JOURNAL OF CLINICAL MICROBIOLOGY,0095-1137/99/$04.0010

Mar. 1999, p. 575–580 Vol. 37, No. 3

Rapid Detection of the Chlamydiaceae and Other Families inthe Order Chlamydiales: Three PCR Tests

KARIN D. E. EVERETT,* LINDA J. HORNUNG, AND ARTHUR A. ANDERSEN

Avian and Swine Respiratory Diseases Research Unit, USDA Agricultural Research Service,National Animal Disease Center, Ames, Iowa 50010

Received 6 October 1998/Accepted for publication 8 December 1998

Few identification methods will rapidly or specifically detect all bacteria in the order Chlamydiales, familyChlamydiaceae. In this study, three PCR tests based on sequence data from over 48 chlamydial strains weredeveloped for identification of these bacteria. Two tests exclusively recognized the Chlamydiaceae: a multiplextest targeting the ompA gene and the rRNA intergenic spacer and a TaqMan test targeting the 23S ribosomalDNA. The multiplex test was able to detect as few as 200 inclusion-forming units (IFU), while the TaqMan testcould detect 2 IFU. The amplicons produced in these tests ranged from 132 to 320 bp in length. The third test,targeting the 23S rRNA gene, produced a 600-bp amplicon from strains belonging to several families in theorder Chlamydiales. Direct sequence analysis of this amplicon has facilitated the identification of new chla-mydial strains. These three tests permit ready identification of chlamydiae for diagnostic and epidemiologicstudy. The specificity of these tests indicates that they might also be used to identify chlamydiae without cultureor isolation.

The order Chlamydiales has been recently shown to includefour families of obligately intracellular bacteria that infect ver-tebrates or amoebae, the Chlamydiaceae, Parachlamydiaceae,Simkaniaceae, and Waddliaceae (8, 23). Members of these fam-ilies are explicitly identified by DNA sequence analysis; a newstudy indicates that the Chlamydiales may be comprised ofeven more lineages (19). The oldest family in this order is theChlamydiaceae, which was proposed in 1957 (21). The Chlamy-diaceae are antigenically and genetically diverse, belonging totwo genera and nine species (8). Inclusions formed in host cellsby these bacteria are recognized, but not necessarily distin-guished from one another, by microscopy and staining meth-ods. At one time, all chlamydiae were thought to be recognizedby immunohistochemical staining or serological techniquesthat were believed to be Chlamydiaceae specific. Occasionally,however, specimens that could not be confirmed by techniquespositively specific for the Chlamydiaceae were cultured or isolated(4, 6, 9, 26). The Chlamydiaceae are all identified by monoclonalantibodies (MAbs) that recognize the lipopolysaccharide epitopeaKdo-(238)-aKdo-(234)-aKdo (Kdo is 3-deoxy-D-manno-oc-tulosonic acid) (3, 5, 13, 18). These MAbs have been used todetect new groups in the Chlamydiaceae (22) and to identifyChlamydiaceae in novel hosts (10, 12, 26). MAb staining may bedone directly on smears or may require days or even weeks forlaboratory culture of chlamydiae in host cell monolayers.

PCR and other DNA-based tests for chlamydiae havetended to be specific for groups within the Chlamydiaceae.Tests targeting the ompA gene have shown some promise astools for identification of all Chlamydiaceae (16, 25, 27). How-ever, the DNA sequence of ompA is highly variable, and it hasbeen difficult to find segments conserved in all species thatcould be targeted by a single set of primers to amplify a short,characteristic PCR product. The rRNA operon contains many

segments that are conserved among all the Chlamydiaceae, butthis locus has been used only for identifying specific species,strains, or groups of strains. Efforts to detect and identifychlamydiae are important because chlamydiae not only causedisease but also interact synergistically with viruses or withother bacteria, increasing the virulence of these organisms (20,28). In humans, livestock, and birds, chlamydiae cause repro-ductive, respiratory, cardiovascular, gastrointestinal, centralnervous system, and systemic disease, as well as conjunctivitisand arthritis (2, 3, 7, 11, 15, 17).

In this report, ribosomal DNA (rDNA) sequences from over60 Chlamydiaceae strains and ompA sequences from 48Chlamydiaceae strains, many of the sequences extending 300 ormore bases past the ompA stop codon, were used to design twoPCR tests for specific and rapid detection of all species be-longing to the Chlamydiaceae. A third PCR test that recog-nized the Chlamydiaceae as well as members of newer familiesin the Chlamydiales was developed. These tests facilitate theidentification of strains belonging to these families.

MATERIALS AND METHODS

Template DNA sources and preparation. Sources of the chlamydial strainsused for these tests have been described previously (5, 7, 14). Chlamydial tem-plate DNA was prepared by reducing alkaline lysis. The first step in reducingalkaline lysis was to pellet chlamydiae and/or chlamydia-infected cells by cen-trifugation (10,000 3 g). The pellet was resuspended in 30 mM Tris (pH 9.0)–10mM EDTA (pH 9.0)–50 mM dithiothreitol and incubated for 1 h at 37°C. Anequal volume of 1% Nonidet P-40 was then added to each sample, as wasDNase-free RNase (Boehringer Mannheim Biochemicals, Indianapolis, Ind.; 2.5mg for a 200-ml mixture). Some samples (of strains R27 and GPICT) were dividedinto two aliquots after the addition of Nonidet P-40, and one aliquot of each wasnot treated with RNase so that control studies in the presence of RNA could bedone. All aliquots were incubated for 1 h at 37°C and then extracted withphenol-chloroform and chloroform (24). DNA from Chlamydophila psittaci6BCT was also prepared by CsCl gradient centrifugation for a series of dilutioncontrols (24). DNA from lysates of Waddlia chondrophila WSU 86-1044T andSimkania negevensis ZT were provided by Fred Rurangirwa and Maureen Fried-man, respectively.

Nonchlamydial template DNA was prepared by several means. Lysis underalkaline reducing conditions as described above was used to prepare DNA frommycoplasmas provided by Janet Saupe (National Veterinary Services Labora-tory, USDA (Animal and Plant Health Inspection Service, Ames, Iowa) andfrom Vero cells, which were the host cells in which chlamydiae were grown.CsCl-prepared DNA from Campylobacter, Arcobacter, Listeria, Erysipelothrix, and

* Corresponding author. Present address: Department of MedicalMicrobiology/Parasitology, College of Veterinary Medicine, Universityof Georgia, Athens, GA 30602-7371. Phone: (706) 542-5823. Fax:(706) 542-5771. E-mail: keverett@calc.vet.uga.edu or kdeeverett@hotmail.com.

575

on April 12, 2019 by guest

http://jcm.asm

.org/D

ownloaded from

Helicobacter species was provided by Irene V. Wesley and Sharon Franklin(National Animal Disease Center, USDA (Agricultural Research Service, Ames,Iowa). Salmonella DNA from isolated colonies was prepared by boiling in Tris-EDTA and provided by Alan Baetz (National Animal Disease Center). DNAsfrom lysates of Verrucomicrobium spinosum and Legionella pneumophila wereprovided by Peter Janssen (University of Melbourne, Melbourne, Australia) andPaul S. Hoffman (Dalhousie University, Halifax, Nova Scotia, Canada), respec-tively. Pasturella, Bordetella, Salmonella, Staphylococcus, Streptococcus, and Esch-erichia coli field isolates from swine were provided by Douglas G. Rogers (Uni-versity of Nebraska, Lincoln).

Test setup and controls. All DNA templates were tested by using threedifferent sets of PCR primers. Identical template arrays were set up on multiwellPCR plates, and each 50-ml PCR mixture for chlamydiae included 0.25 mg oftemplate (determined spectrophotometrically). The concentrations of other tem-plates ranged from 0.25 to 2.0 mg/reaction mixture. Chlamydial templates in-cluded RNase-treated preparations, several preparations that contained RNAand DNA, and the RNA-DNA preparations to which RNase was added alongwith the PCR reagents just before amplification. Six controls without templatewere included on every plate.

Sensitivity. Each plate containing an array of templates also included a seriesof 10-fold dilutions of Chlamydophila psittaci 6BCT template DNA to assess thesensitivity of each assay. CsCl-purified 6BCT DNA was quantitated spectropho-tometrically and had an A260/A280 ratio of 1.90. Electrophoresis of this DNA ona 1% agarose gel showed that most of the DNA was .12 kbp in length. PCR ofall templates on each plate was performed at one time.

Test sensitivity was also determined for specific quantities of inclusion-formingunits (IFU) by using Renografin-purified infectious elementary bodies (EBs) ofC. psittaci NJ1. A dilution series of EBs was prepared on ice, and approximately2,000 Vero cells were added to each aliquot to provide a carrier for the smallnumbers of EBs. The aliquots were then immediately centrifuged to provide anEB-cell pellet from which DNA was prepared for PCR. Microtiter plates con-taining monolayers of Vero cells were also infected with the serially diluted NJ1EBs. IFU were scored in duplicate at 20 and 42 h by microimmunofluorescenceusing MAb NJ1/D3 (1).

Primers and PCR conditions. The PCR primers used in these tests are sum-marized in Table 1 and illustrated in Fig. 1. Because the control template DNAswere obtained from many laboratories, RNase was included in the amplificationreaction mixtures to ensure that RNA did not interfere with control templateamplification. RNase, per se, did not interfere with PCR amplification. To testwhether chlamydial RNA affected amplification, some aliquots of R27 andGPICT template DNA were also prepared without RNase. To test whethertemplate integrity affected amplification, specific aliquots of GPICT templatethat had been damaged with DNase so that no template of .12 kbp could bedetected were prepared.

For test 1, primer IGF exactly matched the 16S/23S intergenic spacer of allknown Chlamydiaceae; primer IGR spanned the start site of the 23S rRNA geneof all known Chlamydiaceae, with a deliberate 2-base mismatch in the center.Primer 1260 recognized all known ompA genes starting 48 bases before the stopcodon; primer TGLY complemented a tRNAGly located approximately 270 bpdownstream of the ompA stop codon in all known Chlamydiaceae. These primerswere used for PCR amplification of template DNA in a GeneAmp PCR System9600 thermocycler with Taq DNA polymerase (Boehringer Mannheim). Reac-tions were prepared on ice in a 13 PCR mix containing Mg21 (1.5 mM; Boehr-inger Mannheim), with or without added MgCl2 (Mg21 final concentration, 4.0mM) and with or without 1 ml of RNase (0.5 mg) in each 50-ml reaction mix.Cycling conditions for PCR were 40 cycles of 30 s at 94°C, 15 s at 55°C, and 30 sat 72°C, followed by incubation for 5 min at 72°C. Electrophoresis of 5 ml of each50-ml reaction mix separated the multiplex PCR products in a VisiGel separationmatrix (Stratagene, La Jolla, Calif.). The DNA was visualized with ethidiumbromide, which was included in the gel.

The primer set in test 2 (Table 1) was designed for use with the TaqMansequence detection system (Perkin-Elmer, Foster City, Calif.) to target the 23SrRNA gene. This primer set included primers TQF and TQR, which werespecific for all known Chlamydiaceae, and a fluorescent-labeled probe whichannealed between primers TQF and TQR. Reaction mixtures were prepared atroom temperature with 2.5 mM MgCl2, 400 mM dUTP, 200 mM each dATP,dCTP, and dGTP, 13 TaqMan buffer A, 0.25 ml (1.25 U) of AmpliTaq GoldDNA polymerase (Perkin-Elmer; AmpErase UNG was not included), 0.15 mMeach primer, 0.1 mM probe, and 1 ml of RNase in each 50-ml reaction mixture.The reaction mixtures were incubated for 10 min at 94°C and then immediatelysubjected to 40 cycles of 15 s at 95°C and 1 min at 59°C. After cycling, thereaction mixtures were held at 4°C for less than 1 h prior to fluorometric TaqManreading. The mixtures were frozen for storage.

The primers in test 3 were U23F, which matched the sequence just after thestart of the 23S rRNA gene, and 23SIGR, which complemented the sequenceapproximately 600 bases downstream (Table 1) (8). These primers have beenshown to PCR amplify the 23S rRNA signature sequence, which has beendesignated for use in distinguishing species belonging to the Chlamydiaceae andto other families in Chlamydiales (8). A BLAST search of the GenBank databasewith these primers suggested that they might also amplify other bacterial tem-plates. These primers had high melting temperatures to ensure that they wouldanneal without regard for a few mismatches. Reaction mixtures were preparedon ice with Taq DNA polymerase, as in test 1, and with 1 ml of RNase in each50-ml reaction volume. Cycling conditions for PCR were 35 cycles of 30 s at 94°C,15 s at 61°C, and 30 s at 72°C, followed by incubation for 5 min at 72°C.Electrophoresis of 5 ml of each positive 50-ml reaction mixture provided a single600-bp PCR product that could be visualized with ethidium bromide in theVisiGel separation matrix.

Sequence analysis and primer synthesis. Oligonucleotide primers for tests 1and 3 were prepared by the Iowa State University DNA Sequencing and Syn-thesis Facility, Ames. Test 2 primers and probe were prepared by Perkin-Elmer.The sequences upon which these tests were based are available from GenBank.

RESULTSTest 1: specific detection of the Chlamydiaceae. Multiplex

PCR amplified a 320-bp ompA/tRNAGly PCR product and a240-bp rRNA intergenic spacer product from each of the ninespecies in Chlamydiaceae (Fig. 2). The sizes were consistentwith sizes expected from sequence data, with the exact sizesvarying in accordance with known sequence differences. Usingtest 1, PCR products were not amplified from any of a widevariety of other bacterial DNAs (Table 2). DNA templates

TABLE 1. Oligonucleotide primers

Test Name Primer

1 IGF 59 GACTAGGTTGGGCAAG 39IGR 59 AGCTCTTA(T/G/A)(C/T)AACTTGGTCTGTA 391260 59 CGCTTAATC(A/G)A(T/C)GAAAGAGCTGCTCA 39TGLY 59 GGCTACAGCTCTACCATTGA 39

2 TQF 59 GAAAAGAACCCTTGTTAAGGGAG 39Probe FAM-CAAAAGGCACGCCGTCAAC-TAMRATQR 59 CTTAACTCCCTGGCTCATCATG 39

3 U23Fa 59 GATGCCTTGGCATTGATAGGCGATGAAGGA 3923SIGR 59 TGGCTCATCATGCAAAAGGCA 39

a The T in boldface type in this primer’s sequence is a mismatch to Chlamydiaceae sequences but enhances the PCR amplification of Parachlamydiaceae.

FIG. 1. Map of primer loci. 1, test 1 multiplex primers; 2, test 2 TaqManprimers and probe; 3, test 3 primers.

576 EVERETT ET AL. J. CLIN. MICROBIOL.

on April 12, 2019 by guest

http://jcm.asm

.org/D

ownloaded from

from the species most closely related to the Chlamydiaceae,i.e., S. negevensis and W. chondrophila, did not amplify. As-sayed dilutions of C. psittaci NJ1 IFU showed that when 4 mMMg21 was included in the PCR buffer, as few as 170 IFU couldbe detected (Table 3). Amplification of a dilution series ofCsCl-purified C. psittaci 6BCT template DNA indicated thatthe test could detect as little as 0.7 pg of 6BCT template DNA(500 target chromosomes) (Fig. 2; Table 4). When the concen-tration of Mg21 was reduced from 4 to 1.5 mM, the sensitivitywas reduced by 4 logs. When heavily fragmented DNA tem-plate was used or when RNA was present, the sensitivity wasreduced by 2 to 4 logs.

Test 2: specific detection of the Chlamydiaceae. The primersand fluorescent probe designed for specific PCR detection ofthe Chlamydiaceae in the TaqMan 7200 sequence detectionsystem were strongly positive for all nine species in theChlamydiaceae (Fig. 3; Table 2). The primers generated onlynegative scores with DNA from S. negevensis and W. chon-drophila, which are closely related to the Chlamydiaceae; neg-ative scores were generated with all other bacterial templatesexamined (Table 2). The sensitivity of plus/minus computerscoring of the test was set by the level of background fluores-cence produced in six no-template controls (Fig. 3). A detailedexamination of the raw fluorescence spectra showed that chla-mydial fluorescence intensity appeared as a broad plateau at10,000 U (Fig. 3C). When chlamydial template was seriallydiluted to less than 50 target molecules (Table 4), the intensityof fluorescence at 515 nm was reduced to background levels(Fig. 3B and C). After PCR, the raw spectra from some non-

chlamydial templates were of intermediate fluorescence inten-sity (not reaching the 10,000-nm plateau and not background).Qualitatively, these intermediate spectra could not be distin-guished from the raw spectra produced by using extremelydilute chlamydial template. The DNA concentrations of thesenonchlamydial DNA templates were high (0.25 to 2.0 mg/re-action mixture), relative to the concentration of chlamydialtemplate that was sufficiently dilute to generate a comparablesignal (,70 fg/reaction mixture). To characterize the interme-diate nonchlamydial signals, template DNAs from the non-chlamydial bacteria that had produced the highest signals werediluted 10-fold and retested (data not shown). The levels offluorescence from these diluted templates were at backgroundlevels, indicating that nonchlamydial template could not pro-duce a strongly positive fluorescent signal plateau.

By using the TaqMan test, as few as 1.7 IFU of C. psittaciNJ1 EBs could be detected (Table 3). In the 6BCT templatedilution series, the sequence detection system scored a positivefluorescent signal when as little as 70 fg of C. psittaci 6BCT

template was used for PCR (50 targets) (Table 4). Fluores-cence intensity decreased as the template concentration wasreduced until the raw spectral fluorescence was equivalent tothe background fluorescence (Fig. 3). The sensitivity of theTaqMan assay decreased by at least 4 logs when samples wereprepared by boiling rather than by the reducing alkaline lysismethod. Sensitivity was not diminished, however, when dam-aged template was used or when RNA was present in thesample.

Test 3: detection of the Chlamydiales. PCR of a wide varietyof template DNAs using the 23S rRNA signature sequenceprimers resulted in PCR amplicons from all Chlamydiaceae,from S. negevensis and W. chondrophila, and from several non-chlamydial species (Fig. 4; Table 2). All of these PCR productswere approximately the same size, based on gel electrophore-sis. A number of the PCR products were subjected to directsequence analysis using the amplification primers. These gave23S rRNA sequences as expected from both chlamydial andnonchlamydial templates. Assayed dilutions of C. psittaci NJ1EBs showed that as few as 170 IFU could be detected when 4mM Mg21 was used in the PCR mixture (Table 3). Amplifi-cation of a dilution series of 6BCT template DNA indicatedthat the test could detect as little as 0.7 pg of C. psittaci 6BCT

template DNA (500 targets) (Table 4). When damaged tem-plate DNA was used, the sensitivity was reduced by 2 to 4 logs.When the concentration of Mg21 was reduced from 4 to 1.5mM, the sensitivity was reduced by another 1 log. When RNAwas present, the amount of PCR product generated was fur-ther reduced.

DISCUSSION

This study has characterized three different PCR tests thatcan be used for the identification of chlamydiae. The TaqManand multiplex tests were specific for members of the familyChlamydiaceae, and they targeted the rRNA operon and/or theompA gene. These tests are so specific for the Chlamydiaceaethat they may be useful for the screening of field specimens.The third test targeted 23S rDNA segments that were con-served among all families belonging to the order Chlamydiales,including the Chlamydiaceae. This test also recognized somenonchlamydial bacterial templates and therefore is recom-mended primarily for characterizing isolates. Test 3 is ex-tremely important because a specific way to identify new chla-mydial families has not previously existed. All three tests weredesigned to generate short PCR products so that amplificationand electrophoresis time would be minimized, enzyme and

FIG. 2. Test 1 multiplex detection of the Chlamydiaceae. (A) PCR amplifi-cation of the Chlamydiaceae and several other bacterial strains, in 1.5 mM Mg21;(B) multiplex PCR amplification of 10-fold dilutions of the 6BCT template, in 4.0mM Mg21.

VOL. 37, 1999 CHLAMYDIACEAE DETECTION 577

on April 12, 2019 by guest

http://jcm.asm

.org/D

ownloaded from

amplification conditions would not be limiting, and poor tem-plate integrity would not prevent detection.

Test 2, the TaqMan test, was more sensitive than test 1 andtest 3 by approximately 2 logs. This test required no pipettingor handling of PCR products following the initial setup of thePCR mix. The TaqMan test amplified a 132-bp PCR prod-uct, in comparison to the 320- and 240-bp multiplex prod-ucts and the 600-bp test 3 product. The TaqMan test coulddetect as few as two target molecules in a 50-ml reaction

mixture, as determined by assay of a dilution series of C.psittaci NJ1 IFU. This plus/minus assay required 100 min ofPCR and 10 min of automated reading for 90 samples andsix controls.

Test 1, the multiplex gel detection test, was also specific forthe Chlamydiaceae. The limit of detection for this test was 200to 500 target molecules. Primer set 1260-TGLY targeted the 39end of the ompA gene, and primer set IGF-IGR targeted theintergenic spacer of the rRNA operon. Having two PCR prod-ucts provides confirmation of the identity of positive specimens

TABLE 2. PCR test summary

StrainaResults forb:

ATCC no. Test 1 Test 2 Test 3

Arcobacter cryaerophilus 43158 2 2 11Arcobacter skirrowi CCUG 10374 2 2 11Campylobacter coli 33559 2 2 11Campylobacter coli NADC 3521 2 2 11Campylobacter curvus 35224 2 2 11Campylobacter jejuni 33560 2 2 1Campylobacter lari 43675 2 2 11Campylobacter upsaliensis NADC 2744 2 11Campylobacter ureolyticus 33387 2 2 1Campylobacter rectus 33238 2 2 1Chlamydia muridarum MoPnT VR-123 111 111 111Chlamydia suis R22 111 111 111Chlamydia trachomatis D/UW-3/CX VR-885 111 111 111Chlamydophila abortus EBA 111 111 111Chlamydophila caviae GPICT VR-813 111 111 111Chlamydophila felis FP BakerT VR-120 111 111 111Chlamydophila pecorum IPA VR-629 111 111 111Chlamydophila pneumoniae TW-183T VR-2282 111 111 111Chlamydophila psittaci 6BCT VR-125 111 111 111Helicobacter fennelliae NADC 2745 2 2 11Helicobacter pylori NADC 3226 2 2 1Listeria monocytogenes NADC 2045 2 2 1Simkania negevensis ZT VR-1471 2 2 111Waddlia chondrophila WSU 86-1044T VR-1470 2 2 111

a Strains that were positive in at least one test are shown. Strains that were not detected by any of the three PCR tests include the following: Acholeplasma laidlawiifield strain (FS), Arcobacter butzleri ATCC 49616, Bordetella bronchiseptica FS 1 and 2, Campylobacter gracilis ATCC 33236, Campylobacter hyointestinalis ATCC 35217,Erysipelothrix strains NADC 3174 and NADC 3177, Escherichia coli FS 1 and 2, Helicobacter cinaedi NADC 2743, Helicobacter mustelae NADC 3169, Legionellapneumophila SVir, Listeria grayii NADC 2129, Listeria innocua NADC 2086, Mycoplasma arginini NVSL 96-159, Mycoplasma bovigenitalium NVSL 96-192, Mycoplasmabovirhinis NVSL 97-005, Mycoplasma bovis NVSL 97-002, Mycoplasma californicum FS, Mycoplasma gallinaceum NVSL 97-044, Mycoplasma mycoides NVSL 97-087,Mycoplasma ovipneumoniae FS, Mycoplasma pullorum NVSL 96-188, Pasturella multocida FS 1 and 2, Salmonella cholerasuis FS 1, Salmonella dublin FS 1 and 2,Salmonella FS 1 and 2, Staphylococcus epidermidis FS 1 and 2, Streptococcus suis FS, Verrucomicrobium spinosum DSM 4136T, Vero cells ATCC CCL 81.

b 2, negative; 1, positive; 11, strongly positive; 111, intensely positive.

TABLE 3. Results of PCR using a dilution series of C. psittaciNJ1 IFU and several MgCl2 concentrationsa

C. psittaci IFUand/or Vero cells

used in PCR

Results forb:

Test 1c Test 1d Test 2e Test 3c Test 3d

1.7 3 106 only 1 1 11 1 11.7 3 106 1 cells 1 11 11 1 111.7 3 104 1 cells 2 1 11 1 11.7 3 102 1 cells 2 w 11 2 w1.7 1 cells 2 2 1 2 2Cells only 2 2 2 2 2

a An aliquot of each EB dilution was centrifuged to provide a pellet of EBs forDNA preparation and PCR. Approximately 2,000 Vero cells (cells) were addedto each aliquot before centrifugation, to provide a carrier for the small numbersof EBs.

b 1, detectable PCR product; w, weakly detectable product; 2, no detectableproduct.

c In 1.5 mM Mg21.d In 4.0 mM Mg21.e In 2.5 mM Mg21.

TABLE 4. Results of PCR using a series of C. psittaci 6BCT

template dilutionsa

Amt oftemplate

Equivalentno. of genomes

Results forb:

Test 1c Test 2d Test 3c

70 ng 5 3 107 111 11 1117 ng 5 3 106 111 11 111

0.7 ng 5 3 105 111 11 11170 pg 5 3 104 11 11 1117 pg 5 3 103 1 11 111

0.7 pg 500 w 1 170 fg 50 2 1 27 fg 5 2 2 2

a In strain 6BCT, each genome contains one target locus.b 1, detectable PCR product; w, weakly detectable product; 2, no detectable

product.c In 4.0 mM Mg21.d In 2.5 mM Mg21.

578 EVERETT ET AL. J. CLIN. MICROBIOL.

on April 12, 2019 by guest

http://jcm.asm

.org/D

ownloaded from

yet also helps to ensure that mutations in as-yet-undiscoveredchlamydiae will not entirely prevent detection by this test. TheTGLY primer, complementing sequence just downstream ofompA, was an exact match to all known Chlamydiaceae strains.

Primer IGF, located within the rRNA intergenic spacer, wasalso an exact match to all known strains. Primers 1260 and IGReach had two or more bases that did not match all chlamydialtemplate sequences. Primer 1260 mismatches were overcomeby making this primer extra long, whereas the 2-base mismatchin primer IGR was designed to ensure a mismatch with everychlamydial template. IGR mismatches enhanced the specificityof the primer, because close to its natural annealing termpera-ture, this primer would be readily dissociated from template ifthere were additional mismatches. Annealing by this primercould even be made more tenuous with a low Mg21 concen-tration. Figure 2 illustrates this effect: the 6BCT ribosomalPCR product was poorly amplified in 1.5 mM Mg21 (Fig. 2A)but well amplified in 4 mM Mg21 (Fig. 2B). This discrimina-tion helps to ensure the specificity of the ribosomal primers forthe Chlamydiaceae.

Test 3 used a primer set that amplified domain I of the 23SrRNA. This segment is a signature sequence for chlamydialspecies, genera, and families (8). The test identified chlamydia-like isolates that were not recognized by the tests that werespecific for the Chlamydiaceae. Identification was done by di-rectly sequencing the 600-bp PCR product with the U23F and23SIGR amplification primers (8) and then using this sequencein a BLAST search of the GenBank database. The primer setamplified as few as 500 targets. It was used to PCR amplify andsequence the 23S rRNA gene of S. negevensis and W. chron-FIG. 4. Test 3 PCR results for chlamydiae and several bacterial strains.

FIG. 3. Test 2, TaqMan results and output, showing automated 1/2 scoring and fluorescence intensity at 515 nm for each sample. Each experiment had its ownset of no-template controls for automated calculation of background fluorescence. (A) Column 1, rows 1 to 6, no-template controls; column 1, rows 7 and 8, and column2, rows 1 to 7, nine species of the Chlamydiaceae (Table 2). All other columns and rows used template DNA from the strains with negative PCR results shown in Table2, including those listed in footnote a. (B) Column 1, rows 1 to 6, no-template controls; column 1, rows 7 and 8, and column 2, rows 1 to 8, 10-fold dilutions of 6BCT

template DNA. (C) Raw spectra corresponding to the 6BCT dilutions shown in panel B, column 2. Left panel, template only; right panel, the six no-template controlsand one of the template samples.

VOL. 37, 1999 CHLAMYDIACEAE DETECTION 579

on April 12, 2019 by guest

http://jcm.asm

.org/D

ownloaded from

drophila, species which belong to two new families in theChlamydiales.

Currently, because of the difficulties involved in chlamydialdetection and identification, our understanding of the Chlamy-diales has been primarily limited to strains found in hosts ofeconomic importance. The PCR tests described in this reportmake it possible to recognize all of these chlamydiae and newstrains, as well, with good sensitivity. Furthermore, the PCRproducts generated in these analyses (including the TaqManproducts) can be directly sequenced to identify the species orstrain, if desired. The availability of these assays facilitates thestudy of the epidemiology of chlamydiae and may also improvediagnostic capability. By using these tests, biodiversity studiescan be reasonably and affordably undertaken, with the assur-ance that the outcome will be consistent with our currentunderstanding of chlamydial phylogeny.

ACKNOWLEDGMENTS

We thank Alan Baetz, Harlan D. Caldwell, Lee Ann Campbell, PamM. Dilbeck, Sharon Franklin, Maureen Friedman, Peter Janssen, PaulS. Hoffman, Douglas G. Rogers, Fred Rurangirwa, and Irene V. Wes-ley for providing DNA or strains used in this study.

ADDENDUM IN PROOF

The new family, genus, and species names for bacteria in theorder Chlamydiales that are used in this work will become validupon the publication of references 8 and 23.

REFERENCES

1. Andersen, A. A., and R. A. Van Deusen. 1988. Production and partial char-acterization of monoclonal antibodies to four Chlamydia psittaci isolates.Infect. Immun. 56:2075–2079.

2. Balin, B. J., H. C. Gerard, E. J. Arking, D. M. Appelt, P. J. Branigan, J. T.Abrams, J. A. Whittum-Hudson, and A. P. Hudson. 1998. Identification andlocalization of chlamydia pneumoniae in the Alzheimer’s brain. Med. Mi-crobiol. Immunol. 187:23–42.

3. Birtles, R. J., T. J. Rowbotham, C. Storey, T. J. Marrie, and D. Raoult. 1997.Chlamydia-like obligate parasite of free-living amoebae. Lancet 349:925–926.

4. Bocklisch, V. H., C. Ludwig, and S. Lange. 1990. Chlamydien als Abort-ursache beim Pferd. Berl. Muench. Tieraerztl. Wochenschr. 104:119–124.

5. Dilbeck, P. M., J. F. Evermann, T. B. Crawford, A. C. S. Ward, C. W.Leathers, C. J. Holland, C. A. Mebus, L. L. Logan, F. R. Rurangirwa, andT. C. McGuire. 1990. Isolation of a previously undescribed rickettsia from anaborted bovine fetus. J. Clin. Microbiol. 28:814–816.

6. Dilbeck, P. M., J. F. Evermann, S. Kraft, and S. Tyler. 1985. Equine chla-mydial infections: comparative diagnostic aspects with bovine and ovinechlamydiosis, p. 285. In M. W. Vorheis (ed.), Proceedings of the 28th AnnualMeeting of the American Association of Veterinary Laboratory Diagnosti-cians. American Association of Veterinary Laboratory Diagnosticians, Mil-waukee, Wis.

7. Everett, K. D. E., and A. A. Andersen. 1997. The ribosomal intergenic spacerand domain I of the 23S rRNA gene are phylogenetic markers for Chlamydiaspp. Int. J. Syst. Bacteriol. 47:461–473.

8. Everett, K. D. E., R. M. Bush, and A. A. Andersen. Emended description ofthe order Chlamydiales, proposal of Parachlamydiaceae fam. nov. and Sim-kaniaceae fam. nov., each containing one monotypic genus, revised taxonomyof the family Chlamydiaceae including a new genus and five new species, andstandards for the identification of organisms. Int. J. Syst. Bacteriol., in press.

9. Forster, J.-L., M. M. Wittenbrink, H.-J. Hani, L. Corboz, and A. Pospischil.

1997. Absence of Chlamydia as an aetiological factor in aborting mares. Vet.Rec. 141:424.

10. Groff, J. M., S. E. LaPatra, R. J. Munn, M. L. Anderson, and B. I. Osburn.1996. Epitheliocystis infection in cultured white sturgeon (Acipensertransmontanus): antigenic and ultrastructural similarities of the causativeagent to the chlamydiae. J. Vet. Diagn. Invest. 8:172–180.

11. Herring, A. J. 1993. Typing Chlamydia psittaci—a review of methods andrecent findings. Br. Vet. J. 149:455–475.

12. Huchzermeyer, F. W. 1997. Public health risks of ostrich and crocodile meat.Rev. Sci. Technol. 16:599–604.

13. Kahane, S., Everett, K. D. E., Kimmel, N., and M. G. Friedman. Simkanianegevensis, strain ZT: growth, antigenic and genome characteristics. Int. J.Syst. Bacteriol., in press.

14. Kahane, S., R. Gonen, C. Sayada, J. Elion, and M. G. Friedman. 1993.Description and partial characterization of a new chlamydia-like microor-ganism. FEMS Microbiol. Lett. 109:329–334.

15. Kahane, S., D. Greenberg, M. G. Friedman, H. Haikin, and R. Dagan. 1998.High prevalence of S. negevensis, a novel chlamydia-like bacterium, in infantswith acute bronchiolitis. J. Infect. Dis. 177:1425–1427.

16. Kaltenbock, B., N. Schmeer, and R. Schneider. 1997. Evidence for numerousomp1 alleles of porcine Chlamydia trachomatis and novel chlamydial speciesobtained by PCR. J. Clin. Microbiol. 35:1835–1841.

17. Lieberman, D., S. Kahane, D. Lieberman, and M. G. Friedman. 1997. Pneu-monia with serological evidence of acute infection with the chlamydia-likemicroorganism “Z.” Am. J. Respir. Crit. Care Med. 156:578–582.

18. Lobau, S., U. Mamat, W. Brabetz, and H. Brade. 1995. Molecular cloning,sequence analysis, and functional characterization of the lipopolysaccharidebiosynthetic gene kdtA encoding 3-deoxy-alpha-D-manno-octulosonic acidtransferase of Chlamydia pneumoniae strain TW-183. Mol. Microbiol. 18:391–399.

19. Meijer, A., and J. M. Ossewaarde. 1998. Broad range Chlamydia PCR de-tects previously unrecognized Chlamydia sequences: a new genus in thefamily Chlamydiaceae?, p. 523–526. In R. S. Stephens, G. I. Byrne, G. Chris-tiansen, I. N. Clarke, J. T. Grayston, R. G. Rank, G. L. Ridgway, P. Saikku,J. Schachter, and W. E. Stamm (ed.), Chlamydial infections: proceedings ofthe Ninth International Symposium on Human Chlamydial Infection. Inter-national Chlamydia Symposium, San Francisco, Calif.

20. Pospischil, A., and R. D. Wood. 1987. Intestinal Chlamydia in pigs. Vet.Pathol. 24:568–570.

21. Rake, G. W. 1957. Family II. Chlamydiaceae Rake, Fam. Nov., p. 957–968. InR. S. Breed, E. G. D. Murray, and N. R. Smith (ed.), Bergey’s manual ofsystematic bacteriology, 7th ed. The Williams & Wilkins Co., Baltimore, Md.

22. Rogers, D. G., A. A. Andersen, A. Hogg, D. L. Nielsen, and M. A. Huebert.1993. Conjunctivitis and keratoconjunctivitis associated with chlamydiae inswine. J. Am. Vet. Med. Assoc. 203:1321–1323.

23. Rurangirwa, F. R., P. M. Dilbeck, T. B. Crawford, T. C. McGuire, and T. F.McElwain. 16S DNA sequence of WSU 86-1044 microorganism from anaborted bovine fetus reveals it is a member of the order Chlamydiales:proposal of Waddliaceae fam. nov., Waddlia chondrophila, gen. nov., sp. nov.Int. J. Syst. Bacteriol., in press.

24. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Press, Cold Spring Harbor,N.Y.

25. Sayada, C., E. Denamur, J. Orfila, F. Catalan, and J. Elion. 1991. Rapidgenotyping of the Chlamydia trachomatis major outer membrane protein bythe polymerase chain reaction. FEMS Microbiol. Lett. 83:73–78.

26. Vanrompay, D., R. Ducatelle, and F. Haesebrouck. 1992. Diagnosis of avianchlamydiosis: specificity of the modified Gimenez staining on smears andcomparison of the sensitivity of isolation in eggs and three different cellcultures. J. Vet. Med. B 39:105–112.

27. Yoshida, H., Y. Kishi, S. Shiga, and T. Hagiwara. 1998. Differentiation ofChlamydia species by combined use of polymerase chain reaction and re-striction endonuclease analysis. Microbiol. Immunol. 42:411–414.

28. Zahn, I., L. Szeredi, I. Schiller, U. Straumann-Kunz, E. Burgi, F. Guscetti,E. Heinen, L. Corboz, T. Sydler, and A. Pospischil. 1995. Immunohistochem-ical determination of Chlamydia psittaci/pecorum and C. trachomatis in thepiglet gut. J. Vet. Med. B 42:226–276.

580 EVERETT ET AL. J. CLIN. MICROBIOL.

on April 12, 2019 by guest

http://jcm.asm

.org/D

ownloaded from