Relation of disease activity during chronic hepatitis C infection to complexity of hypervariable region 1 quasispecies

Relation of Disease Activity During Chronic Hepatitis CInfection to Complexity of Hypervariable Region 1 Quasispecies

NOBUKAZU YUKI,1 NORIO HAYASHI,1 TOYOKI MORIBE,2 YOSHIKI MATSUSHITA,3 TSUTOMU TABATA,3 TAKASHI INOUE,3

YOSHIYUKI KANAZAWA,1 KAZUYOSHI OHKAWA,1 AKINORI KASAHARA,1 HIDEYUKI FUSAMOTO,1 AND TAKENOBU KAMADA1

that antibodies to HCV envelope glycoproteins may have aWe studied the heterogeneity in the E2/NS1 hypervari-neutralizing effect,4,5 and the genetic drift in HVR1 is thoughtable region 1 of the hepatitis C virus (HCV) genome into provide HCV with a better chance for adaptation to im-relation to the natural course after infection. The sub-mune pressure.6,7jects were composed of 38 chronic hepatitis C carriers

Very recently, it has been shown that patients with a het-who had been followed for 9 to 218 months after theerogenous HCV population are less likely to respond to inter-onset of non-A, non-B (type C) hepatitis, being testedferon therapy than those with a homogenous HCV popula-monthly for serum alanine aminotransferase levels. Thetion,8-10 indicating that the HVR1 quasispecies nature maycomplexity of the sequence heterogeneity was assessedbe useful for predicting responses to antiviral therapy, as isby single-strand conformation polymorphism analysis.the case with HCV replicative levels and genotypes.11-15 Thus,The quasispecies complexity had no relation to the routethe HVR1 quasispecies seem to play an important role inof infection, the time from infection and the duration ofpersistent HCV infection.aminotransferase elevation after the onset. However, it

At present, factors affecting the development of the HVR1had a significant relationship with the degree of amino-quasispecies nature in the natural course of chronic HCVtransferase elevation in the course of the disease. Theinfection remain to be worked out. In this study, the degreequasispecies complexity was directly correlated withof complexity of HVR1 quasispecies was assessed in chronicthe first peak of serum aminotransferase at the onset (rHCV carriers using single-strand conformation polymor-Å .48, P õ .01) and the mean aminotransferase levelsphism (SSCP) analysis.10 The results were correlated withduring the period of persistent aminotransferase eleva-the clinical courses of the patients after infection to studytion (r Å .58, P õ .01). Twenty-three of the 38 patientsfactors affecting the HVR1 quasispecies nature.were further followed for 24 months with biweekly ala-

nine transaminase (ALT) tests. Their aminotransferasePATIENTS AND METHODSlevels remained within the normal range during follow-

up, and no significant change was seen in the quasispe- Patients. Sixty-two patients had undergone detailed follow-upcies complexity after this asymptomatic period. How- after the onset of non-A, non-B (type C) hepatitis in a hemodialysis

unit. Forty of the 62 patients received no blood transfusion after theever among the 23 patients, the quasispecies complexityonset and were subjected to the study. The remaining 22 patients,increased in six cases (26%) and decreased in five (22%).who received blood products during the follow-up, were excludedA significant direct relation was seen between changesbecause possible superinfection with HCV in contaminated bloodin the quasispecies complexity and the mean amino-products can hamper the analysis of HCV HVR1 derived from initialtransferase levels during the asymptomatic period (r Åinfection. The HVR1 quasispecies nature at the end of follow-up could.55, PÅ .01). These findings suggest that the development be estimated using SSCP analysis in 38 of the 40 cases tested. Thus,

of the HCV quasispecies nature may be related to the these 38 patients were enrolled in the analysis. They were 17 malesseverity of the hepatitis in the course of infection. (HEPA- and 21 females ranging in age from 36 to 75 years (median age, 55TOLOGY 1997;25:439-444.) years). The causes of their renal failure were chronic glomerulone-

phritis (n Å 30), diabetic nephropathy (n Å 4), and polycystic kidneydisease (n Å 4). The 38 patients had undergone detailed follow-upSince the genome of hepatitis C virus (HCV) was cloned,1 for 9 to 218 months (median, 93 months) from the onset of non-A,

many studies have revealed the heterogeneity of the HCV non-B (type C) hepatitis until 1993. After the diagnosis of renalgenome. As with other RNA viruses, HCV circulates as a disease, they received monthly routine laboratory tests includingmixture of genetically different but closely related variants, serum alanine transaminase (ALT) activity. Hepatitis B surface anti-

gen was examined every 1 to 3 months. Since serological tests forthus forming quasispecies. This quasispecies nature is mostHCV became available in 1990, HCV antibody was also tested everyprominent in the hypervariable region 1 (HVR1) found at the3 to 6 months. These 38 patients showed the onset of non-A, non-BN-terminus of the E2/NS1 region.2,3 Several studies showed(type C) hepatitis 6 to 108 months (median, 15 months) after theirentry to the hemodialysis program. They had no preexisting liverdisease and had showed repeatedly normal ALT values for more than3 years. Elevated ALT activity was first noted, and at least two

Abbreviations: HCV, hepatitis C virus; HVR1, hypervariable region 1; SSCP, single-abnormal values were observed in measurements separated by 1 orstrand conformation polymorphism; ALT, alanine transaminase; RT-PCR, reverse-tran-more weeks. Hepatotropic viruses other than HCV and nonviralscription polymerase chain reaction; bDNA assay, branched DNA assay; nt, nucleotidecauses of hepatocellular injury were excluded by conventional clinicalposition.

From the 1First Department of Medicine, Osaka University Medical School, Suita 565; and laboratory studies in all cases. In 16 of the 38 patients, HCV2Diagnostic Science Department, Shionogi Biomedical Laboratories, Settsu 566; and 3De- antibody seroconversion was seen after the onset of the disease, andpartment of Medicine, Inoue Hospital, Suita 564, Japan. HCV antibody was persistently found during follow-up. The re-

Received April 13, 1995; accepted September 13, 1996. maining 22 patients contracted non-A, non-B hepatitis before theSupported by a Grant-in-Aid from the Ministry of Education, Science and Culture, discovery of HCV, and were shown to have HCV infection in 1990

Japan.when serological tests for HCV became available. Thereafter, theyAddress reprint requests to: Norio Hayashi, M.D., First Department of Medicine, Osakaremained seropositive for HCV during follow-up. HCV infection wasUniversity Medical School, Yamadaoka 2-2, Suita 565, Japan.further confirmed in all of the 38 patients by reverse-transcriptionCopyright q 1997 by the American Association for the Study of Liver Diseases.

0270-9139/97/2502-0031$3.00/0 polymerase chain reaction (RT-PCR) for the detection of serum HCV

439

AID Hepa 0004 / 5P1C$$$$61 01-10-97 15:27:56 hpta WBS: Hepatology

440 YUKI ET AL. HEPATOLOGY February 1997

RNA. During the entire follow-up periods, all of the 38 patients were was classified into four genotypes (1a, 1b, 2a, and 2b) based on varia-tion in nucleotide sequence within restricted regions in the putativepersistently negative for HBsAg. They had no history of administra-

tion of hepatotoxic drugs or alcohol abuse (ú80 g/d) and showed no HCV core gene.Complexity of the Sequence Heterogeneity in the E2/NS1evidence of autoimmune liver disease. Thus, there was no apparent

cause of hepatocellular injury other than HCV during the follow-up. HVR1. HVR1 quasispecies was assessed by PCR-SSCP analysis asdescribed previously.10 In brief, a portion of the HCV E2/NS1 regionSerum ALT elevation occurred 1 to 7 months after transfusion of

two units of packed erythrocytes in 17 cases, and their illness was including HVR1 was amplified by RT-PCR using a sense primer S1(5*TGGCTTGGGATATGATGATGAAC3*, nucleotide positions [nt]considered to be posttransfusion non-A, non-B (type C) hepatitis. The1277-1299 of HC-J4)19 and antisense primers A1 (5*GGGGTGAAG-other 21 cases had had no apparent risk factors for viral hepatitis,CAATACACTGGACCACA3*, nt 1831-1856 of HC-J4)/A2 (5*GGG-and their illness was considered to be sporadic non-A, non-B (typeGTGAAGCAGTACACTGGGCCGCA3*, nt 1839-1864 of BK16). A por-C) hepatitis. Their first peaks of serum ALT elevation ranged be-tion of the first-stage PCR products was further amplified by PCRtween 1.1 and 23.0 times the upper limit of the normal range (45 U/using a nested pair of a sense primer S2 (5*TGGGATATGATGATC-L) (median, 4.1). Persistent serum ALT elevation began with lowAACTGGTC3*, nt 1282-1304 of HC-J4) and antisense primers A3ALT peaks of õ2 times the upper limit of the normal range in nine(5*GTGAAGGAATTCACTGGACCACACAC3*, nt 1828-1853 of HC-cases. The duration of serum ALT elevation in the 38 patients rangedJ4)/A4 (5*GTGAAGGAATTCACTGGGCCGCACAC3*, nt 1836-1861between 1 and 206 months (median, 22 months). In 30 patientsof BK). The third-stage PCR was performed using SSCP primers:(79%), serum ALT fluctuation lasted for at least 6 months indicatingsense primer HS (5*GCCTTGCCTACTATTCCATG3*, nt 1405-1424a strong likelihood of chronicity of the disease. However, after theof HC-J4) and antisense primer HA (5*TTGATGTGCCAACTGCCA-last episode of serum ALT elevation, 25 (83%) of the 30 patients hadTT3*, nt 1581-1600 of HC-J4). The third-stage PCR products werea period of serum ALT normalization. Until the end of follow-up,subjected to electrophoresis, and successful amplification of the pre-serum ALT normalization was observed for more than 1 year in 16dicted length (196 base pairs) was confirmed. For PCR-SSCP analy-patients (53%), and eight patients (27%) showed normal serum ALTsis, the third-stage PCR amplification was performed using 32P-la-levels for more than 5 years, thus indicating biochemical remissionbelled SSCP primers. A portion of the PCR products were denaturedof the disease. Serum samples obtained from each patient at the endto obtain single-stranded DNA at 957C for 10 minutes in a denatur-of follow-up in 1993 were subjected to analysis of the HCV quasispe-ation solution comprised of 95% formamide, 0.05% bromophenol blue,cies nature, HCV RNA levels and HCV genotypes.0.05% xylene cyanol, and 20 mmol/L ethylene diamine tetraaceticTwenty-three of the 38 patients could be further followed for theacid. The denatured products were chilled on ice water for 10 minutessubsequent 24 months with biweekly serum ALT tests and thenand applied to a 5% polyacrylamide gel (acrylamide:N, N*-bisacryl-tested for the HCV quasispecies nature and HCV RNA levels again.amide Å 49:1). Electrophoresis was performed at 257C for 1 hour atThey remained seropositive for HCV during this period, and HCVa constant power of 30 W using a Macrophor sequencing systemviremia was revealed by RT-PCR. However, biweekly ALT levels(Pharmacia LKB Biotechnology AB., Uppsala, Sweden). The gel wasremained within the normal range in each case.dried on a glass board and exposed to x-ray film at room temperatureSerological Testing. Serum samples were tested for HBsAg withfor 20 hours.a radioimmunoassay (Abbott Laboratories, North Chicago, IL). For

Thus, heterogenous mixtures of mutant genomes were separatedthe diagnosis of non-A, non-B hepatitis, an enzyme immunoassay forinto different bands depending on sequence-specific, three-dimen-immunoglobulin M antibody to hepatitis B core antigen, a radioim-sional conformations. In preliminary experiments, SSCP analysismunoassay for IgM antibody to hepatitis A virus (Abbott Labora-was performed using plasmid DNA clones isolated from serum sam-tories), and indirect immunofluorescence tests for antibodies to cyto-ples after two-round RT-PCR using S1, S2, A1/A2, and A3/A4 prim-megalovirus and Epstein-Barr virus were further performed toers. The third-stage PCR products from a single clone were separatedexclude other types of viral hepatitis. HCV antibody was tested withinto two bands by SSCP analysis. The particularly inseparable clonesa first-generation enzyme-linked immunosorbent assay or a second-could be clearly separated into two bands under different SSCP elec-generation radioimmunoassay (Ortho Diagnostic Systems Co., Ltd.,trophoretic conditions of lower temperature. To detect sequence dif-Tokyo, Japan). The assays were performed according to the manufac-ferences, we also examined the sensitivity. Analysis of a mixture ofturer’s instructions and were done in duplicate.multiple clones differing in nucleotide sequence by more than 10%Detection, Quantification, and Typing of Serum HCV RNA.usually gave the expected number of SSCP bands. However, in someSerum HCV RNA sequences were detected by RT-PCR. HCV RNAcases, several bands migrated to the same position, resulting in awas extracted from 100 mL of serum samples, copied into comple-smaller number of bands than expected. On the other hand, multiplementary DNA by RT, and amplified by PCR as described else-clones differing by õ10% could not be separated under our electro-where.13 Primers were derived from the 5*-noncoding region of the phoretic conditions and were recognized as the same bands. Thesepublished sequence:16 antisense primer 5*ATGGTGCACGGTCTA- findings indicate that our SSCP analysis can evaluate the approxi-CGAGACCTCC3* and sense primer 5*CACTCCCCTGTGAGG- mate number of major clones with more than 10% differences inAACTACTGTC3*. The PCR mixtures were amplified in a DNA nucleotide sequence. Furthermore, preliminary experiments showedthermal cycler (Perkin-Elmer Cetus, Norwalk, CT) for 40 cycles that the degree of complexity of HVR1 quasispecies assessed by SSCP(947C for 0.5 minutes; 557C for 1 minute; 727C for 1 minute), fol- analysis correlated with the degree of diversity assessed by sequencelowed by a 10-minute final extension at 727C. A portion of the PCR analysis.

products was fractionated by agarose gel electrophoresis, trans- Statistical Analysis. Statistical analysis for group comparisonsferred onto a nylon membrane, hybridized to a 32P-labelled HCV was performed by the x2 method and the Wilcoxon nonparametriccomplementary DNA between the two primers, and autoradio- test. Correlations between the variables were calculated using Spear-graphed. Because of the extreme sensitivity of PCR, great care was man rank order correlations. A value of P õ .05 (two-tailed) wastaken to prevent false-positive PCR results, and the contamination considered to indicate significance.avoidance measures of Kwok and Higuchi17 were strictly appliedthroughout. Also, we included nine test samples, two negative con- RESULTStrol sera from healthy individuals without risk factors for HCV

All of the 38 patients were followed until 1993, and theinfection, and one sample of distilled water to prevent false-posi-clinical course of hepatitis C infection and the results of viro-tive results.

Quantification of serum HCV RNA was performed using a logical investigation at this point were compared betweenbranched DNA (bDNA) assay (Chiron HCV-RNA, Chiron Corpora- the posttransfusion and sporadic hepatitis groups (Table 1).tion, Emeryville, CA).12 The assay was performed according to the Follow-up periods after the onset of non-A, non-B (type C)manufacturer’s instructions. Specimens with quantification values hepatitis were the same for the 17 patients with posttransfu-over the cut-off value of the kits (350,000 HCV RNA Eq/mL) were sion hepatitis and the 21 patients with sporadic hepatitis.considered positive. All assays were performed in duplicate, and the No significant difference was found in the clinical course ofmean quantification value of the duplicates was calculated. The re-

the disease between the two groups. The first ALT peaks atsults were expressed as log10 (HCV RNA equivalent per mL). Anthe onset tended to be high in the posttransfusion hepatitisarbitrary value of 175,000 Eq/mL was attributed to the serum sam-group (median, 6.1; range, 1.6-23.0 times the upper limit ofples positive by RT-PCR but negative by bDNA assay.normal) compared with the sporadic hepatitis group (median,HCV RNA–positive serum samples were further subjected to ge-

notype analysis according to a method described previously.18 HCV 3.9; range, 1.1-21.5 times the upper limit of normal). How-


HEPATOLOGY Vol. 25, No. 2, 1997 YUKI ET AL. 441

TABLE 1. Patient Characteristics in Posttransfusion and Sporadic Non-A, Non-B (Type C) Hepatitis Groups

Characteristics Posttransfusion (n Å 17) Sporadic (n Å 21) P

Follow-up period after the onset of hepatitis (mo) 88 (14-170) 100 (9-218) NSFirst ALT peak (1 normal)* 6.1 (1.6-23.0) 3.9 (1.1-21.5) NS

Chronicity 13/17 (76%) 17/21 (81%) NSPeriod of ALT normalization (mo) 41 (0-141) 20 (0-128) NSVirological tests for HCV

HCV quasispecies† 3 (1-5) 2 (1-6) NSSerum HCV RNA titers (Eq/mL) 105.9 (RT-PCR//bDNA0 to 107.1) 106.0 (RT-PCR//bDNA0 to 107.6) NS

HCV genotype1b 11 (65%) 17 (81%)2a 2 (12%) 0 NS1b / 2b 1 (6%) 1 (5%)Unclassified 3 (18%) 3 (14%)

NOTE. All patients were followed until 1993 and then subjected to virological tests. Quantitative data expressed as median (range).Abbreviation: NS, not significant.* Values are multiples of the upper limit of normal.† HCV quasispecies are expressed as the number of bands in single-strand conformation polymorphism analysis.

ever, the difference was not significant. The development of developed. A significant direct relation was found betweenthe number of bands in SSCP analysis and the mean valuechronic hepatitis, defined as persistent serum ALT fluctua-

tion for at least 6 months, was frequently seen in both groups of the monthly ALT tests during the period of ALT fluctuation(rÅ .58, Põ .01) (Fig. 2). Thus, patients, who had had higher(76% and 81%, respectively), and the periods of ALT normal-

ization after the last episode of serum ALT elevation were levels of serum ALT elevation, showed higher complexity ofHVR1 quasispecies at the end of follow-up.also the same for the two groups.

In these 38 patients with serum HCV RNA detected by On the other hand, no significant relationship was seenbetween the complexity of the HVR1 quasispecies nature andRT-PCR, the degree of complexity of the HVR1 quasispecies

assessed by the number of bands in SSCP analysis ranged HCV replicative levels assessed by viremic levels at the endof follow-up in 1993 (Fig. 3). The number of bands in SSCPbetween one and six (median 3). No difference was found in

the complexity of the HVR1 quasispecies nature between the analysis ranged between one and three (median, three) forthe 10 patients who had low titers of serum HCV RNA belowposttransfusion and sporadic hepatitis groups. HCV viremic

levels in the 38 patients ranged from RT-PCR//bDNA0 to the bDNA cutoff but were positive according to RT-PCR (RT-PCR//bDNA0), and between one and six (median, three)107.6 Eq/mL (median 106.0 Eq/mL). HCV genotyping showed

that 28 patients (74%) had genotype 1b and two patients (5%) for the remaining 28 patients with serum HCV RNA titersdetectable by the bDNA assay. The difference did not reachhad genotype 2a. Both genotypes 1b and 2b were found in

two patients (5%). HCV genotype(s) could not be identified a statistically significant level. Furthermore, no correlationwas found between the number of bands in SSCP analysisin six cases (16%). No significant difference was also observed

in HCV viremic levels and the prevalence of HCV genotypes and serum HCV RNA titers (r Å .19).In this study, we investigated changes in the HVR1 quasi-between the posttransfusion and sporadic hepatitis groups.

The virological implications of HVR1 quasispecies nature species complexity for 23 patients, who underwent furtherdetailed follow-up with biweekly serum ALT tests for 24were further investigated in relation to the clinical course of

chronic HCV infection. A relationship between the time from months after sera were drawn in 1993. The HVR1 quasispe-cies nature at the beginning and the end of this period wasinfection and the degree of complexity of HVR1 quasispecies

at the end of follow-up in 1993 was not evident. The duration compared with the same run of SSCP analysis. Their serumALT levels remained within the normal range during thisfrom infection was estimated from the time of blood transfu-

sion for the posttransfusion hepatitis group. For the sporadic period although the mean value of the biweekly ALT testsdiffered considerably (median, 20; range, 8-32 U/L). Twelvehepatitis group, it was estimated from the time when the

patients were first noted to have elevated serum ALT levels.No significant relationship was found between the numberof bands in SSCP analysis and the time from infection (r Å.13). High complexity of HVR1 quasispecies could be observedin patients with short-term infection. Conversely, in patientswith long-term infection, the degree of complexity of HVR1quasispecies was often low. The degree of complexity of HVR1quasispecies was further correlated with serum ALT profilesduring follow-up after the onset of hepatitis. The number ofbands in SSCP analysis had no relation to the duration ofserum ALT fluctuation from the onset of hepatitis to the lastepisode of serum ALT elevation (r Å .05) or the duration ofsubsequent serum ALT normalization (rÅ .15). However, thenumber of bands in SSCP analysis had relation to the levelsof serum ALT elevation during follow-up. It tended to bedirectly correlated with the first serum ALT peak at the onset(rÅ .48, Põ .01) (Fig. 1). Patients with high ALT peaks at theonset tended to show high complexity of HVR1 quasispecies.Disease activity during the entire period of persistent ALT FIG. 1. Relationship between the first peak of serum ALT levels at thefluctuation until the last episode of ALT elevation was fur- onset of hepatitis and complexity of HVR1 quasispecies assessed by SSCP

analysis in patients with chronic HCV infection (r Å .48; P õ .01).ther evaluated for the 30 patients in whom chronic hepatitis



FIG. 4. The mean value of biweekly serum ALT tests during asymptomaticHCV infection had relation to the occurrence of changes in complexity of HVR1quasispecies (r Å .55; P Å .01). The HVR1 quasispecies complexity was as-sessed by the number of bands in SSCP analysis.FIG. 2. Relationship between the mean serum ALT levels in the chronic

hepatitis period showing persistent ALT fluctuation and complexity of HVR1quasispecies assessed by SSCP analysis in patients with chronic HCV infection(r Å .58; P õ .01).

biweekly ALT tests during follow-up (r Å .55, P Å .01) (Fig.4). The HVR1 quasispecies complexity tended to increase inassociation with relatively high ALT levels, whereas patientscases (52%) showed no change in the number of bands inwith low ALT levels tended to show no change or decreaseSSCP analysis although changes in the band pattern werein the HVR1 quasispecies complexity. As for changes in HCVseen in eight (67%) of the 12 cases indicating replacement ofviremic levels, serum HCV RNA titers in the 23 patientsHCV populations. The number of bands increased by one toranged from RT-PCR//bDNA0 to 107.1 Eq/mL (median, 106.0

four (median, one) in six cases (26%), whereas it decreasedEq/mL) at the beginning of the asymptomatic period and fromby one in the remaining five cases (22%). Thus, no significantRT-PCR//bDNA0 to 106.8 Eq/mL (median, RT-PCR//change was seen in the HVR1 quasispecies complexity afterbDNA0) at the end. A slight but significant reduction in HCVthe asymptomatic period. In these patients, however, a signif-viremic levels was observed (P õ .01). No relationship wasicant direct relation was observed between changes in theseen between the percent changes in HCV viremic levels andHVR1 quasispecies complexity and the mean value of thechanges in the number of bands in SSCP analysis (r Å .18).

Then again, we correlated the HVR1 quasispecies complex-ity at the final end of follow-up (1,993 for the 15 cases withoutthe subsequent follow-up and 1,995 for the remaining 23cases) with the clinical course after infection. At this point,patients’ clinical and virological characteristics (listed in Ta-ble 1) remained the same for the posttransfusion hepatitisgroup and the sporadic hepatitis group. The HVR1 quasispe-cies complexity had no relation to the term from infection (rÅ .10), the duration of serum ALT fluctuation (r Å .15), orthe duration of subsequent serum ALT normalization (r Å0.02). However, it was still directly correlated with the firstserum ALT peak at the onset (r Å .51; P õ .01) and themean ALT levels during the chronic hepatitis period showingpersistent ALT elevation (r Å .39, P õ .05). There was norelationship between the HVR1 quasispecies complexity andHCV viremic levels at the final end of follow-up (r Å .19).

DISCUSSION

HCV, like other RNA viruses, is thought to mutate rapidlybecause of the high error rate in RNA replication, leading tothe simultaneous coexistence of multiple variants in the sameindividual (quasispecies). There are hypervariable regions lo-cated at the N-terminal part of the envelope 2 region showinghigh amino acid variability,2,3 which seem to have pervasiveclinical implications in that the variability could enable theHCV to escape from the host’s immune system6,7 and alsoresist antiviral therapy.8-10 However, the development of thequasispecies nature in the hypervariable regions is not fullyunderstood in the natural course of HCV infection. It may beFIG. 3. Relationship between serum HCV RNA titers and complexity ofaffected by the host immune pressure and also by some viralHVR1 quasispecies assessed by SSCP analysis in patients with chronic HCV

infection (r Å .19, not significant). characteristic associated with mutation frequencies.


HEPATOLOGY Vol. 25, No. 2, 1997 YUKI ET AL. 443

To address the question of which factor has relevance to the ated with a slow decline of CD4/ cell numbers after infectionand the V3 quasispecies evolution is directly related to thedevelopment of the HVR1 quasispecies nature in the course of

chronic HCV infection, we studied the complexity of the duration of the immunocompetent period.26,27 Similarly, in-tense immune pressure during the period with aminotrans-HVR1 quasispecies in relation to various clinical characteris-

tics after HCV infection. For this purpose, we attempted to ferase elevation may play an important role in the develop-ment of the HCV HVR1 quasispecies complexity. However,evaluate the HVR1 quasispecies nature by SSCP analysis.

Thus far, the HCV quasispecies nature has been investigated we can’t exclude a possibility that the quasispecies changesin HCV infection conversely enhance host immunological re-by cloning and sequencing of PCR products. However, such

analysis requires much effort to isolate and sequence multi- activity, resulting in active liver inflammation. Thus, contro-versy remains about the causal relation between host im-ple cDNA clones; only a limited number of clones obtained

from a small number of patients can be examined. Another mune pressure and the development of the HVR1quasispecies complexity.drawback is that a limited number of complementary DNA

clones do not necessarily reflect the total spectrum of HCV Alternatively, the marked elevation of aminotransferaselevels may be related to the acceleration of HCV replication,quasispecies in vivo. On the other hand, SSCP analysis can

separate DNA fragments of the same size into different elec- which results in an increase in mutation frequencies inHVR1. In the present study, no significant correlation wastrophoretic bands depending on their sequence-specific three-

dimensional conformations.20,21 The number of bands is di- found between the degree of complexity of the HVR1 quasi-species and HCV replicative levels. Moreover, changes inrectly proportional to the degree of sequence complexity.

Thus, SSCP analysis has the advantage of enabling rough HCV replicative levels had no relation to those in the HVR1quasispecies complexity. Thus, it seems that the HVR1 quasi-estimation of the major quasispecies of the total virus popula-

tion in many samples. species nature in chronic HCV infection has distinct virologi-cal implications from HCV replicative levels assessed by vire-The data obtained showed that disease activity in the

course of chronic HCV infection showed relevance to the pres- mic levels. Nevertheless, we cannot completely exclude apossible interrelationship between the progression of theent HVR1 quasispecies nature. The degree of complexity of

the HVR1 quasispecies at the end of follow-up was directly HVR1 quasispecies nature and viral replicative levels in thecourse of HCV infection. HCV replicative levels at a fewrelated to the levels of serum aminotransferase elevation

after infection. On the other hand, the route of infection and points in time do not always reflect viral replication duringthe entire follow-up period. Further studies are necessary tothe total period from infection had no apparent relation to

the complexity of the HVR1 quasispecies. In the present address this issue more accurately.Finally, the present study showed that the HVR1 quasispe-study, we further investigated changes in the HVR1 quasi-

species complexity after a period of asymptomatic HCV infec- cies nature in chronic HCV carriers had relation to only dis-ease activity during HCV infection. Patients with HCV infec-tion showing normal ALT levels. The HVR1 quasispecies

complexity showed no significant change after the asymptom- tion showing higher complexity of the HVR1 quasispecies aremore likely to fail to neutralize the virus and resist antiviralatic period. However, changes in the HVR1 quasispecies com-

plexity were seen in half of the patients examined, which had therapy. Thus, from the virological point of view, the currentstudy sheds further light on adverse implications of activerelevance to serum ALT levels during follow-up. Increase in

the HVR1 quasispecies complexity tended to occur in associa- liver inflammation in the course of HCV infection.tion with relatively high ALT levels. On the other hand, in

REFERENCESpatients with low ALT levels, decrease in the HVR1 quasispe-cies complexity could be observed, which may be a reflection 1. Choo Q-L, Kuo G, Weiner AJ, Overby LR, Bradley DW, Houghton M.of competitive selection of the quasispecies populations in Isolation of a cDNA clone derived from a blood-borne non-A, non-B viral

hepatitis genome. Science 1989;244:359-362.vivo. It has been suggested that hemodialysis patients can2. Weiner AJ, Brauer MJ, Rosenblatt J, Richman KH, Tung J, Crawford K,show low serum ALT activity and the real upper limit of the

Bonino F, et al. Variable and hypervariable domains are found in thenormal range may be lower in such patients compared with regions of HCV corresponding to the flavivirus envelope and NS1 proteinsnormal control subjects.22 Taken together, these findings in- and the pestivirus envelope glycoproteins. Virology 1991;180:842-848.

3. Hijikata M, Kato N, Ootsuyama Y, Nakagawa M, Ohkoshi S, Shimotohnodicate that disease activity in HCV infection may be a factorK. Hypervariable regions in the putative glycoprotein of hepatitis C virus.which contributes to the development of the HVR1 quasispe-Biochem Biophys Res Commun 1991;175:220-228.cies nature. Thus far, a few reports suggested that the rate 4. Choo Q-L, Kuo G, Ralston R, Weiner A, Chien D, Van Nest G, Han J, et

of mutation in the HVR1 correlated with the pattern of ALT al. Vaccination of chimpanzees against infection by the hepatitis C virus.Proc Natl Acad Sci U S A 1994;91:1294-1298.profiles in chronic HCV infection and was high in patients

5. Shimizu Y, Hijikata M, Iwamoto A, Alter HJ, Purcell RH, Yoshikura H.with high ALT levels.23,24 Our findings seem to be generallyNeutralizing antibodies against hepatitis C virus and the emergence ofcompatible with such studies on the mutation rate. However, neutralization escape mutant viruses. J Virol 1994;68:1494-1500.

controversy remains about the mechanism of the develop- 6. Weiner AJ, Geysen HM, Christopherson C, Hall JE, Mason TJ, SaraccoG, Bonino F, et al. Evidence for immune selection of hepatitis C virusment of the HVR1 quasispecies complexity, and further stud-(HCV) putative envelope glycoprotein variants: potential role in chronicies are necessary to address this issue.HCV infections. Proc Natl Acad Sci U S A 1992;89:3468-3472.The marked elevation of serum aminotransferase levels 7. Kato N, Sekiya H, Ootsuyama Y, Nakazawa T, Hijikata M, Ohkoshi S,

can be associated with the rapid elimination of infected hepa- Shimotohno K. Humoral immune response to hypervariable region 1 ofthe putative envelope glycoprotein (gp70) of hepatitis C virus. J Virol 1993;tocytes by active host immunological reactions to viral compo-67:3923-3930.nents, and the intensity of such host immune pressure may

8. Okada S, Akahane Y, Suzuki H, Okamoto H, Mishiro S. The degree ofbe relevant to the progression of the quasispecies nature in variability in the amino terminal region of the E2/NS1 protein of hepatitisHCV HVR1, which is considered to bear neutralizing epi- C virus correlates with responsiveness to interferon therapy in viremic

patients. HEPATOLOGY 1992;16:619-624.topes. It has been shown that the HVR1 sequence remained9. Kanazawa Y, Hayashi N, Mita E, Li T, Hagiwara H, Kasahara A, Fusa-unchanged in an agammaglobulinemic patient with chronic

moto H, et al. Influence of viral quasispecies on effectiveness of interferonhepatitis C, thus providing support for the hypothesis that therapy in chronic hepatitis C patients. HEPATOLOGY 1994;20:1121-1130.the generation of genetic variation in HVR1 is the result of 10. Moribe T, Hayashi N, Kanazawa Y, Mita E, Fusamoto H, Negi M, Kanes-

hige T, et al. Hepatitis C viral complexity detected by single-strand confor-host immune pressure.25 Human immunodeficiency virusmation polymorphism and response to interferon therapy. Gastroenterol-type 1 also has variable domains in the envelope gene, andogy 1995;108:789-795.the third variable domain, V3, includes recognition sites for 11. Takada N, Takase S, Enomoto N, Takada A, Date T. Clinical backgrounds

both humoral and T-cell immune responses. Several reports of the patients having different types of hepatitis C virus genomes. JHepatol 1992;14:35-40.revealed that greater V3 quasispecies complexity is associ-



12. Lau JYN, Davis GL, Kniffen J, Qian K-P, Urdea MS, Chan CS, Mizokami polymorphisms of human DNA by gel electrophoresis as single-strand con-formation polymorphisms. Proc Natl Acad Sci U S A 1989;86:2766-2770.M, et al. Significance of serum hepatitis C virus RNA levels in chronic

hepatitis C. Lancet 1993;341:1501-1504. 21. Orita M, Suzuki Y, Sekiya T, Hayashi K. Rapid and sensitive detection ofpoint mutations and DNA polymorphisms using the polymerase chain13. Hagiwara H, Hayashi N, Mita E, Takehara T, Kasahara A, Fusamoto H,

Kamada T. Quantitative analysis of hepatitis C virus RNA in serum during reaction. Genomics 1989;5:874-879.22. Yasuda K, Okuda K, Endo N, Ishiwatari Y, Ikeda R, Hayashi H, Yokozekiinterferon alfa therapy. Gastroenterology 1993;104:877-883.

14. Mita E, Hayashi N, Hagiwara H, Ueda K, Kanazawa Y, Kasahara A, K, et al. Hypoaminotransferasemia in patients undergoing long-term he-modialysis: clinical and biochemical appraisal. Gastroenterology 1995;109:Fusamoto H, et al. Predicting interferon therapy efficacy from hepatitis C

virus genotype and RNA titer. Dig Dis Sci 1994;39:977-982. 1295-1300.23. Kurosaki M, Enomoto N, Marumo F, Sato C. Rapid sequence variation of15. Yuki N, Hayashi N, Kasahara A, Hagiwara H, Takehara T, Oshita M,

Katayama K, et al. Pretreatment viral load and response to prolonged the hypervariable region of hepatitis C virus during the course of chronicinfection. HEPATOLOGY 1993;18:1293-1299.interferon-a course for chronic hepatitis C. J Hepatol 1995;22:457-463.

16. Takamizawa A, Mori C, Fuke I, Manabe S, Murakami S, Fujita J, Onishi 24. Enomoto N, Kurosaki M, Tanaka Y, Marumo F, Sato C. Fluctuation ofhepatitis C virus quasispecies in persistent infection and interferon treat-E, et al. Structure and organization of the hepatitis C virus genome iso-

lated from human carriers. J Virol 1991;65:1105-1113. ment revealed by single-strand conformation polymorphism analysis. JGen Virol 1994;75:1361-1369.17. Kwok S, Higuchi R. Avoiding false positives with PCR. Nature 1989;339:

237-238. 25. Kumar U, Monjardino J, Thomas HC. Hypervariable region of hepatitis Cvirus envelope glycoprotein (E2/NS1) in an agammaglobulinemic patient.18. Okamoto H, Sugiyama Y, Okada S, Kurai K, Akahane Y, Sugai Y, Tanaka

T, et al. Typing hepatitis C virus by polymerase chain reaction with type- Gastroenterology 1994;106:1072-1075.26. Delwart EL, Sheppard HW, Walker BD, Goudsmit J, Mullins JI. Humanspecific primers: application to clinical surveys and tracing infectious

sources. J Gen Virol 1992;73:673-679. immunodeficiency virus type 1 evolution in vivo tracked by DNA hetero-duplex mobility assays. J Virol 1994;68:6672-6683.19. Okamoto H, Okada S, Sugiyama Y, Yotsumoto S, Tanaka T, Yoshizawa

H, Tsuda F, et al. The 5*-terminal sequence of the hepatitis C virus ge- 27. Lukashov VV, Kuiken CL, Goudsmit J. Intrahost human immunodefi-ciency virus type 1 evolution is related to length of the immunocompetentnome. Jpn J Exp Med 1990;60:167-177.

20. Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T. Detection of period. J Virol 1995;69:6911-6916.


Documents

Relation of disease activity during chronic hepatitis C infection to complexity of hypervariable region 1 quasispecies