Recombinase Polymerase amplification assay for rapid detection of Francisella tularensis

1

1

Recombinase Polymerase amplification assay for rapid 2

detection of Francisella tularensis 3

Milena Euler1, Yongjie Wang2, Peter Otto3, Herbert Tomaso3, Raquel Escudero4, Pedro 4 Anda4, Frank T. Hufert1, Manfred Weidmann1 5 6

1. University Medical Center, Department of Virology, Kreuzbergring 57, 37075 7

Göttingen, Germany 8

2. Laboratory of Marine and Food Microbiology, College of Food Science and 9

Technology, Shanghai Ocean University, Shanghai, China 10

3. Friedrich-Loeffler-Institut, Jena, Germany 11

4. Laboratorio de Espiroquetas y Patógenos Especiales, Servicio de Bacteriología, 12

Centro Nacional de Microbiología, Instituto de Salud Carlos III, Ctra. Majadahonda-13

Pozuelo km 2, 28220 Majadahonda, Madrid 14

15

Corresponding author 16 17 Manfred Weidmann 18 Department of Virology 19 Kreuzbergring 57 20 37075 Göttingen 21 22 23 tel: +49-551-3910554 24 fax: +49-551-3910552 25 26 e-mail: [email protected] 27

28 29 30 Running Title: RPA assay for F. tularensis 31

Keywords: RPA, Recombinase polymerase amplification, Franciscella tularensis 32

33 Word count abstract: 92 words 34 Word count text: 2007 words 35 36 37 38 39 40 41 42

Copyright © 2012, American Society for Microbiology. All Rights Reserved.J. Clin. Microbiol. doi:10.1128/JCM.06504-11 JCM Accepts, published online ahead of print on 18 April 2012

on January 24, 2019 by guesthttp://jcm

.asm.org/

Dow

nloaded from

http://jcm.asm.org/

2

43 44 45 46

ABSTRACT 47

48

Several real time PCR approaches to develop field detection for Francisella 49

tularensis the infectious agent causing Tularaemia have been explored. We report 50

the development of a novel qualitative real time isothermal recombinase polymerase 51

amplification (RPA) on a small ESEQuant tubescanner device. The analytical 52

sensitivity and specificity was tested using a plasmid standard and DNA extracts from 53

infected rabbit tissues. The assay showed a performance comparable to real time 54

PCR but reduced assay time to 10 minutes. The rapid RPA method has great 55

application potential for field use or point of care diagnostics. 56

57


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

3

Introduction 58

Because of its extraordinary infectiousness the zoonotic pathogen Francisella 59

tularensis causing Tularaemia was in the past subject of state run bio-warfare 60

research programmes and therefore is included on the CDC category A list of 61

biothreat agents. It causes disease in a vast range of animals with relevant disease 62

transmission to humans by direct contact or via vectors such as deer flies, horse 63

flies, mosquitoes and hard ticks. Infection due to inhalation of aerosols can occur 64

through contact with infected hares. There are three F. tularensis subspecies 65

tularensis, holarctica and mediaasiatica, which can be found in several environments 66

and geographical regions. The first two subspecies and F. novicida cause the bulk of 67

human infections (7, 19). Infection by F. hispaniensis has also been described and 68

results of phylogentic analysis suggest to regroup F. novicida as a 4th subspecies of 69

F. tularensis (3, 12). 70

In all scenarios dealing with intentional release of biothreat agents timely diagnosis is 71

regarded as a caveat to identify and contain outbreaks of infectious disease (4). 72

Many efforts have been made to reduce assay time of PCR based nucleic acid 73

detection. In spite of engineering constraints regarding temperature cycling needed 74

for the PCR assays, short protocols and miniaturised cyclers or chip platforms are 75

being developed (5, 6, 18). 76

In recent years a variety of isothermal amplification methods have been developed 77

which offer the possibility to develop even simpler point of care systems. One 78

example is the ESEQuant Tubescanner device (Qiagen Lake Constance GmbH, 79

Stockach, Germany). This device contains a sophisticated fluorescence sensor, 80

which slides back and forth under a set of 8 tubes collecting fluorescence signals 81

over time and allowing for real time documentation of increasing fluorescence 82

signals. A combined threshold and signal slope analysis is used for signal 83


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

4

interpretation which can be confirmed by 2nd derivative analysis (11, 24). The 84

recombinase polymerase amplification (RPA) is an isothermal amplification, which 85

can be combined with a sequence-specific fluorescent probe for real time detection. 86

In RPA the phage derived recombinase UvsX assisted by its co-factor UvsY 87

aggregates with oligonucleotide primers to scan for homologous sequences in a DNA 88

template. Upon identifying the specific homologous sequence strand invasion and 89

consequent strand displacement amplification via Sau polymerase (Staphylococcus 90

aureus) starting from opposite primers generate amplified dsDNA copies very much 91

like in PCR. The real time probe format used is a probe (TwistAmpTM exo Probe) with 92

a longer upstream stretch (30nt) carrying the fluorophore at its 3’-end, which is 93

connected via a tetrahydrofuran (THF) spacer (dTFAM-THF-dTQuencher) to an 94

adjacent downstream smaller oligonucleotide (15nt) carrying a 5’-Quencher. Upon 95

binding to the complementary sequence an exonuclease recognizes the double 96

strand hybridisation complex and cuts the spacer leading the smaller quencher probe 97

to dissociate thus allowing for real time fluorescence development on the hybridized 98

longer probes hybridized to the accumulating amplified copies (21). Here we describe 99

the development of a real time RPA assay on a ESEQuant tubescanner device for 100

the detection of F. tularensis. 101

102

Materials and Methods 103

Preparation of F. tularensis genomic DNA and DNA from hare samples: 104

Francisella strains (Table 1) were grown in chocolate agar supplemented with 105

IsoVitaleX (Becton Dickinson, Madrid, Spain) and L-Cysteine (Sigma-Aldrich Quimica 106

SA, Madrid, Spain). Plates were incubated for 48h at 37 ºC in an atmosphere with 5 107

% CO2. Colonies were resuspended in 200 µl of PBS and genomic DNA was 108

extracted and purified with a QIAamp DNA minikit (IZASA S.A., Barcelona, Spain), 109


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

5

following the instructions of the manufacturer. DNA was quantified by 110

spectrophotometry with a Nano-Drop ND-1000 spectrophotometer (Nucliber, Madrid, 111

Spain). DNA from naturally infected hare tissues was prepared in a BSL-3 laboratory 112

as follows. Snippets of hare tissue were homogenized in a pestle and incubated at 113

56°C over night in 180µl of the kit’s ALT buffer (QIAamp DNA Kit Mini) and 20µl 114

protease. DNA was subsequently extracted using the tissue protocol of the QIAamp 115

DNA blood kit (Qiagen, Hilden, Germany) as recommended by the manufacturer. 116

117

Plasmid DNA standard and real time PCR. The tul4 gene was amplified using the 118

primers Tul4 UP / DP (Table 2) and the genomic DNA of a F. tularensis strain DuBa-119

1 using the following PCR protocol: Reaction volume 50µl, 30ng DNA, 200nM 120

primers, 200µM dNTPs, 1U Taq-Polymerase, 1x Taq buffer (5 Prime, Hamburg, 121

Germany), temperature profile: activation 95°C/1min, PCR 95°C/1min, 60°C/1min, 122

68°C/1min for 30 cycles. The PCR product was ligated into pCRII and transformed 123

into one Shot® INVαF’ chemically competent E.coli (Invitrogen, Darmstadt, 124

Germany). The plasmid was prepared and sequenced and quantified using the 125

PiccoGreen reagent kit (Invitrogen, Darmstadt, Germany) as previously described 126

(32). The standard was tested using the real time PCR for the tul4 gene as described 127

(8). The rabbit samples were additionally tested with a second real time PCR for the 128

23 kDa protein gene (16). The real time PCR assays were performed on a Light 129

Cycler 2.0 using the FastStart TaqMan® Probe Master kit (Roche, Manheim, 130

Germany) and the 2nd derivative method for analysis and showed the same 131

sensitivities as reported in the original publications. 132

133

Real time RPA amplicon design. The RPA amplicon for the detection of the tul4 134

gene of F. tularensis was designed using the following available GeneBank 135


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

6

sequences (M32059, EF208970-77, EF208979). In reference to sequence M32059 136

(tul4-from nt 551 to 1000,) the RPA amplicon was placed between nt 792 to 936 137

(length 144nt). The RPA probe was synthesized by TIBMOLBIOL (Berlin, Germany) 138

using an inverse arrangement of fluorophore and quencher (dTBHQ1-THF-dTFAM) 139

140

RPA-conditions. RPA was performed in a 50µl volume using the TwistAmp™ exo kit 141

(TwistDX, Cambridge, UK) 420nM RPA primers and 120nM FAM-tagged RPA-probe, 142

14mM Mg acetate and 1x rehydration buffer. All reagents except for the template or 143

sample DNA and Mg-acetate were prepared in a mastermix, which was distributed 144

into each 0,2 ml reaction tubes each containing a dried enzyme pellet. Mg–acetate 145

was pipetted into the tube lids. Subsequently 1µl standard DNA or genomic DNA or 146

10µl DNA eluate extracted from rabbit tissues was added to the tubes. The lids were 147

closed and the Mg-acetate centrifuged into the tubes using a minispin centrifuge and 148

the tubes immediately placed into a ESEQuant tubescanner device (Qiagen Lake 149

Constance, Stockach, Germany). Fluorescence measurements (Excitation 470nm, 150

Detection 520nm (FAM channel)) were performed at 42°C for 20 minutes. This 151

reaction temperature was found to yield the best performance in terms of sensitivity 152

in a range tested from 39°C to 42°C. The Tubescanner software offers threshold 153

validation i.e. evaluation of fluorescence by increase of fluorescence above three 154

standard deviations over the background determined in minute one (adaptable) of the 155

reaction. Additionally the slope of the curve as mV/time can be used (slope 156

adaptable). A 2nd derivative window calculating the turning point of the upward 157

fluorescence development helps to verify curves with a very low slope. 158

159 160

161

162


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

7

Determination of sensitivity and specificity The F. tularensis tul4 gene plasmid 163

standard was tested in 8 replicates, the threshold time (in minutes) was plotted 164

against molecules detected and a semi-log regression was calculated. For exact 165

determination a probit regression (26) was performed using the Statistica software 166

(StatSoft, Hamburg, Germany). The final assay was tested with DNA from bacterial 167

strains listed in Table 1. 168

169

170

Results 171

172

RPA sensitivity. 173

Using the plasmid standard, the real time PCR showed a sensitivity of 102 molecules 174

detected whereas the RPA assay showed a sensitivity of 102 – 101 molecules 175

detected (Figure 1 A, B). Using the results of 8 complete molecular standard runs a 176

probit model regression predicted that in 95% of cases the RPA assay determines 177

19.01 molecules (Figure 1C). The RPA assay was tested with several F. tularensis 178

strains (Table 1). It detected strains of F. tularensis ssp. holarctica, F. tularensis ssp. 179

tularensis, F. hispaniensis and F. novocida but it did not detect F. philomiragia (DNA 180

concentration range from 114,47 ng/µl – 563,59ng/µl) 181

182

Specificity 183

The RPA assay did not detect the genomic DNA of 4 Yersina strains and 17 Bacillus 184

strains. Nine hare tissue samples of naurally infected hares were tested for the 185

presence of F. tularensis DNA. The DNA extracted from the samples was tested by 186

two real-time PCRs and the new RPA assay. The RPA was almost as good as the 187

tul4-PCR (8) but detected fewer samples than the 23kDa gene PCR (16) (Table 3). 188


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

8

189

5. Discussion 190

There are several isothermal amplification methods that have been developed in the 191

recent decade. Apart from T7 promotor driven amplifcations (TMA, NASBA, SPIA) 192

there are strand displacement methods (SDA, LAMP, SmartAmp), helicase 193

dependent amplification (HDA), recombinase polymerase amplification (RPA) and 194

several rolling circle amplification (RCA) methods (1, 2, 10, 13, 28). 195

Most fluorescent formats for isothermal amplification use non-specific intercalating 196

fluorophores or fluorescent primers (LAMP, SDA, HDA, RCA). For specific detection 197

probe formats have been developed for NASBA, RCA, HDA, RCA (14, 17, 20, 29, 198

31). We chose to test the RPA method for several reasons: (i) the RPA method 199

allows verification of an exponentially amplified product using a fluorescent probe, (ii) 200

the RPA mixture contains the single strand binding protein GP32, which has been 201

shown to enhance nucleic acid detection (33), (iii) the reagents are commercially 202

available in a dried pellet format which makes the reaction amenable to field use or 203

point of care applications. 204

In the past several real time PCR protocols for the detection of F. tularensis have 205

been described targeting fopA, 23kDa, tul4 genes, the RD1 region and the insertion 206

element ISFtu2 (27). The tul4 gene detection assays appear to show the highest 207

sensitivity. We established a published tul4 gene targeting real time PCR (16) and 208

tested it using a tul4 gene plasmid standard created in our laboratory. It showed an 209

analytical sensitivity of 10 molecules detected (data not shown). For this study we 210

designed an RPA assay for the same target region and tested it on the same plasmid 211

standard and achieved a comparable analytical sensitivity (Figure 1 B), which we 212

additionally analysed by probit analysis (Figure 1 C). This clearly demonstrated that 213

the isothermal real time RPA assay has the same sensitivity as real time PCR. The 214


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

9

speed of the reaction however is much higher yielding results in 10 minutes (Figure 1 215

A, B). Although in principle quantitative real time RPA (qRPA) is possible the 216

TwistAmp™ exo kit currently has not yet been adapted for qRPA. The emphasis is 217

on a robust reaction, which makes it an ideal tool for qualitative real time RPA ((21) 218

and Piepenburg personal communication). 219

Using several target genes simultaneously was shown to elevate the sensitivity of F. 220

tularensis detection (30). We therefore additionally established a 23kDa gene real 221

time PCR (16) and tested tissue samples of infected hares using both real time PCRs 222

and the new RPA assay. The 23KDa gene real time PCR detected F. tularensis in 223

9/9 rabbit tissue samples, the tul4 gene real time PCR tested 6/9 samples positive 224

and the tul4 gene RPA tested 4/9 samples positive. Thus the 23KDa gene real time 225

PCR appeared more sensitive than the tul4 gene real time PCR and the RPA assay 226

did not detect samples, which had tested positive in the real time PCR assays 227

between CT 35 to 40. In diagnostic real time PCR assays it is customary to regard 228

results between CT 35-40 as equivocal and above CT40 as negative. This particular 229

RPA assay therefore is almost as sensitive as the real time PCR and the obsereved 230

reduced sensitivity missing the range of equivocal or false positives of the tested real 231

time PCRs. 232

Among the F. tularensis strains tested, all human pathogens were detected except 233

for F. philomiragia, which in general is a fish pathogen and has been described to 234

infect patients with an underlying chronic disease (9, 22, 25, 34). However there may 235

be more Francisella species or strains that potentially can infect humans as a recent 236

first report from the southern hemisphere indicates (23). 237

This novel RPA assay therefore seems well suited for a biothreat first line detection 238

device able to detect pathogenic F. tularensis strains at high sensitivity. 239


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

10

The robust tubescanner device has a great potential to develop into an isothermal 240

nucleic acid detection device for point of care detection and field use. It is much 241

lighter and smaller than the R.A.P.I.D. or the RAZOR instrument for which real time 242

PCR assays for F. tularensis have been developed and evaluated (6, 16). RPAs 243

have already been integrated onto a foil based microfluidic LabDisc system (15). This 244

could eventually lead to the development of RPA panels e.g. for the simultaneous 245

detection of category A infectious agents in small point of care devices. 246

In summary we have developed a very rapid and highly sensitive isothermal real time 247

RPA assay for the detection of F. tularensis on a mobile device. The results merit 248

further investigation into this methodology. 249

250

Acknowledgments. 251

252

This work was supported by Federal Ministry of Education and Research (BMBF) 253

funded project ‘Potential release-oriented biothreat emergency diagnostics 254

(P.R.O.B.E.)’ under the research programme for civil security of the German Federal 255

Government as part of the high-tech strategy for Germany. We thank Mandy 256

Elschner of the FLI reference center for bacterial zoonoses for supporting us with the 257

choice of bacterial strains for the cross detection studies. 258

259

260 261

262


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

11

Figure Legends 263

264

Figure 1. Real-time recombinase polymerase amplification assay performance. A: Original 265

graph of fluorescence development over time from the tubescanner software, B: Analytical 266

sensitivity as determined on plasmid standard. Semi-logarithmic regression of data from 8 267

runs, B: Probit regression with the data of 8 runs. Triangle: calculated detection limit in 95% 268

of cases. 269

270

271

272

273

274


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

12

Table 1. Bacterial strains tested. 275 276 strain

species

RPA detection

1. LVS F. tularensis subs holarctica + 2. FT 7 F. tularensis subs holarctica + 3. FT 10 F. tularensis subs holarctica + 4. B38 F. tularensis subs. tularensis + 5. DuBa-1 F. tularensis subs. tularensis + 6. FHSP F. hispaniensis + 7. FX 1 F. novicida + 8. FX 2 F. novicida + 9. U112 F. novicida + 10. CCUG4992 F. philomiragia - 11. 03-1501 Y. pestis - 12. ATCC 55075 Y. enterocolitica - 13. ATCC 9610 Y. enterocolitica - 14. ATCC 29833 Y. pseudtuberculosis - 15. 3007 B. anthracis - 16. ATCC 12759 B. licheniformis - 17. ATCC 6633 B. subtilis - 18. DSM 2046 B. thuringiensis - 19. ATCC 14581 B. megaterium - 20. DSM 299 B. mycoides - 21. ATCC 31325 B. polymyxa - 22. ATCC 53522 B. cereus - 23. DSM 9378 B. cereus - 24. DSM 6127 B. cereus - 25. DSM 31 B. cereus - 26. DSM 345 B. cereus - 27. DSM 487 B. cereus - 28. DSM 609 B. cereus - 29. DSM 626 B. cereus - 30. DSM 4490 B. cereus - 31. DSM 6791 B. cereus - 277 Genomic DNA of strains 1-4, 6-10 were provided by the 278 laboratory from Spain, strain 5, 11 and 15 were provided by the 279 Institute for Microbiology of the German Armed Forces. All other 280 strains were provided by the Institute of Bacterial Infections and 281 Zoonoses of the Federal Research Center for Animal Health 282 (FLI). DNA concentrations of the DNA preparations ranged from 283 114,47 ng/µl – 563,59ng/µl. 284 285 286 Table 2. Primers for standard and for RPA assay 287 288 name

sequence 5’ to 3’

FTUL UP TTATCTTTATCAATCGCAGGTTTAGC FTUL DP GGTTGGTGCACATGGCTAAGTFT RPA FP CACAAGGAAGTGTAAGATTACAATGGCAGGCTCC FT RPA RP CGCTACAGAAGTTATTACCTTGCTTAACTGTTA FT RPA P GTGCCATGATACAAGCTTCCCAATTACTAAG(BHQ1-dT)(THF)(FAMdT)

GCTGAGAAGAACGATA(phosphate)


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

13

289 FTUL UP / DP: standard fragment upstream primer / downstream primer, FT RPA FP / RP 290 RPA primer, FT RPA P: RPA exo probe, BHQ1-dT: Thymidine nucleotide carrying 291 Blackhole quencher 1, THF: Tetrahydrofuran spacer, FAM-dT: Thymidine nucleotide 292 carrying fluorescein, Phosphate: 3’phosbate to block elongation. 293

294


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

14

Table 3. Rabbit tissues tested and test results 295 296 sample no. hare tissue qPCR

23kDa

qPCR tul4

RPA tul4

10TO174 B2 bone marrow 30.13 29.07 7.7 10TO183 B10 tongue 31.63 29.70 9.3 10TO179 B7 spleen 34.12 32.66 10.0 10TO173 B1 liver 36.12 34.77 11.7 10TO176 B4 lymph node (gut) 38.46 37.25 neg 10TO180 B8 kidney 41.37 40.31 neg 10TO178 B6 muscle 41.35 neg neg 10TO175 B3 lung 43.10 neg neg 10TO182 A2 brain 41.28 neg neg 11T0351 (n.i) spleen neg neg neg 11T0350 (n.i) liver neg neg neg 297

PCR results are given as CT values analysed with the fit points method on the 298 Light cycler 2.0. 23kDa -real time PCR (16), tul4 real time PCR (8). n.i: not 299 infected, DNA concentration of the extracts ranged from 2.32 to 6.77ng/µl. 300


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

15

References 301 302 303 1. Andras, S. C., J. B. Power, E. C. Cocking, and M. R. Davey. 2001. Strategies for 304

signal amplification in nucleic acid detection. Molecular biotechnology 19:29-44. 305 2. Asiello, P. J., and A. J. Baeumner. 2011. Miniaturized isothermal nucleic acid 306

amplification, a review. Lab on a Chip 11:1420-30. 307 3. Birdsell, D. N., T. Stewart, A. J. Vogler, E. Lawaczeck, A. Diggs, T. L. Sylvester, 308

J. L. Buchhagen, R. K. Auerbach, P. Keim, and D. M. Wagner. 2009. Francisella 309 tularensis subsp. novicida isolated from a human in Arizona. BMC research notes 310 2:223. 311

4. Buehler, J. W., R. L. Berkelman, D. M. Hartley, and C. J. Peters. 2003. 312 Syndromic surveillance and bioterrorism-related epidemics. Emerging infectious 313 diseases 9:1197-204. 314

5. Cady, N. C., S. Stelick, M. V. Kunnavakkam, Y. Liu, and C. A. Batt. 2004. 315 Presented at the IEEE Sensors 2004. 316

6. Christensen, D. R., L. J. Hartman, B. M. Loveless, M. S. Frye, M. A. Shipley, D. 317 L. Bridge, M. J. Richards, R. S. Kaplan, J. Garrison, C. D. Baldwin, D. A. 318 Kulesh, and D. A. Norwood. 2006. Detection of biological threat agents by real-time 319 PCR: comparison of assay performance on the R.A.P.I.D., the LightCycler, and the 320 Smart Cycler platforms. Clinical chemistry 52:141-5. 321

7. Dennis, D. T., T. V. Inglesby, D. A. Henderson, J. G. Bartlett, M. S. Ascher, E. 322 Eitzen, A. D. Fine, A. M. Friedlander, J. Hauer, M. Layton, S. R. Lillibridge, J. 323 E. McDade, M. T. Osterholm, T. O'Toole, G. Parker, T. M. Perl, P. K. Russell, 324 and K. Tonat. 2001. Tularemia as a biological weapon: medical and public health 325 management. JAMA : the journal of the American Medical Association 285:2763-73. 326

8. Emanuel, P. A., R. Bell, J. L. Dang, R. McClanahan, J. C. David, R. J. Burgess, J. 327 Thompson, L. Collins, and T. Hadfield. 2003. Detection of Francisella tularensis 328 within infected mouse tissues by using a hand-held PCR thermocycler. Journal of 329 Clinical Microbiology 41:689-93. 330

9. Friis-Moller, A., L. E. Lemming, N. H. Valerius, and B. Bruun. 2004. Problems in 331 identification of Francisella philomiragia associated with fatal bacteremia in a patient 332 with chronic granulomatous disease. Journal of clinical microbiology 42:1840-2. 333

10. Gill, P., and A. Ghaemi. 2008. Nucleic acid isothermal amplification technologies: a 334 review. Nucleosides, nucleotides & nucleic acids 27:224-43. 335

11. Haberstroh, K., and E.-C. Reiff. 2007. Fluoreszenzmessung wird alltagstauglich, p. 336 29-33, Sensortechnik aktuell 2007. Oldenbourg Industrieverlag GmbH. 337

12. Huber, B., R. Escudero, H. J. Busse, E. Seibold, H. C. Scholz, P. Anda, P. 338 Kampfer, and W. D. Splettstoesser. 2010. Description of Francisella hispaniensis sp. 339 nov., isolated from human blood, reclassification of Francisella novicida (Larson et al. 340 1955) Olsufiev et al. 1959 as Francisella tularensis subsp. novicida comb. nov. and 341 emended description of the genus Francisella. International journal of systematic and 342 evolutionary microbiology 60:1887-96. 343

13. Kim, J., and C. J. Easley. 2011. Isothermal DNA amplification in bioanalysis: 344 strategies and applications. Bioanalysis 3:227-39. 345

14. Leone, G., H. van Schijndel, B. van Gemen, F. R. Kramer, and C. D. Schoen. 346 1998. Molecular beacon probes combined with amplification by NASBA enable 347 homogeneous, real-time detection of RNA. Nucleic Acids Res 26:2150-5. 348

15. Lutz, S., P. Weber, M. Focke, B. Faltin, J. Hoffmann, C. Muller, D. Mark, G. 349 Roth, P. Munday, N. Armes, O. Piepenburg, R. Zengerle, and F. von Stetten. 350 2010. Microfluidic lab-on-a-foil for nucleic acid analysis based on isothermal 351 recombinase polymerase amplification (RPA). Lab on a Chip 10:887-93. 352


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

16

16. Matero, P., H. Hemmila, H. Tomaso, H. Piiparinen, K. Rantakokko-Jalava, L. 353 Nuotio, and S. Nikkari. 2011. Rapid field detection assays for Bacillus anthracis, 354 Brucella spp., Francisella tularensis and Yersinia pestis. Clinical microbiology and 355 infection : the official publication of the European Society of Clinical Microbiology 356 and Infectious Diseases 17:34-43. 357

17. Nilsson, M., M. Gullberg, F. Dahl, K. Szuhai, and A. K. Raap. 2002. Real-time 358 monitoring of rolling-circle amplification using a modified molecular beacon design. 359 Nucleic Acids Res 30:e66. 360

18. Park, S., Y. Zhang, S. Lin, T. H. Wang, and S. Yang. 2011. Advances in 361 microfluidic PCR for point-of-care infectious disease diagnostics. Biotechnology 362 advances 29:830-9. 363

19. Petersen, J. M., P. S. Mead, and M. E. Schriefer. 2009. Francisella tularensis: an 364 arthropod-borne pathogen. Veterinary research 40:7. 365

20. Piepenburg, O., C. H. Williams, D. L. Stemple, and N. A. Armes. 2006. DNA 366 detection using recombination proteins. Plos Biology 4:1115-1121. 367

21. Piepenburg, O., C. H. Williams, D. L. Stemple, and N. A. Armes. 2006. DNA 368 detection using recombination proteins. Plos Biology 4:e204. 369

22. Polack, F. P., S. M. Harrington, J. A. Winkelstein, W. G. Merz, and R. E. 370 Willoughby. 1998. Recurrent Francisella philomiragia sepsis in chronic 371 granulomatous disease. The Pediatric infectious disease journal 17:442-3. 372

23. ProMED-mail. 2011. Tularemia, human, possum - Australia., ProMED-mail vol. 6 373 Nov 20111105.3299. 374

24. Qiagen. 2011. ESEQuant Tube Scanner 375 http://www.qiagen.com/Products/ESEQuantTubeScanner.aspx?r=603. 376

25. Sicherer, S. H., E. J. Asturias, J. A. Winkelstein, J. D. Dick, and R. E. 377 Willoughby. 1997. Francisella philomiragia sepsis in chronic granulomatous disease. 378 The Pediatric infectious disease journal 16:420-2. 379

26. Smieja, M., J. B. Mahony, C. H. Goldsmith, S. Chong, A. Petrich, and M. 380 Chernesky. 2001. Replicate PCR testing and probit analysis for detection and 381 quantitation of Chlamydia pneumoniae in clinical specimens. J Clin Microbiol 382 39:1796-801. 383

27. Splettstoesser, W. D., H. Tomaso, S. Al Dahouk, H. Neubauer, and P. Schuff-384 Werner. 2005. Diagnostic procedures in tularaemia with special focus on molecular 385 and immunological techniques. Journal of veterinary medicine. B, Infectious diseases 386 and veterinary public health 52:249-61. 387

28. Stougaard, M., S. Juul, F. F. Andersen, and B. R. Knudsen. 2011. Strategies for 388 highly sensitive biomarker detection by Rolling Circle Amplification of signals from 389 nucleic acid composed sensors. Integrative biology : quantitative biosciences from 390 nano to macro 3:982-92. 391

29. Tong, Y., W. Tang, H. J. Kim, X. Pan, T. Ranalli, and H. Kong. 2008. 392 Development of isothermal TaqMan assays for detection of biothreat organisms. 393 BioTechniques 45:543-57. 394

30. Versage, J. L., D. D. Severin, M. C. Chu, and J. M. Petersen. 2003. Development 395 of a multitarget real-time TaqMan PCR assay for enhanced detection of Francisella 396 tularensis in complex specimens. Journal of clinical microbiology 41:5492-9. 397

31. Vincent, M., Y. Xu, and H. Kong. 2004. Helicase-dependent isothermal DNA 398 amplification. EMBO Rep 5:795-800. 399

32. Weidmann, M., U. Meyer-Konig, and F. T. Hufert. 2003. Rapid detection of herpes 400 simplex virus and varicella-zoster virus infections by real-time PCR. J Clin Microbiol 401 41:1565-8. 402


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

17

33. Weidmann, M., V. Rudaz, M. R. Nunes, P. F. Vasconcelos, and F. T. Hufert. 403 2003. Rapid detection of human pathogenic orthobunyaviruses. J Clin Microbiol 404 41:3299-305. 405

34. Wenger, J. D., D. G. Hollis, R. E. Weaver, C. N. Baker, G. R. Brown, D. J. 406 Brenner, and C. V. Broome. 1989. Infection caused by Francisella philomiragia 407 (formerly Yersinia philomiragia). A newly recognized human pathogen. Annals of 408 internal medicine 110:888-92. 409

410 411


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

107

A

106105

104

103

10210110

B

eth

resh

old

time

Cmolecules detected

60%

80%

100%

C

20%

40%

60%

0%1.00E+001.00E+011.00E+021.00E+031.00E+041.00E+051.00E+061.00E+07100 101 102 103 104 105 106

107

molecules detected


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

Documents

Recombinase Polymerase amplification assay for rapid detection of Francisella tularensis