Recall Notes on DNA!

Unit 4 - Molecular Genetics

Complete Lab Exercise 4.1.1:Evidence of Hereditary Material

DNA Replication and Repair

During cell division in eukaryotic cells, the replicated genetic material in the nucleus is _____ ________________________________________.

It is important that each _________________has an ___________of the parent cell’s DNA.

DNA replication is ____________________

1. Replication begins at a ________________on the DNA known as the ___________________.

Steps to Replication

The two strands of DNA are held together by ______________and are twisted to form a ________________.

To expose a __________________, the DNA must be ___________.

2. The _________________________________ the double helix by breaking the __________________between base pairs.

3. Base pairs want to ___________, so ____________________ ________________________ bind to the exposed DNA single strands and ____________________________

4. _________________ is an enzyme that relieves any _____________ brought about by the _______________ of the DNA (bacteria)

__________ _____ both strands of DNA, allowing them to ___________, then _____________ the cut strands.

Replication begins in ___________________from the origin(s)

______________________________________

____________________________are built as soon as an area of the DNA has been unwound.

Where two strands of DNA are unwound, where they are joined is called _______________________________

DNA replication moves _______________________________________ __________________________________________________________

______________________________are the three enzymes known to function in _____________________. __________________requires a template to start synthesizing a new complementary DNA strand.

5. The enzyme _______________ lays down _______________that will be used by _________________________as a starting point to build

6. DNA polymerase III adds the appropriate ___________________ _______________________________ to the __________of the new strand using the template strand as a guide.

____________________is built continuously __________ the replication fork. (5' to 3')

___________________composed of short segments of DNA, known as ____________________, is built in pieces ______ from the replication fork.

7. __________________excises the ________________and replaces them with the appropriate deoxyribonucleotides.

8. ______________joins the gaps in the ______________by the creation of a ____________________ bond.

9. __________________________________.

If mistakes are found the act as an ____________________, excising incorrectly paired nucleotides and replacing.

In the nucleus, the human genome is organized into _____________________

Chromosomes consist of DNA wrapped around protein - called _______________

Every __________ nucleotides, the DNA is coiled around a core group of __________ ____________________, known as ___________________. (+ve histones attracted to -ve charged DNA.

________________= nucleosome

_______________________ coil into chromatin fibres.

Chromatin fibres then ___________________ into chromatin

Chromatin coils again to form a ________________________

DNA Organization

Different organisms have different # of chromosomes.

____________________of DNA codes for proteins.

________ of the human genome is _________________.

Noncoding regions are filled ________________________________ (repeating sequences - TAGTAGTAGTAG)

The ____________________________have long sequences of repetitive noncoding DNA, known ______________________.

Repetitive DNA sequences are also found in the region of the _____________________, which play a role ___________________.

Chromosomes also contain _________________________. (sequence similar to a functioning gene _______________________).

Two types - LINEs ___________________________________________ SINEs ____________________________________________

The function of LINEs and SINEs is not clear.

Protein Synthesis

____________________experiments with garden peas laid the foundation for genetics.

His results led to the idea that “____________” were responsible for the patterns of inheritance

Today these are known as ____________, and they direct the production of ______________.

Garrod’s Hypothesis

The physician Archibald Garrod was the first to hypothesize that ______________________________________in 1909

George Beadle and Edward Tatum

Thirty-three years later, these 2 were able to demonstrate _______________ the relationship. Summarized this relationship as the _______________________________.

Now known as the ___________________________ (genes also code for _____________) V.I. demonstrated the relationship while studying the ______________________of hemoglobin from individuals with _____________________.

Vernon Ingram

Even though this an effective way to think of genes, science has recently ___________________________and found that there seem to be "only" about _____________. The problem is humans produce at least ______________ different _____________________ !!The research is still ongoing today, but it looks like a ___________ can code for _______________. (More later)

DNA contains the __________________, but their seem to be many complications if it is the DNA that gives rise to protiens:- DNA is too _________________ to be allowed out of the __________.- Only ___________of DNA in a cell: Protein is required ____________________. Proteins need to be _______________________________

The answer is _____________________.

DNA is ________________ into an RNA message and then ____________

So how are proteins made?

Transcription can be divided into three sequential processes:1. __________________2. __________________3. __________________.

Transcription

Transcription begins when the ______________________binds to the segment of DNA that is to be ____________________and ______________________________________

It binds to the DNA molecule _____________ of the gene to be transcribed.

This region is a sequence on one strand of DNA called the _________________. In most genes it looks like ___________________________________________________

1. Initiation

____________________binds to the _______________ which is the strand of DNA that is used as a ____________ to build _________________________________

The other strand of DNA is the _______________and is ___________transcription. It will be identical in sequence to ________

2. Elongation-The __________________________opens the double helix

- It starts building _________ in the direction of ____________.

- RNA polymerase __________________________________.

- The ________________ itself does not _______________.

- The process is similar to that of _______________________.

AGCTTCCGAGATACAGTAATAGC

3. Termination

Elongation continues until __________________recognizes the end of the gene - ________________________.

At the _____________________, the newly synthesized mRNA disassociates, ____________________ and the RNA polymerase released.

Posttranscriptional Modifications

The mRNA (known as ____________________________) needs to be ___________ before leaving the nucleus.

A ____________is added to the start of the primary transcript.

This __________protects the _________________________as it exits the nucleus. It also plays a role in the ________________________.

A string of approximately ______________are added to the ________________

Genes also contain ___________ regions (_________________) and _________ regions (known as ________________). The __________ are interspersed among _______________;

_____________________must be removed. The _______ are removed by ________________________.

_______________cut out the _________ and join the remaining _______.

The _______________________.

Unlike DNA replication, there is ____________________enzyme.

This results in more _________________.

Genes are transcribed ________________, so ______ ______________________compared to DNA replication.

Only 30000 genes???

T I M E

Once in the ___________ the mRNA it can be ________________.

_____________________ is the process of ____________________of the mRNA into ________________

___________________ind to the mRNA, recognizing the ___________in eukaryotes.

The ribosome consists of two subunits, _____________________________________.

The two subunits clamp around the mRNA and proceed along the mRNA in the ____ ____________________________________________________________________ to the growing polypeptide chain

mRNA TRANSLATION

Reading Code

There are _______________but only _________________in mRNA.

To code for ________________, a sequence of _________ is used for each amino acid. Each _________ is called a __________.

Each __________________________________and more than one __________ can code for a __________________.

This redundancy minimizes _________ that may lead to ___________________.

One _______ serves as the ______________and others serve as _______________

The mRNA is ___________________

Using the genetic code, decipher the following mRNA sequence:

5' - GGCAUGGGACAUUAUUUUGCCCGUUGUGGUGGGGCGUGA - 3'

The genetic code is _____________. The same ______________is used for translation in ______ ____________ from ________________ with only a few isolated exceptions.

In order to synthesize the ____________the ribosome requires the ______________ to be delivered to it.

__________________________________.

tRNA

tRNA's structure resembles a _____________where one arm of tRNA, a sequence of _________________________________recognizes the _________________________

The other arm carries the ____________________________

Every tRNA carries only ___________________ (aminoacyl-tRNA)

Therefore at least _____ different ______ are required, but ________________means ____ possible different types of _______

It has been observed that sometimes ____________of an anticodon are needed _______________. For example the anticodon ______________________________which both code for ____________.

This flexibility makes it possible for ________________to be added despite ___________________________of mRNA.

The first codon is the ____________________.

This means that every ______________________ __________________________

The ribosome has two sites for tRNA:

Here is how it works:1. The tRNA that carries _________________________.2. The next tRNA ______________________.3. ____________ is bonded to the _________________.4.Next the ribosome ____________________________.

This process continues, growing the ____________________

The tRNAs that have been released are recycled by ____________________________________________

The ribosome will eventually reach ________________.

A protein known as a release factor recognizes that the ribosome has stalled and releases the polypeptide chain from the ribosome by releasing the 2 subunits of the ribosome.

Final modifications may include sugars (glycosylation) or phosphate being added to some of the amino acid residues and the peptide may also be cleaved at specific places