Analytical Biochemistry 422 (2012) 89–95

Contents lists available at SciVerse ScienceDirect

Analytical Biochemistry

journal homepage: www.elsevier .com/locate /yabio

PrimRglo: A multiplexable quantitative real-time polymerase chain reactionsystem for nucleic acid detection

Richard Lai a,b, Fang Liang b, Darnley Pearson a, Graeme Barnett a, David Whiley c, Theo Sloots c,Ross T. Barnard b,⇑, Simon R. Corrie d

a Biochip Innovations, Mount Gravatt, Queensland 4122, Australiab School of Chemistry and Molecular Biosciences, Australian Infectious Disease Research Centre, University of Queensland, St. Lucia, Queensland 4072, Australiac Clinical Virology Research Unit, Sir Albert Sakzewski Virus Research Centre, Royal Children’s Hospital and Health Service District, Herston, Queensland 4029, Australiad Australian Institute for Bioengineering and Nanotechnology, University of Queensland, St. Lucia, Queensland 4072, Australia

a r t i c l e i n f o

Article history:Received 9 October 2011Received in revised form 26 December 2011Accepted 26 December 2011Available online 4 January 2012

Keywords:QuantitativeReal timePolymerase chain reactionMultiplex

0003-2697/$ - see front matter � 2012 Elsevier Inc. Adoi:10.1016/j.ab.2011.12.038

⇑ Corresponding author. Fax: +61 7 33654299.E-mail address: rossbarnard@uq.edu.au (R.T. Barna

1 Abbreviations used: PCR, polymerase chain reactioSASVRC, Sir Albert Sakzewski Virus Research Centre; C

a b s t r a c t

We report the development of a new real-time polymerase chain reaction (PCR) detection system thatuses oligonucleotide ‘‘tagged’’ PCR primers, a fluorophore-labeled ‘‘universal’’ detection oligonucleotides,and a complementary quenching oligonucleotide. The fluorescence signal decreases as PCR product accu-mulates due to the increase in detection/quencher hybrid formation as the tagged primer is consumed.We use plasmids containing the influenza A matrix gene and the porA and ctrA genes of Neisseria menin-gitidis as targets for developing the system. Cycle threshold (Ct) values were generated, and the sensitivityof the new system (dubbed ‘‘PrimRglo’’) compared favorably with the commonly used SYBR green andTaqman detection systems and, unlike the latter system, does not require the design of a new dual-labeled detection oligonucleotide for each new target sequence.

� 2012 Elsevier Inc. All rights reserved.

Polymerase chain reaction (PCR)1 has become an indispensabletool of molecular biology and diagnostics. Traditional end-pointPCR is based on amplification of a specific DNA molecule by a ther-mocycling process, using DNA polymerase and oligonucleotide prim-ers [1], followed by qualitative or semiquantitative analysis of thefinal amplified product. Adaptation of end-point PCR to quantify tar-get nucleic acid is difficult because by the end of the reaction,depending on the initial concentration of template, the reactionmay have passed its exponential phase and reached a plateau [2].Real-time PCR was introduced to overcome the quantitative analysislimitations of the end-point PCR method. Compared with the con-ventional end-point PCR method, real-time PCR measures the incor-poration of a fluorescent probe into the amplification product duringPCR cycles, producing an increased fluorescence intensity over time.This allows the kinetic measurement of PCR product accumulation[2]. The real-time PCR assay has been successfully applied in manyclinical microbiology diagnoses, for example, detection of Neisseriameningitidis (or NM) [3], Giardia lamblia [4], and the influenza A virus[5].

Real-time PCR is achieved with the use of fluorescence technol-ogy. There are two main classes of real-time fluorescent chemis-

ll rights reserved.

rd).n; NM, Neisseria meningitidis;t, cycle threshold.

tries, hereafter referred to as the ‘‘generic’’ and ‘‘strand-specific’’methods [2,6]. The generic method relies on a fluorescent dye thatbinds nonspecifically to the DNA molecule. Commercially availableSYBR green, employed in a wide range of research areas, is themost common fluorescent dye used in this type of fluorescentchemistry [7]. The strand-specific probe relies on an oligonucleo-tide probe, labeled at opposite ends with a fluorophore and aquencher, which binds to a specific sequence of target DNA. Taq-man probes is a commercially available fluorescent probe systemthat is employed in many real-time PCR assays [8].

SYBR green is a cyanine dye that binds especially to the minorgroove of double-stranded DNA intercalating between the twostrands of DNA. On binding to the DNA molecule, the dye typicallyemits a 2- to 100-fold increase in detectable fluorescence signal.Most commercial real-time instruments are set to detect the fluo-rescence wavelength for this system [7]. The limitations of SYBRgreen-based methods are the amplification of nonspecific productsand the lack of multiplexing potential based on single coloranalysis.

Taqman was one of the first probe-based real-time systems. Ituses the 50 nuclease activity of Taq DNA polymerase. Briefly, a Taq-man probe is a short strand of oligonucleotide (20–30 bp long) thatis complementary to the target DNA sequence. The Taqman probeconsists of a fluorescent reporter at the 50 end and a quencher dyeat the 30 end. During real-time PCR cycles, the probe binds to thetarget DNA sequence during the annealing step. At this stage, no

90 PCR system for nucleic acid detection / R. Lai et al. / Anal. Biochem. 422 (2012) 89–95

fluorescent signal is detected by the fluorescent monitor systembecause the quencher dye quenches the fluorescence energy emit-ted from the reporter. During the primer extension step of the real-time PCR cycle, the Taq DNA polymerase cleaves both the reporterand quencher dyes by its exonuclease activity. This results in sep-aration of the reporter and quencher dyes, and then the fluorescentmonitor system detects the fluorescent signal [8,9]. Although thehigh specificity and multiplexing ability of Taqman PCR overcomesthe main limitations of the SYBR green method, the extra cost ofdye-labeled reagents and the complexity of designing primer/probes that are both target specific and unique are considered lim-itations of this method. Clearly, a method that combines relativelylow cost and simple primer/probe design with a multiplexing abil-ity would be of immense benefit for the next generation of real-time PCR assays.

In this article, we report the development of a novel probe-basedreal-time PCR system dubbed ‘‘PrimRglo’’ (Fig. 1). In brief, thesystem relies on two single-stranded complementary reporter se-quences (TM sequence). One sequence has a fluorescent reporterattached to the 50 end (referred to as FAM-TM1), and the comple-mentary sequence has a quencher dye attached at the 30 end(referred to as BHQ-TM10). When these two reporter oligonucleo-tides bind to each other and form a reporter complex, no fluorescentsignal is emitted. At the start of the real-time PCR cycle, the PCR for-ward primer (consisting of both TM and target sequence, referred toas TM1-FluA-MF) interrupts the formation of reporter complex bycompeting for binding with the BHQ-TM10 reporter sequence. Thisbinding competition results in an initially high fluorescent signal(produced by unbound FAM-TM1) that can be detected by the fluo-rescent monitoring system. As PCR progresses, the PCR productforms and the concentration of TM1-FluA-MF forward PCR primerdecreases. This favors the formation of reporter complexes, whichin turn results in a reduction in detected fluorescence. This reduc-tion in fluorescent signal can be computationally inverted to gener-ate a more intuitively understood increase in signal as the PCRproduct accumulates. Conceptually, the PrimRglo system has allthe advantages of the Taqman system; furthermore, it avoids theneed for a target-specific dual-labeled probe for amplification, lead-ing to a significantly simpler experimental design and lower reagentcost.

In this article, we demonstrate the principle of the PrimRglosystem and compare its sensitivity with the SYBR green and theTaqman systems. In addition, we demonstrate the capability ofthe PrimRglo system in a duplex real-time PCR.

Materials and methods

Design of primer and real-time PCR probe for influenza A M gene

The PCR forward (FluA-MF) and reverse (FluA-MR) primerswere designed to amplify the gene encoding the matrix proteinof influenza A virus. The use of this set of primers in a diagnosticsetting has been published previously [5]. The PCR forward primerdesigned for the PrimRglo system (TM1-FluA-MF) has two seg-ments: the TM1 sequence followed by the FluA-MF sequence.The Taqman 50 endonuclease probe (FAM-FluA-M-BHQ) was de-signed to target the matrix protein gene of influenza virus A. Theprobe has been modified with FAM attached at the 50 end andBHQ attached at the 30 end. This probe was reported in a previousstudy [5]. The TM reporter complex consists of two single strandsof complementary oligonucleotide known as FAM-TM1 and BHQ-TM10. The FAM-TM1 reporter forward primer has FAM modifiedat the 50 end and a C3 spacer modified at the 30 end, whereas theBHQ-TM10 reporter reverse primer has a C3 spacer modified atthe 50 end and BHQ modified at the 30 end. To favor the interaction

between the TM1-FluA-MF PCR forward primer and the BHQ-TM10

reporter reverse primer at the initiation of PCR amplification, onesingle-base mismatch was introduced within the FAM-TM1 se-quence. The details of all probes and primer sequences are listedin Table 1. All primers and probes were purchased from Geneworks(Hindmarsh, SA, Australia).

Design of primer and real-time PCR probe for N. meningitidisporA and ctrA

Two sets of PCR forward primers (NM-porAF and NM-ctrAF) andreverse primers (NM-porAR and NM-ctrAR) were designed to tar-get the N. meningitidis porA and ctrA genes. These two sets of prim-ers were described and published in a previous study [3]. The twoPCR forward primers were further modified for the PrimRglo sys-tem. In brief, the TM2-NM-porAF PCR primer was modified fromthe NM-PorAF sequence with an additional TM2 sequence attachedat the 50 end. The TM3-NM-ctrAF PCR primer was modified fromthe NM-ctrAF sequence with an additional TM3 sequence attachedat the 50 end. Two reporter complexes were designed for the du-plex experiment. The FAM-TM2 had FAM modified at the 50 end,and the HEX-TM3 had HEX modified at the 50 end of the reporterforward primers. Both of these reporter primers have a C3 spacermodified at the 30 end. The BHQ-TM20 and BHQ-TM30 reporter re-verse primers have a C3 spacer modified at the 50 end and BHQmodified at the 30 end. Once again, a single mismatch base wasintroduced within the FAM-TM2 and HEX-TM3 reporter sequences.The sequences of all probes and primers are listed in Table 2. Allprimers and probes were purchased from Geneworks.

Construction of pGEM-T/H1N1/M plasmid and pGEM-T/NM/ctrA/porA plasmid

The H1N1 influenza A viral RNA sample was kindly supplied bythe Sir Albert Sakzewski Virus Research Centre (SASVRC, Herston,QLD, Australia). The M protein gene of the viral RNA was amplifiedwith FluA-MF and FluA-MR primers using the Qiagen One-Step RT–PCR Kit (Qiagen, Doncaster, VIC, Australia). The reaction comprised200 nM of forward and reverse primers and 1 ng of influenza A vir-al RNA sample in a total reaction volume of 50 ll. PCR was per-formed using the Eppendorf Mastercycler (Hamburg, Germany)with the following conditions: initial holding temperature of50 �C for 30 min, then 95 �C for 15 min, followed by 45 cycles of95 �C for 15 s and 60 �C for 1 min. The PCR product was purifiedusing a Qiagen PCR Purification Kit as per the manufacturer’s pro-tocol. The purified PCR product was cloned into a pGEM-T Easyvector (Promega, Sydney, NSW, Australia) as per the manufac-turer’s protocol. The sequence of the M protein clone was con-firmed by sequence analysis (Australian Genome ResearchFacility [AGRF], Brisbane, QLD, Australia). This M protein clone(pGEM-T/H1N1/M) was prepared as a DNA sample using a QiagenMidi Prep Kit as per the manufacturer’s protocol.

The N. meningitidis DNA sample was generously supplied by theSASVRC. Plasmids were constructed as described above using thePCR method and NM-porA- and NM-ctrA-specific PCR primers(see Tables 2 and 3).

SYBR green real-time PCR

The SYBR green real-time PCR was performed using the ABISYBR green PCR Master Mix (Applied Biosystems, Foster City, CA,USA) and Rotor-Gene 6000 (Corbett Research, Mortlake, NSW, Aus-tralia). The real-time PCR was carried out in a total volume of 50 llthat consisted of 1 � ABI SYBR green PCR master mixture buffer,400 nM FluA-MF and FluA-MR PCR primer, and pGEM-T/H1N1/MDNA template ranging from 2 � 10�9 ng to 2 � 10�1 ng. The

Fig.1. Schematic representation of the PrimRglo real-time PCR system. In this system, signal detection relies on the hybridization between the reporter forward primer, whichhas a fluorescence reporter attached at its 50 end (labeled ‘‘Tm’’ and shown in purple) and reporter reverse primer, which has quencher attached at its 30 end (labeled ‘‘Tm’’ andshown in red). At the start of the PCR, the chimeric PCR forward primer (consisting of both Tm color- and target template-specific sequence) interacts with the reporterreverse primer. This allows the fluorescence signal to be emitted from the reporter on the tag probe. The interaction between chimeric PCR forward primer and reporterreverse primer is favored due to the presence of a single nucleotide mutation in the reporter probe. During the PCR process, the chimeric PCR forward primers are integratedinto the newly formed PCR product. As the amount of chimeric PCR forward primers is reduced, an interaction between the reporter forward primer and reverse primer isestablished. This allows the quencher from the reporter reverse primer to absorb the fluorescence signal emitted from the reporter forward primer, thereby decreasing thefluorescence signal with each PCR cycle.

Table 1List of primer and probe sequences involved in influenza A real-time PCR (monoplex).

Name Sequence Purpose 50 modification 30 modification

TM1-FluA-MF CTTTAATCTCAATCAATACAAATCCTTCTAACCGAGGTCGAAACGTA FluA PrimRglo forward primer NA NAFluA-MF CTT CTA ACC GAG GTC GAA ACG TA FluA PCR forward primer NA NAFluA-MR GGT GAC AGG ATT GGT CTT GTC TTT A FluA PCR reverse primer NA NAFAM-FluA-BHQ TC AGG CCC CCT CAA AGC CGA G FluA Taqman probe FAM BHQFAM-TM1 CT TTA ATC TCC ATC AAT ACA AAT C PrimRglo reporter forward primer FAM C3

BHQ-TM1’ GA TTT GTA TTG ATT GAG ATT AAA G PrimRglo reporter reverse primer C3 BHQ1

Note. The underlined nucleotide indicates the position of mismatch between the reporter forward and reverse oligonucleotides.

PCR system for nucleic acid detection / R. Lai et al. / Anal. Biochem. 422 (2012) 89–95 91

real-time PCR was performed under the following conditions: ini-tial holding at 95 �C for 10 min, followed by 40 cycles of 95 �C for30 s, 45 �C for 30 s, and 72 �C for 30 s, and finished with a final

extension at 95 �C for 1 min and 60 �C for 10 min. The SYBR greensignal was detected during the annealing step of the PCR (45 �C for30 s). The SYBR green real-time PCR experiments were repeated

Table 2List of primer and probe sequences involved in NM real-time PCR (duplex).

Name Sequence Purpose 50 modification 30 modification

NM-porAF CGGCTCGTTTATCGGCTT NM porA PCR forward primer NA NANM-porAR CGACAAAGGATTCCCTGTTG NM porA PCR reverse primer NA NANM-ctrAF CCGCATTATTCTGCACCA NM ctrA PCR forward primer NA NANM-ctrAR GCCTTTCTTCGATGGGCT NM ctrA PCR reverse primer NA NAFAM-TM2 TGATTGTATTATGTATTGATAAAG PrimRglo reporter forward primer FAM C3

HEX-TM3 GATTGTAAGAGTTGATAAAGTGTA PrimRglo reporter forward primer HEX C3

BHQ-TM20 CTT TAT CAA TAC ATA CTA CAA TCA PrimRglo reporter reverse primer C3 BHQBHQ-TM30 TACACTTTATCAAATCTTACAATC PrimRglo reporter reverse primer C3 BHQTM2-NM-porAF TGATTGTAGTATGTATTGATAAAGCGGCTCGTTTATCGGCTT NM porA PrimRglo forward primer NA NATM3-NM-ctraF GATTGTAAGATTTGATAAAGTGTACCGCATTATTCTGCACCA NM ctrA PrimRglo forward primer NA NA

Note. The underlined nucleotides indicate the positions of mismatch between the reporter forward and reverse oligonucleotides.

Table 3Summary of sensitivity study of PrimRglo, Taqman probe, and SYBR green real-time PCR system.

Real-time PCR system PrimRglo (45 cycles) Taqman (40 cycles) SYBR green (40 cycles)[pGEM-T/H1N1/M plasmid] Av Ct ± SD (n = 3) Av Ct ± SD (n = 3) Av Ct ± SD (n = 3)

5.85 � 107 copies 18.9 ± 0.3 13.6 ± 0.1 11.2 ± 0.15.85 � 106 copies 22.4 ± 0.4 17.1 ± 0.3 14.8 ± 0.05.85 � 105 copies 25.8 ± 0.5 20.3 ± 0.1 18.3 ± 0.25.85 � 104 copies 29.3 ± 0.1 23.8 ± 0.1 21.6 ± 0.15.85 � 103 copies 33.3 ± 0.4 27.3 ± 0.1 25.2 ± 0.15.85 � 102 copies 36.9 ± 0.4 31.0 ± 0.3 28.7 ± 0.35.85 � 101 copies 40.9 ± 0.5 34.2 ± 0.2 32.6 ± 0.35.85 � 100 copies – 38.0 ± 0.2 36.2 ± 0.1

92 PCR system for nucleic acid detection / R. Lai et al. / Anal. Biochem. 422 (2012) 89–95

three times, and each set of experiments consisted of a triplicatepGEM-T/H1N1/M DNA template.

Taqman probe real-time PCR system

The Taqman probe real-time PCR was performed using ABI Taq-man Universal PCR Master Mix (Applied Biosystems) and Rotor-Gene 6000 (Corbett Research). The real-time PCR was carried outin a total volume of 50 ll that consisted of 1 � ABI Taqman univer-sal PCR master mixture, 400 nM FluA-MF and FluA-MR PCR prim-ers, 100 nM FAM-FluA-M-BHQ probe, and a pGEM-T/H1N1/M DNAtemplate ranging from 2 � 10�9 ng to 2 � 10�1 ng. The real-timePCR cycle conditions were the same as described for the SYBRgreen PCR system. The Taqman probe real-time PCR experimentswere repeated three times, and each replicate of experimentswas carried out on a triplicate aliquot of pGEM-T/H1N1/M DNAtemplate.

PrimRglo real-time PCR system

The PrimRglo probe real-time PCR was performed using ABITaqman universal PCR Master Mix (Applied Biosystems) and theRotor-Gene 6000 machine (Corbett Research). The real-time PCRwas carried out in a total volume of 50 ll that consisted of 1 � ABITaqman universal PCR master mixture buffer, 400 nM TM1-FluA-MF and FluA-MR PCR primer, 200 nM BHQ-TM10 and 100 nMFAM-TM1 reporter primers, and a pGEM-T/H1N1/M DNA templateranging from 2 � 10�9 ng to 2 � 10�1 ng. The real-time PCR wasperformed under the following conditions: initial holding at95 �C for 10 min, followed by 45 cycles of 95 �C for 30 s, 45 �C for30 s, and 72 �C for 30 s. The FAM signal was detected during theannealing step of the PCR (45 �C for 30 s). The PrimRglo real-timePCR experiments were repeated three times, and each set of exper-iments consisted of a triplicate pGEM-T/H1N1/M DNA template.

The duplex NM PrimRglo experiment was carried out on do-nated N. meningitidis plasmid (pGEM-T/NM/ctrA/porA) in a totalvolume of 50 ll that consisted of 1 � ABI Taqman universal PCR

master mix buffer, 400 nM TM2-NM-porAF, TM3-NM-ctrAF, NM-porAR, and NM-ctrAR PCR primer, 200 nM TM20-BHQ and TM30-BHQ, 100 nM FAM-TM2 and HEX-TM3 reporter sequence, and apGEM-T/NM/ctrA/porA DNA template ranging from 2 � 10�6 ngto 2 ng. The real-time PCR was performed under the following con-ditions: initial holding at 95 �C for 10 min, followed by 35 cycles of95 �C for 30 s, 45 �C for 30 s, and 72 �C for 30 s. The FAM and HEXsignals were detected during the annealing step of PCR (45 �C for30 s). The PrimRglo real-time PCR experiments were repeatedthree times, and each set of experiments consisted of a triplicateplasmid DNA template.

Results

Demonstration of the principle of the PrimRglo real-time system

The PrimRglo system relies on the competition between the PCRforward primer (TM1-FluA-MF) and reporter/quencher probe com-plex (FAM-TM1 and BHQ-TM10). This system initially exhibits highfluorescence intensity due to the competition between the PCR for-ward primer and the FAM-TM1 reporter. As PCR progresses, freePCR forward primer is incorporated into PCR products, which fa-vors the formation of the reporter complex, thereby resulting ina decrease in fluorescence intensity. During assay optimization,we introduced a single-base change into the FAM-TM1 reporterprobe, which weakens the reporter complex, thereby increasingthe relative binding affinity between the TM1-FluA-MF PCR primerand the BHQ-TM10 reporter at the start of PCR. This resulted in agreater dynamic range in terms of the fluorescent output acrossthe PCRs.

On the formation of reporter complex, the emitted fluorescencesignal from the FAM molecule was quenched by the juxtaposedBHQ molecule, resulting in a low-fluorescence signal. This wasdemonstrated in a BHQ dose–response experiment. In this experi-ment, 200 nM FAM-TM1 reporter was titrated with different con-centrations of BHQ-TM10 reporter (ranging from 25 to 800 nM).

0 200 400 600 8000

10

20

30200nM FAM-TM1

A BHQ-TM1' concentration (nM)

Rel

ativ

e fl

uo

resc

ence

0 200 400 600 8000

10

20

30200nM FAM-TM1/100nM BHQ-TM1'

B TM1-FluA-MF PCR primer concentration (nM)

(i)

(ii)

Fig.2. (A) Dose–response study of BHQ-TM10 reporter reverse primer to FAM-TM1 reporter forward primer. In this experiment, 200 nM FAM-TM1 reporter oligonucleotidewas titrated against different concentrations of BHQ-TM10 reporter reverse oligonucleotide. (B) Dose–response study of TM1-FluA-MF PCR primer to TM1 reporter primercomplex. In this experiment, 200 nM FAM-TM1 reporter complex and 100 nM BHQ-TM10 reporter primer were titrated with different concentrations of TM1-FluA-MF PCRprimer. To highlight comparisons between plots A and B, dotted line (i) indicates maximum fluorescent signal intensity for unbound 200 nM FAM-TM1 and dotted line (ii)indicates fluorescent signal intensity for the complex formed by mixing 200 nM FAM-TM1 with 100 nM BHQ-TM10 .

PCR system for nucleic acid detection / R. Lai et al. / Anal. Biochem. 422 (2012) 89–95 93

As shown in Fig. 2A, the initial fluorescence decreased as the BHQmolecular concentration increased. However, this linear relation-ship reached its plateau phase when both FAM-TM1 and BHQ-TM10 reporters had equal molecular concentration. In this study,the optimal molecular ratio between FAM-TM1 and BHQ-TM10

was 1:2, which produced approximately a 75% reduction of the ini-tial fluorescence signal (Fig. 2A).

The PCR forward primer (TM1-FluA-MF) was then introducedinto the reporter complex system. Because the PCR forward primerconsisted of the same TM1 sequence as the FAM-TM1 reporter, thePCR forward primer competed with the FAM-TM1 reporter forbinding to the BHQ-TM10 reporter. This binding competition re-sulted in an increased amount of free FAM-TM1 reporter in the sys-tem and so an increased fluorescence level was detected. Thisprinciple could be demonstrated in a FluA-MF PCR primer dose–re-sponse study. In this experiment, 100 nM FAM-TM1 and 200 nMBHQ-TM10 were titrated against different concentrations of TM1-FluA-MF PCR primer (ranging from 25 to 800 nM). As shown inFig. 2B, the initial fluorescence signal from the reporter complexincreased as the concentration of TM1-FluA-MF PCR primer in-creased. This relationship reached its plateau phase when theTM1-FluA-MF PCR primer had four times the molecular concentra-tion of FAM-TM1 reporter. In this study, the optimal molecular ra-tio among FAM-TM1, BHQ-TM10, and TM1-FluA-MF was 1:2:4,which exhibited approximately an 80% increase in the initial fluo-rescence signal from the reporter complex (Fig. 2B). Importantly,we found that for the three targets investigated in this study, ineither single or duplex reactions, the 1:2:4 ratio allowed sufficientamplification sensitivity without requiring additional optimiza-tion. In other experiments, we have also observed good dynamicrange for detection within the 1:2:2 to 1:2:5 ratios, suggestingrobustness of the assay to different sequences.

Comparative sensitivity of SYBR green, Taqman probe,and PrimRglo real-time PCR

To determine the sensitivity of the PrimRglo, Taqman probe,and SYBR green real-time PCR systems, each real-time PCR systemwas titrated against a range of H1N1 influenza A viral M proteingene clones (ranging from 2 � 10�9 ng to 2 � 10�1 ng). The resultsin Table 3 and Supplementary Fig. S1 (see supplementary material)show that the Taqman and SYBR green systems have approxi-mately equal sensitivity, whereas the PrimRglo system is approxi-mately 10-fold less sensitive (�60 copies). Interestingly, thereappeared to be a lag in amplification for the PrimRglo system, such

that more than 40 cycles were required to amplify the lowestdetectable target concentration. This might suggest that reducingthis lag phase may improve sensitivity by shifting the range ofthe assay to the lower cycle threshold (Ct) values.

PrimRglo application to N. meningitidis duplex real-time PCR system

The ability to perform multiplex reactions is a desirable featurefor any newly developed real-time PCR system. In this study, wedemonstrated the capability of PrimRglo to perform duplex real-time PCR for NM porA and ctrA, targets already used in clinicaldiagnostic tests for N. meningitidis [3]. Two reporter complexes(FAM-TM2 and HEX-TM3) were employed in this experiment. Eachof the reporter complexes was responsible for the amplification oftwo different NM targets; the FAM-TM2 reporter complex wasresponsible for NM porA detection, whereas the TM3 reporter com-plex was responsible for NM ctrA detection. As the results show,both porA and ctrA real-time PCR signals were detected from a sin-gle PCR (Table 4 and Supplementary Fig. S2). Amplification wasspecific, as shown by the lack of signal when either ctrA or porA tar-gets were not added to the duplex reaction mixture. Gel electro-phoresis of amplification products confirmed the expectedmolecular weight of each specific target (Fig. 3), and sequencingdata confirmed sequence accuracy (see Supplementary DatasetD1 in supplementary material). A primer dimer was observed inthe gels and quantitative real-time PCR and is discussed in the nextsection. This demonstrated that the PrimRglo system was usefulfor performing duplex real-time PCRs.

Discussion

PCR techniques have been available for approximately 25 years,and real-time PCR quantitative techniques have been available fornearly 20 years [2]. The most widely used real-time detectionchemistries are SYBR green and Taqman probe, although othermethods are also available [2,6]. The essential considerations forreal-time PCR systems include costs, target specificity, sensitivity,and the ability to conduct multiplex reactions [2,6]. In this study,we have compared our newly developed PrimRglo with alternativeSYBR green and Taqman probe real-time PCR chemistry for detec-tion of the influenza A M gene and the porA and ctrA genes of N.meningitidis. We found that PrimRglo showed comparable sensitiv-ity to the Taqman system, and we were able to design a duplex as-say with low cost and a simple design.

Table 4Demonstration of duplex PrimRglo using porA and ctrA detection.

Template copies Target genes added to PCR

porA only ctrA only porA/ctrAporA ctrA Av Ct ± SD (n = 3) Av Ct ± SD (n = 3) Av Ct ± SD (n = 3)

5.91 � 108 13.3 ± 0.4 – 12.7 ± 0.45.75 � 108 34.3 ± 0.3 13.2 ± 0.4 14.9 ± 1.05.91 � 107 16.6 ± 0.2 – 15.7 ± 0.65.75 � 107 – 16.4 ± 0.6 15.9 ± 0.75.91 � 106 20.6 ± 0.3 – 20.5 ± 0.85.75 � 106 – 19.2 ± 0.3 20.4 ± 1.55.91 � 105 23.1 ± 0.4 – 24.5 ± 0.65.75 � 105 – 22.6 ± 0.8 24.7 ± 0.95.91 � 104 26.3 ± 0.4 – 28.0 ± 0.35.75 � 104 – 26.5 ± 0.7 28.4 ± 0.35.91 � 103 30.3 ± 0.1 – 31.3 ± 0.65.75 � 103 – 29.6 ± 1.1 31.4 ± 0.45.91 � 102 33.8 ± 0.2 – 34.6 ± 0.45.75 � 102 – 34.6 ± 0.5 33.4 ± 0.3

Fig.3. Sequence analysis of products from duplex PrimRglo reaction. Gel electro-phoresis confirmed the presence of two bands with fragment size corresponding toctrA and porA (see sequence confirmation in Supplementary material) along with anegative template control (‘‘NT’’) and a band attributed to primer dimer (‘‘PD’’)formation.

94 PCR system for nucleic acid detection / R. Lai et al. / Anal. Biochem. 422 (2012) 89–95

The PrimRglo system uses a fluorescence reporter–primer com-plex to quantify, in real time, the amount of DNA molecule presentin the reaction. This PrimRglo real-time system offers the sameadvantages as the Taqman probe system. However, the PrimRglosystem has two additional advantages. First, the PrimRglo systemhas overcome the disadvantage of the Taqman probe system wherea target-specific fluorescent probe needs to be designed for differ-ent target templates. In the PrimRglo system, the universal TM se-quence can be used in different PCR amplification conditions withdifferent DNA templates. Second, up to 100 TM sequences (used inthe Luminex multiplex microsphere system) could be used in thePrimRglo system, providing it with great potential for multiplexingbeyond the duplex reaction that has been used here to show proofof principle. One potential limitation associated with this systemwas the length of the PCR primer. Because the PCR primer in thePrimRglo system consists of two regions (TM and target-specificsequence), it is expected to be longer than conventional PCR prim-ers. This could potentially cause primer–primer interaction duringthe PCR cycle. To date, this has not presented a serious technicaldifficulty.

Following duplex PrimRglo reactions, we observed a band in thegel that we attribute to primer dimer formation (Fig. 3). This likelyoriginates from the formation of excess reporter complex resulting

from standard primer dimer formation involving the forward andreverse primer sequences. In the quantitative PCRs, this effectwas also observed in the porA detection channel of the duplex sam-ple containing only the ctrA target gene. This suggests that porAPCR primers may be forming primer dimer structures. In conven-tional PCR, primer dimer formation can often occur when the tem-plate concentration is so low that it is consumed so early in thereaction that the partially complementary primers can anneal toeach other [10,11].

In terms of the specific duplex reaction investigated in thisstudy (ctrA/porA), we can predict which primer set is more likelyto form primer dimers by investigating the difference in free en-ergy (DDG) of formation between the relevant heterodimer du-plexes. Given that temperature T is the primer annealingtemperature and R is the universal gas constant, the equilibriumconstant Keq can be calculated by Eq. (1):

DKeq ¼ e�DDG

RT : ð1Þ

Using IDT Oligo Analyzer software online, DDG = –1330 cal/mol,giving DKeq = 8.2. In this context, DKeq can be interpreted as the ra-tio of primer dimer formation for each given heteroduplex, suggest-ing that in the given system the formation of porA primer dimers isapproximately 10-fold more favorable than primer dimer formationby the ctrA primer sequences, in agreement with the experimentaldata presented.

In this study, we have developed an alternative platform forreal-time PCR. This new PrimRglo system offers the same level ofsensitivity and systemic advantages as the Taqman probe system,with additional potential advantages in relation to multiplexingof real-time PCRs on a universal platform.

Conflict of interest

G.B. and R.T.B. are coinventors on a patent (WO 2007/003017)describing this technology.

Acknowledgments

This work was supported by Biochip Innovations via Uniquest,the commercialization office of the University of Queensland.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.ab.2011.12.038.

References

[1] K.B. Mullis, E. Faloona, Specific synthesis of DNA in vitro via a polymerasecatalyzed chain reaction, Methods Enzymol. 155 (1987) 335–350.

[2] H.D. VanGuilder, K.E. Vrana, W.M. Freeman, Twenty-five years of quantitativePCR for gene expression analysis, BioTechniques 44 (2008) 619–626.

[3] D.M. Whiley, M.E. Crisante, M.W. Syrmis, I.M. Mackay, T.P. Sloots, Detection ofNeisseria meningitidis in clinical samples by a duplex real-time PCR targetingthe porA and ctrA genes, Mol. Diagn. 7 (2003) 141–145.

[4] T. Wahab, J. Ankarklev, M. Lebbad, S. Glavas, S. Svard, D. Palm, Real-timepolymerase chain reaction followed by fast sequencing allows rapidgenotyping of microbial pathogens, Scand. J. Infect. Dis. 43 (2011) 95–99.

[5] D.M. Whiley, T.P. Sloots, A 50-nuclease real-time reverse transcriptase–polymerase chain reaction assay for the detection of a broad range ofinfluenza A subtypes, including H5N1, Diagn. Microbiol. Infect. Dis. 53(2005) 335–337.

[6] M. Buh Gasparic, K. Cankar, J. Zel, K. Gruden, Comparison of different real-timePCR chemistries and their suitability for detection and quantification ofgenetically modified organisms, BMC Biotech. 8 (2008) 26.

[7] H. Zipper, H. Brunner, J. Bernhagen, F. Vitzthum, Investigations on DNAintercalation and surface binding by SYBR green I, its structure determination,and methodological implications, Nucleic Acids Res. 32 (2004) e103.

[8] C.A. Heid, J. Stevens, K.J. Livak, P.M. Williams, Real time quantitative PCR,Genome Res. 6 (1996) 986–994.

PCR system for nucleic acid detection / R. Lai et al. / Anal. Biochem. 422 (2012) 89–95 95

[9] E. Reynisson, M.H. Josefsen, M. Krause, J. Hoorfar, Evaluation of probechemistries and platforms to improve the detection limit of real-time PCR, J.Microbiol. Methods 66 (2006) 206–216.

[10] L. Raeymaekers, Quantitative PCR: theoretical considerations with practicalimplications, Anal. Biochem. 214 (1993) 582–585.

[11] P.M. Giffard, J.A. McMahon, H.M. Gustafson, R.T. Barnard, J. Voisey, Comparisonof competitively primed and conventional allele-specific nucleic acidamplification, Anal. Biochem. 292 (2001) 207–215.