Pseudomonas aeruginosa Cystic Fibrosis Isolates Induce ...Apoptosis assays. (i) DNA fragmentation assay. DNA was isolated from eu-karyotic cells as described previously (30), quantiﬁed,

INFECTION AND IMMUNITY,0019-9567/00/$04.0010

May 2000, p. 2916–2924 Vol. 68, No. 5

Copyright © 2000, American Society for Microbiology. All Rights Reserved.

Pseudomonas aeruginosa Cystic Fibrosis Isolates Induce Rapid,Type III Secretion-Dependent, but ExoU-Independent, Oncosis

of Macrophages and Polymorphonuclear NeutrophilsDENIS DACHEUX,1 BERTRAND TOUSSAINT,1 MARCELINE RICHARD,2 GUY BROCHIER,2

JACQUES CROIZE,3 AND INA ATTREE1*

Departement de Biologie Moleculaire et Structurale, BBSI, UMR-314 CNRS, CEA-Grenoble,1 and Service deBacteriologie et Virologie, CHU,3 Grenoble, and Service d’Imagerie et de

Microscopie Electronique, CRSSA, La Tronche,2 France

Received 18 November 1999/Returned for modification 27 December 1999/Accepted 25 January 2000

Pseudomonas aeruginosa, an opportunistic pathogen responsible most notably for severe infections in cysticfibrosis (CF) patients, utilizes the type III secretion system for eukaryotic cell intoxication. The CF clinicalisolate CHA shows toxicity towards human polymorphonuclear neutrophils (PMNs) which is dependent on thetype III secretion system but independent of the cytotoxin ExoU. In the present study, the cytotoxicity of thisstrain toward human and murine macrophages was demonstrated. In low-multiplicity infections (multiplicityof infection, 10), approximately 40% of the cells die within 60 min. Analysis of CHA-infected cells by trans-mission electron microscopy, DNA fragmentation assay, and Hoechst staining revealed the hallmarks ofoncosis: cellular and nuclear swelling, disintegration of the plasma membrane, and absence of DNA fragmen-tation. A panel of 29 P. aeruginosa CF isolates was screened for type III system genotype, protein secretionprofile, and cytotoxicity toward PMNs and macrophages. This study showed that six CF isolates were able toinduce rapid ExoU-independent oncosis on phagocyte cells.

Pseudomonas aeruginosa is a major opportunistic pathogencausing nosocomial pneumonia, infections in immunocompro-mised patients, and severe pulmonary damage in cystic fibrosis(CF) patients (28). Among numerous virulence determinants,P. aeruginosa clinical isolates use the so-called type III secre-tion system as a specialized mechanism to provoke eukaryoticcell intoxication.

Type III secretion systems, which are conserved in variousplant and animal pathogens, require close contact with theeukaryotic cell in order to deliver toxic bacterial proteins di-rectly into the cytoplasm of the cell. The phenotypic effectsinduced by type III systems differ from one bacterial species toanother but may be classified according to the major cell func-tions that are modified (12). For example, Shigella spp. (20)and Salmonella spp. (11) modulate actin organization to in-duce their own uptake by nonphagocytic cells. The main tar-gets of type III secretion effectors include cells involved ininnate immunity. Yersinia spp. and P. aeruginosa synthesizetype III system effectors that can alter normal actin structuresin macrophages to inhibit phagocytosis (2, 10). Furthermore,Yersinia (21), Shigella (15), and Salmonella (22), via the activityof type III effectors, are able to induce apoptosis in infectedmacrophages.

Several groups have investigated the interaction between P.aeruginosa and eukaryotic cells, using different ex vivo infectionmodels. These studies have made it possible to elucidate thecontribution of certain type III secreted proteins to P. aerugi-nosa cytotoxicity. To date, four type III effectors have beenidentified: ExoS, ExoT, ExoU, and ExoY. ExoS and ExoT haveADP-ribosylating activity toward low-molecular-weight GTP-binding proteins of the Ras family (18). Expression of ExoS is

correlated with multiple effects on cellular processes, includinginhibition of DNA synthesis (24), alteration in actin cytoskel-etal structure (10, 26), and interference with cell matrix adher-ence (25). ExoY is a recently discovered adenylate cyclasewhose activity is associated with profound morphologicalchanges in epithelial cells (35). Finally, a type III secretedeffector, ExoU (PepA), with unknown activity, is responsiblefor the acute cytotoxicity of P. aeruginosa toward epithelialcells (7, 14) and macrophages (29).

We have reported recently that a CF clinical isolate, CHA,is able to induce cell death in human polymorphonuclear neu-trophils (PMNs) in an ExoU-independent manner. The cyto-toxic phenotype of CHA, however, requires the functional typeIII secretion system (3). In the present work, we have furtherinvestigated the cytotoxicity of CHA and of 28 other CF iso-lates of P. aeruginosa and shown that the type III secretion-dependent, ExoU-independent cell death of phagocytes occursby rapid oncosis, involving swelling of the cell and nucleus anddisintegration of the plasma membrane. This type of eukary-otic cell death, which is distinct from apoptosis (16), has beenrecently associated with the cytotoxicity of some Shigella (6, 23)and enteroaggregative Escherichia coli (5) strains.

MATERIALS AND METHODS

Bacterial strains. The P. aeruginosa strains used in this study included CHA,a bronchopulmonary isolate from a CF patient (31), and CHA-D1, an isogenicmutant of CHA in which the exsA gene, encoding the ExsA transcriptional factornecessary for type III system synthesis (9), has been inactivated (3). Further P.aeruginosa strains isolated from different CF patients were designated CF1, CF2,CF3, CF4, CF5, CF6, CF7, CF8, CF9, CF10, CF11, CF12, CF13, CF14, CF15,CF16, CF17, CF18, CF19, CF20, RIE, T6, 37.11, K569, REN0, REN3, REN4,and REN7. All strains were tested for resistance to 10% pooled normal humanserum. Strains CF18, CF20, T6, 37.11, K569, REN0, and REN7 were found to beserum sensitive. All strains were grown on pseudomonas isolation agar (Difco)plates or in Luria-Bertani (LB) liquid medium at 37°C. The antibiotics used werecarbenicillin (300 mg/ml) and gentamicin (200 mg/ml). The strains and plasmidsused in this study are listed in Table 1.

In vitro secretion of type III system proteins. To test the ability of P. aerugi-nosa isolates to secrete in vitro type III secretion system proteins, bacteria were

* Corresponding author. Mailing address: DBMS/BBSI, CEA-Grenoble, 17 rue des Martyrs, 38054 Grenoble cedex 09, France.Phone: 33.4.76.88.34.83. Fax: 33.4.76.88.44.99. E-mail: [email protected].

2916

on January 18, 2021 by guesthttp://iai.asm

.org/D

ownloaded from

http://iai.asm.org/

grown in a calcium-depleted LB medium and extracellular proteins were ana-lyzed by 0.1% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) (12% polyacrylamide) as described previously (3). The protein profileswere compared to the protein profile obtained with the CHA strain, for whichsecreted ExoS, ExoT, PopB, and PopD were identified by matrix-assisted laserdesorption ionization–time-of-flight mass spectrometry (MALDI-TOF) (3).

Genotype analysis. The presence of exsA, exoS, exoT, exoY, and exoU genes wasdetermined by Southern blot analysis. Chromosomal DNA was isolated fromeach strain, subjected to digestion with EcoRI, transferred to a nylon membrane,and hybridized with the digoxigenin-labeled probes as specified by the manufac-turer (Roche Molecular Biochemicals, Meylan, France). Probes were synthesizedby PCR using primers 59GGCCCAGGATCGGCTTGCAA and 59GATCCGCTGCCGAGCCAAGA for amplification of exoS (34), 59GATATCCATCGGGTTCTCCG and 59AGGCCTCCTTGCCGCCCATT for amplification of exoT(33), 59GTCGCAGCCATCTACCTAG and 59GCGTCGCCCAGCATATTCCG(AF061745 EMBL data bank) for amplification of exoY, and 59GATCTTATTTCGCTGCTCGA and 59CCTTCTGGCGAAAAGCCAC for amplification ofexoU (14). The PCR probe for exsA was obtained as described previously (3).

Preparation of PMNs and cell culture. Human PMNs were isolated fromwhole blood by Percoll gradient centrifugation as described previously (3). TheEBV-B lymphocytes, provided by Laboratoire d’Immunochimie, CEA-Grenoble,Grenoble, France, were grown in RPMI 1640 medium containing L-glutamine(Gibco) and supplemented with 10% heat-inactivated fetal calf serum (FCS)(Gibco). The macrophage cell line J774 and HeLa cells were grown in Dulbeccomodified Eagle medium supplemented with 10% heat-inactivated FCS. At 24 hbefore infection, the cells were seeded in 24-well culture plates at 5 3 105

cells/well. Human macrophages were a gift from J. Plumas (Etablissement detransfusion sanguine de l’Isere et de la Savoie). The cells were obtained bydifferentiation from peripheral blood mononuclear cells by a 7-day incubation inthe presence of granulocyte-macrophage colony-stimulating factor (500 U/ml;Sandoz) and 2% autologous serum. After purification by counterflow centrifu-gation, morphological and phenotypic analysis indicated that .95% of the cellswere macrophages. Infection was carried out in RPMI 1640–10% FCS. Allincubations were performed in a 5% CO2 incubator at 37°C.

Infection conditions and cytotoxicity assay. Unless otherwise indicated, thebacterial strains were grown in LB medium to an optical density at 600 nm(OD600) between 1 and 1.2 after dilution of overnight cultures at 0.1 OD600,washed once with phosphate-buffered saline (PBS), and resuspended in theappropriate eukaryotic cell growth medium. Infections were carried out in 24-well culture dishes in a CO2 incubator at 37°C. Samples (300 ml) contained 5 3105 cells/well and 5 3 106 CFU of P. aeruginosa, giving a multiplicity of infection(MOI) of 10. We developed a test in 96-well plates to analyze the cytotoxicity ofP. aeruginosa CF isolates on PMNs. For infection, bacteria were collected bycentrifugation, washed once with modified HEPES-buffered saline (mHBS) (3),and opsonized for 5 min with pooled normal human serum. Sample (200 ml)contained 5 3 106 PMNs/ml, 5 3 107 CFU of P. aeruginosa per ml (MOI, 10),and 10% normal human serum in mHBS. At each hour of incubation, a 30-mlaliquot was taken and the cytotoxicity was determined by measuring the releaseof the cytosolic enzyme lactate dehydrogenase (LDH) into infection superna-tants by using the cytotoxicity detection kit (Roche Molecular Biochemicals) asdescribed previously (3).

Examination of cell morphology. Cells were grown and infected with bacteria(MOI, 10) in Lab-Tek chambers (Nunc). Cell morphology was assessed byphase-contrast microscopy with inverted Zeiss IM. Observations were made witha 403 objective lens.

Apoptosis assays. (i) DNA fragmentation assay. DNA was isolated from eu-karyotic cells as described previously (30), quantified, and subjected to electro-phoresis on a 1.5% agarose gel containing 1 mg of ethidium bromide (EtBr) perml. DNA was visualized under UV light.

(ii) Nuclear morphology. After infection, cells were washed once with PBS andfixed with 3.7% formaldehyde in PBS for 10 min at room temperature. After two

washes with PBS, the cells were permeabilized with 0.8% Triton X-100 in PBSfor 10 min at room temperature. To analyze the nuclei, cells were stained withHoechst 33342 (Sigma) (working dilution, 1:1,000) at 37°C for 30 min andvisualized by fluorescence microscopy (Axioskop 20; Zeiss). Apoptosis in PMNswas induced by a 5-h treatment with 50 mM actinomycin D (Clontech, Palo Alto,Calif.) or a 30-min UV treatment. Apoptosis in J774 macrophages was inducedby UV irradiation for 15 min.

TEM. After 1 h of infection, PMNs and J774 macrophages were pelleted bycentrifugation at 1,200 3 g for 5 min, fixed for 1 h using 3% glutaraldehyde in 0.1M phosphate buffer (pH 7.4), and postfixed for 1 h with 1% OsO4 in 0.1 Mcacodylate buffer (pH 7.4). The pellet was embedded in epoxy resin and sec-tioned for transmission electron microscopy (TEM) observation (JEOL JEM1010). The sections were scored for the occurrence of different morphologicalappearance of PMNs and macrophages. Phagocytosis was estimated by countingmore than 100 cells.

RESULTS

Cytotoxicity of the CHA strain on macrophages, B lympho-cytes, and epithelial cells. The CF clinical isolate CHA waspreviously shown to induce type III secretion-dependent celldeath in human PMNs, yielding 80% cell lysis after 3 h ofcoincubation. Cell death was independent of the previouslyidentified type III-secreted toxin ExoU, since the exoU gene isnot present in the genome of the CHA strain (3). To testwhether ExoU-independent cytotoxicity is exhibited towardother types of leukocytes, macrophages and B lymphocyteswere infected with CHA and the CHA-D1 mutant strain at alow MOI of 10. CHA-D1 is a derivative of CHA in which theexsA gene, encoding a transcriptional activator of P. aeruginosatype III secretion system genes, has been inactivated. CHA-D1is deficient in type III secretion and is noncytotoxic on PMNs(3). In preliminary experiments, monocyte-derived macro-phages of human origin and the murine macrophage-like cellline J774 were tested in parallel. Since the results obtained withthe two cell types were identical, J774 cells were used in furtherstudies. Infected J774 cells were observed by phase-contrastmicroscopy, and cytotoxicity was assessed by measuring therelative release of the cytosolic enzyme LDH. CHA-infectedmacrophages rapidly began to round up, and a large number ofcells became swollen and translucent, usually detaching fromthe cell dish surface (Fig. 1D). These cells were able to take upEtBr, a DNA-binding fluorescent dye, indicating a substantialloss of membrane integrity. In agreement with the microscopicobservations, the LDH activity released from CHA-infectedmacrophages was already detectable 30 min postinfection andreached 80 to 90% within 2 h. The macrophages infected withCHA-D1 showed no release of LDH in comparison to thebasal level of LDH activity measured in the supernatants ofuninfected cells (Fig. 1A). In agreement with the LDH data, noimportant morphological changes of CHA-D1-infected cellswere observed during the course of the 3-h incubation.Complementation of the mutant CHA-D1 in trans with thewild-type exsA gene restored its cytotoxicity (Fig. 1A). UnlikePMNs and macrophages, B lymphocytes infected with CHAand CHA-D1 released no LDH activity during the first 4 h ofinfection. If incubation was continued to 6 h, the LDH activityreleased by CHA-infected B cells indicated about 40% lysis(Fig. 1B). Similar results were obtained with CHA-infectedepithelial cell line HeLa, in which only 40 to 50% of cells diedin 6 h (Fig. 1C). This slow cytotoxic activity of CHA towardlymphocytes and epithelial cells was nevertheless dependenton the functional type III secretion system, since the ExsAmutant strain CHA-D1 was less cytotoxic and the complemen-tation in trans restored the cytotoxicity (Fig. 1B and C). Theresults obtained with different cell lines suggest that there issome cell type specificity in type III secretion-mediated intox-ication.

Preliminary experiments indicated that the kinetics of the

TABLE 1. Bacterial strains and plasmid used in this study

Strain or plasmid Relevant genotype or phenotypea Source orreference

P. aeruginosaCHA Mucoid CF isolate 31CHA-D1 exsA::Gmr mutant of CHA 3REN0 CF isolate This workREN0-D1 exsA::Gmr mutant of REN0 This workCF1 CF isolate This workCF1-D1 exsA::Gmr mutant of CF1 This work

Plasmid pDD2 pUCP20-derived plasmid containingexsA

3

a Gmr, gentamicin resistance.

VOL. 68, 2000 P. AERUGINOSA CF ISOLATES INDUCE ONCOSIS IN PHAGOCYTES 2917


.org/D

ownloaded from

http://iai.asm.org/

CHA-induced cell death could vary significantly from one ex-periment to another, depending on the age of the bacterialculture. To establish the relationship between the kinetics ofcytotoxicity and the bacterial growth phase, the CHA strainwas grown in LB at 37°C with agitation and aliquots were takenat different time points. J774 macrophages were infected at aconstant MOI of 10, and cytotoxicity was determined 1 and 2 hafter infection. As shown in Fig. 2, the most rapid cell deathoccurred when bacteria from the late logarithmic phase wereused for infection. Under these conditions, morphologicalchanges in the infected macrophages were already noticeable15 min after infection and 30 to 40% cell lysis was detected 1 hlater. As soon as the bacterial culture entered the stationaryphase, the ability of CHA to induce cell death began to de-crease. The cytotoxicity of bacteria from the late stationary

phase was reduced to 40% at 2 h postinfection. A similargrowth phase-dependent cytotoxicity was observed for PMNs(data not shown). With the exception of the above experi-ments, all the infections described in this work were carried outusing bacteria grown to the stage where cytotoxicity was themost efficient.

Characterization of cell death by DNA fragmentation andHoechst staining. The release of LDH activity into the infectedculture supernatants, and the uptake of EtBr reflect the loss ofcell membrane integrity but do not provide any informationabout the mode of cell death. Since several animal pathogensare able to induce apoptosis of macrophages through the ac-tivity of type III secreted effectors (see the introduction),CHA-infected PMNs and macrophages were first examined forinternucleosomal DNA fragmentation, one of the main indi-cations of apoptosis. Chromosomal DNA, extracted from 3-h-infected PMNs and macrophages, showed no evidence of chro-matin cleavage and was indistinguishable from DNA isolatedfrom uninfected cells (Fig. 3A). Similarly to 3 h, at 30 min, 1 h,and 2 h, no evidence of apoptosis was detected (data notshown). As controls, apoptosis was induced in PMNs by a 5-hincubation with actinomycin D and in macrophages by 15 minof UV treatment. DNA isolated from these cells showed aclear 200-bp DNA ladder on agarose gels (Fig. 3A, lanes 5 and9). Possible changes in nuclear morphology were also assessedby Hoechst staining. As shown in Fig. 3B, uninfected PMNshave a typical polymorphonuclear morphology while PMNsinfected with CHA contain nuclei that seem to be perfectlyround, uniformly stained, and swollen. No evidence of chro-matin condensation, which is characteristic of apoptotic nucleias seen in UV-treated cells, was observed in CHA-infectedPMNs or macrophages. These results suggest that PMNs andmacrophages killed by the CHA strain undergo cell death by amechanism distinct from apoptosis.

TEM analysis of infected PMNs and macrophages. To fur-ther characterize the nature of phagocyte cell death mediated

FIG. 1. Cytotoxicity of P. aeruginosa strains CHA, CHA-D1, and CHA-D1(pDD2) toward J774 macrophages (A), B lymphocytes (B), and HeLa cells (C). Thepercent cytotoxicity was calculated from the release of LDH activity. Data are the means of at least three experiments. (D) J774 macrophages were infected with strainCHA or CHA-D1 (MOI, 10) and examined for morphological alterations by phase-contrast microscopy after 1 h.

FIG. 2. Growth-phase-dependent cytotoxicity of CHA on J774 macrophages.Bacterial culture was started at 0.1 OD600 unit (F). The percent cytotoxicity wascalculated from the release of LDH activity after 1 h (E) and 2 h ({) of infection.The experiment was repeated twice, and a representative experiment is shown.DO 600nm, optical density at 600 nm.

2918 DACHEUX ET AL. INFECT. IMMUN.


.org/D

ownloaded from

http://iai.asm.org/

by CHA, the ultra-structure of the infected cells was examinedby TEM. At 1 h after infection, when the LDH activity hadreached approximately 40%, cells were recovered by centrifu-gation and fixed as described in Materials and Methods. Cen-trifugation resulted in the recovery of fewer CHA-infectedcells than of control uninfected cells or even cells infected withthe CHA-D1 mutant, suggesting that CHA-induced cell lysishad occurred. Indeed, preparations of PMNs infected withCHA showed a marked background of cellular debris aroundthe cells, providing confirmation of the existence of consider-able cell lysis. CHA-infected PMNs that had not been lysedcontained internalized bacteria in numbers similar to those inPMNs infected with the noncytotoxic CHA-D1 mutant. How-ever, CHA-infected PMNs showed an unusual round morphol-ogy, with many fewer pseudopodia, compared to PMNs in-fected with CHA-D1. In addition to the visible cellular debris,in the CHA-infected PMN preparation 3 to 4% of the cellswere “ghosts,” with disintegrated plasma membranes, no visi-ble cytoplasm, and dispersed chromatin within the swollennuclei (Fig. 4B). These morphological changes provide addi-tional evidence that the death of PMNs induced by infectionwith CHA has none of the features of apoptosis but does havethose of oncosis. To further confirm the existence of this typeof cell death, PMNs were heated for 30 min at 56°C to provokeaccidental cell death. The heat-treated PMNs (Fig. 4D)showed the same morphological changes as did CHA-infectedPMNs. In contrast, PMNs in which apoptosis was induced byactinomycin D treatment were shrunken with condensed nu-clei, but the plasma membrane was intact. In this preparation,some of the cells underwent lysis but the chromatin still re-mained condensed.

To confirm the type of cell death in macrophages, we alsostudied the morphological consequences of CHA infection(Fig. 5). As with PMNs, CHA-infected macrophages showedthe characteristics of accidental cell death. The nucleus wasentire with dispersed chromatin, the plasma membrane wasabsent, and some vacuolization could be observed (Fig. 5B).

Most of the infected macrophages lacked pseudopodia,whereas these were common in the control cells. UV-treatedmacrophages that underwent either early or late apoptosisshowed all the features of classic apoptosis, with pronouncedchromatin condensation. In conclusion, the absence of DNAfragmentation, observations of Hoechst-stained nuclei, and theTEM studies have enabled us to demonstrate that CHA-in-duced cell death in phagocytes exhibits the features of oncosis.

CF clinical isolates. A total of 28 P. aeruginosa CF isolatescollected from different patients at the Centre Hospitalier Uni-versitaire, Grenoble, France, were obtained and tested fortheir ability to induce type III secretion-dependent and ExoU-independent cytotoxicity toward phagocytes. Strains weretested in parallel for the secretion of type III system proteins invitro (3) and the presence of exsA, as well as the genes exoS,exoT, exoY, and exoU, encoding the four known type III secre-tion effectors (Fig. 6). The strain CHA was included in thisstudy. Southern blot analysis of chromosomal DNA showedthat all strains except one, REN7, possess genes encoding thetranscriptional activator ExsA and the effectors ExoT, ExoS,and ExoY. The exoU-specific sequences were detected in onlythree CF isolates, CF16, CF17, and CF18, in accordance withprevious studies concerning strain variability in expression ofthe ExoU toxin (7, 14). SDS-PAGE profile analysis of proteinssecreted into culture media under inducing conditions showedthat eight (27.5%) of the isolates, CF1, CF6, CF11, CF12, T6,37.11, and REN0, as well as CHA, were able to secrete type IIIsecretion system proteins (ExoS, ExoT, PopB, and PopD).

In the cytotoxicity test with PMNs, five isolates, CF1, CF6,CF11, CF12, and REN0, were cytotoxic. These five strainswere also able to induce rapid oncosis of J774 macrophages,which was accompanied by cellular and nuclear swelling (datanot shown), the morphological changes observed during infec-tion of macrophages by the cytotoxic strain CHA. StrainsCF16, CF17, and CF18, which possess the exoU gene, wereunable to secrete in vitro and were noncytotoxic. To confirmthat the observed cytotoxicity of CF isolates was still due to a

FIG. 3. DNA fragmentation assays. (A) DNA was isolated from J774 macrophages or PMNs and migrated on a 1.5% agarose gel. Lanes: 1, ladder molecular sizemarkers; 2, uninfected J774; 3, CHA-infected J774; 4, CHA-D1-infected J774; 5, J774 treated by UV irradiation for 15 min; 6, uninfected PMNs; 7, CHA-infectedPMNs; 8, CHA-D1-infected PMNs; 9, PMNs treated with 50 mM actinomycin D for 5 h. (B) Nuclear morphology of PMNs. At 2 h after infection with the CHA strain,cells were stained with the DNA-specific fluorochrome Hoechst 33342. Uninfected cells showed polymorphic nuclei typical for normal PMNs isolated from bloodsamples. CHA cells exhibited rounded, uniformly stained, swollen nuclei. Apoptotic cells (UV treated) showed typical highly condensed and fragmented nuclei.Observations were done using epifluorescence microscopy (magnification, 31,000).



.org/D

ownloaded from

http://iai.asm.org/

type III secretion-mediated mechanism, as is the case forCHA, we constructed ExsA mutants in REN0 and CF1. Thesame construction used for inactivation of exsA in CHA wasused to construct REN0-D1 and CF1-D1 (3). Both theREN0-D1 and CF1-D1 mutants were unable to induce cyto-toxicity in PMNs and macrophages, with 9% 6 0.5% and10.5% 6 0.7% cytotoxicity, respectively. The complementedstrains REN0-D1(pDD2) and CF1-D1(pDD2) showed cyto-toxicity values of 78% 6 0.4% and 53% 6 5%, respectively,which are similar to the values obtained with parental strains.

Taken together, the analyses of different CF isolates showedthat (i) a significant proportion of CF isolates possess genes of

the type III secretion system, including exsA, exoS, exoT, andexoY; (ii) 8 out of 29 strains tested were able to secrete type IIIsecretion proteins in vitro; (iii) 6 strains were able to initiaterapid oncosis of phagocytes; and (iv) this phenotype was typeIII secretion dependent, but ExoU independent.

DISCUSSION

Many gram-negative pathogens use the type III secretionapparatus to deliver bacterial toxins directly to the host cellcytoplasm. It has been postulated that type III-dependent in-toxication, resulting in either interruption of eukaryotic signal

FIG. 4. Electron micrographs of PMNs. (A) Uninfected PMNs as a control. (B) PMNs 1 h after infection with the CHA strain, showing features of oncosis: dispersedchromatin within swollen nucleus, vacuolization, and absence of cell membrane. (C) PMNs 1 h after infection with the CHA-D1 strain. (D) PMNs heated for 30 minat 56°C, showing oncotic cell death morphology with the same profile as in the CHA-infected cells. (E and F) PMNs, treated with actinomycin D, showing either earlyapoptotic morphology with intense perinuclear chromatin aggregation but cytoplasm integrity (E) or late apoptotic morphology characterized by degenerated nuclei,where the chromatin is completely aggregated as in early apoptosis, but dissolution of the cytoplasm (F). The arrow indicates bacteria. Bars, 1 mm.



.org/D

ownloaded from

http://iai.asm.org/

transduction systems or host cell death, modifies host immuneresponses, thus allowing pathogen survival and multiplication(2).

In this work we have shown that a P. aeruginosa broncho-pulmonary isolate, CHA, from a CF patient induces rapid celldeath in professional phagocytes, PMNs, and macrophages inan ExoU-independent manner (with approximately 80% LDHrelease after 3 h of low-multiplicity infection). This rapid cy-totoxicity was dependent on the functional type III secretionsystem, since a CHA isogenic mutant, CHA-D1, containing theinactivated exsA gene is noncytotoxic. The rapid induction ofcell death was associated with bacteria grown to the late ex-

ponential phase, and a significant delay in cytotoxicity wasobserved when a stationary-phase culture was used for infec-tion. In contrast to CHA-infected macrophages and PMNs, Blymphocytes and epithelial HeLa cells start to die only after aprolonged infection of up to 6 h, indicating that there is somecell type specificity in type III system-mediated intoxication.Indeed, the differential sensitivity of epithelial cells to theaction of type III-secreted ExoS has been attributed to intrinsiccellular properties (19).

Two distinct modes of eukaryotic cell death may be identi-fied by morphological and biochemical changes. Apoptosis,also called cell death by suicide or programmed cell death, is

FIG. 5. Electron micrographs of J774 cells. (A) Uninfected J774 cells as a control. (B) J774 cells 1 h after infection with CHA, showing oncotic morphology:flocculation of the chromatin, dissolution of the cytoplasm, and swollen nuclei. (C) J774 cells 1 h after infection with the CHA-D1 strain. (D and E) J774 cells treatedby UV-irradiation showing either early apoptotic morphology with intense perinuclear chromatin aggregation but cytoplasm integrity (D) or late apoptotic morphologywith the nucleus having the same profile as in early apoptosis but dissolution of the cytoplasm (E). The arrow indicates bacteria. Bars, 2 mm.



.org/D

ownloaded from

http://iai.asm.org/

characterized morphologically by a decrease in cellular sizeand by condensation of the chromatin into “half-moon” shapeswithin shrunken nuclei. In most but not all cases of apoptosis,the chromatin is degraded, yielding 200-bp oligosomal DNA.Cellular and nuclear swelling, blebbing, vacuolization, and dis-integration of the cell membrane accompany the second typeof cell death, known as “accidental” cell death. The term “on-cosis” (derived from oncos, meaning swelling) has beenadopted to describe this form of cell death (16).

We have clearly demonstrated that phagocytes infected withthe CHA strain die by a process distinct from apoptosis. Thishas been confirmed not only by the absence of DNA fragmen-tation, but also by Hoechst staining and electron microscopyobservations of infected PMNs and macrophages. The mode ofcell death in both cell types is identical, with several features ofoncosis, such as nuclear and cellular swelling and loss of mem-brane integrity, which results in dissolution of cellular cyto-plasm.

The mechanism by which phagocytes are killed by the CFstrain is unknown. The fact that cytotoxicity is dependent onthe functional ExsA regulator suggests that a type III secretedeffector(s) may be responsible. ExsA controls the synthesis oftype III secretion proteins and the translocation machinery (9),as well as the expression of four genes encoding P. aeruginosatype III secreted cytotoxins. Studies of the activity of ExoS andExoT have shown that these effectors induce actin cytoskeletonrearrangements (10) and provoke visible morphologicalchanges in eukaryotic cells, including cell rounding and ab-sence of microvilli (25, 32). Our observations concerning theabsence of pseudopods on cells exposed to CHA indicate thatExoS and ExoT might play some role in phagocyte intoxica-tion. However, an ExoS-deficient mutant had the same kineticsof cytotoxicity as did the parental strain, CHA (data notshown), in agreement with published data showing that ExoSand ExoT were never associated with rapid cell death (2 h ofinfection). Similarly, the expression of ExoY, an adenylatecyclase, leads to pronounced morphological changes in epithe-lial CHO and HeLa cells but not to cellular death (32, 35). The

only type III effector that is synthesized by some clinical iso-lates and is able to provoke rapid cell death in eukaryotic cellsis ExoU (7, 14), but the genome of the CHA strain does notcontain exoU.

Two recent reports describe the ExoU-independent acutecytotoxicity of P. aeruginosa strains toward cultured cells.Hauser and Engel (13) showed that the exoU isogenic mutantof PA103 was capable of inducing apoptosis in macrophagesand some epithelial cells at a high MOI of 160 and after a longincubation (6 h of infection). The authors suggest the presenceof a novel type III secreted toxin. While the present work wasin progress, Coburn and Frank (1) reported the ExoU-inde-pendent killing of bone marrow-derived macrophages fromA/J mice by P. aeruginosa strain 388 at a low MOI. Similarly tothe effects of CHA toward the HeLa epithelial cell line, strain388 provoked morphological changes in the lung carcinoma-derived A549 cell line without causing significant cell death.Although the type of 388-induced cell death in macrophageshas not yet been described, it is possible that strains CHA and388 use the same mechanism of macrophage killing.

Our survey of 29 P. aeruginosa strains (including the CHAstrain) isolated from different CF patients shows that theExoU-independent rapid induction of phagocyte cell death is aphenotype associated with approximately 21% of CF isolates.The cell death of phagocytes induced by CF isolates was char-acterized as oncosis, with the same features as described forthe CHA strain. This process seems to be, in all cases, type IIIsecretion dependent, since cytotoxic activity was completelyabolished in two exsA mutants of cytotoxic isolates (CF1-D1and REN0-D1). Southern blot analysis showed that only 3 of29 isolates contain the ExoU-encoding gene, suggesting thatexoU is the main variable trait in CF isolates. It is important tonote that ExoU is expressed in most isolates from cornealinfections (7) but is present in only few strains isolated frompatients with acute pneumonia (14). In contrast to corneal P.aeruginosa isolates (8), in the P. aeruginosa CF population, 28out of 29 isolates that possess exsA are also able to encodeExoS. However, although the exsA-regulated genes encoding

FIG. 6. Distribution of the exsA and exoU genotypes, in vitro type III secretion ability, and cytotoxicity to PMNs of 29 P. aeruginosa CF isolates. (A) Percentcytotoxicity calculated from the release of LDH activity. (B) In vitro induction of the type III secretion system, measured by SDS-PAGE analysis of culture supernatants.(C) Southern blot analysis of chromosomal DNAs after digestion with EcoRI. The restriction fragment length polymorphism encountered in exoU-containing strains(CF16, CF17, and CF18) is shown. Molecular sizes markers are indicated on the right.



.org/D

ownloaded from

http://iai.asm.org/

type III system-secreted effectors are present, only eight iso-lates show functional type III secretion, as indicated by in vitrosecretion of ExoS, ExoT, PopB, and PopD (data not shown).Of the eight strains able to secrete type III system proteins invitro, six are cytotoxic, suggesting that a functional type IIIsecretion is necessary but not sufficient to induce acute injuryof macrophages and PMNs. It is possible that in two intoxica-tion-negative strains (T6 and 37.11) the translocation complex,necessary for delivery of type III effectors, is not functional inour cellular model of infection. In addition, we cannot excludethe possibility that type III secretion-dependent intoxicationoccurs in vivo even with strains that are secretion deficient andnoncytotoxic in vitro. There may exist specific conditions dur-ing CF infections that allow the expression of type III secretiongenes and hence the occurrence of the cytotoxic phenotype.

Our results, together with reports from other laboratories,show that P. aeruginosa strains have developed versatile mech-anisms for host cell intoxication. This may be due to differentcombinations of toxin genes present in clinical isolates and/orthe differential expression of certain genes, depending on thecell type and growth conditions. The variety of type III system-induced phenotypes of P. aeruginosa isolates may explain, inpart, the ability of this opportunistic pathogen to cause differ-ent types of infections, including severe chronic respiratoryinfection in CF patients.

The rapid oncosis of professional phagocytes by cytotoxic P.aeruginosa might be an important strategy for pathogen sur-vival. Indeed, we have shown that the cytotoxic CHA strain andisogenic noncytotoxic mutant are equally well ingested byPMNs and macrophages. However, only the cytotoxic strain isable to escape the bactericidal activity and to multiply (3). InCF patients, chronic respiratory infections and associated hostinflammatory responses are the leading cause of morbidity andmortality. There are reports of an excessive influx of phago-cytes (mostly PMNs) at the site of infection (17), which areunable to eliminate bacteria. In contrast, PMNs show an un-controlled release of toxic mediators, contributing to wide-spread tissue destruction (4, 27). This work, which shows thatCF clinical isolates are able to induce type III-dependent on-cotic cell death in phagocytes, will be followed by experimentsin animal models of P. aeruginosa infection to find whether thisphenotype contributes to the virulence of the pathogen and thepersistence of the infection.

ACKNOWLEDGMENTS

This work was supported by grants 97044 and 98033 from the As-sociation Francaise de Lutte contre la Mucoviscidose (AFLM).

We thank J. Chabert and L. Quenee for technical assistance, J. M.Meyer for CF clinical isolates (T6, 37.11 and K569), J. Plumas forhuman macrophages, J. Garin and S. Kieffer (Laboratoire de Chimiedes Proteines, DBMS, CEA, Grenoble) for mass spectrometry analy-sis, and A. Chapel for J774 macrophages. Thanks are due to A. Col-beau, W. Dischert, and O. Attree for helpful discussions and criticalreading of the manuscript.

REFERENCES

1. Coburn, J., and D. W. Frank. 1999. Macrophages and epithelial cells responddifferently to the Pseudomonas aeruginosa type III secretion system. Infect.Immun. 67:3151–3154.

2. Cornelis, G. R., A. Boland, A. P. Boyd, C. Geuijen, M. Iriarte, C. Neyt, M. P.Sory, and I. Stainier. 1998. The virulence plasmid of Yersinia, an antihostgenome. Microbiol. Mol. Biol. Rev. 62:1315–1352.

3. Dacheux, D., I. Attree, C. Schneider, and B. Toussaint. 1999. Cell death ofhuman polymorphonuclear neutrophils induced by a Pseudomonas aerugi-nosa cystic fibrosis isolate requires a functional type III secretion system.Infect. Immun. 67:6164–6167.

4. Elborn, J. S., and D. J. Shale. 1990. Lung injury in cystic fibrosis. Thorax45:970–973.

5. Fernandez-Prada, C., B. D. Tall, S. E. Elliott, D. L. Hoover, J. P. Nataro, andM. M. Venkatesan. 1998. Hemolysin-positive enteroaggregative and cell-detaching Escherichia coli strains cause oncosis of human monocyte-derivedmacrophages and apoptosis of murine J774 cells. Infect. Immun. 66:3918–3924.

6. Fernandez-Prada, C. M., D. L. Hoover, B. D. Tall, and M. M. Venkatesan.1997. Human monocyte-derived macrophages infected with virulent Shigellaflexneri in vitro undergo a rapid cytolytic event similar to oncosis but notapoptosis. Infect. Immun. 65:1486–1496.

7. Finck-Barbancon, V., J. Goranson, L. Zhu, T. Sawa, J. P. Wiener-Kronish,S. M. Fleiszig, C. Wu, L. Mende-Mueller, and D. W. Frank. 1997. ExoUexpression by Pseudomonas aeruginosa correlates with acute cytotoxicity andepithelial injury. Mol. Microbiol. 25:547–557.

8. Fleiszig, S. M., J. P. Wiener-Kronish, H. Miyazaki, V. Vallas, K. E. Mostov,D. Kanada, T. Sawa, T. S. Yen, and D. W. Frank. 1997. Pseudomonasaeruginosa-mediated cytotoxicity and invasion correlate with distinct geno-types at the loci encoding exoenzyme S. Infect. Immun. 65:579–586.

9. Frank, D. W. 1997. The exoenzyme S regulon of Pseudomonas aeruginosa.Mol. Microbiol. 26:621–629.

10. Frithz-Lindsten, E., Y. Du, R. Rosqvist, and A. Forsberg. 1997. Intracellulartargeting of exoenzyme S of Pseudomonas aeruginosa via type III-dependenttranslocation induces phagocytosis resistance, cytotoxicity and disruption ofactin microfilaments. Mol. Microbiol. 25:1125–1139.

11. Galan, J. E. 1999. Interaction of Salmonella with host cells through thecentisome 63 type III secretion system. Curr. Opin. Microbiol. 2:46–50.

12. Galan, J. E., and A. Collmer. 1999. Type III secretion machines: bacterialdevices for protein delivery into host cells. Science 284:1322–1328.

13. Hauser, A. R., and J. N. Engel. 1999. Pseudomonas aeruginosa inducestype-III-secretion-mediated apoptosis of macrophages and epithelial cells.Infect. Immun. 67:5530–5537.

14. Hauser, A. R., P. J. Kang, and J. N. Engel. 1998. PepA, a secreted protein ofPseudomonas aeruginosa, is necessary for cytotoxicity and virulence. Mol.Microbiol. 27:807–818.

15. Hersh, D., D. M. Monack, M. R. Smith, N. Ghori, S. Falkow, and A. Zych-linsky. 1999. The Salmonella invasin SipB induces macrophage apoptosis bybinding to caspase-1. Proc. Natl. Acad. Sci. USA 96:2396–2401.

16. Majno, G., and I. Joris. 1995. Apoptosis, oncosis, and necrosis. An overviewof cell death. Am. J. Pathol. 146:3–15.

17. McElvaney, N. G., H. Nakamura, P. Birrer, C. A. Hebert, W. L. Wong, M.Alphonso, J. B. Baker, M. A. Catalano, and R. G. Crystal. 1992. Modulationof airway inflammation in cystic fibrosis. In vivo suppression of interleukin-8levels on the respiratory epithelial surface by aerosolization of recombinantsecretory leukoprotease inhibitor. J. Clin. Investig. 90:1296–1301.

18. McGuffie, E. M., D. W. Frank, T. S. Vincent, and J. C. Olson. 1998. Modi-fication of Ras in eukaryotic cells by Pseudomonas aeruginosa exoenzyme S.Infect. Immun. 66:2607–2613.

19. McGuffie, E. M., J. E. Fraylick, D. J. Hazen-Martin, T. S. Vincent, and J. C.Olson. 1999. Differential sensitivity of human epithelial cells to Pseudomonasaeruginosa exoenzyme S. Infect. Immun. 67:3494–3503.

20. Menard, R., C. Dehio, and P. J. Sansonetti. 1996. Bacterial entry intoepithelial cells: the paradigm of Shigella. Trends Microbiol. 4:220–226.

21. Mills, S. D., A. Boland, M. P. Sory, P. van der Smissen, C. Kerbourch, B. B.Finlay, and G. R. Cornelis. 1997. Yersinia enterocolitica induces apoptosis inmacrophages by a process requiring functional type III secretion and trans-location mechanisms and involving YopP, presumably acting as an effectorprotein. Proc. Natl. Acad. Sci. USA 94:12638–12643.

22. Monack, D. M., B. Raupach, A. E. Hromockyj, and S. Falkow. 1996. Salmo-nella typhimurium invasion induces apoptosis in infected macrophages. Proc.Natl. Acad. Sci. USA 93:9833–9838.

23. Nonaka, T., A. Kuwae, C. Sasakawa, and S. Imajoh-Ohmi. 1999. Shigellaflexneri YSH6000 induces two types of cell death, apoptosis and oncosis, inthe differentiated human monoblastic cell line U937. FEMS Microbiol. Lett.174:89–95.

24. Olson, J. C., J. E. Fraylick, E. M. McGuffie, K. M. Dolan, T. L. Yahr, D. W.Frank, and T. S. Vincent. 1999. Interruption of multiple cellular processes inHT-29 epithelial cells by Pseudomonas aeruginosa exoenzyme S. Infect. Im-mun. 67:2847–2854.

25. Olson, J. C., E. M. McGuffie, and D. W. Frank. 1997. Effects of differentialexpression of the 49-kilodalton exoenzyme S by Pseudomonas aeruginosa oncultured eukaryotic cells. Infect. Immun. 65:248–256.

26. Pederson, K. J., A. J. Vallis, K. Aktories, D. W. Frank, and J. T. Barbieri.1999. The amino-terminal domain of Pseudomonas aeruginosa ExoS disruptsactin filaments via small-molecular-weight GTP-binding proteins. Mol. Mi-crobiol. 32:393–401.

27. Pier, G. B. 1998. Pseudomonas aeruginosa: a key problem in cystic fibrosis.ASM News 64:339–347.

28. Salyers, A. A., and D. D. Whitt. 1994. Bacterial pathogenesis: a molecularapproach. ASM Press, Washington, D.C.

29. Sawa, T., T. L. Yahr, M. Ohara, K. Kurahashi, M. A. Gropper, J. P. Wiener-Kronish, and D. W. Frank. 1999. Active and passive immunization with thePseudomonas V antigen protects against type III intoxication and lung injury.Nat. Med. 5:392–398.



.org/D

ownloaded from

http://iai.asm.org/

30. Tilly, J. L., and A. J. Hsueh. 1993. Microscale autoradiographic method forthe qualitative and quantitative analysis of apoptotic DNA fragmentation.J. Cell. Physiol. 154:519–526.

31. Toussaint, B., I. Delic-Attree, and P. M. Vignais. 1993. Pseudomonas aerugi-nosa contains an IHF-like protein that binds to the algD promoter. Biochem.Biophys. Res. Commun. 196:416–421.

32. Vallis, A. J., V. Finck-Barbancon, T. L. Yahr, and D. W. Frank. 1999.Biological effects of Pseudomonas aeruginosa type III-secreted proteins onCHO cells. Infect. Immun. 67:2040–2044.

33. Yahr, T. L., J. T. Barbieri, and D. W. Frank. 1996. Genetic relationshipbetween the 53- and 49-kilodalton forms of exoenzyme S from Pseudomonasaeruginosa. J. Bacteriol. 178:1412–1419.

34. Yahr, T. L., A. K. Hovey, S. M. Kulich, and D. W. Frank. 1995. Transcrip-tional analysis of the Pseudomonas aeruginosa exoenzyme S structural gene.J. Bacteriol. 177:1169–1178.

35. Yahr, T. L., A. J. Vallis, M. K. Hancock, J. T. Barbieri, and D. W. Frank.1998. ExoY, an adenylate cyclase secreted by the Pseudomonas aeruginosatype III system. Proc. Natl. Acad. Sci. USA 95:13899–13904.

Editor: E. I. Tuomanen



.org/D

ownloaded from

http://iai.asm.org/

Documents

Pseudomonas aeruginosa Cystic Fibrosis Isolates Induce ...Apoptosis assays. (i) DNA fragmentation assay. DNA was isolated from eu-karyotic cells as described previously (30), quantiﬁed,