Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
This material is made freely available at www.njctl.org and is intended for the non-commercial use of students and teachers. These materials may not be used for any commercial purpose without the written permission of the owners. NJCTL maintains its website for the convenience of teachers who wish to make their work available to other teachers, participate in a virtual professional learning community, and/or provide access to course materials to parents, students and others.
Click to go to website:www.njctl.org
New Jersey Center for Teaching and Learning
Progressive Science Initiative
Slide 1 / 81
www.njctl.org
Eukaryotes & Gene Expression
Practice Questions
Slide 2 / 81
1 Identify two characteristics that are shared by all cells.
Slide 3 / 81
2 Suppose you are investigating a cell that contains a nucleus. Would you categorize this cell as a prokaryote or eukaryote? Explain your answer.
Slide 4 / 81
3 Is it more efficient for cells to have a high or low surface area to volume ratio? Explain.
Slide 5 / 81
4 Explain, in terms of cell function, why it is more advantageous for cells to be small.
Slide 6 / 81
5 Organelles are to cells as organs are to the human body. Explain why this analogy is true.
Slide 7 / 81
6 What are two differences between prokaryotic and eukaryotic cells?
Slide 8 / 81
7 Would you be more likely to observe a prokaryotic cell or eukaryotic cell under the lowest magnification available on your microscope? Explain your answer.
Slide 9 / 81
8 Explain, in terms of surface area to volume ratio, why cells are small.
Slide 10 / 81
9 Identify the four major categories of eukaryotic cells.
Slide 11 / 81
10 Explain how the meaning of the terms prokaryote and eukaryote help explain the structure of the cell.
Slide 12 / 81
11 Why is it important that the nucleus of a cell contains nuclear pores?
Slide 13 / 81
12 How is it possible that even though all the cells of a multicellular organism contain the same DNA, there are many different types of cells that differ in structure and function?
Slide 14 / 81
13 How are chromosomes related to chromatin?
Slide 15 / 81
14 How does the ‘packing’ of DNA impact the process of gene expression in cells?
Slide 16 / 81
15 How does the presence of transcription factors influence the process of gene expression?
Slide 17 / 81
16 How is the presence of transcription factors related to external stimuli in an environment?
Slide 18 / 81
17 Explain the observable differences that would exist between a molecule of pre-mRNA and a finished molecule of mRNA?
Slide 19 / 81
18 In what way does the splicing of a molecule of mRNA alter the contents of the molecule? Be sure to use appropriate terminology.
Slide 20 / 81
19 How does alternative splicing affect the ability of a molecule of mRNA to produce multiple proteins?
Slide 21 / 81
20 Explain how nuclear pores are like the ‘gatekeepers’ of the nuclear membrane.
Slide 22 / 81
21 How does the length of a poly-A tail on mRNA impact the amount of protein can be produced from the mRNA?
Slide 23 / 81
22 Given the sequence of eukaryotic DNA below, transcribe the gene and complete all three steps of RNA processing. (Exons are bold)
Non-template strand:5’ATTATGGGCATATATCCGGCGCCTTAATTATTC3’ Template strand:3’TAATACCCGTATATAGGCCGCGGAATTAATAAG5’
Slide 24 / 81
23 How is the process of transcription related to the process of translation in the cell?
Slide 25 / 81
24 Why is the nucleus often referred to as the ‘control center’ of the cell.
Slide 26 / 81
25 Is the process of gene expression the same in prokaryotes as it is in eukaryotes? Explain your answer.
Slide 27 / 81
26 What is the difference between prokaryotic and eukaryotic DNA?
Slide 28 / 81
27 What role do histones play in the packing of DNA?
Slide 29 / 81
28 How is the presence of transcription factors related to the characteristics that define living organisms?
Slide 30 / 81
29 Identify the purpose of the modification of pre-mRNA by adding the nucleotide cap and poly-A tail.
Slide 31 / 81
30 Why are coding segments of mRNA referred to as ‘exons?’
Slide 32 / 81
31 Explain how alternative splicing allows a cell to produce different proteins from the same segment of mRNA.
Slide 33 / 81
32 Given the sequence of eukaryotic DNA below, transcribe the gene and complete all three steps of RNA processing. (Exons are bold) Non-template strand:3’GGCCGGCTATAATCGATACTTACGAATGTAAAA5’ Template strand:5’CCGGCCGATATTAGCTATGAATGCTTACATTTT3’
Slide 34 / 81
33 What role do hydrolytic enzymes play in the production of protein in a cell?
Slide 35 / 81
34 What are the components of the ‘endomembrane system?’
Slide 36 / 81
35 How does the role of the smooth endoplasmic reticulum relate to the amount of smooth E.R. found within different types of cells?
Slide 37 / 81
36 Explain the progression of a protein through the endomembrane system of a cell.
Slide 38 / 81
37 Compare the Golgi apparatus to a component of a city or town, based on the function of the organelle.
Slide 39 / 81
38 How is the creation of lysosomes related to the Golgi apparatus?
Slide 40 / 81
39 How is a peroxisome related to a lysosome?
Slide 41 / 81
40 Why are cell membranes often referred to as semipermeable?
Slide 42 / 81
41 Identify and explain the process by which large proteins created in the cell are transported to the extracellular environment?
Slide 43 / 81
42 What is a ‘secretory protein?’
Slide 44 / 81
43 Identify the relationship between ribosomes and the rough endoplasmic reticulum.
Slide 45 / 81
44 How does a glycoprotein help determine the role of a protein within a cell?
Slide 46 / 81
45 What is the function of the Golgi apparatus in the process of protein production within a cell?
Slide 47 / 81
46 Identify three different cellular functions accomplished by the smooth E.R.
Slide 48 / 81
47 What is the purpose of lysosomes for the cell?
Slide 49 / 81
48 What function do peroxisomes perform for the cell?
Slide 50 / 81
49 What role might a protein play that is created within the cell and becomes embedded in the cell membrane?
Slide 51 / 81
50 Why is endocytosis important for efficient cellular function?
Slide 52 / 81
51 Explain the structure of a chloroplast, identifying the areas where the light reactions and Calvin cycle occur.
Slide 53 / 81
52 What is the function of the mitochondria for the cell?
Slide 54 / 81
53 Do prokaryotic cells contain mitochondria? Explain your answer.
Slide 55 / 81
54 Both mitochondria and chloroplasts contain highly folded internal membranes. Explain the importance of these membranes for the organelle, including the importance of the folded nature.
Slide 56 / 81
55 Briefly summarize the endosymbiotic theory as proposed by Lynn Margulis.
Slide 57 / 81
56 According to the endosymbiotic theory, before they were eukaryotic organelles, the chloroplast and mitochondria more closely resembled what type of organism?
Slide 58 / 81
57 Why is mitochondrial DNA utilized to trace maternal heritage?
Slide 59 / 81
58 Identify the role of the chloroplast for a plant cell.
Slide 60 / 81
59 Do plant cells contain mitochondria even though they are photosynthetic? Explain your answer.
Slide 61 / 81
60 Explain the meaning of the term endosymbiosis.
Slide 62 / 81
61 What is the evidence used to support the endosymbiotic theory?
Slide 63 / 81
62 What is the ‘mitochondrial eve?’
Slide 64 / 81
63 Why do organisms receive all of their mitochondrial DNA from their mother?
Slide 65 / 81
64 How is the central vacuole of a plant cell related to wilting?
Slide 66 / 81
65 How do a food vacuole and lysosome help to digest particles within a cell?
Slide 67 / 81
66 What is the role of a contractile vacuole in a cell?
Slide 68 / 81
67 How are sugars related to the cell wall of plant cells?
Slide 69 / 81
68 Why is it important that adjacent plant and animal cells contain cell junctions?
Slide 70 / 81
69 Suppose you are investigating a cell that contains plasmodesmata. Would you label this cell as a plant or animal cell? Explain your answer.
Slide 71 / 81
70 Which sort of cell junction would you most likely observe between adjacent cells that cannot experience leakage? What type of cells may you be observing?
Slide 72 / 81
71 If animal cells need to transport ions and sugars, what sort of cell junction would you predict they would utilize? Support your response.
Slide 73 / 81
72 What is a vacuole?
Slide 74 / 81
73 How is a central vacuole related to turgor pressure in a cell?
Slide 75 / 81
74 What is a cytoskeleton and what does it do for the cell?
Slide 76 / 81
75 Compare and contrast the external structure of plant cells and fungi.
Slide 77 / 81
76 What role does the extracellular matrix provide for a group of cells?
Slide 78 / 81
77 Do plant and animal cells contain the same type of cell junctions? Why or why not?
Slide 79 / 81
78 Finish the following analogy. Plasmodesmata: plant cells:: __________________: animal cells.
Slide 80 / 81
79 Identify three differences between the structure of plant and animal cells.
Slide 81 / 81