Upload
nailah
View
34
Download
3
Tags:
Embed Size (px)
DESCRIPTION
Promoting fungi in the DNA barcoding movement. Keith A. Seifert 1 , Ursula Eberhardt 2 , Conrad L. Schoch 3 1 Biodiversity, Agriculture & Agri-Food Canada, Ottawa, Ontario 2 CBS Fungal Diversity Centre, Utrecht, the Netherlands - PowerPoint PPT Presentation
Citation preview
Keith A. Seifert1 , Ursula Eberhardt2 , Conrad L. Schoch3
1Biodiversity, Agriculture & Agri-Food Canada, Ottawa, Ontario2 CBS Fungal Diversity Centre, Utrecht, the Netherlands
3 National Centre for Biotechnology Information, Bethesda, MD (GenBank)
Promoting fungi in the DNA barcoding movement
MSA symposium 2010
Politics!
1:00 Advances in DNA barcoding for fungi. Conrad L. Schoch, Keith A. SeifertSpecific Genes
1:30 DNA barcoding using cytochrome c oxidase I (COI): A valuable addition to oomycete molecular taxonomy. Gregg Robideau et al.
2:00 Barcoding the Yeasts – Which Genes? Cletus P. Kurtzman2:30 Coffee Break
Applications
3:00 Barcoding the Dothideomycetes and Sordariomycetes. Andy N. Miller3:30 Barcoding agaric fungi in the Great Smoky Mountains National Park: What have we learned?
Karen W. Hughes et al.
4:00 Challenges and successes in ITS barcoding of fungal communities in Alaskan boreal forest soil. L. Taylor
4:30 Discussion
Aftermath
A chat over beer
IMC Symposium U5 – Fungal BarcodingChairs: Ursula Eberhardt & Keith Seifert
Promoting fungi in the DNA barcoding movement KA Seifert*, U Eberhardt, CL Schoch
Practice towards DNA barcoding of the nectriaceous fungi P. Zhao, J. Luo, W.-Y. Zhuang*
DNA Barcoding of the mycobiota in indoor environments R A Samson*
The ITS region as barcoding for medical fungi W Meyer*, C Serena, S Chen, M Arabatzis, A Velegraki
DNA barcoding of arbuscular mycorrhizal fungi (Glomeromycota) A. Schuessler*, H. Stockinger, M. Krueger
DNA barcoding of fungal endophytes from a Eucalyptus grandis tree in South AfricaK Pillay, M Gryzenhout*, B Slippers, MJ Wingfield
QBOL - Barcoding organisms of quarantine importance to Europe J.Z. Groenewald*, W. Quaedvlieg, P.J.M. Bonants, N. Boonham, P.W. Crous
Overview
– The politics of DNA barcoding.– What happened to cox1?– Should ITS be the official Fungal Barcode?– Data standards for the barcode keyword.– Data resources for DNA barcoding.– International barcoding projects
Our goal: Motivate mycological participation in DNA barcoding!– Formalize the fungal barcode.– Establish Fungal Working Group– Develop new fungal barcoding projects.– Participate in multi-kingdom projects.
“DNA, you know, is Midas’ gold. Everybody who touches it goes mad.” Maurice Wilkins, quoted in The Eighth Day of Creation
What is DNA barcoding?
Pre-2002 (or whenever)
1. Pileus comex to comparmulate, lemellae ascending-adnote, peleipellis of clonate cells, chilocystidia ventruiore to eubryludinal, basidiospores with pronviant apical gum pore .……………………………………………………………………………………….Panaeolus mallochii
2. Pileus glalions to finely primrose, lemellae dark blocked umpher, peleipellis hymenform, cheilocystidia a continuous timule margin, bandospins conspeniously compressed ………………………………………………………………………………….. Panaeolus summerbellii
Post-2002 (or whenever)
1. CATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAATAAACTGGGTGGGTTGTTGCTGTCCCTCTCGGGGGAACTGTGCACGCCTTACCTTTTTTGTTTTTCCACCTGTGAA ………………………………………………………Panaeolus mallochii
2. CATTATTGAATAAACTTGGTTAGGTTGCTGCTGGCTCCTTGGAGCATGTGCACACCTAGCACCNTTTTTACCACCTGTGCACCCTTTGTAGACCTGGATACCTCTCGAGGAAACTCGGTTTGAGGAC ………………………………………………………………………………. Panaeolus summerbellii OR
1. …………………………………..……………………………………………………Panaeolus mallochii2. ….………………………………………………………………………………. Panaeolus
summerbellii
Trichocladium asperum Humicola grisea
Consortium for the Barcode of Life (CBOL) • Regulates the ‘barcode’ keyword for GenBank• Organization
– Secretariat• Smithsonian Institution, Washington, D.C., USA• 5 people
– Executive Committee• 7 members, including Pedro Crous
– Implementation Board• 19 members, including Conrad Schoch
– Members• 200 Member Organizations, 50 countries• Natural history museums, biodiversity organizations• Users: e.g., government agencies• Private sector biotech companies, database providers
• Facilitates barcoding but does not fund research
www.barcodeoflife.org
The Barcode Keyword in GenBankThe Barcode Data Standard
• Sequence records with… – Voucher specimens– On-line metadata– Reliable standard of taxonomic identification– Agreed gene region
• sanctioned by peer review by CBOL Implementation Board– Sequence traces
• Identification of unknowns of ALL kingdoms (except bacteria)– GenBank– Barcode of Life Database (BOLD)
What is DNA Barcoding? Part 2.
• All Kingdoms, All Species, One gene (or two or three genes?)(or two or three genes?)• The purpose is identification … NOT phylogeny• In animals, the barcode gene is cytochrome oxidase 1 (cox1 or CO1)
• A single copy mitochondrial gene, AT rich• 648 bp region is the core for animals
• In plants, the barcode genes are matK and rbcL – Hollingsworth et al., 2009, PNAS 106: 12794–12797, 2009.
• In fungi, the barcode gene has not been formalized – By default it is cox1 until an alternative is accepted
Barcode
• Big science– More than $100,000,000
• Biodiversity Institute of Ontario (Guelph)
• Netherlands Centre for Biodiversity
Naturalis (Leiden) – € 30 million
• High throughput sequencing– Near genome centre volumes– Immediate data release policy (based
on public genome model) is controversial
– Primer mixes often used for PCR– M13 tagged sequencing primers– Data release papers
What is DNA Barcoding? Part 3.
• Taxon specific ‘campaigns’• Development of multikingdom databases
– For use by all scientists and the public… not just mycologists• Multi-kingdom projects
– QBOL – Quarantine Barcode of Life• Ecological projects
– IM-Bol Indoor Mycota Barcode of Life• Geographic Projects
– Moorea
What is DNA Barcoding? Part 4.
mooreabiocode.org
www.barcodingbirds.org
www.fishbol.org
www.lepbarcoding.org
Barcode of Life Database – BOLDwww.boldsystems.org Mirrored in China, negotiations with ECBol, Australia, Mexico
•Accepts ITS sequences as barcodes•Submission open to anyone•Few fungal sequences•Spreadsheets for metadata
• No specific fungal format
• Process can be tedious
•Images of specimens•Descriptions•‘Automated’ GenBank submission
Barcode Submission Tool www.ncbi.nlm.nih.gov/WebSub/index.cgi?tool=barcode
•Familiar submission process•Trace archive available
www.ncbi.nlm.nih.gov/Traces/home/
•ITS sequences not yet accepted as barcodes•Submission open to anyone•Few fungal barcode sequences are now cox1•Metadata must be stored off-site
RefSeq Targeted Loci
• Bacteria: all type sequences• Fungi: 200 sequences from AFToL, 28S, 18S, just beginning
INSD(International Nucleotide Sequence Databases)
DDBJEMBLGenBank
submission
selection & some curation(NCBI)
RefSeq
model organismsreference organismsgenomic level
16S rRNA*other molecular markersother RNAs
www.ncbi.nlm.nih.gov/RefSeq/
GenBank RefSeq
Not curated Curated
Author submits NCBI creates from existing data
Only author can revise NCBI revises as new data emerge
Multiple records for same loci common Single records for each molecule of major organisms
Records can contradict each other
Data exchanged among INSDC members Exclusive NCBI database
Akin to primary literature Akin to review articles
RefSeq Accession #
Additional references
RefSeq references
Expanded qualifiers
Project number
Criticisms of DNA Barcoding
• Not science (or bad science)
• A threat to classical taxonomy• Removes funding from
classical taxonomy• Standardization of markers Standardization of markers
impossibleimpossible
• Oversimplifies delimiting Oversimplifies delimiting speciesspecies
• It is not phylogeny• Distrust and questioning of
CBOL’s mandate• National prideNational pride• Disciplinary prideDisciplinary pride
www.ibolproject.org
iBOL Member Nations
Each central node should have a high-throughput DNA barcoding facility
Now Canada US France PolandScientific Steering Committee (mycologists): Pedro Crous, Keith Seifert
ECBOL- European Consortium for the Barcode of LifeMission: To unleash the potential of European expertise and collections to
contribute towards identifying life on earth.• Plan: • Establish a Network of European Leading Laboratories (NELL)• Formalise National DNA barcoding campaigns in each European country• Establish new projects and barcoding campaigns, • Functioning as the European node for international initiatives such as iBOL
Participating countries: Belgium, Finland, France, Germany, Italy, Lithuania, Netherlands, Norway, Poland, Portugal, Spain, Switzerland, U.K.
www.ecbol.org
ECBOL2 meetingECBOL2 meetingJune 2010, Braga, PortugalJune 2010, Braga, Portugal Lorenzo Lombard
Selecting barcode genes• International Nucleotide Sequence Database Collaboration
– INSDC, GenBank, the European Molecular Biology Laboratory and the DNA Data Bank of Japan
– CBOL Implementation Board decides by peer review which gene regions receive BARCODE status
• Possible reasons for rejection of cox1– PCR problems (amplification or primer problems)– Patterns of inter- and infraspecific variation– Resolving power
• Selection of new genes– Patterns of inter- and infraspecific variation– Prefer a ‘barcode’ gap– Universality of primer pair etc.
Comparison of barcodes in Oomycetes (250 species)
ITS cox1 LSU
Per
cen
t o
f st
rain
sw
ith
in s
pec
ies
b
etw
een
sp
ecie
s
Average pairwise distance
n=375n= 1179 n=1179
Min 0Mean 0.297Max 0.539
Min 0Mean 0.004Max 0.062
Min 0Mean 0.102Max 0.307
Min 0Mean 0.098Max 0.201
Min 0Mean 0.004Max 0.037
Min 0Mean 0.002Max 0.037
Courtesy Gregg Robideau & André Lévesque
cox1cox1 Barcoding of Barcoding of Eumycota & OomycotaEumycota & Oomycota
0 introns1 intron2 introns3 introns7 introns
Species resolutionin Penicillium
cox1 67.1 %B-tub 81.2 %ITS 24.5 %
F. oxysporum genome 1 F. circinatum DAOM235753
F. sacchari DAOM 235795 F. verticillioides genome **F. circinatum DAOM 235752 b1
F. graminearum DAOM 235800F. graminearum DAOM 235624F. circinatum DAOM 235752 b5
F. oxysporum genome 2
3 spp./3 major clades. Identical barcodes.
Fusarium. Low resolution.Multiple copies.
All Fungi Barcode of Life Planning Workshop
Rossman, AY. 2007. Report of the Planning Workshop for All Fungi DNA Barcoding. Inoculum 58(6): 1-5.
Smithsonian Conservation and Research CenterFront Royal, Virginia
13-15 May 2007
Zasmidium nocoxi Crous
The ITS reality… Hurray!
• Large reference database – most not barcode data standard compliant
• Robust primers• Strong demand from many mycologists that this be the
fungal barcode– Especially ecologists studying environmental metagenomics
The ITS Reality – BOO!
• Multiple copies within species – At this conference… – Dan Lindner – Laetiporus, this conference– Uwe Simon & M. Weiss – Ascomycetes– Of concern for cloning based and metagenomic studies
wanting to use barcode ID databases• Serious lack of resolution in Ascomycetes
– Possibly too short – 500-700 bp optimum barcode but subtract 150 bp 5.8S…
• Chimera problems for some methodological approaches
Fungi
Dikarya
per
net
TEF
RPB2
RPB1
TEF
RPB2RPB1
The Ascomycete Barcode Problem
• ITS (and cox1) lack resolution in many groups
• A second barcode is needed– TEF1-α– RPB1 or RPB2– Mcm7
Schmitt et al. 2009. Persoonia 23: 35-40.
– FG1565– MS204– FG1093
• V. Robert @ CBS/ C. Lewis @ AAFC
• Ascomycete Barcode Working Subgroup?
Courtesy J. Spatafora
ActionEstablish Fungal DNA Barcoding Working Group• Chair: Conrad Schoch• International Membership• 10-15 members• Establish Ascomycete subgroup (or other subgroups?)Establish Working Plan
• Prepare Fungal Barcoding proposal• For peer reviewed publication• For CBOL implementation board approval
• CBOL will support meetings of WG as necessary
Possible approaches
• Volunteers needed for Fungal Working Group• Collaborators to provide data
• Mine data from existing publications
• Collaborators to provide DNA• Multiple strains per species• Multiple species per genus
• Authorship open to all who contribute• AFTOL model
• Sequencing of other markers • part of main proposal• or as separate activity• CBOL agreement with Life Tech
CONTACT: Conrad Schoch:
Fungal DNA Barcoding – Proposed Proposal
• General Barcode for Fungi– rDNA internal transcribed spacer (ITS)
• Secondary barcodes– Yeasts
• rDNA large subunit (28S, LSU) D2 region
– Ascomycetes• Second barcode required, subsequent proposal
• Oomycetes– A separate proposal– Data on ITS, cox1 and LSU now being prepared for publication– 2 barcode system
• rDNA internal transcribed space (ITS)• rDNA large subunit (28S, LSU) D2 region
• Other groups?
CBOL Implementation BoardPeer review of barcode marker proposals
Chairs• Robert Hanner, University of Guelph, Databases • Peter Hollingsworth, Royal Botanic Gardens Edinburgh, Plant WG • Line Le Gall, Muséum National d’Histoire Naturelle, Paris; Protist WG• Neil Sarkar, Marine Biol. Lab., Woods Hole, MA; Data analysis WG• Conrad Schoch, NCBI, GenBank Taxonomy, Fungal WG • Lee Weigt, Smithsonian Inst., Washington, DC; Leading Lab Network
CBOL Campaign and Project Leaders• George Amato, American Museum of Natural History, Conservation • Damon Little, NY Botanical Garden, TreeBOL • Marc De Meyer, Royal Mus. Central Africa, Belgium; Tephritid Barcoding Initiative • Yvonne Linton, NHM, London; Mosquito Barcoding Initiative • Dirk Steinke, University of Guelph, MarBOL • Mark Stoeckle, Rockefeller University, ABBI • Pablo Luis Tubaro, Museum of Natural Sciences, Argentina, ABBI
Liaisons for Associated Initiatives• Paul De Barro, CSIRO Agriculture Australia, invasive species • Scott Federhen, NCBI, GenBank Taxonomy • Paul Hebert, University of Guelph, iBOL • Daniel Masiga, ICIPE, Nairobi, Kenya, East Africa • Chris Meyer, Smithsonian Institution, Washington, Moorea/BioCode• Sujeevan Ratnasingham, Biodiversity Institute of Ontario, BOLD
Taxonomic group # spp. Volunteers for data
Pezizomycotina 60 000
Saccharomycotina 1000
Taphrinomycotina 150
Agaricomycotina 21 000
Ustilaginomycotina 1700
Pucciniomycotina 8300
Glomeromycotina 170
Mucoromycotina 325
Kickxellomycotina 265
Zoopagomycotina 190
Entomophthoromycotina 275
Blastocladiomycotina 180
Chytridiomycotina 700
Neocallimastigomycotina 20
Microsporidia 1300
Rozella 22
Keith Seifert: [email protected] Ursula Eberhardt: [email protected]
Conrad Schoch: [email protected]
www.lepbarcoding.org
www.fishbol.orgwww.barcodingbirds.org
Websites
www.ecbol.org
www.qbol.org
www.barcodeoflife.org
www.ibolproject.org www.boldsystems.orgThanks for images:Pedro CrousAndré Lévesque & Gregg RobideauJoey Spatafora