22
Shyam Murali Mentor: Dr. Katherine Friedman Stimulation of de novo telomere addition by the Rap1 protein of yeast

Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere

  • Upload
    others

  • View
    2

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere

Shyam Murali Mentor: Dr. Katherine Friedman

Stimulation of de novo telomere addition by the Rap1 protein of

yeast

Page 2: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere

CEN

W W W

Correct repair Incorrect repair GCR

Telomere addition

Translocation/deletion Resume cell cycle

Sequence loss

“Damage tolerance” De novo

Fates of a double-stranded break

Image from Dr. Friedman

No repair Resection

Cell death

Page 3: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere

Telomeres

• Repetitive sequence at the end of chromosome

• Protect ends of chromosome from “end-replication” problem and chromosome fusion

• TG- and Protein-rich

• Telomerase

Page 4: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere

Telomere Hotspot

• Chromosome V – Saccharomyces cerevisiae

8.4 kb 83 bp Highly TG-rich Rap1 binding site

Essential WWW Hotspot HO HYGR URA3

3 kb

Image from Kati Turner

Page 5: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere

HO Endonuclease Assay

8.4 kb 83 bp Highly TG-rich Rap1 binding site

Essential WWW Hotspot HO HYGR URA3

3 kb

GAL10 HO

Image from Kati Turner

Page 6: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere

Multiplex PCR Centromere proximal Telomere proximal

WWW

PCM1 URA3 HS

*

HO HYGR

Hotspot

Image from Kati Turner

Page 7: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere

Telomere Hotspot

• Chromosome V – Saccharomyces cerevisiae

5’ –GGATGTAGGATGAGTTGGTGTGGTGTTACTACTAGGATTTGGCGTGGATGAAGGACCTGCAGTGGAGGGTGTTGTTGTGGAGTT- 3’

AAAAAAAAAAAAAAAAAA

Essential WWW HS HO

HYGR URA3

Rap1 Binding Site

PolyA Mutation

Image from Kati Turner

Page 8: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere

Preliminary HO Endonuclease Assay Data

Page 9: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere

Rif1 Rif2 TLC1

Est2

Rap1

The Rap1/Rif1/Rif2 complex has different effects

TLC1

Est2 +

Centromere Telomere HOTSPOT

Rap1 Rap1 Rap1 Rap1

Rif1 Rif2

Rap1

ENDOGENOUS TELOMERE

Image from Dr. Friedman

Page 10: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere

Gal4 UAS Project: Important Objectives

• Is Rap1p sufficient for telomere addition at the hotspot?

• Determine which proteins, or protein domains, are required for de novo telomere addition

• Hypothesis:

• Rap1p is sufficient for telomere addition

• Rap1p C-terminus is sufficient

Page 11: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere

How will we do this?

Page 12: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere
Page 13: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere

UAS Sequence creation and integration

• Created a new strain

– JRL017 91-2 Rap1BS [UAS] Hxt13::URA3

• Used PCR to create constructs and cloned into pRS306

Rap1 Binding site UAS Mutation

TG rich (telomere-like)

HindIII

XbaI

XbaI

HindIII

Image from Jacob Seloff

Page 14: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere

Two-Step Integration

Plated On 5-FOA

URA3

1.

2.

BamH1 Cut Site

URA3

-Mutated Hotspot

-Deleted Hotspot

URA3

Image from Jacob Seloff

Page 15: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere

UAS strain Gal Assay

• Expectation: replacement of Rap1p binding domain should yield results similar to Rap1BS PolyA Mutant

Page 16: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere

Integration of Gal4 DBD constructs

1. Gal4 DBD (alone)

2. GBD+Rap1 fusion

3. GBD+Rap1c fusion

Only C-terminus of Rap1

How?

1. Clone GBD constructs into pRS304 (integrative) and pRS314 (centromeric)

2. Transform into UAS strain of yeast

3. Confirm Integration

4. Perform HO Endonuclease Assay

Page 17: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere

Southern #1 – GBD Probe

Page 18: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere

Southern #2 – TRP1 Probe

Ho

t 1

kb la

dd

er

Λ

+φx

DN

A m

arke

r H

ot

1kb

lad

de

r H

ot

1kb

lad

de

r G

BD

+Rap

1C

#6

W

ild-T

ype

GBD only GBD+Rap1

Page 19: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere

Future Goals

• Western Blot

• If GBD constructs have correct expression HO Endonuclease Assay

• Disparity between Positive (at hotspot) vs. Negative (at telomeres) regulation of telomerase by Rap1p. Why?

• Does number matter?

• Multiple UAS sites for more Rap1 recruitment

• Rif1p/Rif2p fusion?

Page 20: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere

Does the number of Rap1 molecules matter?

Page 21: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere

Caveat - Directionality

• Directionality of Rap1p

• Use other non-hotspot Rap1p binding sites

Page 22: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere

Acknowledgements

• Lab Members:

• Dr. Katherine Friedman

• Margaret Platts

• Udo Obodo

• Ann Ding

• Kati Turner

• Laura Bechard

• Charlene Hawkins

• Committee Members:

• Dr. Woelfle

• Dr. Rokas

• Honors Program Coordinator

• Dr. Patton

• Beckman Scholars Program

• Dr. Johnston