Click here to load reader

Sintesis Protein Samriana-f1c112013

  • View
    240

  • Download
    12

Embed Size (px)

Text of Sintesis Protein Samriana-f1c112013

KUNING DAN PUTIH TELUR

JURUSAN KIMIAFAKULTAS MATEMATIKA DAN ILMU PENGETAHUAN ALAMUNIVERSITAS HALU OLEOKENDARI 2014SINTESIS PROTEIN

SAMRIANAF1C112013

PendahuluanSintesis protein adalah proses penerjemahan informasi yang ada pada DNA (sumber materi genetik) yang mengkode asam amino sehingga terbentuk rantai peptida

Komponen yang terlibat dalam proses sintesis protein DNA RNA Katalis berupa enzim2DNA

DNA merupakan asam nukleatGula penyusunnya adalah Gula deoksiribosa Merupakan double heliks Basa nitrogennya adalah A, T, G, S Sebagai pengarah dalam sintesis protein Mengandung informasi genetik yang menyebabkan munculnya sifat spesifik pada organisme

3RNA

RNA merupakan asam nukleatRNA merupakan rantai tunggalGula penyusunnya adalah Gula ribosaBasa nitrogen penyusun RNA adalah A, U, G, STiga tipe RNA adalah rRNA, tRNA dan mRNAsatu mempunyai gugus amino bebas (ujung N atau amino,NH2-) dan ujung satunya mempunyai gugus karboksil bebas (ujung C atau karboksil, COOH-). 4Tipe RNAmRNAMengandung pesan genetik dari DNAMerupakan RNA transkriptRNA dibuat dalam nukleus komponen molekuler translasiberperan mentransfer asam amino dari sitoplasma dan meletakkannya pada rantai polipeptida di ribosom

rRNA (ribosom) tempat terjadinya translasiSebagai fasilitator perpasangan mRNA dan tRNA terdiri atas dua sub unit yaitu sub unit besar dan kecil sub unitnya terbuat dari protein dan molekul RNA

Pada gambar sebelah kiri, terlihat bahwa struktur alfa-helix terbentuk oleh backbone ikatan peptida yang membentuk spiral dimana jika dilihat tegak lurus dari atas, arah putarannya adalah searah jarum jam menjauhi pengamat (dinamakan alfa). Satu putaran terdiri atas 3.6 residu asam amino dan struktur ini terbentuk karena adanya ikatan hidrogen antara atom O pada gugus CO dengan atom H pada gugus NH (ditandai dengan garis warna oranye).Seperti halnya alfa-helix, struktur beta-sheet juga terbentuk karena adanya ikatan hidrogen, namun seperti terlihat pada gambar sebelah kanan, ikatan hidrogen terjadi antara dua bagian rantai yang pararel sehingga membentuk lembaran yang berlipat-lipat.

5Perbedaan DNA dan RNAPerbedaanDNARNALetakSebagian besar di nukleus, sedikit dimitokondria dan kloroplasInti sitplasma dan ribosomGula yang menyususnDeoksiribosaRibosaBasa purinBasa pirimidinAdenin, GuaninSitosin, TiminAdenin, GuaninSitosin, UrasilBentuk normalDs dan ssDs =double strandedSs=single strandedssJenis/macamHanya satuAda tigamRNAtRNArRNAKadarTetapBerubah, tergantung aktivitas sintesis proteinEnzim penghidrolisisDeoxyribonuclease (DNase)Ribonuclease (RNasePerananPembawa informasi genetikSintesis priteinSentral Dogma eukariotik

Central Dogma adalah sebuah konsep biologi molekuler yang dikemukaakan oleh Francis Crick pada 1985.Konsep ini menjelaskan bahwa transfer informasi genetik dari DNA ke protein terjadi melalui beberapa langkah, yaitu replikasi, transkripsi,translasi dan produksi protein.Replikasi dan transkripsi terjadi dinukleusTranslasi terjadi di sitosolTerjadi penghilangan intron yaitu bagian RNA yang tidak diterjemahkanAda proses RNA (cap -tail)

Tahapan sintesis protein

Perjalanan informasi genetik dalam kebanyakan sel seperti terlihat dalam Gambar

Tirosin,serin,fenilalaninFiber(panjang,serabut)=kolagenGlobular(bulat)=albumin8Replikasi DNA

Replikasi DNA merupakan proses penggandaan DNA, yaitu dari satu molekul DNA dibuat tiruannya sehingga menjadi 2 molekul DNA.

Komponen yang terlibat pada proses replikasiDNANukleusOri (origin of replication)SSBP (Single strand binding Protein)Enzim DNA polimeraseTopoisomeraseEnzim primaseEnzim helikaseProtein SSBPEnzim ligase

terdiri atas 2 subunit alfa dan 2 subunit beta 9Tahap-tahap replikasi DNADenaturasi (pemisahan) untaian DNA induk Proses replikasi DNA diawali dengan pemutusan (denaturasi) ikatan antara untai DNA yang satu dengan untaian komplementernya (secara enzimatis).Denaturasi awal terjadi pada bagian DNA yang dikenal sebagai ori (origin of replication) atau titik awal replikasi.

1. Inisiasi

Untaian DNA membuka membentuk struktur yang disebut sebagai garpu replikasi102. Sintesis primer

Sintesis baru, untai komplementer DNA menggunakan untai yang ada sebagai template yang dibawa oleh enzim DNA polimerasedan dibantu oleh DNA primase untuk mensintesis bentan-gen pendek RNA ke untai DNA yang ada. segmen pendek disebut primer, dan terdiri dari 9 -12 nukleotida. Setelah primer terbentuk pada kedua untai, DNA polimerase memperpanjang primer ini menjadi untai DNA baru.

3. Sintesis leading strand

Repikasi leading strand berjalan secara kontinyu

DNA polimerase menambahkan nukleotida baru hanya untuk ujung 3 dari untai yang ada, dan mensintesis DNA dalam arah 5 3 saja. Tapi untai DNA berjalan di arah yang berlawanan, DNA polimerase III (DNA pol III) mengenali 3 OH akhir primer RNA, dan menambahkan nukleotida komplementer baru, nukleotida baru ditambahkan secara terus menerus, sehingga menghasilkan untai baru.

4. Sintesis lagging strand

Repikasi lagging strand berjalan secara diskontinyu

DNA disintesis secara terputus dengan menghasilkan serangkaian fragmen ke-cil dari DNA baru dalam arah 5 3.Fragmen ini disebut fragmen Okazaki, yang kemudian bergabung untuk membentuk sebuah rantai terus menerus nukleotida.primase menambahkan primer di beberapa tempat sepanjang untai DNA pol III memperpanjang primer dengan menambahkan nukleotida baru, dan jatuh ketika bertemu fragmen yang terbentuk sebelumnya

5. Penghapusan primer

dilakukan oleh enzim DNA polimerase I (DNA pol I). Ini khusus menghilangkan RNA primer melalui 5 3 aktivitas eksonukleasenya,Digantikan dengan deoksiribonukleotida baru oleh 5 3 aktivitas polimerase DNA.

6. Ligasi

Setelah penghapusan primer selesai untai tertinggal masih mengandung celah antara fragmen Okazaki berdekatan. Enzim ligase mengidentifikasi segel celah tersebut dengan menciptakan ikatan fosfodiester antara 5 fosfat dan 3 gug us hidroksil fragmen yang berdekatan.7. Pemutusanmenghentikan di lokasi terminasi khusus yang terdiri dari urutan nukleotida yang unik. Urutan ini diidentifikasi oleh protein khusus yang disebut tus yang mengikat ke situs ters ebut, sehingga secara fisik menghalangi jalur helikase.Ketika helikase bertemu protein tus,keduanya jatuh bersama dengan terdekat untai tunggal protein pengikat.

Transkripsi merupakan proses yang mengawali ekspresi sifat-sifat genetik yang nantinya akan muncul sebagai fenotip. Merupakan Proses penyalinan kode-kode genetik yang ada pada urutan DNA menjadi molekul RNA. Tahapan : inisiasi, elongasi dan terminasi

Komponen yang terlibat DNARNA polimerase Nukleus17Tahapan transkripsi1. Inisiasi

Titik mulai transkripsi disebut promotor. Promotorlah yang menentukan dimana transkripsi dimulai dan untai mana yang digunakan sebagai cetakan selain itu promotor berperan dalam pengikatan RNA polimerasiSetelah itu barulah RNA melekat pada promotor dan memulai inisisasi dengan membuka kedua untai DNA dan RNA polimerase mulai mentranskip untai cetakan

2. Elongasi

RNA polimerase bergerak sepanjang DNA membuka heliks ganda RNA polimerase menambahkan nukleotida pada ujung 3 RNA yang sedang tumbuh sambil menyusuri heliksterjadi proses pemanjangan untaian RNA hasil sintesis,

Terminasi

Setelah terjadi proses pemanjangan untaian RNA hasil sintesis, selanjutnya diikuti dengan proses terminasi yang ditandai dengan pelepasan RNA polimerase dari DNA yang ditranskripsi.Terbentuk molekul RNA baruMolekul RNA baru akan melepaskan diri dari cetakan Heliks DNA terbentuk kembali

TranslasiMerupakan proses penerjemahan urutan nukleotida yang ada pada molekul mRNA menjadi rangkaian asam-asam amino yang menyusun suatu polipeptida atau protein.Tahapan : inisiasi, elongasi dan terminasi

Komponen yang berperanmRNAtRNARibosom

Anatomi ribosom

1. Inisiasi

2. Elongasi

3. Terminasi

Tabel kode genetik

UCAGUUUUUCUUAUUGUUUUCUCCUACUGCCUUAUCAUAAUGAAUUGUCGUAGUGGGCCUUCCUCAUCGUUCUCCCCCACCGCCCUACCACAACGAACUGCCGCAGCGGGAAUUACUAAUAGUUAUCACCAACAGCCAUAACAAAAAGAAAUGACGAAGAGGGGGUUGCUGAUGGUUGUCGCCGACGGCCGUAGCAGAAGGAAGUGGCGGAGGGGGPhenylalanineLeucineLeucineIsoleucinefMethionine*ValineSerineProlineThreonineAlanine}}}}}}}}}}}}}STARTTyrosineSTOP**HistidineGlutamineAsparagineLysineAspartic acidGlutamic acidCysteineSTOP**TryptophanArginineSerineArginineGlycineCatatan :Start (*) merupakan kodon untuk memulai (start)Stop (**) merupakan kodon untuk berhenti Urutan sintesis protein

1. mRNA (RNAd) yang telah dicetak dari DNA sense 2. mRNA menuju ke Ribosom 3. tRNA masuk ke ribosom dengan membawa asam amino yang cocok dengan kode pada mRNA4. a. tRNA dengan asam amino lain b. terbentuk polipeptida c. polipeptida dilepaskan dari ribosom dan tRNA keluar dari ribosom

5 TAC ATG AGT CGC CAC TAG GTA ATT 33 ATG TAC TCA GCG GTG ATC CAT TAA 5 5 UAC AUG AGU CGC CAC UAG GUA AUU 3 Tyr - Met Ser - Arg His Stop Val - Isoleu ProteinmRNAtranskripsitranslasiAsam aminoRantai DNADNA templateContoh proses translasi

TERIMA KASIH