ANTIMICROBIAL AGENTS AND CHEMOTHERAPY,0066-4804/00/$04.0010

May 2000, p. 1359–1361 Vol. 44, No. 5

Copyright © 2000, American Society for Microbiology. All Rights Reserved.

Occurrence of a Salmonella enterica Serovar Typhimurium DT104-LikeAntibiotic Resistance Gene Cluster Including the floR Gene

in S. enterica Serovar AgonaAXEL CLOECKAERT,1* KARIM SIDI BOUMEDINE,1 GERALDINE FLAUJAC,1 HEIN IMBERECHTS,2

INGE D’HOOGHE,2 AND ELISABETH CHASLUS-DANCLA1

Station de Pathologie Aviaire et Parasitologie, Institut National de la Recherche Agronomique,37380 Nouzilly, France,1 and Centre d’Etude et de Recherches Veterinaires

et Agrochimiques, B-1180 Brussels, Belgium2

Received 17 September 1999/Returned for modification 15 December 1999/Accepted 14 February 2000

Recently a chromosomal locus possibly specific for Salmonella enterica serovar Typhimurium DT104 has beenreported that contains a multiple antibiotic resistance gene cluster. Evidence is provided that Salmonella en-terica serovar Agona strains isolated from poultry harbor a similar gene cluster including the newly describedfloR gene, conferring cross-resistance to chloramphenicol and florfenicol.

Multidrug-resistant Salmonella enterica serovar Typhimu-rium phage type DT104 has emerged during the last decade asa world health problem because it causes disease in animalsand humans (6, 9). The DT104 isolates are mostly resistant toampicillin, chloramphenicol, spectinomycin, streptomycin, sul-fonamides, and tetracyclines (Ap Cm Sm Sp Su Tc antibioticresistance profile). Recently the genetic basis of these resis-tances has been elucidated (1, 3, 4, 10, 11). The DT104 strainspossess a chromosomal locus of about 12.5 kb carrying allresistance genes, with evidence of two integron structures (Fig.1) (1, 4). The first integron carries the aadA2 gene, conferringresistance to streptomycin and spectinomycin, and a deletionin the sulI resistance gene. The second one contains the b-lac-tamase gene blaPSE-1 and a complete sulI gene. Flanked bythese two integron structures are the newly described floR gene(1), also called floSt (3), conferring cross-resistance to chlor-amphenicol and florfenicol, and the tetracycline resistancegenes tetR and tetA. This chromosomal locus also carries twoputative genes, orf1 and orf2 (Fig. 1), which would code forproteins showing homology to a transcriptional regulator ofthe LysR family and a transposase-like protein, respectively.

Of particular interest is the newly described floR gene (1, 2,3, 4). Florfenicol resistance and detection of the floR gene byPCR-based methods have been proposed as means for rapidlyidentifying multidrug-resistant serovar Typhimurium DT104strains (3), as phage typing remains a laborious task achievableonly in specialized laboratories. Multiplex PCR based on thesurrounding genes of the cluster has also been proposed forthe identification of DT104 strains (5) or to monitor furtherevolution of multiresistant serovar Typhimurium strains (2).

Since 1992 increasing numbers of multidrug-resistant Sal-monella enterica serovar Agona strains exhibiting the sameantibiotic resistance profile as serovar Typhimurium DT104(Ap Cm Sm Sp Su Tc) have been isolated in Belgium (7).These strains were isolated mainly from poultry. The purposeof the present study was to assess whether these isolates could

carry a multidrug resistance gene cluster, comprising the floRgene, similar to the epidemic serovar Typhimurium DT104strains. We studied at the molecular level five independentisolates from poultry taken at different periods of 1997 andfrom different areas in Belgium.

Florfenicol resistance and the floR gene. Antibiograms andMICs of florfenicol were determined as described previously(1, 2). Florfenicol disks and the drug were purchased fromShering-Plough Animal Health (Kenilworth, N.J.). Serovar Ty-phimurium DT104 strain BN9181 was used as a control (1).The five serovar Agona strains showed resistance to florfeni-col to a same extent as serovar Typhimurium DT104 strainBN9181 (MIC of 32 mg/ml). PCR was performed on geno-mic DNAs using internal primers of the floR gene, cml01 andcml15, as described previously (1). An amplification fragmentof the same size as for strain BN9181 (494 bp) was obtained forthe five serovar Agona strains (data not shown). Nucleotidesequencing of two of them showed only one nucleotide differ-ence from the published floR nucleotide sequence of serovarTyphimurium DT104, indicating that the serovar Agona strainsindeed carry the floR gene.

Multidrug resistance gene cluster. Several PCRs (resultingin amplification fragments A to D [Fig. 1]) were performed ongenomic DNAs to assess the genetic environment of the sero-var Agona floR gene, in particular the links with the tetR andtetA genes and with the first integron, carrying the aadA2 gene.The presence of the second integron, carrying the blaPSE-1gene, was also assessed (amplification fragment E [Fig. 1]).Primers used are listed in Table 1. PCR conditions were thosedescribed previously (1, 2). Fragments A, C, and D were am-plified in a multiplex PCR, whereas fragments B and E wereamplified separately. The amplified fragments of the five sero-var Agona strains run on agarose gels showed profiles identicalto those from serovar Typhimurium DT104 control strainBN9181 (Fig. 2), suggesting the occurrence of a DT104-likeantibiotic resistance gene cluster with the two integron struc-tures in the serovar Agona strains. This was further confirmedby Southern blot hybridization of genomic DNA cut byHindIII, EcoRI, XhoI, and XbaI (Appligene, Illkirch, France)with a probe consisting of the XbaI insert of plasmid pSTF3comprising nearly the entire antibiotic resistance gene clusterof serovar Typhimurium DT104 (1). The probe was labeled

* Corresponding author. Mailing address: Station de PathologieAviaire et Parasitologie, Institut National de la Recherche Agronom-ique, 37380 Nouzilly, France. Phone: (33) 2 47427750. Fax: (33) 247427774. E-mail: cloeckae@tours.inra.fr.

1359

on May 7, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

with peroxidase by using the ECL direct nucleic acid labelingkit (Amersham Pharmacia Biotech, Les Ulis, France). South-ern blot hybridization was performed at 42°C according to themanufacturer’s instructions. The HindIII and EcoRI profiles ofthe five serovar Agona strains were identical to those of sero-var Typhimurium DT104 control strain BN9181 (Fig. 3). Therewere slight differences in the XhoI and XbaI profiles, with anadditional band detected in some of the serovar Agona strains.The three XhoI bands seen in serovar Agona were expected onthe basis of the restriction map of the DT104 antibiotic resis-tance gene cluster (Fig. 1). However, unexpectedly one of thebands was lacking in control strain BN9181 and in one serovarAgona strain. The EcoRI profile is of particular interest be-cause only one EcoRI site occurs in the 12.5-kb DT104 genecluster (Fig. 1), and two bands of high molecular mass and ofthe same size as in serovar Typhimurium DT104 control strainBN9181 were revealed with the XbaI probe in serovar Agona.This probably means that the gene cluster extends over the12.5 kb described and/or that the insertion site in the chromo-some could be the same in serovar Agona as in serovar Typhi-murium DT104.

Genomic characterization of the strains. The five serovarAgona strains showed identical pulsotypes in pulsed-field gelelectrophoresis (PFGE) of their genomic DNAs cut by XbaI,which were clearly distinct from that of serovar TyphimuriumDT104 strain BN9181 (Fig. 4), indicating that the serovar

Agona isolates were not variants of serovar TyphimuriumDT104.

Thus, all data indicate that the multidrug-resistant serovarAgona strains harbor a DT104-like antibiotic resistance genecluster including the newly described floR gene. It seems there-fore difficult to base methods of identifying serovar Typhi-murium DT104 on florfenicol resistance, detection of the floRgene, or its genetic environment. We have also preliminaryevidence that the multidrug resistance gene cluster also occurson other phage types of serovar Typhimurium, such as DT120,which also showed a pulsotype in PFGE different from that ofserovar Typhimurium DT104 (Fig. 4). Furthermore, florfenicolresistance encoded by the floR gene has also recently beenrevealed in Escherichia coli isolates from diseased cattle (A.Cloeckaert, G. Flaujac, J. L. Martel, and E. Chaslus-Dancla,Abstr. 39th Intersci. Conf. Antimicrob. Agents Chemother.,abstr. 809, 1999).

The discover of a DT104-like antibiotic resistance gene clus-ter in serovar Agona raises the question of its mobility. Re-cently it has been shown that the resistance genes of serovarTyphimurium DT104 can be efficiently transduced by P22-likephage ES18 and by phage PDT17, which is released by allDT104 isolates analyzed so far (12). Also upstream of the firstintegron is a gene encoding a putative resolvase enzyme withmore than 50% identity with the Tn3 resolvase family (1),which suggests that the antibiotic resistance gene cluster could

FIG. 1. Gene organization of the antibiotic resistance gene cluster of serovar Typhimurium DT104 according to Arcangioli et al. (1) and Briggs and Fratamico (4).PCRs used to assess the genetic organization are indicated. Abbreviations for restriction sites: X, XbaI; E, EcoRI; H, HindIII; Xh, XhoI.

TABLE 1. Primers used for PCR

Primer Gene Fragmenta Size (bp) Nucleotide sequence (59–39) Position in sequenceb

cml01 floR 494 TTTGGWCCGCTMTCRGAC 4649–4666cml15 floR SGAGAARAAGACGAAGAAG 5143–5125

int1 int1 A 1,135 GCTCTCGGGTAACATCAAGG 1267–1286aad aadA2 GACCTACCAAGGCAACGCTA 2402–2383

sulTER sulIdelta1 B 942 AAGGATTTCCTGACCCTG 3567–3584F3 floR AAAGGAGCCATCAGCAGCAG 4509–4490

F4 floR C 598 TTCCTCACCTTCATCCTACC 5360–5379F6 tetR TTGGAACAGACGGCATGG 5958–5940

tetR tetR D 1,559 GCCGTCCCGATAAGAGAGCA 6205–6224tetA tetA GAAGTTGCGAATGGTCTGCG 7764–7745

int2 groEL-Int1 E 1,338 TTCTGGTCTTCGTTGATGCC 10764–10783pse1 blaPSE-1 CATCATTTCGCTCTGCCATT 12102–12083

a Fig. 1.b GenBank accession no. AF071555.

1360 NOTES ANTIMICROB. AGENTS CHEMOTHER.

on May 7, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

form part of a large transposon. Further nucleotide sequencingof the regions up- and downstream the 12.5-kb antibiotic re-sistance gene cluster is needed to determine if this cluster be-longs to a transposon. A functional approach such as thatdescribed by Levesque and Jacoby (8) could also be used todetermine its possible transposon-mediated mobility.

We thank C. Mouline for expert technical assistance.

REFERENCES

1. Arcangioli, M. A., S. Leroy-Setrin, J. L. Martel, and E. Chaslus-Dancla.1999. A new chloramphenicol and florfenicol resistance gene flanked by twointegron structures in Salmonella typhimurium DT104. FEMS Microbiol.Lett. 174:327–332.

2. Arcangioli, M. A., S. Leroy-Setrin, J. L. Martel, and E. Chaslus-Dancla.2000. Evolution of chloramphenicol resistance, with emergence of cross-resistance to florfenicol, in bovine Salmonella Typhimurium strains impli-cates definitive phage type (DT) 104. J. Med. Microbiol. 49:103–110.

3. Bolton, L. F., L. C. Kelley, M. D. Lee, P. J. Fedorka-Cray, and J. J. Maurer.1999. Detection of multidrug-resistant Salmonella enterica serotype typhi-murium DT104 based on a gene which confers cross-resistance to florfenicoland chloramphenicol. J. Clin. Microbiol. 37:1348–1351.

4. Briggs, C. E., and P. M. Fratamico. 1999. Molecular characterization of anantibiotic resistance gene cluster of Salmonella typhimurium DT104. Anti-microb. Agents Chemother. 43:846–849.

5. Carlson, S. A., L. F. Bolton, C. E. Briggs, H. S. Hurd, V. K. Sharma, P. J.Fedorka-Cray, and B. D. Jones. 1999. Detection of multiresistant Salmonellatyphimurium DT104 using multiplex and fluorogenic PCR. Mol. Cell Probes13:213–222.

6. Glynn, M. K., C. Bopp, W. DeWitt, P. Dabney, M. Mokhtar, and F. J. Angulo.1998. Emergence of multidrug-resistant Salmonella enterica serotype typhi-murium DT104 infections in the United States. N. Engl. J. Med. 338:1333–1338.

7. Imberechts, H., I. D’hooghe, and P. Pohl. 1998. Prevalence of SalmonellaAgona in animals in Belgium. Salmonella Newsl. 4:4.

8. Levesque, R. C., and G. A. Jacoby. 1988. Molecular structure and interrela-tionships of multiresistance b-lactamase transposons. Plasmid 19:21–29.

9. Poppe, C., N. Smart, R. Khakhria, W. Johnson, J. Spika, and J. Prescott.1998. Salmonella typhimurium DT104: a virulent and drug-resistant patho-gen. Can. Vet. J. 39:559–565.

10. Ridley, A., and E. J. Threlfall. 1998. Molecular epidemiology of antibioticresistance genes in multiresistant epidemic Salmonella typhimurium DT104.Microb. Drug Resist. 4:113–118.

11. Sandvang, D., F. M. Aarestrup, and L. B. Jensen. 1998. Characterisation ofintegrons and antibiotic resistance genes in Danish multiresistant Salmonellaenterica Typhimurium DT104. FEMS Microbiol. Lett. 160:37–41.

12. Schmieger, H., and P. Schicklmaier. 1999. Transduction of multiple drugresistance of Salmonella enterica serovar typhimurium DT104. FEMS Micro-biol. Lett. 170:251–256.

FIG. 2. PCR amplifications generating fragments A, B, C, D, and E (Fig. 1)with serovar Typhimurium DT104 strain BN9181 (lanes 2) and serovar Agonastrains 31SA96 (lanes 3), 64SA96 (lanes 4), 251SA97 (lanes 5), 959SA97 (lanes6), and 1873SA97 (lanes 7). Lanes 1, DNA ladder. (A) Amplification generatingfragments A, C, and D in multiplex PCR; (B) amplification generating fragmentB; (C) amplification generating fragment E.

FIG. 3. Southern blot hybridization with an XbaI probe (Fig. 1) of HindIII-,XhoI-, EcoRI-, and XbaI-digested genomic DNAs of serovar Typhimurium DT104strain BN9181 (lanes 1) and serovar Agona strains 31SA96 (lanes 2), 64SA96(lanes 3), 251SA97 (lanes 4), 959SA97 (lanes 5), and 1873SA97 (lanes 6).

FIG. 4. PFGE of genomic DNAs cut by XbaI of serovar TyphimuriumDT104 strain BN9181 (lane 1); serovar Agona strains 31SA96 (lane 2), 64SA96(lane 3), 251SA97 (lane 4), 959SA97 (lane 5), and 1873SA97 (lane 6); andserovar Typhimurium DT120 strains 424SA93 (lane 7) and 1439SA96 (lane 8).

VOL. 44, 2000 NOTES 1361

on May 7, 2018 by guest

http://aac.asm.org/

Dow

nloaded from