Genetica 105: 239–248, 1999.© 2000Kluwer Academic Publishers. Printed in the Netherlands.

239

Structural instability of 297element inDrosophila melanogaster

Ana Domınguez & Jesus AlbornozDepartamento de Biolog´ıa Funcional, Area de Gen´etica, Universidad de Oviedo, E-33071 Oviedo, Spain(Phone: 34 985 10 30 76; Fax: 34 985 10 35 34; E-mail: ads@sauron.quimica.uniovi.es)

Received 1 June 1999 Accepted 22 October 1999

Key words:transposable elements, LTR-retroelements, rearrangements, population genetics,Drosophila

Abstract

297 element Southern pattern modifications previously detected in mutation accumulation lines ofDrosophilamelanogasterwere further investigated byin situ hybridisation, Southern blotting with different combinations ofgenomic digest-probe, and PCR. Only one out of the nine pattern modifications studied could be interpreted asan excision and was detectable byin situ hybridisation to polytene chromosomes. Results were consistent withmost pattern modifications being small rearrangements within the body of the element. In agreement with theexistence of spontaneous rearrangements of this kind is the observation that many genomic copies of element297are defective and these are not limited to heterochromatin. These findings have important implications for themodels of transposable element (TE) number regulation as well as for the study of genome evolution.

Introduction

Transposable elements are a common feature of eu-karyotic genomes; nevertheless, the control of theiractivity is poorly understood.Drosophila is a modelorganism in the study of the population dynamics ofthese elements. Regulation of their activity is critical,since insertions may have effects on viability and de-crease the fitness of their carriers. Studies of spontan-eous transposition rates inD. melanogasterreportedmean estimates between 10−4 and 10−6 (Eggleston etal., 1988; Harada et al., 1990; Nuzhdin & Mackay,1994; Domínguez & Albornoz, 1996; Junakovic etal., 1997). Besides these studies, it is well knownthat transposition of elements involved in hybrid dys-genesis phenomena (P , I andh o b o) is greatly en-hanced in certain crosses. Furthermore, there havebeen reports of mobilisation bursts for different retro-transposons in particular populations and conditions(Gerasimova et al., 1984; Kim & Belyaeva, 1988;Biémont et al., 1987; Mevel-Ninjo et al., 1989; Pasy-ukova & Nuzhdin, 1993). These cases must representexceptions that escape the normal control of trans-position. In fact, the study of some of these unstablelines lead to the finding of the control mechanism

of gypsyby the host geneflamenco(Pelisson et al.,1997).

In a previous study on mutation rates of nine fam-ilies of TEs (Domínguez & Albornoz, 1996), we havefound the changes in restriction patterns observed bySouthern to be consistent with rearrangements morethan with true transposition events. This interpretationapplied either to class II elementsP, h o b o andfold-back, that transpose via DNA, as to retroelements, orclass I elements,297, 412andcopia, that use RNAtransposition intermediates. Small rearrangements areknown to be associated with elements that transposevia DNA (Engels, 1996) and with non-LTR retrotrans-posons (Finnegan, 1989a). Retroelements fall into twomajor classes, depending on the presence or absenceof long terminal repeats, LTR retrotransposons andnon-LTR retrotransposons (Finnegan, 1989b). Non-LTR retrotransposons frequently lose a 5′ fragmenton transposition resulting in ‘dead on arrival’ copies.These copies have been considered as pseudogenes,under neutral selection, and the accumulation of addi-tional deletions in their body has been reported (Petrovet al., 1996). On the other hand, the accumulationof defective copies of retroelements in heterochro-matin has been documented although its cause andsignificance is not well understood (Dimitri, 1997).

240

Here we study the mutations previously found forthe LTR-retrotransposon297, by using different tech-niques: Southern blotting with different combinationsof enzymes and probes,in situ hybridisation, andPCR. The aim of the study is to take insight in thekind of events that these elements can suffer spon-taneously in absence of genomic instability. Besides,the use of different techniques over a set of lines withfixed modified patterns allows comparing the natureof information that can be obtained depending on theassumptions made.

Materials and methods

Fly lines

Nine mutation accumulation lines with a297elementmodified Southern insertion pattern (B1, B39, B42,B64, B78, B80, B82, C23, and C67) together witha line (C66) that conserved the unmodified pattern(Domínguez & Albornoz, 1996) were used for thiswork. The lines derived from a population made iso-genic for the four chromosomes following a schemeof crosses to balancer chromosomes and carried themarker sepia (s e)as an indicator of contamination(Caballero et al., 1991). Starting from this isogenicpopulation, after five generations of multiplication,lines were established and maintained by brother–sister matings as described (Santiago et al., 1992). Inthis way, lines accumulated mutations in an otherwisehomogeneous genome. After a mutation occurs at agiven locus it can either be fixed or loosed in the fullsib line. The fixation rate under neutrality is equal tothe mutation rate.

297 element probes

Description of element297 is found in FlyBase(1994). PlasmidcDm 4006, containing a copy ofthe element297 plus flanking genomic DNA (Char-lesworth et al., 1994), and a plasmid containing a2.4-kb EcoRI internal fragment (Di Franco et al.,1992) were used as probes. As we show in the res-ults section, the copy of element297 in plasmidcDm4006 lacks a fragment, of approximately 0.8 kb, tothe right of the thirdEcoRI site. In addition, someinternal fragments obtained by digestion and isol-ated from agarose gels using GeneClean were used asprobe. Figure 1 depicts a restriction map of297basedin the complete sequence of the element (Inouye et

al., 1986) obtained from GeneBank (accession num-ber X03431), the localisation of the fragments usedas probes and the region of partial homology withelement17.6 (FlyBase, 1994). None of the internalfragments used as probe share homology with17.6element.

Southern blotting

Genomic DNA that has been extracted from 50 to100 flies per line at generation 80 (Domínguez &Albornoz, 1996) was used for Southern analysis. Dif-ferent digests were carried out on aliquots of the sameDNA preparation. Besides, salivary gland DNA ex-tracted from 200 to 250 larvae at generation 124 bythe method of Di Franco et al. (1989) was used totest the euchromatic or heterochromatic nature of in-complete copies of elements. Digestion, blotting, andhybridisation procedures were as previously describedwith the difference that transfer of DNA fragmentswas carried out under saline conditions, to a nylonmembrane Hybond N+ (Amersham), following therecommendations of the manufacturer. Probe DNAwas 32P labelled either by random priming or bynick-translation.

In situ hybridization

Four individuals from each line were analysed for theinsertion pattern of element297 in polytene chromo-somes at generation 130, two withcDm 4006andtwo with the cloned 2.4-kbEcoRI internal fragmentas probe.

Slides of larval salivary gland chromosomes fromthe lines were hybridised either to probecDm4006 or 2.4-kb EcoRI labelled with bio-16-dUTP(Boebringer Mannheim). Hybridisation sites were de-tected by staining with diaminobenzidine (Sigma)and peroxidase (Vectastain ABC Elite). Preparationof slides, hybridisation, and detection were madefollowing the protocol of Lim (1993) with slightmodifications.

PCR amplifications

Primers (Figure 1) were designated to amplify thebody of the element from the LTRs with the aid ofthe software Amplify (Engels, 1997). The primers donot amplify element17.6, in spite of its similarity with297. Sequences of primers 5′ to 3′ are as follows: for-ward GGCGTTGTCCTTAGTCAACTGACG; reverseGGTCGACGCGTCTGAGCAAATAGA.

241

Figure 1. Element297restriction map and location of fragments used as probes. There are no sites forBamH1, Pst1, Sal1 norXho1.� 1.7 Kbregion homologous to element17.6. Primer sites for PCR amplification are indicated by arrowheads.

Table 1. Combinations of genomic digest- probe used in Southern blots and fragmentsthat would be revealed if genomic copies of297were conserved

Combination Digest Probe Fragments revealed

0 HindIII 2.4-kb EcoRI Right end of the element and

flanking sequences plus a

internal fragment of 2.4 kb

1 HindIII 2.4-kb HindIII Internal fragment of 2.4 kb

2 HindIII EcoRI right Same pattern that

combination 0 but lacking the

internal fragment

3 ClaI EcoRI right Right end of the element and

flanking sequences (other

view)

4 AvaI EcoRI left Left end of the element and

flanking sequences

5 BamHI+PstI cDm 4006 Any fragment of the element

and flanking sequences at

both sides

6 SalI+XhoI cDm 4006 Any fragment of the element

and flanking sequences at

both sides (other view)

PCR was performed in a GeneAmp PCR System2400 thermocycler, using reagents from the GeneAmpXL PCR Kit of Perkin-Elmer. Reactions were set up in50µl with the following components and concentra-tions: 1×XL PCR Buffer; 1.3 mM Mg; 200µM eachnucleotide; 1 Unit ofrTth DNA polymerase, 40 pmolof each primer and 100 ng of genomic DNA. Thermalcycles were as follows: 94◦C, 1 min; 16 cycles dena-turing at 94◦C for 20 s and, annealing and extension

at 68◦C for 10 min; 12 cycles denaturing at 94◦C for20 s and, annealing and extension at 68◦C for 10 minwith increments of 15 s per cycle; 72◦C for 10 min.PCR reaction control was performed on plasmidcDm4006. Amplified DNA was electrophoresed on gelsof agarose and DNA stained with ethidium bromide.Southern blotting of PCR products and hybridisationwith cDm 4006probe allowed to test if amplifiedsequences were from the transposable element.

242

Results

Southern band patterns

Alterations in Southern band pattern may reflect trans-position, rearrangements, whether internal to the ele-ment or affecting flanking sequences, or base sub-stitutions affectingHindIII sites. In order to discernwhether297 element alterations in insertion patternswere due to true transposition of complete elements orto other kind of events, several combinations of ge-nomic digest and probe have been tested. Fragmentsrevealed by each combination if genomic elementswere homogeneous are outlined in Table 1. True trans-positions are expected to modify the band patternobtained with every combination that reveals one orboth ends of the elements (combinations 2–6) and notto modify pattern obtained with combination 1 that isexpected to reveal only an internal fragment.

Heterogeneity among different genomic copies ofthe element297 in restriction map can be deducedfrom the Southern pattern obtained in combination 1(Figure 2). In addition to the expected internal frag-ment of 2.4 kb, the probe revealed many other bandscorresponding to elements lacking eitherHindIII siteor containing internal insertions or deletions. Mostvariant elements are clearly seen in salivary glandDNA, therefore they are fully polytenized.

In this situation, interpretation of the different in-sertion pattern modifications is very difficult and canonly be tentative because the restriction map of thestarting copy is not known. Observed changes in inser-tion patterns are presented in Table 2 and an exampleof the changes found in a subset of lines is shown inFigure 3. Sizes of moved Southern bands were cal-culated from the analysis of scanned autoradiographswith the software GelReader from NCSA (1991). Thefirst column in Table 2 (combination 0) correspondsto the insertion pattern mutations previously detected(Domínguez & Albornoz, 1996). Further analysis ofthis combination of enzyme-probe in 0.5% agarosegels showed that the loss of the 8.7 kb band in line B64was a small shift from 8.7 to 8.3 kb and that anothernew band of 18.6 kb, not previously detected, can bedistinguished in line B78.

Deductions about the nature of changes resulting inthe observed insertion pattern modifications are basedin the following rationales: combination 1 would re-veal changes in non-canonical copies of the elementsbut not true transposition. On the contrary, transposi-tion is expected to be revealed either when looking at

Figure 2. Southern insertion pattern for combinations 0 (a) and 1(b) in control line C66. In each case the left lane corresponds tosalivary gland DNA and the right one to pools of flies. The internalfragment of 2.4 kb expected in either combination is indicated withan arrow. Further bands are not expected in combination 1 (b) unlessgenomic copies of297element heterogeneous. Size markers in kbare fromλ-HindIII digests.

the right side of the element (combinations 2 and 3) orwhen looking at the left (combination 4). The changecould also be appreciated when studying the entireelements (combinations 5 and 6) though, in this case,the discrimination power will be low because frag-ments obtained with enzymes that do not cut insidethe element are very large.

Mutations in lines B1, B64, B78, and C67 affectednon-canonical elements. The 3.9-kb band gain of line

243

B1 and the 7.3-kb band gain of line B64 can not beseen in combination 2. Nevertheless, combinations 0and 2 are expected to reveal the same Southern patternmodifications (see Figure 1 and Table 1). An interpret-ation of this discrepancy is that the observed changesin Southern pattern are due to alterations in the leftside of elements lacking the leftmostHindIII site. Ac-cordingly, changes affecting the left side of element(combination 4) were detected for these lines. Thus,pattern modification in line B1 is compatible with a de-letion affecting the left side of the element or flankingsequence. Line B64 exhibits two pattern modifica-tions, one to the left and the other to the right side.Both modifications are perceptible when surveyingwhole elements in combination 6 and are compatiblewith small deletions. Line B78 alteration can be seenin several combinations always affecting bands of highmolecular weight (see Table 2 and Figure 3). Detectedpattern modifications in this line are particularly inac-curate because of the poor transference and resolutionof high molecular weight DNA inherent to standardSouthern techniques. In any case, it can be deducedthat line B78 suffered any kind of rearrangement af-fecting a stretch of DNA that lacks sites for severalrestriction enzymes. Line C67 lacks a restriction bandfor any combination of enzyme-probe and thereaftercan be assumed to be an excision. This excision isvisible in combination 1 and therefore corresponds toan incomplete element.

The other five lines do not show modification ofthe insertion patterns obtained with combination 1 norwith combination 4. Thus, alterations in the right sideof elements or flanking sequence can be deduced. In-sertion changes in lines B39 and B42 are compatiblewith small gains of a few hundred bases. Detectionof such small changes in blots with enzymes that donot cut inside the element would not be expected andare not seen in fact. Pattern modification in line B80,that had been classified as an excision (Domínguez &Albornoz, 1996), is better interpreted as a rearrange-ment because two simultaneous changes are seen witheither of the three enzyme-probe combinations. Thenature of this putative rearrangement is not easy toimagine. Alteration in B82 could be assumed to be anexcision although it was not visible in combinations5 nor 6, probably due to the low resolution power ofthese combinations. In any case, this interpretation isnot supported byin situhybridisation data (see below).Line C23 mutation could be seen as a deletion of 1 kb(combination 3) or as an insertion of 1.5 kb (combin-ations 0 and 2). These observations are compatible

with a deletion that did away with a siteHindIII oran insertion that added a siteClaI.

In situ band patterns

In situ hybridisation of salivary gland polytene chro-mosomes revealed 27 hybridisation sites for probe2.4-kbEcoRI and 31 sites for probecDm 4006, in allthe lines except C67 that lacks an insertion at 15A witheither probe (Figure 4). One of the hybridisation sites(99E on 3R) of probecDm 4006corresponds to thehybridisation of flanking sequences to the original sitefrom which it was cloned (Charlesworth et al. 1992).The other 30 reflect insertion sites of element297,three of them lacking sequences homologues to the2.4-kbEcoRI internal fragment. The number of sitesdetected by this internal probe agrees with the numberof euchromatic bands estimated from Southern datawith the same probe (Domínguez & Albornoz, 1996).It can be seen hybridisation signal in the chromocenterand this should correspond to elements located in het-erochromatin. Line C67 can be deduced to have lost a297element at 15A on chromosome X. This insertionsite is not revealed by probecDm 4006, therefore, theexcised element did not leave a LTR behind. Southernanalysis pointed to rearrangements as the cause formodifications detected in lines B1, B39, B42, B64,B78, B80, and C23. This interpretation is supportedby their unmodifiedin situ insertion pattern. Alterationin B82 could be interpreted as an excision on the basisof Southern blot but could not be detectedin situ. Thisincongruity can be attributed either to the pattern alter-ation not being an excision but a local rearrangementor to the excision being from a band occupied by otherelement and therefore undetectablein situ.

PCR amplifications

In an attempt to gain information about the nature ofchanges affecting element297, genomic copies wereamplified by PCR. Besides the elements themselves,the primers will amplify intergenic regions betweentwo 297elements if they were within a few kilobasesand therefore allow to identify alterations in clustersof elements if they existed. Amplification of plasmidcDm 4006, used as control, produced a band withan approximate size of 5.5 kb instead of the expec-ted band of 6.3 kb. Restriction analysis of the PCRproduct has shown that the cloned element lacks afragment to the right of the thirdEcoRl site in therestriction map. No differences in PCR amplified frag-ments could be shown between the lines. All of them

244

Table 2. Changes in insertion patterns observed in Southern blots with differentcombinations of genomic digest and probe. Values correspond to the approximatesize in kb of bands gained or lost

Line Combination

0 1 2 3 4 5 6

B1 +3.9 +3.9 0 0 −4.4 −16.7 0

+3.2 +14.0

B39 +6.3 0 +6.3 +12.3 0 0 0

−5.8 −5.8 −11.5

B42 +6.9 0 +6.9 +8.3 0 0 0

−6.7 −6.7 −8.1

B64 −8.7 +7.3 −8.7 0 −4.9 −18.3 −26.1

+8.3 +8.3 +1.8 +18.0 +25.7

+7.3 +6.5 −10.1

+9.8

B78 −34.1 −34.1 −34.1 −39.1 0 −102.3 −103.6

+29.1 +29.1 +29.1 +32.0 +60.2

+18.6 +18.6 +28.5 +24.7

B80 −4.5 0 −4.5 −17.9 0 +5.1 −12.8

+17.3 +6.4 +8.2

B82 −6.3 0 −6.3 0 0 0 0

C23 +9.1 0 +9.1 −7.7 0 +11.8 0

−7.5 −7.5 +6.7

C67 −6.0 −6.0 −6.0 −11.7 −12.8 −17.2 −30.8

produced the expected internal fragment of 6.3 kb andseveral smaller ones. These fragments were shown tocorrespond to defective copies of the element by blot-ting and hybridisation to probecDm 4006(Figure 5).Amplified products of three laboratory lines (Canton-S, SM5, andspapol) and one individual fly recentlycaught from a natural population revealed that, be-sides complete elements, it is common the existenceof defective elements conserving the LTRs and lackingfragments within the body.

Discussion

Initial studies on retrotransposons showed the homo-geneity of genomic copies for several families of ele-ments (Finnegan et al., 1978; Junakovic et al., 1984).Nevertheless, element297 was found heterogeneousin lines Oregon R and Canton S. The abundant exist-ence of defective copies of element297 that we havefound, whether in the isogenic line object of the studyor in other populations, suggest that this is a commonfeature for297element. Different sources of evidence

show that defective elements are not limited to het-erochromatin. Most Southern bands corresponding todefective copies are fully polytenized and thereforecan be assumed to be either in the euchromatin or inthe β-heterochromatin which is amplified in salivaryglands. Line C67 has suffered the loss of an euchro-matic copy of an already defective element; the copyof the element in plasmidcDm 4006, cloned froman euchromatic site, corresponds to an inclompleteelement. These observations agree with the recentlyreported existence of rearranged copies of element412in both euchromatin and heterochromatin (Cizeron &Biémont, 1999), and suggest that structural heterogen-eity of retroelements may be common.

Only one of the297 element Southern patternmodifications studied, that of line C67, was detect-able as a change in the insertion pattern in polytenechromosomes. The other eight lines have experiencedlocal rearrangements not visible byin situ hybridisa-tion. One of the two rearrangements affecting line B64and one of the altered bands in line B78 were classifiedas heterochromatic (Domínguez & Albornoz, 1996).Change in line B64 is compatible with a small dele-

245

Figure 3. Pattern modifications observed for lines B64, B78, and B80 for different combinations of restriction enzyme and probe. Band gainsand losses are indicated with arrowheads. Alterations are unique to each line, therefore modifications in one line can be compared with theunaltered pattern of the other two. Size markers in kb are fromλ-HindIII digests.

tion and line B78 alteration is a rearrangement seenas one band reduction in intensity, accompanied bytwo band gains. It can be interpreted that rearrange-ment in line B78 affects a cluster of repetitive DNAbecause it lacks sites for any of the enzymes usedalong extended DNA stretches. The observation ofvariation in band intensity was also reported by DiFranco et al. (1992) and was interpreted as reflect-ing variations in the length of repeated clusters. Joinconsideration of Southern andin situdata suggest thatalterations in the other six lines and one of the changesin line B64 correspond to small rearrangements in

elements that are polytenised in gland DNA. Simul-taneous changes in Southern patterns have been alsoobserved for other families of elements whether ofclass I or class II and were interpreted as rearrange-ments on the basis of their non-segregation in crosses(Albornoz & Domínguez, 1999).

Attempts to identify the mutated copies of element297 by PCR did not give positive results. This maybe accounted for by the high number of genomic cop-ies of the element (30 as revealed byin situ) addedto the small size of changes. Alternative interpreta-tions are that mutated elements lack one or both LTRs,

246

Figure 4. In situhybridization patterns, with probecDm 4006, of control line C66 (a) and line C67 (b) that has suffered an excision of elementat 15A (marked with an arrowhead).

Figure 5. Southern blotting of PCR amplification products. Expec-ted amplification product for complete elements is marked with anarrowhead. Size markers in kb are fromλ-HindIII digests.

that changes are in flanking sequences and not in the297 element or that the rearrangements occurred byconversion of an element with a non-homologous one.This would produce a copy of an existing element ina different location and therefore would be visible by

Southern. In any case, PCR amplifications showedthe existence of elements with deletions in the bodyand conserving the LTRs to be common. Knowingthe exact nature of the rearrangements we are deal-ing with will require further investigation in a moresimplified situation. Our findings can be related tothe small rearrangements known to be associated withelementP (Engels, 1996). The occurrence of ectopicexchange between copies in heterozygosis (Goldberget al., 1983; Davis et al., 1987) can be excluded be-cause the starting lines were homozygous. It can benoted that most changes were consistent with DNAlosses what could be interpreted as a prevalence ofdeletions over insertions or other rearrangements. Ithas been reported the accumulation of deletions athigh rate in the body of defective copies of a non-LTRretrotransposon (Petrov et al., 1996). It is conceivablethat rearrangements we are dealing with are due to thesame kind of events. The reported deletions accumu-lated at a rate that is about 16% of that for nucleotidesubstitutions. The nucleotide substitution rate inDro-sophilahas been estimated as 8.5×10−9 per base pergeneration (Drake et al., 1998). Thus, for an elementof 6.9 kb, the rate of deletion would be 9.4× 10−6, avalue close to the rate of element297 Southern pat-tern modification that we have previously estimated as1.9× 10−5. We can not say which is the mechanismunderlying the transposable element rearrangements

247

presented nor even whether it is a specific mechanismaffecting transposable elements or a more general one,as DNA loss or unequal recombination. These remainopen questions that require further investigation. Inany case, it can be said that these small, probablyinternal, rearrangements are an important source ofspontaneous mutation affecting transposable elements.

The existence of this kind of mutations affectsmodels on the control of transposable element copynumber. Studies on transposition rate (Eggleston et al.,1988; Harada et al., 1990; Nuzhdin & Mackay, 1994;Domínguez & Albornoz, 1996; Vieira & Biemont,1997; Junakovic et al., 1997) assume a rate of trans-position equal for the different copies of the elementand consequently estimate a mean transposition rateper element per generation. Differences in the num-ber of active elements could contribute to variationin reported rates of transposition. The existence ofdefective elements offer the possibility that the mech-anism of copy number control is through increasingthe proportion of non-autonomous elements as hasbeen considered by Brookfield (1997) for class II ele-ments and by for Hartl et al. (1997) formariner-liketransposable elements.

Acknowledgement

This work was supported by a grant from the Dir-ección General de Investigación Científica y Técnica(D.G.I.C.Y.T, PB 94-1345 A). We thank N. Junakovicfor his critical reading of the manuscript and multiplesuggestions that greatly improved its final draft.

References

Albornoz J. and Domínguez A.: Spontaneous changes inDrosophilamelanogatertransposable elements and their effects on fitness,Heredity83 (1999) (in press).

Biemont C., Aouar A. and Arnault C.: Genome reshuffling of thecopia element in an inbred line ofDrosophila melanogaster,Nature329(1987): 742–744.

Brookfield J.F. and Badge R.M.: Population genetics models oftransposable elements,Genetica100(1997): 281–294.

Caballero A., Toro M.A. and López-Fanjul C.: The response to arti-ficial selection from new mutations inDrosophila melanogaster,Genetics127(1991): 89–102.

Charlesworth B., Jane P. and Assimacopoulos S.: The distributionof transposable elements within and between chromosomes in apopulation ofDrosophila melanogaster. III. Element abundancesin heterochromatin,Genet. Res.64 (1994): 183–197.

Charlesworth B., Lapid A. and Canada D.: The distribution oftransposable elements within and between chromosomes in a

population ofDrosophila melanogaster. I. Element frequenciesand distribution,Genet. Res.60 (1992): 103–114.

Cizeron G. and Biémont C.: Polymorphism in structure of theretrotransposable element412 on Drosophila simulansand D.melanogasterpopulations, Gene232(1999): 183–190.

Davis P.S., Shen M.W. and Judd B.H.: Asymmetrical pairings oftransposons in and proximal to the white locus ofDrosophilaac-count for four classes of regularly occurring exchange products,Proc. Nat. Acad. Sci. USA84 (1987): 174–178.

DiFranco C., Galuppi D. and Junakovic N.: Genomic distribu-tion of transposable elements among individuals of an inbredDrosophilaline, Genetica86 (1992): 1–11.

Di Franco C., Pisano C., Dimitri P., Gigliotti S. and JunakovicN.: Genomic distribution of copia-like transposable elements insomatic tissues and during development ofDrosophila melano-gaster, Chromosoma98 (1989) 402–410.

Di Franco C., Pisano C., Fourcade-Peronnet F., Echalier G. and Jun-akovic N.: Evidence forDe Novorearrangements ofDrosophilatransposable elements induced by the passage to cell culture,Genetica87 (1992): 65–73.

Dimitri P.: Constitutive heterochromatin and transposable elementsin Drosophila melanogaster, Genetica100(1997): 85–93.

Domínguez A. and Albornoz J.: Rates of movement of transpos-able elements inDrosophila melanogaster, Mol. Gen. Genet.251(1996): 130–138.

Drake J.W., Charlesworth B., Charlesworth D. and Crow J.F.: Ratesof Spontaneous Mutation,Genetics148(1998): 1667–1686.

Eggleston W.B., Johnson Schlitz D.M. and Engels W.R.: P-M hy-brid dysgenesis does not mobilize other transposable elementfamilies inD. melanogaster, Nature331(1998): 368–370.

Engels W.:Amplify 1.2. University of Wisconsin, Madison, WI,1997.

Engels W.R.: Pelements inDrosophila, Transposable elements.In: Saedler H. and Gierl A. (eds). Springer-Verlag, Berlin,1996.

Finnegan D.J.:The I factor and I-R hybrid dysgenesis inDrosophilamelanogaster. In: Berg D. and Howe M. (eds), Mobile DNA.The American Society for Microbiology, Wasington, 1989a; pp.503–518.

Finnegan D.J.: Eukaryotic transposable elements and genome evol-ution.Trend. Genet.5 (1989b): 103–107.

Finnegan D.J., Rubin G.M., Young M.W. and Hogness D.S.: Re-peated gene families inDrosophila melanogaster, Cold SpringHarbor Symp. Quant. Biol.42 (1978): 1053–1063.

FlyBase: TheDrosophilagenetic database,Nucleic Acids Res.22(1994): 3456–3458.

Gerasimova T.I., Ilyin Y.V., Mizrokhi L.J., Semjonova L.V.and Georgiev G.P.: Mobilization of the transposable elementmdg4by hybrid dysgenesis generates a family of unstable cutmutations inD. melanogaster, Mol. Gen. Genet.193 (1984):488–492.

Goldberg M.L., Sheen J-Y., Gehring W.J. and Green M.M.: Unequalcrossing-over associated with asymmetrical synapsis betweennomadic elements in theDrosophila melanogastergenome,Proc. Nat. Acad. Sci USA80 (1983): 5017–5021.

Harada K., Yukuhiro K. and Mukai T.: Transposition rates of mov-able genetic elements inDrosophila melanogaster, Proc. Nat.Acad. Sci USA87 (1990): 3248–3252.

Hartl D.L., Lozovskaya E.R., Nursminsky D.I. and Lohe A.R.:What restricts the activity ofmariner-like transposable elements?Trend. Genet.13 (1997): 197–201.

Inouye S., Yuki S. and Saigo K.: Complete nucleotide sequenceand genome organization of aDrosophila transposable geneticelement,297, Eur. J. Biochem.154(1986): 417–425.

248

Junakovic N., Caneva R. and Ballario P.: Genomic distribution ofcopia-likeelements in laboratory stocks ofDrosophila melano-gaster, Chromosoma90 (1984): 378–382.

Junakovic N., Di Franco C. and Terrinoni A.: Evidence for a hostrole in regulating the activity of transposable elements inDroso-phila melanogaster: the case of the persistent instabily ofBari 1elements in Charolles stock,Genetica100(1997): 149–154.

Kim A.I. and Belyaeva E.S.: Transposition of mobile elementsgypsy (mdg-4)andhobo in germ-line and somatic cells of a ge-netically unstable mutator strain ofD. melanogaster, Mol. Gen.Genet. 212(1988): 281–286.

Lim J.K.: In situ hybridization with biotinylated DNA, D.I.S.72(1993): 73–76.

Mevel-Ninio M., Mariol M.C. and Gans M.: Mobilization of thegypsyand copia retrotransposons inDrosophila melanogasterinduces reversion of the ovo super(D) dominant female-sterilemutations: Molecular analysis of revertant alleles,EMBO J. 8(1989): 1549–1558.

NCSA: NCSA GelReader for the Macintosh 2.0.5. University ofIllinois at Urbana-Champaign, IL, 1991.

Nuzhdin S.V. and Mackay T.F.C.: Direct determination of retro-transposon transposition rates inDrosophila melanogaster,Genet. Res.12 (1994): 139–144.

Pasyukova E.G. and Nuzhdin S.V.:Doc andcopia instability in anisogenicDrosophila melanogasterstock,Mol. Gen. Genet.240(1993): 302–306.

Pelisson A., Teyset I., Chalvet F., Kim A., Prud’homme N. andTerzian C.: About the origin of retroviruses and the co-evolutionof thegypsyretrovirus with theDrosophila flamencohost gene,Genetica100(1997): 29–37.

Petrov D.A., Lozovskaya E.R. and Hartl D.L.: High intrinsic rate ofDNA loss inDrosophila, Nature384(1996): 346–349.

Santiago E., Albornoz J., Domínguez A., Toro M.A. and López-Fanjul C.: The distribution of spontaneous mutations on quantit-ative traits and fitness inDrosophila melanogaster, Genetics132(1992): 771–781.

Vieira C. and Biemont C.: Transposition rate of the412 retro-transposable element is independent of copy number in naturalpopulations ofDrosophila simulans, Mol. Biol. Evol.14 (1997):185–188.