraindicated is because it was introduced on the market around the time when other tetracyclines were discovered to have the above-mentioned side effects and the specific side effects for doxycycline were never evaluated (291).

Doxycycline is also an effective antibiotic for treating the other tick-borne infections A. phagocytophilum and Borrelia spp. However due to doxycy-cline’s broad spectrum nature, it is not the first choice in patients presenting with EM and history of tick bite, but without fever. According to recom-mendations made by the Swedish Medical Products Agency (Läke-medelsverket), the preferred choice for uncomplicated Lyme borreliosis is fenoximetylpencillin (292,293).

35

Aims

Paper I The aim of Paper I was to study a possible route of transmission of Rickett-sia spp. over large geographical areas by migratory birds as potential carriers of Rickettsia spp. infested ticks. The study was part of a larger project inves-tigating a number of different vector-borne pathogens.

Paper II The aim of Paper II was to examine the prevalence and distribution of Rick-ettsia spp., Anaplasma spp. and Coxiella burnetii in ticks in a larger geo-graphical area than previously investigated in Sweden.

Paper III The aim of Paper III was to investigate evidence of seroreactivity to Rickett-sia spp. infections in a population naturally exposed to ticks in Sweden. The aim was also to describe symptoms associated with rickettsiosis, and to what extent people are exposed to Rickettsia infections and possible co-infections with other tick-borne pathogens.

Paper IV The aim of Paper IV was to determine whether medical conditions of mainly unknown aetiology, in this study Bell’s palsy and sudden deafness, could be explained by Rickettsia spp. infections.

Paper V The aim of Paper V was to continue investigating the association between rickettsiosis and Bell’s palsy. Serum samples from patients diagnosed with facial nerve paralysis, sent for Borrelia spp. analysis, were also serologically analysed for presence of Rickettsial antibodies.

36

Material and methods

Samples

Paper I Ticks were collected from birds migrating from Africa to Europe during spring. Collection was performed at two bird observatories, one on Capri (Italy) and one on Antikythira (Greece) from March to May in 2009 and 2010. A total of 14,789 migratory birds were trapped in mist nets, resulting in 751 collected ticks. All ticks were photographed and the photos were used to identify the species and stage of all ticks. The dominant species was Hy-alomma marginatum s.l. making up 90% (n=658) of the collection, followed by I. frontalis (n=23). The rest were Ixodes spp., Rhipicephalus spp. and Haemaphysalis spp. The most common stage was nymphs (n=488), followed by larvae (n=198), and only 4 adult ticks were collected, all females of the I. frontalis species. For 44 ticks, species and/or stage were impossible to de-termine.

Paper II Questing ticks were collected between May and September 2008, at 29 dif-ferent sites in central and southern Sweden. Ticks were collected by drag-ging a white woollen flannel cloth over the vegetation. Ticks were kept re-frigerated until species definition, based on morphological criteria, had been performed. Following species identification, the ticks were frozen °C. All ticks were saved separately with some exceptions; 10 ticks were ana-lysed in 5 pools, and 13 other ticks, of which 4 were blood-fed, were collect-ed from a domestic dog. The collected ticks have been used for another study as well (294), which is why only adult ticks were available for Paper II. In this study, 887 adult I. ricinus ticks were included: 469 females and 418 males.

Paper III Part one of Paper III was performed on serum samples collected for a pro-spective study investigating the presence of Borrelia spp., Anaplasma spp. and TBE. Patients experiencing flu-like symptoms and/or EM after con-firmed or suspected tick bite were included in the study. Three serum sam-ples were collected from each of the 206 patients seeking medical attention

37

from May to December 2001, in south-eastern Sweden. The first sample (S1) was collected at the first visit to the health care centre, and the second sam-ple (S2) was collected 6-8 weeks after the initial visit. Lyme borreliosis had previously been found in 186 patients, 18 patients were confirmed and 2 were suspected to be positive for human granulocytic anaplasmosis, and 2 cases of TBE were found (97). The third serum sample (S3) was not used in this study.

The second part of Paper III included 112 patients who left serum sam-ples for Lyme disease investigation (28 were positive) and 47 patients sam-pled for Mycoplasma pneumoniae (11 were positive). Patient sera were col-lected from March to April 2012 at Uppsala University Hospital. Sera from 80 healthy blood donors were used as control material.

Paper IV For Paper IV, serum samples were collected retrospectively (Study I) from frozen stored samples of 40 patients diagnosed with peripheral facial nerve palsy (FNP) involving the VII cranial nerve, also called Bell's palsy, and 30 patients diagnosed with sudden deafness (SD). Six patients were also sam-pled for cerebrospinal fluid when giving their first serum sample, which was also analysed. Samples were collected between 2009 and 2011 at Falun Hospital for most of the cases and some samples were collected at Uppsala University Hospital.

In Study II, serum samples were collected prospectively from 57 pa-tients; 20 showed signs of FNP and 37 experienced SD. Two serum samples were collected per patient, one on enrolment day and a second convalescent serum collected from 6-8 up to 24 weeks after the first sample. Samples were collected at Falun Hospital.

Paper V In Paper V, 36 patients diagnosed with peripheral facial nerve palsy and with serum samples sent for Borrelia spp. testing to Uppsala University Hospital, during the first six months of 2015, were included in the study. Twenty-one patients were women and 15 men, between 18 and 77 years of age. Serum samples were retrospectively analysed and as a control group sera from 50 healthy blood donors were used.

DNA analysis DNA extraction Ticks Both tick collections for Paper I and II were used to search for a number of different tick-borne pathogens, both bacteria and arboviruses.

38

Ticks collected in Paper I were homogenized by Qiagen TissueLyser, and RNA extractions were performed by Qiagen M48 BioRobot using the Ma-gAttract® RNA Tissue Mini 48kit. The RNA extraction was then submitted to cDNA synthesis by reverse transcriptase (RT)-PCR to enable multiple viral and bacterial analyses from the same sample extraction.

Ticks in Paper II were homogenized in phosphate buffered saline (PBS), and DNA and RNA were extracted with the aid of TriPure reagent (Roche diagnostics) and applying a chloroform protocol for precipitation of the DNA (144).

Clinical samples DNA extraction from CSV samples in Paper III was performed with Nu-cliSense easyMAG extraction robot (bioMérieux, Durham, NC, USA). Sam-ples were first centrifuged at 15,000 x g for 10 minutes, the supernatant was removed and the pellet or 200μl of the bottom portion of the sample was mixed by vortex and added to a tube of 2 ml easyMAG lysis buffer. Samples were incubated for 10 minutes before DNA extraction was performed.

PCR Real-time PCR The real-time PCR targeting the citrate synthase (gltA) gene of Rickettsia was used as a screening method in Paper I, II and IV. The assay was adopted from Stenos et al. (265) by running the reactions with LightCycler® Taq-Man® Master, addition of 55 nmol MgCl2 and LightCycler® Uracil-DNA glycosylase (UNG) (Roche Diagnostics, Mannheim, Germany) to avoid car-ry-over contamination.

In Paper II, two additional real-time PCR assays were also used, one tar-geting the isocitrate dehydrogenase gene (icd) of C. burnetii (295) and the other targeting the 16S rRNA gene of Anaplasma spp. (296,297). The C. burnetii PCR assay was run with TaqMan® Universal PCR Master Mix. Because the amplified sequence of the Anaplasma spp. PCR is long enough to be sequenced, this assay was run without UNG, using TaqMan® Univer-sal PCR Master Mix, No AmpErase® UNG (Applied Biosystems, Carlsbad, CA).

All real-time PCR assays are based on TaqMan probes, and the reactions were performed in a Rotor-Gene 3000 (Qiagen, Sydney, Australia).

Conventional PCR A number of conventional PCR assays targeting different rickettsial genes have been used to amplify genes for sequencing and species definition of samples positive in the gltA real-time PCR. In Paper II, a PCR targeting the 16S of A. phagocytophilum was also used (298,299).

39

Table 1. Primers and probes for PCR assays

Bacteria and target genes

Primers and probes

Nucleotide sequence (5’ to 3’)

Rickettsia spp. CS-F TCGCAAATGTTCACGGTACTTT gltA CS-R TCGTGCATTTCTTTCCATTGTG

CS-P 6FAM-TGCAATAGCAAGAACCGTAGGCTGGATG-BBQ gltA(seminested) RH314 AAACAGGTTGCTCATCATTC

CS-Ric-R CAGTGAACATTTGCGACGGTA CSF-R AAGTACCGTGAACATTTGCGA CS535d GCAATGTCTTATAAATATTC

ompB Rc.rompB4,362p GTC AGC GTT ACT TCT TCG ATG C Rc.rompB.4,836n CCGTACTCCATCTTAGCATCAG Rc.rompB4,496p CCAATGGCAGGACTTAGCTACT Rc.rompB4,762n AGGCTGGCTGATACACGGAGTAA

17kDa Rr17kDa.61p GCTCTTGCAACTTCTATGTT Rr17kDa.492n CATTGTTCGTCAGGTTGGCG

17kDa (nested) RickP3 GGAACACTTCTTGGCGGTG RickP2 CATTGTCCGTCAGGTTGGCG RickP5 GCATTACTTGGTTCTCAATTCGG RickP4 AACCGTAATTGCCGTTATCCGG

ompA Rr 190.70F ATGGCGAATATTTCTCCAAAA Rr 190.701R GTTCCGTTAATGGCAGCATCT

Anaplasma spp. GER3 TAGATCCTTCTTAACGGAAGGGCG 16S GER4 AAGTGCCCGGCTTAACCCGCTGGC

GER probe 6FAM-CTGTCGTCAGCTCGTGTCGTGAGATGTTG-BBQ Coxiella burnetii icd-439F CGTTATTTTACGGGTGTGCCA

icd icd-514R CAGAATTTTCGCGGAAAATCA icd-464P 6FAM-CATATTCACCTTTTCAGGCGTTTTGACCGT-BBQ The gene coding for the 17kDa protein was amplified by a modified PCR (300,301), and in Paper II a nested PCR also amplifying the 17kDa gene (302) was used, but has later been abandoned due to lower sensitivity than the PCR proposed by Carl et al. (300).

Amplification of the approximately 632 bp part of the ompA gene was ad-justed, based on the work of Roux et al. (303), by increasing the number of amplification cycles to 45 and doubling the annealing time.

Amplification of the ompB gene, was performed by nested PCR, but often the first PCR was sufficient, without the need to nest the PCR-product (304).

To create a semi-nested PCR amplifying 852 bp of the gltA gene, the pri-mer CS-Ric-R was added together with the forward primer RH314 (143); in the second PCR, the primer CSF-R was run together with RH314 under the same conditions as in the first PCR; a 3-minute denaturation step at 94°C followed by 35 cycles of 1-minute denaturation at 94°C, annealing for 1 minute at 60°C, elongation for 1 minute at 72°C with a final elongation at 72°C for 10 minutes. This assay is not as sensitive as the other PCR assays, but the long fragment is very useful for species definition, because the PCR targets a variable interdomain of this quite conserved gene, and it is especial-ly useful if the species is suspected to be R. helvetica. Since R. helvetica has so far never had the ompA gene amplified by any published PCR, a long gltA sequence is especially usfull for species differentiation (34,57).

40

All reactions were prepared with 5μl DNA template in a total reaction vol-ume of 25μl. For preparation of master mix, the Taq PCR Core kit (Qiagen, Hilden, Germany) was used. All PCR assays, except the semi-nested gltA and the nested 16S PCR, were run with the Coral load buffer.

Gel electrophoreses All conventional and nested PCR products were visualized by gel electro-phoresis on a 1% agarose gel stained with ethidium bromide in Paper I (year one), II and IV and with Gel Red™ (Biotium) in Paper I (year two). PCR products were visualized by UV-light and compared to a DNA molecular weight marker GeneRular™ Express DNA ladder (Thermo Scientific™).

Controls For all PCR assays, DEPC or PCR-grade water was used as negative con-trols.

The positive control for the Rickettsia spp. real-time PCR was a plasmid constructed by cloning the 74-bp sequence into a pCR4-TOPO-TA vector used as a standard control (Invitrogen).

For the Anaplasma spp. real-time PCR, a plasmid was also used as a posi-tive control (296), kindly provided by Anna Aspan, Swedish Veterinary In-stitute, and for the C. burnetii real-time PCR, purified DNA was used as a standard control (Vircell, Granada, Spain).

The positive control for the nested 16S PCR, amplifying Anaplasma spp. (Paper II), was extracted DNA from A. phagocytophilum, kindly provided by Zoonotic Ecology and Epidemiology Section, Kalmar University (Kalmar Sweden). The positive control for the ompA PCR was DNA from R. conorii (AmpliRun® RICKETTSIA CONORII DNA CONTROL, Vircell). For all other conventional PCR assays, extracted R. helvetica DNA from a domestic I. ricinus tick (143) was used in adjusted dilution.

Sequencing PCR products were sequenced using Sanger sequencing. For samples from year one in Paper I and most samples in Paper II, sequencing was per-formed with BigDye® Terminator v 3.1 Cycle Sequencing kit in an ABI 3130 instrument (Applied Biosystems). Some sequences in Paper II were sent for sequencing to Uppsala Genome Centre (Science for Life Laboratory, Dept. of Immunology, Genetics and Pathology, Uppsala University, Rud-beck Laboratory, Sweden). In Paper I, the second year, samples were sent for sequencing to Macrogen Inc. (Macrogen Europe, Amsterdam, Nether-lands).

For all PCR assays, the same set of primers was used for sequencing of the products, with the addition of one sequencing primer for the semi-nested gltA PCR (57).

41

Before sequencing, all PCR products were cleansed from excess nucleotides using Exonuclease I and FastAP™ Thermosensitive Alkaline Phosphatase (Thermo Scientific™).

For analysis and sequence alignments, DNA Baser version 2.80.0 (Hera-cle Software, Lilienthal, Germany) and BioEdit Sequence Alignment Editor Version 7.0.5.3 (Ibis Therapeutics, Carlsbad, CA) were used. The Basic Lo-cal Alignment Search Tool (BLAST) was useful in species identification and examination of similarities and differences between sequences. New se-quences (Paper I) have been submitted to the US National Center for Bio-technology Information (NCBI; www.ncbi.nlm.nih.gov).

Serological methods Antigen Antigen for the two serological methods used was prepared in the same way, but modified according to the methodology used. Vero cells (ATCC33) were cultivated in cell flasks to confluent growth with either Eagle’s minimum essential medium (EMEM) or Dulbecco’s modified Eagle’s medium (DMEM) supplemented with foetal bovine serum (FBS) and L-glutamine. When the cell layer was confluent, the cultures were infected with R. helvet-ica previously isolated from a domestic I. ricinus tick (17); the cell flasks were then centrifuged to facilitate adhesion of the bacteria to the cells. In-fected cultures were incubated at 32ºC and in 5-10% CO2 for approximately 1-2 weeks. When larger amounts of bacteria could be observed in the micro-scope, after staining with Gimenez or immunofluorescence, the cultures were harvested.

Immunofluorescence assay (IFA) IFA was used in Paper III, IV and V. Antigen consisting of a mixture of in-fected Vero cells and free bacteria were prepared with the addition of forma-lin for inactivation of bacteria and 10% yolk sac solution for better attach-ment to microscope slides. A small drop of antigen per microscope slide well was applied, slides were then air dried and fixed in acetone for 15 minutes, thereafter dried at room temperature. Prepared slides were kept in a refriger-ator or at room temperature prior to use.

Serum samples were diluted in PBS, in a series of 1:64, 1:128 and 1:256. Diluted sera were added to the wells, wherein the droplet covered the fixed antigen, then incubated in a humid chamber at 37ºC for 30 minutes. Slides were washed in PBS 3 x 10 minutes and then incubated 30 minutes with a fluorescein isothiocyanate (FITC)-conjugate - and μ-chain specific polyclo-nal rabbit anti-human antibody (Dako, Glostrup, Denmark) for either IgG or IgM detection, in a solution with Evan’s blue.

42

To detect IgM antibodies, sera were first pre-treated with rheumatoid fac-tor adsorbent IgG/RF STRIPPER (The Binding Site Group Ltd, Birming-ham, UK). The rheumatoid adsorbent is a monoclonal anti-human IgG anti-body which binds and creates immune complexes with IgG antibodies in the sera. This allows the complex to be centrifuged into a pellet and leave the IgM antibodies in the supernatant for analysis. The pre-treatment is essential for the validity of IgM analysis due to IgG antibodies higher specificity to antigens, which can hinder IgM from binding the antigen and create a false-negative result. Serum without pre-treatment can also cause a false-positive IgM result if the serum comes from a person that produces rheumatoid factor autoantibodies. These autoantibodies are usually of IgM type and can bind IgG into complexes, the complex bound IgG can then bind to antigens but still be detected as IgM by secondary antibodies, due to the autoantibody, hence the false-positive result.

Western Blot The Western blot technique was used in Paper III, IV and V and performed with XCell SureLock™ Mini-Cell Electrophoresis System and Novex® (Invitrogen) in Paper III and IV, and with Amersham™ WB System (GE Healthcare) in Paper V. All proteins were analysed denatured.

For Paper III a part of the OmpB protein was expressed and used as an antigen, and in Paper IV and V whole cell R. helvetica was used as an anti-gen.

The presence of specific IgG antibodies to R. helvetica was illuminated using a horseradish peroxidise (HRP) labelled goat anti-human IgG second-ary antibody (Bio-RAD, Goat-anti-Human, cat no. 172-1033) when using the XCell SureLock™ system. In Paper V, using the Amersham™ WB Sys-tem, the detection is based on fluorescence. Anti-human antibodies, labelled with Cy3, against IgG and IgM (Rockland Inc., cat no. 609-142-123 and 609-142-007) were used. The protocol also included fluorescent labelling of the proteins with Cy5 so that an overlay image of both labelled protein and antibody labelling of specific antibody reactions could be viewed and quanti-fied.

In Paper IV, the Western blot result was strengthened by demonstrating antibody absorption of positive sera to confirm specific binding. Patient se-rum samples were mixed with a concentrated Vero cell derived whole cell R. helvetica antigen suspension and allowed to incubate for 5.5 hours at 37°C while shaking, then at 4°C overnight, to assure antibody binding to the bac-teria. Antibody-bound bacteria were then centrifuged into a pellet, and the serum of the supernatant was used as a primary antibody for blotting. Com-parison between the reactions of absorbed and non-absorbed sera in a dilu-tion series were used to evaluate whether the antibody binding was specific. Specific binding could be seen when the signals from absorbed sera faded out at a much lower dilution than the untreated matched sera.

43

Controls In Paper III, one patient serum with proven end-point titre of 1:80 for IgG and 1:160 for IgM, respectively, to R. helvetica and one patient serum with confirmed R. conorii antibody titre of 1:160 for IgG, provided by the Swe-dish Institute for Infectious Disease Control, were used as positive IFA con-trols. In Paper IV, one patient serum with the confirmed end-point titre 1:512 for IgG and 1:128 for IgM was used. As a negative control, a human blood donor serum was used. And in Paper V, one patient serum with end-point titre 1:128 for IgG and 1:256 for IgM was used as a positive control and a human blood donor serum was used as negative control for both IgG and IgM.

As reference samples, in Paper III, 80 blood donors were tested for both IgG and IgM antibodies, and in Paper V another 50 blood donors were used as control material.

In the Western blot trials in Paper III and IV, the positive control was a serum from a rabbit repeatedly immunized with purified R. helvetica. As the negative control, the secondary antibody was used alone. In Paper V, the same positive control serum as for IFA was used for both IgG and IgM. The negative control for IgG analysis was a negative patient serum and for IgM a blood donor serum was used.

44

Results and discussion

Migrating birds as carriers of ticks infected with Rickettsia species over large geographical distances In total 751 ticks were collected and 734 ticks were analysed for Rickettsia spp., of which 387 were positive as indicated by real-time PCR. For 353±1 PCR-positive ticks, one or several genes were possible to amplify and se-quence to define the identity of the Rickettsia spp. Of the 14,789 collected birds, only 398 (2.7%) were tick infested, but the infection rate was high with 48% of all ticks carrying a Rickettsia sp. Most ticks were infected with R. aeschlimannii, where 318±1 were confirmed and 20 were probable cases. Six samples were confirmed as R. africae and two were judged to be proba-ble cases. For seven samples, rickettsial DNA was amplified but it was not possible to confirm species identity, however one tick was suspected to be infected with R. monacensis.

For R. aeschlimannii sequence variations were found, compared to al-ready published sequences, and annotated for the ompB gene [GenBank: KF646134] and two variations of the 17kDa-coding gene [GenBank: KF646135 and KF646136]. For the six ticks identified as carrying R. afri-cae, the 17kDa- gene was found to be identical to Rickettsia sp. HymargI-TA12 [AJ781419]. Because our samples had 100% similarity to the se-quenced parts of ompB, ompA and gltA, the 17kDa sequence was annotated as R. africae [GenBank: KF616137]. Because the ompB sequences for R. aeschlimannii were different from previously published sequences, but were identical in both collection years, this could indicate that birds winter in the same geographical areas and fly the same route at spring migration, every year.

The number of ticks per infested bird varied from one to twenty, for some birds infested with multiple ticks all ticks were infected with the same Rick-ettsia sp., but it was just as common for the ticks to be infected with different species or be both infected and uninfected. Thus, these findings do not sup-port the hypothesis that birds are reservoirs for Rickettsia spp.; on the other hand the hypothesis cannot be refuted based on these results.

There was no great difference between the two collection years, 2009 and 2010, except that R. africae was only detected in samples from 2010. The similarity between the years indicates that this is the normal rate with which ticks are transported with migrating birds. Even if the number of tick-

45

infested birds is small, the total migrating bird population consist of billions of birds, making 2.7% a significant number. It seems that migrating birds can be an important part of the dissemination of ticks and their rickettsiae into new geographical areas. The H. marginatum s.l. complex is both pre-sent in Africa and around the Mediterranean part of Europe, which represent areas where R. aeschlimannii is endemic. R. aeschlimannii and R. africae are reported from the same countries of Africa, with more frequently reported findings of the earlier discovered R. africae. Recently a H. marginatum was found harbouring R. africae in Sicily, which would seem to be a natural hab-itat for R. africae (128). This means there is a need for preparedness for new emerging infections not previously reported in Europe, and explains the im-portance of keeping monitoring of tick-borne pathogens up to date.

The tick material was analysed for a number of different pathogens: Bor-relia burgdorferi s.l., West Nile Virus (305), Bartonella spp. (306) and Cri-mean-Congo hemorrhagic fever virus (307). Findings on co-infections will be published separately.

Figure 13. Left figure illustrate the reported distribution of the ticks, Hyalomma marginatum (green) and Hyalomma rufipes (red). Right image illustrates breeding (green) and wintering area (light brown) for Great reed warbler (Acrocephalus arun-dinaceus). The two collection sites Capri (C) and Antikythira (A) is marked on each map. Maps from Paper I.

46

Prevalence of Rickettsia spp. and Anaplasma spp. in Ixodes ricinus ticks in Sweden Questing I. ricinus in central and southern Sweden are carriers of R. helvet-ica and A. phagocytophilum. In 9.5-9.6% (85-86/887) of ticks, Rickettsia spp. were detected by real-time PCR. For 40 ticks (4.5%), sequencing was possible and 39 resulted in 100% similarity to R. helvetica. One of the male ticks collected from a domestic dog had a different sequencing result; the ompB gene was most closely related to the cluster including R. parkerii, R. conorii, R. slovaca and R. sibirica. The gltA gene showed 96.8% similarity with R. helvetica and was 100% identical to R. sibirica. The match with R. sibirica is debatable, as it has not previously been found in any Ixodes spe-cies, but in Haemaphysalis and Dermacentor ticks. What can be concluded is that the rickettsia found in this particular tick is not a R. helvetica, but it is impossible to say whether R. sibirica in Ixodes ticks is an isolated finding or established in Sweden.

Previous studies have reported a prevalence of R. helvetica between 1.5-17.3% in a pooled material representing 1245 I. ricinus ticks (144), and in an earlier study 1.7% of ticks were found to be positive for R. helvetica (11). In a limited study of 125 ticks pooled in 82 samples, the prevalence ranged from 16.8% to 36.8% for R. helvetica (143), the lower prevalence in the range being closer to our present finding.

Anaplasma spp. were found in six of the 815 investigated ticks, half of them were collected at Stenö, which represents the largest collection site. None of the samples were possible to amplify with the nested 16S PCR, but the real-time PCR product was long enough, and four of the samples were sequenced for evaluation of species identity. They all shared 100% similarity to A. phagocytophilum, but the sequenced product was only 102 bp, which is not reliable enough to confirm species identity, however, the result coincides with other studies from the area (144).

No C. burnetii could be detected in the 786 tick samples available for analysis.

Ticks in this study were mainly collected in central Sweden, with the ex-ception of the four southern-most collection points where 15 ticks were gathered, all of which were negative for all three investigated bacterial gene-ra. However, the area in which infected ticks were found is quite large and together with previous findings of R. helvetica from these areas (11,144), this establishes that R. helvetica is an endemic infection in Sweden. The prevalence of Anaplasma spp. was lower than previously reported (1.3-15%) in pooled samples. In the study by Severinsson et al. A. phagocytophilum was only found in nymphs and not in larvae or adult I. ricinus ticks, however the study only included 78 adult ticks, which could explain the negative find-ing (144).

47

Figure 14. Sites where ticks infested with Rickettsia spp. and/or Anaplasma spp. were collected. Figure from Paper II.

Seroreactivity for spotted fever rickettsia and co-infections with other tick-borne agents among tick exposed people in central and southern Sweden In Study I of Paper III, 20 of the investigated 206 patients showed seroreac-tivity to Rickettsia spp. with IgG and/or IgM antibodies equal to or above the cut-off titre of 1:64. Seven patients had a fourfold rise in IgG and were judged as having a recent or current infection. Thirteen patients had serum titres indicating past or probable infection. For 19 patients, access to medical records was possible showing that 11 patients had a seroreactivity to Borre-lia spp., six were seroreactive to Anaplasma sp. and five were seroreactive to all three agents. For three patients with seroconversion, WB was performed and showed specific IgG-binding to the expressed part of the OmpB protein

48

of R. helvetica. Common symptoms reported were fever, chills, rash, head-ache, muscle pain and cough.

In Study II, 16 of the 159 patient sera analysed displayed seroreactivity to Rickettsia spp. Eleven of the patients were originally tested for Borrelia spp. and four of them had serum titres corresponding to present or recent infection. Among the patients primarily investigated for M. pneumoniae, five had antibody titres against Rickettsia spp., one of which indicated present or recent infection. Regarding patients tested in Study II, only one serum for each patient was available, which is why it was not possible to draw any serological conclusions concerning the infectious phase in relation to the previous exposure to Rickettsia. Most common symptoms were cough and joint pain, followed by rash, myalgia and abdominal discomfort reported for two patients.

Among the 80 healthy blood donors, one showed seroreactivity to IgG and IgM antibodies, regarded as a past infection. Three other blood donors had IgM titres, probably a result of non-specific reactivity or previous expo-sure.

An important finding in this paper is that, in Study I, EM was found in patients who were serologically positive for Rickettsia spp., had a co-infection with Rickettsia sp. and Borrelia sp. or Rickettsia sp. and Anaplas-ma sp. EM was observed in patients with co-infection with all three patho-gens and absence of EM in patients with serologic findings suggesting co-

Figure 15. Schematic illustration of 18 of the 19 patients seroreactive to Rickettsia spp., with a complete medical record, included in Study I. Of the 18 patients, 15 had erythema migrans, six of them only displayed antibodies against Ricksettsia spp. In total 11 patients were seroreactive to Borrelia spp., eight with erythema migrans of which five had a co-infection with Rickettsia spp. and three had a triple infection also including Anaplasma spp. When including the two probable cases of anaplas-mosis we found one co-infection with Rickettsia spp. with erythema migrans and two triple-infections without erythema migrans. Patient number nineteen, excluded from the image, only had antibodies to Rickettsia spp. and no erythema migrans. Broken line = EM, thick continues line =Anaplasma positive, dotted line = Borrelia positive.

49

infection with all three agents. Six patients, where only serological evidence of infection with Rickettsia spp. was found, presented EM, which could be due to a very low titre or lack of production of anti-Borrelia antibodies. The finding is solely based on 19 cases and needs further investigation, but indi-cates that caution is desirable in the interpretation of EM. It may not be ob-vious that EM should only be regarded as a hallmark of Lyme borreliosis.

From Study II of the paper, a comment on the indication of cough or res-piratory symptoms as a relatively common symptom is needed, as this could be due to pulmonary vasculitis caused by Rickettsia spp.

In total for Paper III, most of the antibody titres found to Rickettsia spp. represented probable or past infections, and the symptoms for patients bitten by ticks are very general and hard to use to distinguish between infectious causes, even when result of seroreactivity is known.

Bell’s palsy and sudden deafness may be associated with rickettsiosis in some patients In the retrospective Study I in Paper IV, three of the 70 patients with FNP or SD had a fourfold increase in IgG antibodies between acute and convales-cent sera, which confirms recent or present infection with Rickettsia spp.

e-rum, indicating current or recent infection. Most patients lacked a convales-cent serum, which makes the analysis complicated and more speculative. In the FNP group, 21 out of 40 patients, and 16/30 with the SD diagnosis, dis-played seroreactivity indicating early reaction to or past infection or possibly cross-reactivity to some other agent. CSF from six patients were analysed for rickettsial DNA, and in three of those samples (two with FNP and one with SD) DNA were amplified and subsequently sequenced for the 17kDa-coding gene, matching 100% to R. felis. Only one of the 70 patients, diagnosed with FNP, was co-infected with Borrelia spp.

In the prospective Study II, two out of 20 patients diagnosed with FNP and eight out of 37 patients diagnosed with SD had a fourfold increase in IgG antibodies between their acute and convalescent serum, confirming re-cent or current Rickettsia spp. infection. As in Study I, only one of the pa-tients had antibodies against Borrelia spp.

Western blot results for four of the seropositive patients showed specific binding of antibodies to whole cell R. helvetica in a 1:500 dilution. For one serum with high antibody titre, reactions were detected at a dilution of up to 1:1200, but absent in dilution 1:600 after absorption with whole cell R. hel-vetica.

For the 36 patients diagnosed with FNP in Paper V, no convalescent sera were available. Still three samples (8.3%) showed seroreactivity indicating

50

recent or ongoing infection by Rickettsia spp., with IgG titres of at least 1:128. Six patients (16.7%) had IgM antibody titres of at least 1:128. Four patients were confirmed positive for a recent or ongoing Borrelia sp. infec-tion, two of these had a co-infection with Rickettsia sp. Western blot analysis with serum dilutions of 1:200 confirmed 27 of the 36 IFA results, regarding IgG and 29 out of 36 regarding IgM, the correlation was 100% for samples judged as indicating recent or current infection in IFA, for both IgG and IgM.

The control material of blood donor sera showed low titre of seroreactivi-ty, at most 1:64, for 3/50 (6%) samples.

Figure 16. Western blot results from Paper V. Patient 1, 32 and 33 were positive for IgG antibodies, reacting with a protein band in the 110-150 kDa size and the LPS. Patient 3, 8, 10, 16, 20 and 22 were positive for IgM antibodies, reacting with the same antigen as for IgG. To the right is a negative human sera N(h), one positive human sera, P(h), and one positive rabbit sera P(r). The last lane is the molecular weight marker. Sera were analysed in dilution 1:200.

51

Concluding remarks

The papers included in the present thesis have contributed to the growing body of evidence pointing towards the importance of understanding the dis-persal of ticks and their tick-borne infections as a consequence of their feed-ing on migrating birds, which transport ticks over large geographical areas. The challenge is now to estimate what conditions are required for ticks and their pathogens to establish in new areas.

H. marginatum ticks are endemic to both Africa and southern Europe, and the tick-borne infections they bring have a high likelihood of being estab-lished when they are transported between the two continents. One of the ticks analysed in Paper I contained Crimean-Congo haemorrhagic fever virus, endemic to Africa as well as southern Europe (307).

The second paper contributes a more accurate estimate of the prevalence of R. helvetica in Swedish ticks by analysing bacteria in single ticks instead of pooled samples. The area where ticks were collected was also more exten-sive than in previous studies (143,144). Having good estimates of the preva-lence and/or incidence of an infection is important for the ability to evaluate and detect changes such as increases, decreases and spread into new areas or when other species occur. In the present study, the prevalence of R. helvetica was 9.5-9.6% in a relatively large population of ticks collected over a large area in primarily central Sweden. The prevalence of TBE in Sweden is con-centrated to “hot spots” ranging from 0.23-4.48%, and the B. burgdorferi s.l. prevalence is as high as 26% (294,308).

One tick collected contained a rickettsia similar to R. sibirica, clearly dif-ferent from the endemic R. helvetica. How it came to feed on a dog in Swe-den is unclear. Is it possible that the tick came with a migrating bird, had the dog been abroad or is the Rickettsia sp. endemic but previously undetected? It is probable that there will be new Rickettsia spp. in Sweden eventually, possibly R. monacensis, which has I. ricinus as a vector and has been found on migrating birds at a bird observatory in Sweden as well as one isolated finding in Estonia (150,151)

Compared to the first two papers, Paper III through V have a more clinical approach. In Paper III we found indications that erythema migrans, the hallmark of Lyme borreliosis, may be associated with other tick-born infec-tions, Anaplasma spp. and Rickettsia spp. in a tick-exposed population.

52

There are a few reports of erythema migrans in rickettsiosis, one of them describes a co-infection with Borrelia burgdorferi s.l. and R. monacensis that caused EM in a patient in Germany (157,309). Paper III provides proof of the error of judging all EM as single infections caused by B. burgdorferi s.l., and it needs to be challenged further. When a patient seeks health care after confirmed or suspected tick-bite with EM and treatment is prescribed based on clinical evaluation, without laboratory tests, treatment targeting Borrelia spp. only may not be correct. Doxycycline is effective against Ana-plasma spp., Borrelia spp. and Rickettsia spp. and, as suggested by Nordberg et al., may be a more pragmatic treatment choice in patients presenting with EM (97).

The occurrence of co-infections is also evident and needs more attention in studies of tick-borne infections. More studies like the one by Fryland et al. (310), who estimated the risk of developing Lyme borreliosis from a tick bite by infested ticks to be relatively low (6%), would benefit tick-bitten patients and improve our general understanding of tick-transmitted infections in Sweden.

In Paper IV, 10-20% of patients with FNP and 10-24% of patients with SD had serological markers for, and in three cases DNA evidence of, Rickettsia infection, where sequencing of the amplified products showed R. felis. In Paper V 8.3-25% of FNP patients had serological markers for rickettsiosis, 8.3% if only IgG is evaluated as specific and 25% if both IgG and IgM are judged as specific. In comparison with Paper III, which focused on patients with tick bites, these findings may be an indication of a difference in the clinical picture between the endemic R. helvetica and the less often de-scribed R. felis.

Of the 70% of patients with facial nerve palsy, or Bell’s palsy, of un-known aetiology, a certain proportion could be attributed to rickettsiosis, according to our findings in Paper IV and V.

53

Acknowledgments

First of all, I want to thank everyone who has contributed to this thesis in one way or another. But I want to start by thanking some of my high school teachers, who, annoyed at all my questions, told me to “just accept the facts, there is no need to understand how it really works”. This inspired me to think that research must be the best kind of work, spending all of your time finding answers to unanswered questions. I think I was on to something.

My most sincere thanks to my main supervisor Kenneth Nilsson who has taken me on, believed in me and helped me through this education. And who has let me roam free, like a rickettsia in the endothelium, for the past few years. I have enjoyed the academic challenge and working with someone who listens and has such great passion for their research. During the last intensive period of finishing the thesis, I have held on to Kenneth’s modified version of Winston Churchill’s words which have put things into perspective and brought a lot of optimism for the future; “This is the end of the begin-ning, not the beginning of the end”.

To my co-supervisor Thomas Jaenson for sending me interesting research articles, for your help with linguistics and entomology and for taking me on my only field-day during my PhD studies, which I appreciated very much.

To my co-supervisor Björn Olsen for inspiration, thinking new thoughts and for interesting research projects.

To my secret co-supervisor, Calle Påhlson, who refused to be my official co-supervisor but ended up being the one who has supervised and helped me the most when it comes to lab work. Ever helpful, like a walking dictionary and always with a fun story to lighten up the mood.

To my co-authors for good collaborations: Anders Lindblom, Erik Sa-laneck, Thord Fransson, Per-Eric Lindgren, Fredrik Nyström, Christos Barboutis, Marika Nordberg, Pia Forsberg, Ingvar Eliasson, Stefan Hartvig, Thomas Norlander and especially John Pettersson for kind help and encouragement.

54

Special thanks to Eva Hjelm who first hired me to do a small project in 2007 and who thereby introduced me to the world of microbiology research. And to Hilpi Rautelin, Björn Herrmann, Anders Bergqvist, Jonas Blomberg, Johan Lennerstrand, Eva Haxton, Åsa Melhus, Kåre Bonde-son and Otto Cars for keeping up the good work with Clinical microbiology research. And to Åke Gustafsson for making room for us researchers at KMB. To people at Klinisk mikrobiologi who has helped with a lot of questions and advise, especially Bengt Kallin, Christina Öhrmalm, Hilde Riedel and to Eva Tano for giving me insider tips on finishing a thesis and your enthusiasm on my behalf. To people in the One health network and at the Zoonotic lab at BMC, Åke Lundkvist, Tanja Strand, Patrik Ellström, Hasan Badrul and Jenny Hesson for collaborations, interesting discussions and seminars and the ex-cuse to go to BMC and bread in the “research air” once in a while.

And to all the present co-workers in the lab who makes the workplace an ever changing environment; Ayda Shams, Christer Malmberg, Priya De-vi, Astrid Skarp, Cecilia Johansson, Pernilla Lagerbäck, Pikke Yuen, Jenny Dahlberg, Winn Ungphakorn, Johanna Spaak, Hongyan Xia, Bengt Rönnberg, Muhammad Rizwan, Rene Kaden, and Assar Bergfors, good luck with your projects! Also thanks to the extended group-members Karin Elfving for helping me in the beginning and Henry Xi Lu for helping me in the end! And ofcourse my two partners in crime: Anna Nilsson and Jenny Isaksson, it would not be the same without you!

To all former co-workers: Lotta, Stina, Markus, Sultan, Akofa, Patricia, Matti, Karolina, Rachel, Ylva, Linus, Amal, Magnus, Resha, Petter, Hong, Anna, Anna, Shamam, Toffe and Ronny.

To my wonderful friends, I appreciate you more than you know, your friend-ships are more then I deserve. To all who has a special place in my heart, I am truly happy you stick around. To Maria “the BFF”, Hjertat, Anne-Li, Olle and Mia, thank you for always being there.

To my family: mamma, pappa, Nisse and Lisa, I love you guys! Mamma and pappa for all your support throughout my life, and for encouraged me to choose a long education, I think this one qualifies. Also a special thanks to my aunt and uncle for sending their neighbors kids out to collect ticks for me, I promise they will come to good use one day. And to Dare, the light in my life, you make me really happy, sötnos!

55

Sammanfattning på svenska

Fästingar finns spridda över alla världens kontinenter, förutom Antarktis. En del fästingarter specialiserar sig på att suga blod från särskilda djurarter, de så kallade värddjuren, men många fästingarter kan bita vitt skilda djurslag, från ödlor och fåglar till rådjur och människor.

Bland de mest kända infektionerna som fästingar sprider i Sverige finns bakterien borrelia och tick-borne encephalitis (TBE) viruset, för hund- och hästägare är även Anaplasma spp. ofta bekant.

Den här avhandlingen fokuserar på ytterligare en bakterie som sprids av fästingar, nämligen Rickettsia spp. Enligt tidigare studier och Artikel II i avhandlingen är förekomsten av Rickettsia. minst lika vanlig i svenska fäs-tingar som Borrelia spp. och TBE. Hur stor risken är att bli sjuk av ett bett från en infekterad fästing är däremot okänt för Rickettsia spp. Den art av rickettsia som sedan tidigare har visat sig vara endemisk i Sverige är Rickett-sia helvetica, totalt finns ca 30 olika rickettsiaarter. Inga andra fästingburna rickettsior har hittats, men ett antal infektioner hos patienter infekterade med den loppburna R. felis har dokumenterats. De flesta rickettsiainfektioner har ett relativt milt förlopp, med influensaliknande symptom, så som feber, hu-vudvärk och ledsmärta. I vissa fall får patienterna utslag och ett utstansat sår i huden efter fästingbettet, ett eschar. Några arter av rickettsia är förknippade med allvarligare sjukdom så som Rocky Mountain spotted fever och epide-misk tyfus. I vissa fall ger även de andra arterna allvarliga sjukdomstillstånd, så som meningit.

I Artikel I redovisas en trolig spridningsväg av fästingburna infektioner. Fästingar som parasiterar flyttfåglar och följer med fåglarna under deras långa flygningar mellan kontinenter, tar även med sig sina patogener till nya områden. I studien fångades nästan 15 000 flyttfåglar under våren 2009 och 2010, vid två ringmärkningsstationer, på Capri (Italien) och i Antikythira (Grekland). Från fåglarna plockades 734 fästingar som kunde analyseras för förekomst av Rickettsia spp. De flesta fästingar tillhörde arten Hyalomma marginatum sensu lato, de andra arterna var bland andra Ixodes frontalis och H. rufipes. De vanligaste utvecklingsstadierna hos fästingarna var larv och nymf. Endast 4 adulta fästingar hittades. Nästan hälften (48 %) av fästingar-na var infekterade med Rickettsia spp. varav 96 % bar på arten R. aeschli-mannii som är endemisk i Afrika och södra Europa. Den fågel som bar på flest fästingar per individ var den Rödhuvade törnskatan (Lanius senator).

56

Att fästingar och deras patogener transporteras med flyttfåglar är sedan länge känt, men vilken betydelse denna förflyttning har för att nya patogener ska etablera sig i ett område är ännu inte känt. Resultaten från denna studie bidrar till den ökade kunskapen om fästingar i förhållande till migrerande fåglar men fler studier med andra angreppsvinklar behövs för att besvara frågan om förflyttning av fästingar via flyttfåglar leder till spridning av fäs-tingburna infektioner.

Artikel II genomfördes med målet att uppskatta förekomsten av Rickettsia spp., Anaplasma spp. och Coxiella burnetii i fästingar i Sverige. Till skillnad från tidigare studier så analyserades de insamlade fästingarna enskilt, vilket ger en bättre uppskattning av prevalensen. Av de 887 Ixodes ricinus fästing-arna var 9.5–9.6% (84-85st) positiva för Rickettsia spp. och av de 815 prover som fanns kvar för analys av Anaplasma spp. förekomst var 0.7% (6st) posi-tiva. Ingen fästing kunde bekräftas positiv för C. burnetii, bakterien som ger upphov till Q-feber. Av de fästingar som var infekterade med Rickettsia spp. och där artbestämning av rickettsia gick att göra, var majoriteten infekterade med R. helvetica. En fästinghane som plockats från en hund var infekterad med en helt annat fästing-buren rickettsia, mycket likt Rickettsia sibirica, vilket aldrig tidigare hittats i Sverige. Om detta fynd är en isolerad händelse eller en tidigare oupptäckt art är oklart och vi behöver vara öppna för att nya arter av rickettsia redan förekommer eller kommer att förekomma i fästingar och andra vektorer i Sverige.

I Artikel III undersöktes symptom hos personer som sökt vård efter ett ob-serverat eller misstänkt fästingbett. Det visade sig att symptombilden som ofta bestod av utslag, ledvärk, huvudvärk, hosta, muskelvärk och feber inte kunde hjälpa till att avgöra vilken fästingburen infektion som patienterna visade seroreaktivitet mot. Av de 36 patienter som hade en trolig eller miss-tänkt rickettsiainfektion hade 18 en dubbel och fem av dem en trippelinfekt-ion med rickettsia, borrelia och/eller anaplasma. Studien visade också att det typiska utslaget, så kallat ”bullseye” eller erythema migrans, som ofta anses vara synonymt med borrelia också fanns hos de patienter som bara visade seroreaktivitet mot rickettsia eller både rickettsia och anaplasma, men utan laborativa indikationer på borreliainfektion.

I Artikel IV och V undersöktes sambandet mellan antikroppar mot rickett-sia hos personer som drabbats av plötslig dövhet eller ensidig ansiktsförlam-ning (Bells pares). Båda tillstånden kan ha många olika förklaringar. An-siktsförlamning förknippas i vissa fall med borreliainfektion, men båda till-stånden saknar ofta en klarlagd orsak. Hos 10-24% av patienterna med plöts-lig dövhet hittades serumnivåer av antikroppar mot rickettsia som motsvarar en nyligen genomgången eller pågående infektion. Hos patienter med an-siktsförlamning var motsvarande siffra 10-20 % i Artikel IV. I Artikel V in-kluderades bara patienter med ensidig ansiktsförlamning och mellan 8,3 och 25 % av patienterna visade antikroppsreaktivitet mot rickettsia. Hos en pati-

57

ent med plötslig dövhet och två patienter med ensidig ansiktsförlamning hittades R. felis i ryggmärgsvätskan.

58

References

1. Salman MD, Tarrés-Call J, Estrada-Peña A, Farkas R, Jaenson TGT, Koenen F, et al. Ticks and tick-borne diseases: geographical distribution and control strategies in the Euro-Asia region. [Internet]. 2013 [cited 2016 Feb 22]. Avail-able from: http://public.eblib.com/choice/publicfullrecord.aspx?p=1106852

2. Wolbach SB. Studies on Rocky Mountain spotted Fever. J Med Res. 1919 Nov;41(1):1–198.41.

3. Raoult D, Roux V. Rickettsioses as paradigms of new or emerging infectious diseases. Clin Microbiol Rev. 1997 Oct;10(4):694–719.

4. Ricketts HT. The transmission of Rocky Mountain Spotted fever by the bite of the wood-tick (Dermacentor occidentalis). JAMA J Am Med Assoc. 1906 Aug 4;XLVII(5):358.

5. Pinkerton H. The pathogenic rickettsiae with partikular reference to their na-ture, biologic properties, and classification. Bacteriol Rev. 1942 Mar;6(1):37–78.

6. Ormsbee RA. Rickettsiae (as organisms). Annu Rev Microbiol. 1969;23:275–92.

7. Khasnis AA, Nettleman MD. Global warming and infectious disease. Arch Med Res. 2005 Dec;36(6):689–96.

8. Mayxay M, Castonguay-Vanier J, Chansamouth V, Dubot-Pérès A, Paris DH, Phetsouvanh R, et al. Causes of non-malarial fever in Laos: a prospective study. Lancet Glob Health. 2013 Jul;1(1):e46–54.

9. Heinrich N, Dill T, Dobler G, Clowes P, Kroidl I, Starke M, et al. High sero-prevalence for spotted fever group rickettsiae, is associated with higher tem-peratures and rural environment in Mbeya region, Southwestern Tanzania. PLoS Negl Trop Dis. 2015 Apr;9(4):e0003626.

10. Schriefer ME, Sacci JB, Dumler JS, Bullen MG, Azad AF. Identification of a novel rickettsial infection in a patient diagnosed with murine typhus. J Clin Microbiol. 1994 Apr;32(4):949–54.

11. Nilsson K, Jaenson TG, Uhnoo I, Lindquist O, Pettersson B, Uhlén M, et al. Characterization of a Spotted Fever Group Rickettsia from Ixodes ricinus ticks in Sweden. J Clin Microbiol. 1997 Jan;35(1):243–7.

12. Messenger AM, Barnes AN, Gray GC. Reverse zoonotic disease transmission (zooanthroponosis): a systematic review of seldom-documented human biolog-ical threats to animals. PloS One. 2014;9(2):e89055.

13. Taylor LH, Latham SM, woolhouse MEJ. Risk factors for human disease emergence. Philos Trans R Soc B Biol Sci. 2001 Jul 29;356(1411):983–9.

14. Jongejan F, Uilenberg G. The global importance of ticks. Parasitology. 2004;129 Suppl:S3–14.

15. Christou L. The global burden of bacterial and viral zoonotic infections. Clin Microbiol Infect Off Publ Eur Soc Clin Microbiol Infect Dis. 2011 Mar;17(3):326–30.

59

16. Parola P, Paddock CD, Raoult D. Tick-borne rickettsioses around the world: emerging diseases challenging old concepts. Clin Microbiol Rev. 2005 Oct;18(4):719–56.

17. Kelly PJ, Beati L, Mason PR, Matthewman LA, Roux V, Raoult D. Rickettsia africae sp. nov., the etiological agent of African tick bite fever. Int J Syst Bac-teriol. 1996 Apr;46(2):611–4.

18. Parola P, Paddock CD, Socolovschi C, Labruna MB, Mediannikov O, Kernif T, et al. Update on tick-borne rickettsioses around the world: a geographic ap-proach. Clin Microbiol Rev. 2013 Oct;26(4):657–702.

19. WHO | Public health response to biological and chemical weapons: WHO guidance (2004) [Internet]. [cited 2016 Feb 7]. Available from: http://www.who.int/csr/delibepidemics/biochemguide/en/

20. Jones KE, Patel NG, Levy MA, Storeygard A, Balk D, Gittleman JL, et al. Global trends in emerging infectious diseases. Nature. 2008 Feb 21;451(7181):990–3.

21. Rizzoli A, Silaghi C, Obiegala A, Rudolf I, Hubálek Z, Földvári G, et al. Ix-odes ricinus and Its Transmitted Pathogens in Urban and Peri-Urban Areas in Europe: New Hazards and Relevance for Public Health. Front Public Health. 2014;2:251.

22. Schulze TL, Jordan RA. Meteorologically mediated diurnal questing of Ixodes scapularis and Amblyomma americanum (Acari: Ixodidae) nymphs. J Med En-tomol. 2003 Jul;40(4):395–402.

23. Parola P, Socolovschi C, Jeanjean L, Bitam I, Fournier P-E, Sotto A, et al. Warmer weather linked to tick attack and emergence of severe rickettsioses. PLoS Negl Trop Dis. 2008;2(11):e338.

24. Maina AN, Knobel DL, Jiang J, Halliday J, Feikin DR, Cleaveland S, et al. Rickettsia felis infection in febrile patients, western Kenya, 2007-2010. Emerg Infect Dis. 2012 Feb;18(2):328–31.

25. Parola P. Rickettsia felis: from a rare disease in the USA to a common cause of fever in sub-Saharan Africa. Clin Microbiol Infect Off Publ Eur Soc Clin Mi-crobiol Infect Dis. 2011 Jul;17(7):996–1000.

26. Punjabi NH, Taylor WRJ, Murphy GS, Purwaningsih S, Picarima H, Sisson J, et al. Etiology of acute, non-malaria, febrile illnesses in Jayapura, northeastern Papua, Indonesia. Am J Trop Med Hyg. 2012 Jan;86(1):46–51.

27. Crump JA, Morrissey AB, Nicholson WL, Massung RF, Stoddard RA, Gallo-way RL, et al. Etiology of severe non-malaria febrile illness in Northern Tan-zania: a prospective cohort study. PLoS Negl Trop Dis. 2013;7(7):e2324.

28. Merhej V, Raoult D. Rickettsial evolution in the light of comparative ge-nomics. Biol Rev Camb Philos Soc. 2011 May;86(2):379–405.

29. Eisen L. Climate change and tick-borne diseases: A research field in need of long-term empirical field studies. Int J Med Microbiol. 2008 Sep;298:12–8.

30. Wendt A, Kreienbrock L, Campe A. Joint use of Disparate Data for the Sur-veillance of Zoonoses: A Feasibility Study for a One Health Approach in Ger-many. Zoonoses Public Health. 2016 Jan 27;

31. Kingsley P, Taylor EM. One Health: competing perspectives in an emerging field. Parasitology. 2016 Jan 28;1–8.

32. Sonenshine DE, Roe RM, editors. Biology of ticks. 2nd ed. New York: Oxford University Press; 2014.

33. Coipan EC, Jahfari S, Fonville M, Maassen CB, van der Giessen J, Takken W, et al. Spatiotemporal dynamics of emerging pathogens in questing Ixodes rici-nus. Front Cell Infect Microbiol. 2013;3:36.

60

34. Simser JA, Palmer AT, Fingerle V, Wilske B, Kurtti TJ, Munderloh UG. Rick-ettsia monacensis sp. nov., a Spotted Fever Group Rickettsia, from ticks (Ix-odes ricinus) collected in a European city park. Appl Environ Microbiol. 2002 Sep;68(9):4559–66.

35. Angelakis E, Raoult D. Q Fever. Vet Microbiol. 2010 Jan 27;140(3-4):297–309.

36. Bente DA, Forrester NL, Watts DM, McAuley AJ, Whitehouse CA, Bray M. Crimean-Congo hemorrhagic fever: history, epidemiology, pathogenesis, clini-cal syndrome and genetic diversity. Antiviral Res. 2013 Oct;100(1):159–89.

37. Wyrick PB. Intracellular survival by Chlamydia. Cell Microbiol. 2000 Aug;2(4):275–82.

38. Han XY, Silva FJ. On the age of leprosy. PLoS Negl Trop Dis. 2014 Feb;8(2):e2544.

39. Palmer G, Azad AF, Tan M, editors. Intracellular pathogens II: Rickettsiales. Washington, DC: ASM Press; 2012.

40. McMurray DN. Mycobacteria and Nocardia. In: Baron S, editor. Medical Mi-crobiology. 4th ed. Galveston (TX): University of Texas Medical Branch at Galveston; 1996.

41. Weiss E. The biology of rickettsiae. Annu Rev Microbiol. 1982;36:345–70. 42. Walker DH. Rickettsiae. In: Baron S, editor. Medical Microbiology [Internet].

4th ed. Galveston (TX): University of Texas Medical Branch at Galveston; 1996 [cited 2016 Mar 13]. Available from: http://www.ncbi.nlm.nih.gov/books/NBK7624/

43. Taxonomy browser (Rickettsia) [Internet]. [cited 2016 Mar 4]. Available from: http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=780

44. Roux V, Raoult D. Genotypic identification and phylogenetic analysis of the spotted fever group rickettsiae by pulsed-field gel electrophoresis. J Bacteriol. 1993 Aug;175(15):4895–904.

45. Tyeryar FJ, Weiss E, Millar DB, Bozeman FM, Ormsbee RA. DNA base com-position of rickettsiae. Science. 1973 Apr 27;180(4084):415–7.

46. Andersson SG, Zomorodipour A, Andersson JO, Sicheritz-Pontén T, Alsmark UC, Podowski RM, et al. The genome sequence of Rickettsia prowazekii and the origin of mitochondria. Nature. 1998 Nov 12;396(6707):133–40.

47. Fournier P-E, El Karkouri K, Leroy Q, Robert C, Giumelli B, Renesto P, et al. Analysis of the Rickettsia africae genome reveals that virulence acquisition in Rickettsia species may be explained by genome reduction. BMC Genomics. 2009;10:166.

48. Andersson JO, Andersson SG. Genome degradation is an ongoing process in Rickettsia. Mol Biol Evol. 1999 Sep;16(9):1178–91.

49. Ogata H, Renesto P, Audic S, Robert C, Blanc G, Fournier P-E, et al. The genome sequence of Rickettsia felis identifies the first putative conjugative plasmid in an obligate intracellular parasite. PLoS Biol. 2005 Aug;3(8):e248.

50. Baldridge GD, Burkhardt NY, Labruna MB, Pacheco RC, Paddock CD, Wil-liamson PC, et al. Wide dispersal and possible multiple origins of low-copy-number plasmids in rickettsia species associated with blood-feeding arthro-pods. Appl Environ Microbiol. 2010 Mar;76(6):1718–31.

51. Baldridge GD, Burkhardt NY, Felsheim RF, Kurtti TJ, Munderloh UG. Trans-poson insertion reveals pRM, a plasmid of Rickettsia monacensis. Appl Envi-ron Microbiol. 2007 Aug;73(15):4984–95.

61

52. Baldridge GD, Burkhardt NY, Felsheim RF, Kurtti TJ, Munderloh UG. Plas-mids of the pRM/pRF family occur in diverse Rickettsia species. Appl Environ Microbiol. 2008 Feb;74(3):645–52.

53. Blanc G, Ogata H, Robert C, Audic S, Claverie J-M, Raoult D. Lateral gene transfer between obligate intracellular bacteria: evidence from the Rickettsia massiliae genome. Genome Res. 2007 Nov;17(11):1657–64.

54. Fournier P-E, Raoult D. Current knowledge on phylogeny and taxonomy of Rickettsia spp. Ann N Y Acad Sci. 2009 May;1166:1–11.

55. Roux V, Raoult D. Phylogenetic analysis of the genus Rickettsia by 16S rDNA sequencing. Res Microbiol. 1995 Jun;146(5):385–96.

56. Fournier P-E, Dumler JS, Greub G, Zhang J, Wu Y, Raoult D. Gene sequence-based criteria for identification of new rickettsia isolates and description of Rickettsia heilongjiangensis sp. nov. J Clin Microbiol. 2003 Dec;41(12):5456–65.

57. Roux V, Rydkina E, Eremeeva M, Raoult D. Citrate synthase gene comparison, a new tool for phylogenetic analysis, and its application for the rickettsiae. Int J Syst Bacteriol. 1997 Apr;47(2):252–61.

58. Roux V, Raoult D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmpB (ompB). Int J Syst Evol Microbiol. 2000 Jul;50 Pt 4:1449–55.

59. Sekeyova Z, Roux V, Raoult D. Phylogeny of Rickettsia spp. inferred by com-paring sequences of “gene D”, which encodes an intracytoplasmic protein. Int J Syst Evol Microbiol. 2001 Jul;51(Pt 4):1353–60.

60. Fournier PE, Roux V, Raoult D. Phylogenetic analysis of spotted fever group rickettsiae by study of the outer surface protein rOmpA. Int J Syst Bacteriol. 1998 Jul;48 Pt 3:839–49.

61. Anderson BE, Tzianabos T. Comparative sequence analysis of a genus-common rickettsial antigen gene. J Bacteriol. 1989 Sep;171(9):5199–201.

62. Roux V, Fournier PE, Raoult D. Differentiation of spotted fever group rickett-siae by sequencing and analysis of restriction fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rOmpA. J Clin Microbi-ol. 1996 Sep;34(9):2058–65.

63. Dumler JS, Barbet AF, Bekker CP, Dasch GA, Palmer GH, Ray SC, et al. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Ana-plasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and “HGE agent” as subjective synonyms of Ehrlichia phagocytophila. Int J Syst Evol Microbiol. 2001 Nov;51(Pt 6):2145–65.

64. Tamura A, Ohashi N, Urakami H, Miyamura S. Classification of Rickettsia tsutsugamushi in a new genus, Orientia gen. nov., as Orientia tsutsugamushi comb. nov. Int J Syst Bacteriol. 1995 Jul;45(3):589–91.

65. Merhej V, El Karkouri K, Raoult D. Whole genome-based phylogenetic analy-sis of Rickettsiae. Clin Microbiol Infect Off Publ Eur Soc Clin Microbiol Infect Dis. 2009 Dec;15 Suppl 2:336–7.

66. Huebner RJ, Jellison WL, Pomerantz C. Public Health Weekly Reports for November 22, 1946. Public Health Rep. 1946 Nov 22;61(47):1677–712.

67. Azad AF, Sacci JB, Nelson WM, Dasch GA, Schmidtmann ET, Carl M. Genet-ic characterization and transovarial transmission of a typhus-like rickettsia found in cat fleas. Proc Natl Acad Sci U S A. 1992 Jan 1;89(1):43–6.

68. Matthews BE. An Introduction to Parasitology. Cambridge University Press; 1998.

62

69. Rust MK, Dryden MW. The biology, ecology, and management of the cat flea. Annu Rev Entomol. 1997;42:451–73.

70. Parola P, Raoult D. Ticks and tickborne bacterial diseases in humans: an emerging infectious threat. Clin Infect Dis Off Publ Infect Dis Soc Am. 2001 Mar 15;32(6):897–928.

71. Mans BJ, de Klerk D, Pienaar R, Latif AA. Nuttalliella namaqua: a living fossil and closest relative to the ancestral tick lineage: implications for the evo-lution of blood-feeding in ticks. PloS One. 2011;6(8):e23675.

72. Oliver JH. Biology and Systematics of Ticks (Acari:Ixodida). Annu Rev Ecol Syst. 1989;20:397–430.

73. Diakou A, Norte AC, Lopes de Carvalho I, Núncio S, Nováková M, Kautman M, et al. Ticks and tick-borne pathogens in wild birds in Greece. Parasitol Res. 2016 Feb 4;

74. Jaenson TG, Tälleklint L, Lundqvist L, Olsen B, Chirico J, Mejlon H. Geo-graphical distribution, host associations, and vector roles of ticks (Acari: Ixodi-dae, Argasidae) in Sweden. J Med Entomol. 1994 Mar;31(2):240–56.

75. Matsumoto K, Ogawa M, Brouqui P, Raoult D, Parola P. Transmission of Rickettsia massiliae in the tick, Rhipicephalus turanicus. Med Vet Entomol. 2005 Sep;19(3):263–70.

76. Milhano N, Popov V, Vilhena M, Bouyer DH, de Sousa R, Walker DH. Quan-titative study of Rickettsia massiliae in Rhipicephalus sanguineus organs. Ticks Tick-Borne Dis. 2014 Oct;5(6):709–14.

77. Gage KL, Gilmore RD, Karstens RH, Schwan TG. Detection of Rickettsia rickettsii in saliva, hemolymph and triturated tissues of infected Dermacentor andersoni ticks by polymerase chain reaction. Mol Cell Probes. 1992 Aug;6(4):333–41.

78. Socolovschi C, Bitam I, Raoult D, Parola P. Transmission of Rickettsia conorii conorii in naturally infected Rhipicephalus sanguineus. Clin Microbiol Infect Off Publ Eur Soc Clin Microbiol Infect Dis. 2009 Dec;15 Suppl 2:319–21.

79. Burgdorfer W, Varma MG. Trans-stadial and transovarial development of disease agents in arthropods. Annu Rev Entomol. 1967;12:347–76.

80. Levin ML, Killmaster L, Eremeeva ME, Dasch GA. Effects of Rickettsia conorii infection on the survival of Rhipicephalus sanguineus ticks. Clin Mi-crobiol Infect Off Publ Eur Soc Clin Microbiol Infect Dis. 2009 Dec;15 Suppl 2:277–8.

81. Macaluso KR, Sonenshine DE, Ceraul SM, Azad AF. Rickettsial infection in Dermacentor variabilis (Acari: Ixodidae) inhibits transovarial transmission of a second Rickettsia. J Med Entomol. 2002 Nov;39(6):809–13.

82. Zemtsova G, Killmaster LF, Mumcuoglu KY, Levin ML. Co-feeding as a route for transmission of Rickettsia conorii israelensis between Rhipicephalus san-guineus ticks. Exp Appl Acarol. 2010 Dec;52(4):383–92.

83. Niebylski ML, Peacock MG, Schwan TG. Lethal effect of Rickettsia rickettsii on its tick vector (Dermacentor andersoni). Appl Environ Microbiol. 1999 Feb;65(2):773–8.

84. Jones LD, Davies CR, Steele GM, Nuttall PA. A novel mode of arbovirus transmission involving a nonviremic host. Science. 1987 Aug 14;237(4816):775–7.

85. Hayes SF, Burgdorfer W, Aeschlimann A. Sexual transmission of spotted fever group rickettsiae by infected male ticks: detection of rickettsiae in immature spermatozoa of Ixodes ricinus. Infect Immun. 1980 Feb;27(2):638–42.

63

86. Philip CB, Parker RR. Rocky Mountain Spotted Fever: Investigation of Sexual Transmission in the Wood Tick Dermacentor andersoni. Public Health Rep 1896-1970. 1933;48(11):266.

87. Dantas-Torres F. The brown dog tick, Rhipicephalus sanguineus (Latreille, 1806) (Acari: Ixodidae): from taxonomy to control. Vet Parasitol. 2008 Apr 15;152(3-4):173–85.

88. Tappe J, Strube C. Anaplasma phagocytophilum and Rickettsia spp. infections in hard ticks (Ixodes ricinus) in the city of Hanover (Germany): revisited. Ticks Tick-Borne Dis. 2013 Sep;4(5):432–8.

89. Hutchinson ML, Strohecker MD, Simmons TW, Kyle AD, Helwig MW. Prevalence Rates of Borrelia burgdorferi (Spirochaetales: Spirochaetaceae), Anaplasma phagocytophilum (Rickettsiales: Anaplasmataceae), and Babesia microti (Piroplasmida: Babesiidae) in Host-Seeking Ixodes scapularis (Acari: Ixodidae) from Pennsylvania. J Med Entomol. 2015 Jul;52(4):693–8.

90. Levin ML, Fish D. Acquisition of coinfection and simultaneous transmission of Borrelia burgdorferi and Ehrlichia phagocytophila by Ixodes scapularis ticks. Infect Immun. 2000 Apr;68(4):2183–6.

91. Andersson M, Zaghdoudi-Allan N, Tamba P, Stefanache M, Chitimia L. Co-infection with “Candidatus Neoehrlichia mikurensis” and Borrelia afzelii in an Ixodes ricinus tick that has bitten a human in Romania. Ticks Tick-Borne Dis. 2014 Oct;5(6):706–8.

92. Toma L, Mancini F, Di Luca M, Cecere JG, Bianchi R, Khoury C, et al. Detec-tion of microbial agents in ticks collected from migratory birds in central Italy. Vector Borne Zoonotic Dis Larchmt N. 2014 Mar;14(3):199–205.

93. Krause PJ, McKay K, Thompson CA, Sikand VK, Lentz R, Lepore T, et al. Disease-specific diagnosis of coinfecting tickborne zoonoses: babesiosis, hu-man granulocytic ehrlichiosis, and Lyme disease. Clin Infect Dis Off Publ In-fect Dis Soc Am. 2002 May 1;34(9):1184–91.

94. Zaiem F, Alkhawam H, Lee S, Fabisevich M. Severe symptomatic babesiosis co-infection with Lyme disease. QJM Mon J Assoc Physicians. 2015 Sep 14;

95. Elfving K, Lindblom A, Nilsson K. Seroprevalence of Rickettsia spp. infection among tick-bitten patients and blood donors in Sweden. Scand J Infect Dis. 2008;40(1):74–7.

96. Andersson M, Bartkova S, Lindestad O, Råberg L. Co-infection with “Candi-datus Neoehrlichia Mikurensis” and Borrelia afzelii in Ixodes ricinus ticks in southern Sweden. Vector Borne Zoonotic Dis Larchmt N. 2013 Jul;13(7):438–42.

97. Nordberg M, Forsberg P, Berglund J, Bjöersdorff A, Ernerudh J, Garpmo U, et al. Aetiology of Tick-Borne Infections in an Adult Swedish Population—Are Co-Infections with Multiple Agents Common? Open J Clin Diagn. 2014;04(01):31–40.

98. Schwemmler W. Insect Endocytobiosis. CRC Press; 1989. 99. Noda H, Munderloh UG, Kurtti TJ. Endosymbionts of ticks and their relation-

ship to Wolbachia spp. and tick-borne pathogens of humans and animals. Appl Environ Microbiol. 1997 Oct;63(10):3926–32.

100. Mattila JT, Munderloh UG, Kurtti TJ. Rickettsia peacockii, an endosymbiont of Dermacentor andersoni, does not elicit or inhibit humoral immune responses from immunocompetent D. andersoni or Ixodes scapularis cell lines. Dev Comp Immunol. 2007;31(11):1095–106.

64

101. Niebylski ML, Schrumpf ME, Burgdorfer W, Fischer ER, Gage KL, Schwan TG. Rickettsia peacockii sp. nov., a new species infecting wood ticks, Derma-centor andersoni, in western Montana. Int J Syst Bacteriol. 1997 Apr;47(2):446–52.

102. Ahantarig A, Trinachartvanit W, Baimai V, Grubhoffer L. Hard ticks and their bacterial endosymbionts (or would be pathogens). Folia Microbiol (Praha). 2013 Sep;58(5):419–28.

103. Wright CL, Gaff HD, Sonenshine DE, Hynes WL. Experimental vertical transmission of Rickettsia parkeri in the Gulf Coast tick, Amblyomma macula-tum. Ticks Tick-Borne Dis. 2015 Jul;6(5):568–73.

104. Socolovschi C, Matsumoto K, Brouqui P, Raoult D, Parola P. Experimental infection of Rhipicephalus sanguineus with Rickettsia conorii conorii. Clin Microbiol Infect Off Publ Eur Soc Clin Microbiol Infect Dis. 2009 Dec;15 Suppl 2:324–5.

105. Socolovschi C, Gaudart J, Bitam I, Huynh TP, Raoult D, Parola P. Why are there so few Rickettsia conorii conorii-infected Rhipicephalus sanguineus ticks in the wild? PLoS Negl Trop Dis. 2012;6(6):e1697.

106. Burgdorfer W, Brinton LP. Mechanisms of transovarial infection of spotted fever Rickettsiae in ticks. Ann N Y Acad Sci. 1975;266:61–72.

107. Zhang X-C, Yang Z-N, Lu B, Ma X-F, Zhang C-X, Xu H-J. The composition and transmission of microbiome in hard tick, Ixodes persulcatus, during blood meal. Ticks Tick-Borne Dis. 2014 Oct;5(6):864–70.

108. Haydon DT, Cleaveland S, Taylor LH, Laurenson MK. Identifying reservoirs of infection: a conceptual and practical challenge. Emerg Infect Dis. 2002 Dec;8(12):1468–73.

109. Socolovschi C, Mediannikov O, Raoult D, Parola P. The relationship between spotted fever group Rickettsiae and ixodid ticks. Vet Res. 2009 Apr;40(2):34.

110. Ye X, Sun Y, Ju W, Wang X, Cao W, Wu M. Vector competence of the tick Ixodes sinensis (Acari: Ixodidae) for Rickettsia monacensis. Parasit Vectors. 2014;7:512.

111. Sprong H, Wielinga PR, Fonville M, Reusken C, Brandenburg AH, Borgsteede F, et al. Ixodes ricinus ticks are reservoir hosts for Rickettsia helvetica and po-tentially carry flea-borne Rickettsia species. Parasit Vectors. 2009;2(1):41.

112. Elfving K, Malmsten J, Dalin A-M, Nilsson K. Serologic and Molecular Preva-lence of Rickettsia helvetica and Anaplasma phagocytophilum in Wild Cervids and Domestic Mammals in the Central Parts of Sweden. Vector Borne Zoono-tic Dis Larchmt N. 2015 Sep;15(9):529–34.

113. Tamekuni K, Toledo R dos S, Silva Filho M de F, Haydu VB, Pacheco RC, Cavicchioli JH, et al. Serosurvey of antibodies against spotted fever group Rickettsia spp. in horse farms in Northern Paraná, Brazil. Rev Bras Parasitol Veterinária Braz J Vet Parasitol Órgão Of Colégio Bras Parasitol Veterinária. 2010 Dec;19(4):259–61.

114. Inokuma H, Seino N, Suzuki M, Kaji K, Takahashi H, Igota H, et al. Detection of Rickettsia helvetica DNA from peripheral blood of Sika deer (Cervus nippon yesoensis) in Japan. J Wildl Dis. 2008 Jan;44(1):164–7.

115. potential reservoirs of tick-borne pathogens: first evidence of bacteraemia with Rickettsia helvetica. Parasit Vectors. 2014;7:128.

116. Solano-Gallego L, Kidd L, Trotta M, Di Marco M, Caldin M, Furlanello T, et al. Febrile illness associated with Rickettsia conorii infection in dogs from Sici-ly. Emerg Infect Dis. 2006 Dec;12(12):1985–8.

65

117. Segura F, Pons I, Miret J, Pla J, Ortuño A, Nogueras M-M. The role of cats in the eco-epidemiology of spotted fever group diseases. Parasit Vectors. 2014;7:353.

118. Schex S, Dobler G, Riehm J, Müller J, Essbauer S. Rickettsia spp. in wild small mammals in Lower Bavaria, South-Eastern Germany. Vector Borne Zoonotic Dis Larchmt N. 2011 May;11(5):493–502.

119. Levin ML, Killmaster LF, Zemtsova GE. Domestic dogs (Canis familiaris) as reservoir hosts for Rickettsia conorii. Vector Borne Zoonotic Dis Larchmt N. 2012 Jan;12(1):28–33.

120. Dworkin M, Falkow S, editors. The prokaryotes: a handbook on the biology of

121. Abdad MY, Stenos J, Graves S. Rickettsia felis, an emerging flea-transmitted human pathogen. Emerg Health Threats J. 2011;4:7168.

122. Portillo A, Santibáñez S, García-Álvarez L, Palomar AM, Oteo JA. Rick-ettsioses in Europe. Microbes Infect Inst Pasteur. 2015 Dec;17(11-12):834–8.

123. Hoogstraal H, Kaiser MN, Traylor MA, Guindy E, Gaber S. Ticks (Ixodidae) on birds migrating from Europe and Asia to Africa 1959-61. Bull World Health Organ. 1963;28(2):235–62.

124. Olsén B, Jaenson TG, Noppa L, Bunikis J, Bergström S. A Lyme borreliosis cycle in seabirds and Ixodes uriae ticks. Nature. 1993 Mar 25;362(6418):340–2.

125. Mukherjee N, Beati L, Sellers M, Burton L, Adamson S, Robbins RG, et al. Importation of exotic ticks and tick-borne spotted fever group rickettsiae into the United States by migrating songbirds. Ticks Tick-Borne Dis. 2014 Mar;5(2):127–34.

126. Berthová L, Slobodník V, Slobodník R, Olekšák M, Sekeyová Z, Svitálková Z, et al. The natural infection of birds and ticks feeding on birds with Rickettsia spp. and Coxiella burnetii in Slovakia. Exp Appl Acarol. 2015 Oct 17;

127. Hasle G. Transport of ixodid ticks and tick-borne pathogens by migratory birds. Front Cell Infect Microbiol. 2013;3:48.

128. Beninati T, Genchi C, Torina A, Caracappa S, Bandi C, Lo N. Rickettsiae in ixodid ticks, Sicily. Emerg Infect Dis. 2005 Mar;11(3):509–11.

129. Parola P, Jourdan J, Raoult D. Tick-borne infection caused by Rickettsia afri-cae in the West Indies. N Engl J Med. 1998 May 7;338(19):1391.

130. Robinson JB, Eremeeva ME, Olson PE, Thornton SA, Medina MJ, Sumner JW, et al. New approaches to detection and identification of Rickettsia africae and Ehrlichia ruminantium in Amblyomma variegatum (Acari: Ixodidae) ticks from the Caribbean. J Med Entomol. 2009 Jul;46(4):942–51.

131. Rizzoli A, Hauffe H, Carpi G, Vourc H G, Neteler M, Rosa R. Lyme borrelio-sis in Europe. Euro Surveill Bull Eur Sur Mal Transm Eur Commun Dis Bull. 2011;16(27).

132. Beaujean D, Crutzen R, Kengen C, van Steenbergen J, Ruwaard D. Increase in Ticks and Lyme Borreliosis, Yet Research into Its Prevention on the Wane. Vector Borne Zoonotic Dis Larchmt N. 2016 Feb 22;

133. Kunze U. The International Scientific Working Group on Tick-Borne Encepha-litis (ISW TBE): Review of 17 years of activity and commitment. Ticks Tick-Borne Dis. 2015 Dec 29;

134. Cases by year [Internet]. [cited 2016 Mar 4]. Available from: http://ecdc.europa.eu/en/healthtopics/emerging_and_vector-borne_diseases/tick_borne_diseases/tick_borne_encephalitis/TBE-epidemiology/Pages/cases-by-year.aspx

66

135. Süss J, Klaus C, Gerstengarbe F-W, Werner PC. What makes ticks tick? Cli-mate change, ticks, and tick-borne diseases. J Travel Med. 2008 Feb;15(1):39–45.

136. Jensen PM, Hansen H, Frandsen F. Spatial risk assessment for Lyme borrelio-sis in Denmark. Scand J Infect Dis. 2000;32(5):545–50.

137. Jaenson TGT, Jaenson DGE, Eisen L, Petersson E, Lindgren E. Changes in the geographical distribution and abundance of the tick Ixodes ricinus during the past 30 years in Sweden. Parasit Vectors. 2012;5:8.

138. Randolph SE. Evidence that climate change has caused “emergence” of tick-borne diseases in Europe? Int J Med Microbiol IJMM. 2004 Apr;293 Suppl 37:5–15.

139. Gray JS. Ixodes ricinus seasonal activity: Implications of global warming indi-cated by revisiting tick and weather data. Int J Med Microbiol. 2008 Sep;298:19–24.

140. Tälleklint L, Jaenson TG. Increasing geographical distribution and density of Ixodes ricinus (Acari: Ixodidae) in central and northern Sweden. J Med Ento-mol. 1998 Jul;35(4):521–6.

141. Lindblom A, Severinson K, Nilsson K. Rickettsia felis infection in Sweden: report of two cases with subacute meningitis and review of the literature. Scand J Infect Dis. 2010 Dec;42(11-12):906–9.

142. Wallménius K, Pettersson JH-O, Jaenson TGT, Nilsson K. Prevalence of Rick-ettsia spp., Anaplasma phagocytophilum, and Coxiella burnetii in adult Ixodes ricinus ticks from 29 study areas in central and southern Sweden. Ticks Tick-Borne Dis. 2012 Apr;3(2):100–6.

143. Nilsson K, Lindquist O, Liu AJ, Jaenson TG, Friman G, Påhlson C. Rickettsia helvetica in Ixodes ricinus ticks in Sweden. J Clin Microbiol. 1999 Feb;37(2):400–3.

144. Severinsson K, Jaenson TG, Pettersson J, Falk K, Nilsson K. Detection and prevalence of Anaplasma phagocytophilum and Rickettsia helvetica in Ixodes ricinus ticks in seven study areas in Sweden. Parasit Vectors. 2010;3:66.

145. Granquist EG, Kristiansson M, Lindgren P-E, Matussek A, Nødtvedt A, Ok-stad W, et al. Evaluation of microbial communities and symbionts in Ixodes ricinus and ungulate hosts (Cervus elaphus and Ovis aries) from shared habi-tats on the west coast of Norway. Ticks Tick-Borne Dis. 2014 Oct;5(6):780–4.

146. Quarsten H, Skarpaas T, Fajs L, Noraas S, Kjelland V. Tick-borne bacteria in Ixodes ricinus collected in southern Norway evaluated by a commercial kit and established real-time PCR protocols. Ticks Tick-Borne Dis. 2015 Jun;6(4):538–44.

147. Nielsen H, Fournier P-E, Pedersen IS, Krarup H, Ejlertsen T, Raoult D. Sero-logical and molecular evidence of Rickettsia helvetica in Denmark. Scand J In-fect Dis. 2004;36(8):559–63.

148. Svendsen CB, Krogfelt KA, Jensen PM. Detection of Rickettsia spp. in Danish ticks (Acari: Ixodes ricinus) using real-time PCR. Scand J Infect Dis. 2009;41(1):70–2.

149. Kantsø B, Svendsen CB, Jensen PM, Vennestrøm J, Krogfelt KA. Seasonal and habitat variation in the prevalence of Rickettsia helvetica in Ixodes ricinus ticks from Denmark. Ticks Tick-Borne Dis. 2010 Jun;1(2):101–3.

150. Katargina O, Geller J, Ivanova A, Värv K, Tefanova V, Vene S, et al. Detec-tion and identification of Rickettsia species in Ixodes tick populations from Es-tonia. Ticks Tick-Borne Dis. 2015 Sep;6(6):689–94.

67

151. Elfving K, Olsen B, Bergström S, Waldenström J, Lundkvist A, Sjöstedt A, et al. Dissemination of spotted fever rickettsia agents in Europe by migrating birds. PloS One. 2010;5(1):e8572.

152. Faccini-Martínez ÁA, García-Álvarez L, Hidalgo M, Oteo JA. Syndromic classification of rickettsioses: an approach for clinical practice. Int J Infect Dis IJID Off Publ Int Soc Infect Dis. 2014 Nov;28:126–39.

153. Jensenius M, Fournier P-E, Kelly P, Myrvang B, Raoult D. African tick bite fever. Lancet Infect Dis. 2003 Sep;3(9):557–64.

154. Botelho-Nevers E, Rovery C, Richet H, Raoult D. Analysis of risk factors for malignant Mediterranean spotted fever indicates that fluoroquinolone treatment has a deleterious effect. J Antimicrob Chemother. 2011 Aug;66(8):1821–30.

155. Mouffok N, Parola P, Lepidi H, Raoult D. Mediterranean spotted fever in Al-geria-new trends. Int J Infect Dis IJID Off Publ Int Soc Infect Dis. 2009 Mar;13(2):227–35.

156. Silva-Pinto A, Santos M de L, Sarmento A. Tick-borne lymphadenopathy, an emerging disease. Ticks Tick-Borne Dis. 2014 Oct;5(6):656–9.

157. Oteo JA, Ibarra V, Blanco JR, Martínez de Artola V, Márquez FJ, Portillo A, et al. Dermacentor-borne necrosis erythema and lymphadenopathy: clinical and epidemiological features of a new tick-borne disease. Clin Microbiol Infect Off Publ Eur Soc Clin Microbiol Infect Dis. 2004 Apr;10(4):327–31.

158. Dubourg G, Socolovschi C, Del Giudice P, Fournier PE, Raoult D. Scalp es-char and neck lymphadenopathy after tick bite: an emerging syndrome with multiple causes. Eur J Clin Microbiol Infect Dis Off Publ Eur Soc Clin Micro-biol. 2014 Aug;33(8):1449–56.

159. Cascio A, Torina A, Valenzise M, Blanda V, Camarda N, Bombaci S, et al. Scalp eschar and neck lymphadenopathy caused by Rickettsia massiliae. Emerg Infect Dis. 2013 May;19(5):836–7.

160. Pérez-Pérez L, Portillo A, Allegue F, Zulaica A, Oteo JA, Caeiro J-L, et al. Dermacentor-borne Necrosis Erythema and Lymphadenopathy (DEBONEL): A case associated with Rickettsia rioja. Acta Derm Venereol. 2010 Mar;90(2):214–5.

161. Ibarra V, Portillo A, Palomar AM, Sanz MM, Metola L, Blanco JR, et al. Sep-tic shock in a patient infected with Rickettsia sibirica mongolitimonae, Spain. Clin Microbiol Infect Off Publ Eur Soc Clin Microbiol Infect Dis. 2012 Aug;18(8):E283–5.

162. Oteo JA, Portillo A. Tick-borne rickettsioses in Europe. Ticks Tick-Borne Dis. 2012 Dec;3(5-6):271–8.

163. Kostopoulou V, Chochlakis D, Kanta C, Katsanou A, Rossiou K, Rammos A, et al. A case of human infection by Rickettsia slovaca in Greece. Jpn J Infect Dis. 2015 Sep;11 DOI: 10.7883/yoken.JJID.2015.194.

164. Khairallah M, Zaouali S, Ben Yahia S, Ladjimi A, Messaoud R, Jenzeri S, et al. Anterior Ischemic Optic Neuropathy Associated With Rickettsia Conorii In-fection. J Neuro-Ophthalmol Off J North Am Neuro-Ophthalmol Soc. 2005 Sep;25(3):212–4.

165. Agahan ALD, Torres J, Fuentes-Páez G, Martínez-Osorio H, Orduña A, Calonge M. Intraocular inflammation as the main manifestation of Rickettsia conorii infection. Clin Ophthalmol Auckl NZ. 2011;5:1401–7.

166. Vaphiades MS. Rocky Mountain Spotted Fever as a cause of macular star fig-ure. J Neuro-Ophthalmol Off J North Am Neuro-Ophthalmol Soc. 2003 Dec;23(4):276–8.

68

167. Caisso C, Payan J, Dunais B, Neri D, Vassallo M. A case of uveitis due to Rickettsia conorii infection in Southeastern France. Ticks Tick-Borne Dis. 2016 Mar;7(2):338–41.

168. Pettersson JH-O. The Origin of the Genus Flavivirus and the Ecology of Tick-Borne Pathogens [dissertation]. [Uppsala]: Acta Universitatis Upsaliensis; 2013.

169. Wilson LB, Chowning WM. Classics in infectious diseases. Reprinted from The Journal of Infectious Diseases 1:31-57, 1904. Studies in Pyroplasmosis Hominis (“Spotted Fever” or “Tick Fever” of the Rocky Mountains). Rev In-fect Dis. 1979 Jun;1(3):540–58.

170. Regan JJ, Traeger MS, Humpherys D, Mahoney DL, Martinez M, Emerson GL, et al. Risk factors for fatal outcome from rocky mountain spotted Fever in a highly endemic area-Arizona, 2002-2011. Clin Infect Dis Off Publ Infect Dis Soc Am. 2015 Jun 1;60(11):1659–66.

171. Raoult D, Ndihokubwayo JB, Tissot-Dupont H, Roux V, Faugere B, Abegbinni R, et al. Outbreak of epidemic typhus associated with trench fever in Burundi. Lancet Lond Engl. 1998 Aug 1;352(9125):353–8.

172. Raoult D, Weiller PJ, Chagnon A, Chaudet H, Gallais H, Casanova P. Mediter-ranean spotted fever: clinical, laboratory and epidemiological features of 199 cases. Am J Trop Med Hyg. 1986 Jul;35(4):845–50.

173. de Sousa R, Nóbrega SD, Bacellar F, Torgal J. Mediterranean spotted fever in Portugal: risk factors for fatal outcome in 105 hospitalized patients. Ann N Y Acad Sci. 2003 Jun;990:285–94.

174. Holman RC, Paddock CD, Curns AT, Krebs JW, McQuiston JH, Childs JE. Analysis of risk factors for fatal Rocky Mountain Spotted Fever: evidence for superiority of tetracyclines for therapy. J Infect Dis. 2001 Dec 1;184(11):1437–44.

175. Helmick CG, Bernard KW, D’Angelo LJ. Rocky Mountain spotted fever: clin-ical, laboratory, and epidemiological features of 262 cases. J Infect Dis. 1984 Oct;150(4):480–8.

176. La Scola B, Bechah Y, Lepidi H, Raoult D. Prediction of rickettsial skin es-chars in humans using an experimental guinea pig model. Microb Pathog. 2009 Sep;47(3):128–33.

177. Sahni SK, Narra HP, Sahni A, Walker DH. Recent molecular insights into rickettsial pathogenesis and immunity. Future Microbiol. 2013 Oct;8(10):1265–88.

178. Sahni SK. Endothelial cell infection and hemostasis. Thromb Res. 2007;119(5):531–49.

179. Cardwell MM, Martinez JJ. The Sca2 autotransporter protein from Rickettsia conorii is sufficient to mediate adherence to and invasion of cultured mamma-lian cells. Infect Immun. 2009 Dec;77(12):5272–80.

180. Li H, Walker DH. rOmpA is a critical protein for the adhesion of Rickettsia rickettsii to host cells. Microb Pathog. 1998 May;24(5):289–98.

181. Blanc G, Ngwamidiba M, Ogata H, Fournier P-E, Claverie J-M, Raoult D. Molecular evolution of rickettsia surface antigens: evidence of positive selec-tion. Mol Biol Evol. 2005 Oct;22(10):2073–83.

182. Riley SP, Goh KC, Hermanas TM, Cardwell MM, Chan YGY, Martinez JJ. The Rickettsia conorii autotransporter protein Sca1 promotes adherence to nonphagocytic mammalian cells. Infect Immun. 2010 May;78(5):1895–904.

69

183. Chan YGY, Cardwell MM, Hermanas TM, Uchiyama T, Martinez JJ. Rickett-sial outer-membrane protein B (rOmpB) mediates bacterial invasion through Ku70 in an actin, c-Cbl, clathrin and caveolin 2-dependent manner. Cell Mi-crobiol. 2009 Apr;11(4):629–44.

184. Stevens JM, Galyov EE, Stevens MP. Actin-dependent movement of bacterial pathogens. Nat Rev Microbiol. 2006 Feb;4(2):91–101.

185. Reed SCO, Lamason RL, Risca VI, Abernathy E, Welch MD. Rickettsia actin-based motility occurs in distinct phases mediated by different actin nucleators. Curr Biol CB. 2014 Jan 6;24(1):98–103.

186. Van Kirk LS, Hayes SF, Heinzen RA. Ultrastructure of Rickettsia rickettsii actin tails and localization of cytoskeletal proteins. Infect Immun. 2000 Aug;68(8):4706–13.

187. Dittrich S, Rattanavong S, Lee SJ, Panyanivong P, Craig SB, Tulsiani SM, et al. Orientia, rickettsia, and leptospira pathogens as causes of CNS infections in Laos: a prospective study. Lancet Glob Health. 2015 Feb;3(2):e104–12.

188. Silpapojakul K, Ukkachoke C, Krisanapan S, Silpapojakul K. Rickettsial me-ningitis and encephalitis. Arch Intern Med. 1991 Sep;151(9):1753–7.

189. Koetsveld J, Tijsse-Klasen E, Herremans T, Hovius JWR, Sprong H. Serologi-cal and molecular evidence for spotted fever group Rickettsia and Borrelia burgdorferi sensu lato co-infections in The Netherlands. Ticks Tick-Borne Dis. 2015 Dec 17;

190. L, et al. Survival of rat cerebrocortical neurons after rickettsial infection. Mi-crobes Infect Inst Pasteur. 2015 Dec;17(11-12):845–9.

191. Rajadhyaksha A, Phatak S, Nolkha N, Pathan Y, Sonawale A. Rickettsial fever presenting with isolated third nerve palsy. J Assoc Physicians India. 2013 Feb;61(2):144–5.

192. Bitsori M, Galanakis E, Papadakis CE, Sbyrakis S. Facial nerve palsy associat-ed with Rickettsia conorii infection. Arch Dis Child. 2001 Jul;85(1):54–5.

193. Kularatne S a. M, Weerakoon KG a. D, Rajapakse RPVJ, Madagedara SC, Nanayakkara D, Premaratna R. A case series of spotted fever rickettsiosis with neurological manifestations in Sri Lanka. Int J Infect Dis IJID Off Publ Int Soc Infect Dis. 2012 Jul;16(7):e514–7.

194. Rossio R, Conalbi V, Castagna V, Recalcati S, Torri A, Coen M, et al. Medi-terranean spotted fever and hearing impairment: a rare complication. Int J In-fect Dis IJID Off Publ Int Soc Infect Dis. 2015 Jun;35:34–6.

195. Zavala-Velázquez JE, Ruiz-Sosa JA, Sánchez-Elias RA, Becerra-Carmona G, Walker DH. Rickettsia felis rickettsiosis in Yucatán. Lancet Lond Engl. 2000 Sep 23;356(9235):1079–80.

196. Ishikura M, Ando S, Shinagawa Y, Matsuura K, Hasegawa S, Nakayama T, et al. Phylogenetic analysis of spotted fever group rickettsiae based on gltA, 17-kDa, and rOmpA genes amplified by nested PCR from ticks in Japan. Microbi-ol Immunol. 2003;47(11):823–32.

197. Speck S, Perseke L, Petney T, Skuballa J, Pfäffle M, Taraschewski H, et al. Detection of Rickettsia helvetica in ticks collected from European hedgehogs (Erinaceus europaeus, Linnaeus, 1758). Ticks Tick-Borne Dis. 2013 Apr;4(3):222–6.

198. Dobec M, Golubic D, Punda-Polic V, Kaeppeli F, Sievers M. Rickettsia helvet-ica in Dermacentor reticulatus ticks. Emerg Infect Dis. 2009 Jan;15(1):98–100.

70

199. First detections of Rickettsia helvetica and R. monacensis in ectoparasitic mites (Laelapidae and Trombiculidae) infesting rodents in south-western Slovakia. Parasitol Res. 2015 Jul;114(7):2465–72.

200. Hornok S, Földvári G, Rigó K, Meli ML, Tóth M, Molnár V, et al. Vector-borne agents detected in fleas of the northern white-breasted hedgehog. Vector Borne Zoonotic Dis Larchmt N. 2014 Jan;14(1):74–6.

201. Hornok S, Kovács R, Meli ML, Gönczi E, Hofmann-Lehmann R, Kontschán J, et al. First detection of bartonellae in a broad range of bat ectoparasites. Vet Microbiol. 2012 Oct 12;159(3-4):541–3.

202. Burgdorfer W, Aeschlimann A, Peter O, Hayes SF, Philip RN. Ixodes ricinus: vector of a hitherto undescribed spotted fever group agent in Switzerland. Acta Trop. 1979 Dec;36(4):357–67.

203. Fournier PE, Grunnenberger F, Jaulhac B, Gastinger G, Raoult D. Evidence of Rickettsia helvetica infection in humans, eastern France. Emerg Infect Dis. 2000 Aug;6(4):389–92.

204. Nilsson K, Lukinius A, Påhlson C, Moron C, Hajem N ’a, Olsson B, et al. Evidence of Rickettsia spp. infection in Sweden: a clinical, ultrastructural and serological study. APMIS Acta Pathol Microbiol Immunol Scand. 2005 Feb;113(2):126–34.

205. Sekeyova Z, Subramanian G, Mediannikov O, Diaz MQ, Nyitray A, Blaskovi-cova H, et al. Evaluation of clinical specimens for Rickettsia, Bartonella, Bor-relia, Coxiella, Anaplasma, Franciscella and Diplorickettsia positivity using serological and molecular biology methods. FEMS Immunol Med Microbiol. 2012 Feb;64(1):82–91.

206. Fournier P-E, Allombert C, Supputamongkol Y, Caruso G, Brouqui P, Raoult D. Aneruptive fever associated with antibodies to Rickettsia helvetica in Eu-rope and Thailand. J Clin Microbiol. 2004 Feb;42(2):816–8.

207. Phongmany S, Rolain J-M, Phetsouvanh R, Blacksell SD, Soukkhaseum V, Rasachack B, et al. Rickettsial infections and fever, Vientiane, Laos. Emerg In-fect Dis. 2006 Feb;12(2):256–62.

208. Inokuma H, Takahata H, Fournier P-E, Brouqui P, Raoult D, Okuda M, et al. Tick paralysis by Ixodes holocyclus in a Japanese traveler returning from Aus-tralia associated with Rickettsia helvetica infection. J Travel Med. 2003 Feb;10(1):61–3.

209. Cinco M, Luzzati R, Mascioli M, Floris R, Brouqui P. Serological evidence of Rickettsia infections in forestry rangers in north-eastern Italy. Clin Microbiol Infect Off Publ Eur Soc Clin Microbiol Infect Dis. 2006 May;12(5):493–5.

210. Sonnleitner ST, Simeoni J, Lang S, Dobler G, Speck S, Zelger R, et al. Spotted fever group-Rickettsiae in the Tyrols: evidence by seroepidemiology and PCR. Zoonoses Public Health. 2013 Jun;60(4):284–90.

211. Nilsson K, Lindquist O, Påhlson C. Association of Rickettsia helvetica with chronic perimyocarditis in sudden cardiac death. Lancet. 1999 Oct 2;354(9185):1169–73.

212. Nilsson K, Liu A, Påhlson C, Lindquist O. Demonstration of intracellular mi-croorganisms (Rickettsia spp., Chlamydia pneumoniae, Bartonella spp.) in pathological human aortic valves by PCR. J Infect. 2005 Jan;50(1):46–52.

213. Nilsson K. Septicaemia with Rickettsia helvetica in a patient with acute febrile illness, rash and myasthenia. J Infect. 2009 Jan;58(1):79–82.

214. Nilsson K, Elfving K, Pahlson C. Rickettsia helvetica in patient with meningi-tis, Sweden, 2006. Emerg Infect Dis. 2010 Mar;16(3):490–2.

71

215. Nilsson K, Wallménius K, Påhlson C. Coinfection with Rickettsia helvetica and Herpes Simplex Virus 2 in a Young Woman with Meningoencephalitis. Case Rep Infect Dis. 2011;2011:469194.

216. Adams JR, Schmidtmann ET, Azad AF. Infection of colonized cat fleas, Cten-ocephalides felis (Bouché), with a rickettsia-like microorganism. Am J Trop Med Hyg. 1990 Oct;43(4):400–9.

217. Jiang J, Maina AN, Knobel DL, Cleaveland S, Laudisoit A, Wamburu K, et al. Molecular detection of Rickettsia felis and Candidatus Rickettsia Asemboensis in Fleas from Human Habitats, Asembo, Kenya. Vector Borne Zoonotic Dis Larchmt N. 2013 Aug;13(8):550–8.

218. Abarca K, López J, Acosta-Jamett G, Martínez-Valdebenito C. Rickettsia felis in Rhipicephalus sanguineus from two distant Chilean cities. Vector Borne Zo-onotic Dis Larchmt N. 2013 Aug;13(8):607–9.

219. Tsui P-Y, Tsai K-H, Weng M-H, Hung Y-W, Liu Y-T, Hu K-Y, et al. Molecu-lar detection and characterization of spotted fever group rickettsiae in Taiwan. Am J Trop Med Hyg. 2007 Nov;77(5):883–90.

220. Thepparit C, Sunyakumthorn P, Guillotte ML, Popov VL, Foil LD, Macaluso KR. Isolation of a rickettsial pathogen from a non-hematophagous arthropod. PloS One. 2011;6(1):e16396.

221. Socolovschi C, Pagés F, Raoult D. Rickettsia felis in Aedes albopictus mosqui-toes, Libreville, Gabon. Emerg Infect Dis. 2012 Oct;18(10):1687–9.

222. Socolovschi C, Pages F, Ndiath MO, Ratmanov P, Raoult D. Rickettsia species in African Anopheles mosquitoes. PloS One. 2012;7(10):e48254.

223. Reif KE, Macaluso KR. Ecology of Rickettsia felis: a review. J Med Entomol. 2009 Jul;46(4):723–36.

224. Richards AL, Jiang J, Omulo S, Dare R, Abdirahman K, Ali A, et al. Human Infection with Rickettsia felis, Kenya. Emerg Infect Dis. 2010 Jul;16(7):1081–6.

225. Angelakis E, Munasinghe A, Yaddehige I, Liyanapathirana V, Thevanesam V, Bregliano A, et al. Detection of rickettsioses and Q fever in Sri Lanka. Am J Trop Med Hyg. 2012 Apr;86(4):711–2.

226. Edouard S, Bhengsri S, Dowell SF, Watt G, Parola P, Raoult D. Two human cases of Rickettsia felis infection, Thailand. Emerg Infect Dis. 2014 Oct;20(10):1780–1.

227. Richter J, Fournier P-E, Petridou J, Häussinger D, Raoult D. Rickettsia felis infection acquired in Europe and documented by polymerase chain reaction. Emerg Infect Dis. 2002 Feb;8(2):207–8.

228. Zavala-Castro J, Zavala-Velázquez J, Walker D, Pérez-Osorio J, Peniche-Lara G. Severe human infection with Rickettsia felis associated with hepatitis in Yu-catan, Mexico. Int J Med Microbiol IJMM. 2009 Nov;299(7):529–33.

229. Raoult D, La Scola B, Enea M, Fournier PE, Roux V, Fenollar F, et al. A flea-associated Rickettsia pathogenic for humans. Emerg Infect Dis. 2001 Feb;7(1):73–81.

230. Williams M, Izzard L, Graves SR, Stenos J, Kelly JJ. First probable Australian cases of human infection with Rickettsia felis (cat-flea typhus). Med J Aust. 2011 Jan 3;194(1):41–3.

231. Renvoisé A, Joliot AY, Raoult D. Rickettsia felis infection in man, France. Emerg Infect Dis. 2009 Jul;15(7):1126–7.

232. Lado P, Costa FB, Verdes JM, Labruna MB, Venzal JM. Seroepidemiological survey of Rickettsia spp. in dogs from the endemic area of Rickettsia parkeri rickettsiosis in Uruguay. Acta Trop. 2015 Jun;146:7–10.

72

233. Brouqui P, Bacellar F, Baranton G, Birtles RJ, Bjoërsdorff A, Blanco JR, et al. Guidelines for the diagnosis of tick-borne bacterial diseases in Europe. Clin Microbiol Infect Off Publ Eur Soc Clin Microbiol Infect Dis. 2004 Dec;10(12):1108–32.

234. Philip RN, Casper EA, Ormsbee RA, Peacock MG, Burgdorfer W. Microim-munofluorescence test for the serological study of rocky mountain spotted fe-ver and typhus. J Clin Microbiol. 1976 Jan;3(1):51–61.

235. Fournier P-E, Jensenius M, Laferl H, Vene S, Raoult D. Kinetics of antibody responses in Rickettsia africae and Rickettsia conorii infections. Clin Diagn Lab Immunol. 2002 Mar;9(2):324–8.

236. Hechemy KE, Raoult D, Fox J, Han Y, Elliott LB, Rawlings J. Cross-reaction of immune sera from patients with rickettsial diseases. J Med Microbiol. 1989 Jul;29(3):199–202.

237. Raoult D, Fournier PE, Fenollar F, Jensenius M, Prioe T, de Pina JJ, et al. Rickettsia africae, a tick-borne pathogen in travelers to sub-Saharan Africa. N Engl J Med. 2001 May 17;344(20):1504–10.

238. Jensenius M, Fournier P-E, Vene S, Ringertz SH, Myrvang B, Raoult D. Com-parison of immunofluorescence, Western blotting, and cross-adsorption assays for diagnosis of African tick bite fever. Clin Diagn Lab Immunol. 2004 Jul;11(4):786–8.

239. Engvall E, Perlmann P. Enzyme-linked immunosorbent assay, Elisa. 3. Quanti-tation of specific antibodies by enzyme-labeled anti-immunoglobulin in anti-gen-coated tubes. J Immunol Baltim Md 1950. 1972 Jul;109(1):129–35.

240. Wächter M, Wölfel S, Pfeffer M, Dobler G, Kohn B, Moritz A, et al. Serologi-cal differentiation of antibodies against Rickettsia helvetica, R. raoultii, R. slovaca, R. monacensis and R. felis in dogs from Germany by a micro-immunofluorescent antibody test. Parasit Vectors. 2015;8:126.

241. Halle S, Dasch GA, Weiss E. Sensitive enzyme-linked immunosorbent assay for detection of antibodies against typhus rickettsiae, Rickettsia prowazekii and Rickettsia typhi. J Clin Microbiol. 1977 Aug;6(2):101–10.

242. Wächter M, Pfeffer M, Schulz N, Balling A, Chirek A, Bach J-P, et al. Sero-prevalence of spotted fever group Rickettsiae in dogs in Germany. Vector Borne Zoonotic Dis Larchmt N. 2015 Mar;15(3):191–4.

243. Hechemy KE, Anacker RL, Carlo NL, Fox JA, Gaafar HA. Absorption of Rickettsia rickettsii antibodies by Rickettsia rickettsii antigens in four diagnos-tic tests. J Clin Microbiol. 1983 Mar;17(3):445–9.

244. Raoult D, Dasch GA. Line blot and western blot immunoassays for diagnosis of Mediterranean spotted fever. J Clin Microbiol. 1989 Sep;27(9):2073–9.

245. Anacker RL, Mann RE, Gonzales C. Reactivity of monoclonal antibodies to Rickettsia rickettsii with spotted fever and typhus group rickettsiae. J Clin Mi-crobiol. 1987 Jan;25(1):167–71.

246. Hajem N, Weintraub A, Nimtz M, Römling U, Påhlson C. A study of the anti-genicity of Rickettsia helvetica proteins using two-dimensional gel electropho-resis. APMIS Acta Pathol Microbiol Immunol Scand. 2009 Apr;117(4):253–62.

247. Uchiyama T, Zhao L, Yan Y, Uchida T. Cross-reactivity of Rickettsia japonica and Rickettsia typhi demonstrated by immunofluorescence and Western im-munoblotting. Microbiol Immunol. 1995;39(12):951–7.

248. Xu W, Raoult D. Distribution of immunogenic epitopes on the two major im-munodominant proteins (rOmpA and rOmpB) of Rickettsia conorii among the other rickettsiae of the spotted fever group. Clin Diagn Lab Immunol. 1997 Nov;4(6):753–63.

73

249. Jiao Y, Wen B, Chen M, Niu D, Zhang J, Qiu L. Analysis of immunoprotectiv-ity of the recombinant OmpA of Rickettsia heilongjiangensis. Ann N Y Acad Sci. 2005 Dec;1063:261–5.

250. Chan YG-Y, Riley SP, Chen E, Martinez JJ. Molecular basis of immunity to rickettsial infection conferred through outer membrane protein B. Infect Im-mun. 2011 Jun;79(6):2303–13.

251. Feng H-M, Whitworth T, Popov V, Walker DH. Effect of antibody on the rickettsia-host cell interaction. Infect Immun. 2004 Jun;72(6):3524–30.

252. Teysseire N, Raoult D. Comparison of Western immunoblotting and microim-munofluorescence for diagnosis of Mediterranean spotted fever. J Clin Micro-biol. 1992 Feb;30(2):455–60.

253. Cruickshank R. The Weil-Felix Reaction in Typhus Fever. J Hyg (Lond). 1927 Nov;27(1):64–9.

254. Amano K, Hatakeyama H, Okuta M, Suto T, Mahara F. Serological studies of antigenic similarity between Japanese spotted fever rickettsiae and Weil-Felix test antigens. J Clin Microbiol. 1992 Sep;30(9):2441–6.

255. Amano KI, Williams JC, Dasch GA. Structural properties of lipopolysaccha-rides from Rickettsia typhi and Rickettsia prowazekii and their chemical simi-larity to the lipopolysaccharide from Proteus vulgaris OX19 used in the Weil-Felix test. Infect Immun. 1998 Mar;66(3):923–6.

256. Amano K, Fujita M, Suto T. Chemical properties of lipopolysaccharides from spotted fever group rickettsiae and their common antigenicity with lipopoly-saccharides from Proteus species. Infect Immun. 1993 Oct;61(10):4350–5.

257. Walker DH, Burday MS, Folds JD. Laboratory diagnosis of Rocky Mountain spotted fever. South Med J. 1980 Nov;73(11):1443–6, 1449.

258. Kularatne S a. M, Gawarammana IB. Validity of the Weil-Felix test in the diagnosis of acute rickettsial infections in Sri Lanka. Trans R Soc Trop Med Hyg. 2009 Apr;103(4):423–4.

259. Udayan U, Dias M, Machado S. A hospital based study of rickettsial diseases evidenced by Weil Felix test in a tertiary care hospital. CHRISMED J Health Res. 2014;1(3):150.

260. Roopa KS, Karthika K, Sugumar M, Bammigatti C, Shamanna SB, Harish BN. Serodiagnosis of Scrub Typhus at a Tertiary Care Hospital from Southern In-dia. J Clin Diagn Res JCDR. 2015 Nov;9(11):DC05–7.

261. Mullis K, Faloona F, Scharf S, Saiki R, Horn G, Erlich H. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb Symp Quant Biol. 1986;51 Pt 1:263–73.

262. Renvoisé A, Rolain J-M, Socolovschi C, Raoult D. Widespread use of real-time PCR for rickettsial diagnosis. FEMS Immunol Med Microbiol. 2012 Feb;64(1):126–9.

263. Sanger F. Determination of nucleotide sequences in DNA. Science. 1981 Dec 11;214(4526):1205–10.

264. Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. 1977. Biotechnol Read Mass. 1992;24:104–8.

265. Stenos J, Graves SR, Unsworth NB. A highly sensitive and specific real-time PCR assay for the detection of spotted fever and typhus group Rickettsiae. Am J Trop Med Hyg. 2005 Dec;73(6):1083–5.

266. Znazen A, Sellami H, Elleuch E, Hattab Z, Ben Sassi L, Khrouf F, et al. Com-parison of two quantitative real time PCR assays for Rickettsia detection in pa-tients from Tunisia. PLoS Negl Trop Dis. 2015 Feb;9(2):e0003487.

74

267. Angelakis E, Richet H, Rolain J-M, La Scola B, Raoult D. Comparison of real-time quantitative PCR and culture for the diagnosis of emerging Rickettsioses. PLoS Negl Trop Dis. 2012;6(3):e1540.

268. Vestris G, Rolain JM, Fournier PE, Birg ML, Enea M, Patrice JY, et al. Seven years’ experience of isolation of Rickettsia spp. from clinical specimens using the shell vial cell culture assay. Ann N Y Acad Sci. 2003 Jun;990:371–4.

269. Ammerman NC, Beier-Sexton M, Azad AF. Laboratory maintenance of Rick-ettsia rickettsii. Curr Protoc Microbiol. 2008 Nov;Chapter 3:Unit 3A.5.

270. Killmaster LF, Zemtsova GE, Montgomery M, Schumacher L, Burrows M, Levin ML. Isolation of a Rickettsia slovaca-Like Agent from Dermacentor variabilis Ticks in Vero Cell Culture. Vector Borne Zoonotic Dis Larchmt N. 2016 Jan;16(1):61–2.

271. Teysseire N, Chiche-Portiche C, Raoult D. Intracellular movements of Rickett-sia conorii and R. typhi based on actin polymerization. Res Microbiol. 1992 Dec;143(9):821–9.

272. Luce-Fedrow A, Macaluso KR, Richards AL. Growth of Rickettsia felis in Drosophila melanogaster S2 cells. Vector Borne Zoonotic Dis Larchmt N. 2014 Feb;14(2):101–10.

273. Horta MC, Labruna MB, Durigon EL, Schumaker TTS. Isolation of Rickettsia felis in the mosquito cell line C6/36. Appl Environ Microbiol. 2006 Feb;72(2):1705–7.

274. Bell-Sakyi L, Zweygarth E, Blouin EF, Gould EA, Jongejan F. Tick cell lines: tools for tick and tick-borne disease research. Trends Parasitol. 2007 Sep;23(9):450–7.

275. Kumar S. Textbook of Microbiology. JP Medical Ltd; 2012. 276. Gimenez DF. Staining Rickettsiae in Yolk-Sac cultures. Stain Technol. 1964

May;39:135–40. 277. Silverman DJ, Wisseman CL. Comparative ultrastructural study on the cell

envelopes of Rickettsia prowazekii, Rickettsia rickettsii, and Rickettsia tsutsu-gamushi. Infect Immun. 1978 Sep;21(3):1020–3.

278. Vellaiswamy M, Campagna B, Raoult D. Transmission electron microscopy as a tool for exploring bacterial proteins: model of RickA in Rickettsia conorii. New Microbiol. 2011 Apr;34(2):209–18.

279. Yssouf A, Almeras L, Terras J, Socolovschi C, Raoult D, Parola P. Detection of Rickettsia spp in ticks by MALDI-TOF MS. PLoS Negl Trop Dis. 2015 Feb;9(2):e0003473.

280. Fotso Fotso A, Mediannikov O, Diatta G, Almeras L, Flaudrops C, Parola P, et al. MALDI-TOF mass spectrometry detection of pathogens in vectors: the Bor-relia crocidurae/Ornithodoros sonrai paradigm. PLoS Negl Trop Dis. 2014 Jul;8(7):e2984.

281. Rolain JM, Maurin M, Vestris G, Raoult D. In vitro susceptibilities of 27 rick-ettsiae to 13 antimicrobials. Antimicrob Agents Chemother. 1998 Jul;42(7):1537–41.

282. Rolain J-M, Stuhl L, Maurin M, Raoult D. Evaluation of antibiotic susceptibili-ties of three rickettsial species including Rickettsia felis by a quantitative PCR DNA assay. Antimicrob Agents Chemother. 2002 Sep;46(9):2747–51.

283. Gudiol F, Pallares R, Carratala J, Bolao F, Ariza J, Rufi G, et al. Randomized double-blind evaluation of ciprofloxacin and doxycycline for Mediterranean spotted fever. Antimicrob Agents Chemother. 1989 Jun;33(6):987–8.

284. Raoult D, Drancourt M. Antimicrobial therapy of rickettsial diseases. Antimi-crob Agents Chemother. 1991 Dec;35(12):2457–62.

75

285. CDC. Diagnosis and Management of Tickborne Rickettsial Diseases: Rocky Mountain Spotted Fever, Ehrlichioses, and Anaplasmosis - United States - A Practical Guide for Physicians and Other Health-Care and Public Health Pro-fessionals [Internet]. [cited 2016 Mar 4]. Available from: http://www.cdc.gov/mmwr/preview/mmwrhtml/rr5504a1.htm

286. Stewart DJ. Prevalence of tetracyclines in children’s teeth. II. A resurvey after five years. Br Med J. 1973 Aug 11;3(5875):320–2.

287. Milch RA, Rall DP, Tobie JE. Fluorescence of tetracycline antibiotics in bone. J Bone Joint Surg Am. 1958 Jul;40-A(4):897–910.

288. Keysary A, Itzhaki A, Rubinstein E, Oron C, Keren G. The in-vitro anti-rickettsial activity of macrolides. J Antimicrob Chemother. 1996 Oct;38(4):727–31.

289. Bella F, Font B, Uriz S, Muñoz T, Espejo E, Traveria J, et al. Randomized trial of doxycycline versus josamycin for Mediterranean spotted fever. Antimicrob Agents Chemother. 1990 May;34(5):937–8.

290. Cascio A, Colomba C, Antinori S, Paterson DL, Titone L. Clarithromycin versus azithromycin in the treatment of Mediterranean spotted fever in chil-dren: a randomized controlled trial. Clin Infect Dis Off Publ Infect Dis Soc Am. 2002 Jan 15;34(2):154–8.

291. Cross R, Ling C, Day NPJ, McGready R, Paris DH. Revisiting doxycycline in pregnancy and early childhood - time to rebuild its reputation? Expert Opin Drug Saf. 2016 Mar;15(3):367–82.

292. Albåge M, Berglund J, Bergman B, Bylund P, Dotevall L, Edlund C, et al. Läkemedelsbehandling av borreliainfektion – ny rekommendation. Information från Läkemedelsverket [Internet]. 2009; 4:12-17. Available from: https://lakemedelsverket.se/malgrupp/Halso---sjukvard/Behandlings--rekommendationer/Behandlingsrekommendation---listan/Borrelia/

293. Thomas RJ, Dumler JS, Carlyon JA. Current management of human granulo-cytic anaplasmosis, human monocytic ehrlichiosis and Ehrlichia ewingii ehr-lichiosis. Expert Rev Anti Infect Ther. 2009 Aug;7(6):709–22.

294. Pettersson JH-O, Golovljova I, Vene S, Jaenson TGT. Prevalence of tick-borne encephalitis virus in Ixodes ricinus ticks in northern Europe with particular ref-erence to Southern Sweden. Parasit Vectors. 2014;7:102.

295. Klee SR, Tyczka J, Ellerbrok H, Franz T, Linke S, Baljer G, et al. Highly sen-sitive real-time PCR for specific detection and quantification of Coxiella bur-netii. BMC Microbiol. 2006;6:2.

296. Jäderlund KH, Bergström K, Egenvall A, Hedhammar A. Cerebrospinal fluid PCR and antibody concentrations against Anaplasma phagocytophilum and Borrelia burgdorferi sensu lato in dogs with neurological signs. J Vet Intern Med Am Coll Vet Intern Med. 2009 Jun;23(3):669–72.

297. Goodman JL, Nelson C, Vitale B, Madigan JE, Dumler JS, Kurtti TJ, et al. Direct cultivation of the causative agent of human granulocytic ehrlichiosis. N Engl J Med. 1996 Jan 25;334(4):209–15.

298. Barlough JE, Madigan JE, DeRock E, Bigornia L. Nested polymerase chain reaction for detection of Ehrlichia equi genomic DNA in horses and ticks (Ix-odes pacificus). Vet Parasitol. 1996 Jun;63(3-4):319–29.

299. Barlough JE, Madigan JE, Kramer VL, Clover JR, Hui LT, Webb JP, et al. Ehrlichia phagocytophila genogroup rickettsiae in ixodid ticks from California collected in 1995 and 1996. J Clin Microbiol. 1997 Aug;35(8):2018–21.

76

300. Carl M, Tibbs CW, Dobson ME, Paparello SF, Dasch GA. Diagnosis of acute typhus infection using the polymerase chain reaction. Ann N Y Acad Sci. 1990;590:439–44.

301. Webb L, Carl M, Malloy DC, Dasch GA, Azad AF. Detection of murine ty-phus infection in fleas by using the polymerase chain reaction. J Clin Microbi-ol. 1990 Mar;28(3):530–4.

302. Leitner M, Yitzhaki S, Rzotkiewicz S, Keysary A. Polymerase chain reaction-based diagnosis of Mediterranean spotted fever in serum and tissue samples. Am J Trop Med Hyg. 2002 Aug;67(2):166–9.

303. Roux V, Fournier PE, Raoult D. Differentiation of spotted fever group rickett-siae by sequencing and analysis of restriction fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rOmpA. J Clin Microbi-ol. 1996 Sep;34(9):2058–65.

304. Choi Y-J, Lee S-H, Park K-H, Koh Y-S, Lee K-H, Baik H-S, et al. Evaluation of PCR-based assay for diagnosis of spotted fever group rickettsiosis in human serum samples. Clin Diagn Lab Immunol. 2005 Jun;12(6):759–63.

305. Hagman K, Barboutis C, Ehrenborg C, Fransson T, Jaenson TGT, Lindgren P-E, et al. On the potential roles of ticks and migrating birds in the ecology of West Nile virus. Infect Ecol Epidemiol. 2014 Jan 15;4.

306. Molin Y, Lindeborg M, Nyström F, Madder M, Hjelm E, Olsen B, et al. Migra-tory birds, ticks, and Bartonella. Infect Ecol Epidemiol. 2011;1.

307. Lindeborg M, Barboutis C, Ehrenborg C, Fransson T, Jaenson TGT, Lindgren P-E, et al. Migratory birds, ticks, and crimean-congo hemorrhagic fever virus. Emerg Infect Dis. 2012 Dec;18(12):2095–7.

308. Wilhelmsson P, Lindblom P, Fryland L, Ernerudh J, Forsberg P, Lindgren P-E. Prevalence, diversity, and load of Borrelia species in ticks that have fed on humans in regions of Sweden and Åland Islands, Finland with different Lyme borreliosis incidences. PloS One. 2013;8(11):e81433.

309. Tijsse-Klasen E, Sprong H, Pandak N. Co-infection of Borrelia burgdorferi sensu lato and Rickettsia species in ticks and in an erythema migrans patient. Parasit Vectors. 2013;6:347.

310. Fryland L, Wilhelmsson P, Lindgren P-E, Nyman D, Ekerfelt C, Forsberg P. Low risk of developing Borrelia burgdorferi infection in the south-east of Sweden after being bitten by a Borrelia burgdorferi-infected tick. Int J Infect Dis IJID Off Publ Int Soc Infect Dis. 2011 Mar;15(3):e174–81.

77

Acta Universitatis UpsaliensisDigital Comprehensive Summaries of Uppsala Dissertationsfrom the Faculty of Medicine 1195

Editor: The Dean of the Faculty of Medicine

A doctoral dissertation from the Faculty of Medicine, UppsalaUniversity, is usually a summary of a number of papers. A fewcopies of the complete dissertation are kept at major Swedishresearch libraries, while the summary alone is distributedinternationally through the series Digital ComprehensiveSummaries of Uppsala Dissertations from the Faculty ofMedicine. (Prior to January, 2005, the series was publishedunder the title “Comprehensive Summaries of UppsalaDissertations from the Faculty of Medicine”.)

Distribution: publications.uu.seurn:nbn:se:uu:diva-280667

ACTAUNIVERSITATIS

UPSALIENSISUPPSALA

2016