Embed Size (px)
DESCRIPTION
Â
Citation preview
Australian Poultry Science Symposium 2015
poultrydigestFebruary/March 2015
www.primarymedia.com.au
RIRDC funded research enables quick and accurate on-farm testing for Adenovirus
VIV Asia 2015 showcases complete global feed to meat supply chain
Print Post Approved PP243096/00007 ISSN 1444-8041
Volume 30, Number 4
Vaxsafe® PM is a new product funded by the Australian Poultry CRCfor the Australian poultry farmer to help control Fowl Cholera.
This live vaccine oers signi�cant improvements in controlof Pasteurella multocida (PM) over previous vaccines.
Its broad protection means it is the �rst stop forPM control irrespective of what PM you have.
Brought to you by Bioproperties to help prevent blood from staining the wattle**Apologies to Henry Lawson
Phone (03) 9876 0567Fax (03) 9876 0556bioproperties.com.au
Vaxsafe PM
The new vaccine for Fowl Cholera
PDJuneJuly2012:PDFEBMAR09 24/07/12 6:55 PM Page 2
poultrydigestwww.primarymedia.com.au
February/March 2015
EDITORIAL & DESIGN
Features
News
ADVERTISING
SUBSCRIPTIONS
ENQUIRIES
EDITOR:JOURNALIST/PHOTOGRAPHERPRODUCTION EDITOR
Peter BedwellMob: 0419 235 288Email: [email protected] [email protected]
OFFICE ADDRESS:250 Hawthorne Pde, Haberfield NSW, 2045Ph: (02) 9797 2406Mob: 0419 235 288Production: 0409 944 472Email: [email protected] [email protected]
Poultry Digest consists of a bi-monthly management magazine and an annual industry review, Poultry Industry YearbookPublished by CD Supplies Pty Ltd trading as Primary Media (ACN 091 560 557).All material copyright (editorial and advertisements) and may not be reproduced without the written consent of the publishers. Whilst every care is taken to ensure the accuracy of the contents of POULTRY DIGEST, the publishers do not accept any responsibility or liability for the material herein.
AUSTRALIAOne Year - $55.00*NEW ZEALAND One Year - NZ$80OTHER COUNTRIESOne Year: Airmail - $A90Please send payment in Australian dollars.Send payment and full details to:250 Hawthorne Parade, Haberfield NSW, 2045*Australian subscription rate includes GST
Peter BedwellAlex Bedwell
Rosemary Embery
3
for the .This
of
*
VaThe new v
Page 8: RIRDC funded research enables quick and accurate on-farm testing for Adenovirusby Peter Bedwell
Page 28: Thermal Equalisation De-Stratification Unitsby Fernando Ferraira, Scolexia Project Manager
Page 32: A loop isothermal amplification assay to detect fowl adenovirus – 8 in a variety of poultry materialsby KR Renz, RR Achari, SW Walkden-Brown and ME Katz
Page 4: Australian Poultry Science Symposium 2015
Page 18: VIV Asia 2015 showcases complete global feed to meat supply chain
Page 22: AB Vista Inspire Seminar held at Royal Sydney Motor Yacht Club
Page 26: Broiler grower demonstrates effective, safe in-shed litter treatment with birds in place
Volume 30, Number 4
Dr Katrin Renz, a researcher from UNE, has developed a new method for accurately and quickly testing for Adenovirus.
NEWS
4
26th Australian Poultry Science Symposium 2015
Dr Juliet Roberts from the University of New England (UNE) in her paper on ‘Egg Quality’ stated that “Egg Shell quality and egg internal quality are of major importance to the egg industry worldwide and may be measured in a range of ways both commercially and in research facilities.
“Ongoing technological advances have led to improved in-line monitoring of egg shell quality.
“Egg quality is also important for food safety as eggs are periodically implicated in cases of food borne illness,” Dr Roberts said.
The next invited speaker was Dr Maureen Bain from the University of Glasgow UK, whose paper was ‘Increasing persistency in lay and stabilising egg quality in longer laying cycles – what are the challenges?’
She predicted that with the advance of molecular genetics there will soon emerge a ‘long life layer’ capable of producing 500 eggs in a laying cycle of 100 weeks.
“Currently the modern commercial layer is capable of producing more than 320 eggs in a single laying cycle if she is kept in optimum conditions,” she explained.
“The benefits of genetic selection for improved persistency in lay and stability for improved egg quality can only be realised if they are matched by improvements in hen nutrition and careful monitoring, recording and analysis of the effects of this process on the health and welfare of the hens.
“The opportunities for broader selection indices, thanks to molecular genetics, are increasing and it is evident that poultry geneticists are already harnessing this added tool in an attempt to address some of the major issues that the industry faces for the betterment of all,” Dr Bain said.
Next Dr Bain spoke on ‘The Cute Egg Project’ – a study which aims to quantify and improve the the quality of the eggshell cuticle.
“The economic forces for continuing improvement in productivity are massive but there is also an undercurrent for improved welfare and the industry ignores this at its peril,” she stated.
Invited speaker from Alltech, University of Kentucky, was Dr Kristen Brennan, one of Alltech’s leading w
1. Dr Peter Groves, Director APSS. 2. Dr Michael Kidd, University Arkansas USA. 3. Prof David Raubenheimer, Charles Perkin Centre, University of Sydney. 4. Prof Marian Dawkins, Oxford Uni, UK.
The 26th Australian Poultry Science Symposium, held at the Camperdown Campus at University of Sydney February 9 to 11, 2015, continues to build on a reputation for delivering leading edge poultry science of international significance.
The event attracts scientists from around the world who are at the top of their game and seem to be genuinely pleased to share their research with what is, at the end of the day a relatively small industry by global standards.
Maybe this is a factor in lifting the achievements of our own science community which is clearly in evidence at APSS.
Post graduates who were presenting papers on their research just a few short years ago, are now in responsible and key positions in our industry running their own programs to ensure the viability, safety and future of Australia’s major protein source – poultry.
Though small in comparison to the broiler sector, the layer industry is a significant supplier of safe and nutritious protein that still has the opportunity to grow in the Australian market despite challenges from retail, consumer, animal activists and regulators who seem determined to deny the majority of Australians a safe and affordable healthy diet.
At the 2015 event the first topic on for the opening session was ‘Quality of the Egg-Hatchability to Edibility’.
After the opening address by Dr Peter Groves (Director of the Organising Committee) and Judy O’Keefe, President of the Poultry Research Foundation, JoJo Jackson from the Australian Egg Corporation introduced the first keynote speaker Dr Aidan Leek, MD of HyLine UK whose topic was ‘Feeding for egg quality’.
“Food safety ranks high on consumer demands and that starts with what is fed to the hen,” Dr Leek said.
“Internal quality can be influenced both directly and indirectly by nutrition.
“Specific egg enrichments add value, fulfill a consumer niche and can represent a significant proportion of some egg markets.
“External quality is a prerequisite for saleability of the egg into a whole egg market and represents an important quality factor for the producer,” he said.
1
2
3
4
advert_AA_poultrydigest_A4_23.09.11.pdf 1 23/09/11 10:04 AM
Ph: (03) 5979 [email protected]
VictoriaAgriculturalAutomationPh: (03) 5979 1666
6
NEWSv
1. Ha Truong, University of Sydney. 2. Aidan Leek, Hy-Line UK. 3. Maureen Bain, University of Glasgow. 4. Isabelle Ruhnke, Univeristy of New England.
researchers on nutrigenomics.Her paper was, ‘Practical
applications of nutrigenomics in poultry nutrition’.
“Novel molecular techniques such as microarray technologies have spurred the development of the field of nutrigenomics,” Dr Brennan said.
“Using microarrays to evaluate gene responses allows us to assess the activity of thousands of genes at the same time, thus allowing a rapid measure of physiological changes.
“Nutrigenomics can provide a powerfull tool for understanding how nutrition impacts performance, health and disease in poultry.
“This paper will serve as a review of current applications of Nutrigenomics in poultry nutrition.
“The wealth of information obtained from nutrigenomics studies can help nutritionists and producers better understand how to feed poultry to insure optimal health and performance,” she explained.
“The whole point of the APSS event is to really dig into science and find where it can take us as an industry.
“Retail, consumer and welfare issues all distract from the pure science of what we do.
“If nothing else APSS challenges participants to think about the presentations before them.”
‘The Euclidian pathway to more instructive broiler bioassays: nutritional geometry’ was presented by Professor David Raubenheimer from the Charles Perkins Centre at Sydney University.
Prof Raubenheimer is a leading author and researcher on such matters as global obesity.
In preparing his paper he was assisted by Professor Stephen Simpson also from the Charles Perkins Centre as well as Sonia Liu, Peter Selle and Aaron Cowieson working with the Poultry Research Foundation, University of Sydney.
That Professor Raubenheimer was well versed about his topic is to be expected, the fact that he could explain the significance of the research to the participants at APSS 2015 clearly illustrates the value to the poultry industry of the Australian poultry Science Symposium.
In concluding his paper Prof Raubenheimer stated that “Relationships between food compositions, diet compositions and diet utilisation are complex and multi- dimensional,” he said.
“The geometric framework offers an approach for conceptualising these relationships and constructing models
which identify key relationships needed to understand how the nutritional regulatory systems of animals interact with the compositions of foods to determine outcomes such as growth, body composition, feed conversion efficiency, fecundity and so forth,” he said.
“Understanding these relationships is an important step towards the key managing and the key control points to manage these for optimal production outcomes.
“As yet, the use of this approach in poultry production is in its infancy, but a detailed example illustrating these points can be found for finfish production in aquaculture (Ruohonen et al, 2007),” Prof Raubenheimer concluded.
Keynote invited speaker, Dr Mike Kidd from the Center for Excellence for Poultry Science, University of Arkansas USA delivered two significant papers, the first being, ‘Progeny Performance: Current Research and US Field Perspectives’.
In concluding his paper Dr Kidd stated that “Hen nutrition and hatchery management can help to generate a robust chick.
“For many micronutrients, progeny needs are higher than for hen productive performance.
“In this paper energy, a dried fermentation product from Saccharomyces cerevisiae, tocopherols, cholecalciferol, selenium, manganese and zinc have been shown to impact progeny from hen research studies.
“With fat soluble vitamins, cost benefit studies should be conducted based on seven day mortality.
“Finally hen levels of micronutrients and additives thought to improve progeny viability should be further assessed in their ability to impact yields.
“The interaction of in ovo nutrition with hen nutrition remains unclear,” Dr Kidd concluded.
His second paper, produced with the assistance of Steve Bolden of Cobb Vantress, was ‘Amino Acids vs Energy: trends in feeding modern commercial broilers’.
No APSS event is complete without a paper by Dr Peter Selle, nowadays assisted by talented students at the Sydney University Poultry Research Foundation.
In this instance Ha Truong helped to explain their joint research findings.
As an invited speaker his paper was on ‘Free amino acids: their role in starch and protein digestive dynamics’.
His paper was delivered in the CONTINUED ON PAGE 44 w
1
2
3
4
With 95% accuracy in targeting the effective vaccination location in the egg,it’s obvious why Embrex® Inovoject® is the in ovo vaccination leader. These numbers make it even clearer: When vaccinating 1.5 million eggs in ovo,* Inovoject helps ensure that 1.425 million receive proper vaccination at the correct site of injection. Compared to the competition, that is 34% greater protection against disease challenge.1 Can you afford ineffective vaccination and disease risk in 510,000 birds per week?
Smarter is greater accuracy. Smarter is Embrex Inovoject.
For more information talk to Mark Bennett 0427 627 774.
DUAL-NEEDLE INJECTION TOOLING
*Based on assumed weekly volume of 1.5 million eggs injected.1 Williams CJ, Hopkins BA. Field evaluation of the accuracy of vaccine deposition by two different commercially available
in ovo injection systems. Poultry Science 2011; 90:223–226.
SMARTERIS RELIABLEVACCINATION.
© 2014 Zoetis Inc. All rights reserved. Zoetis Australia Pty Ltd Level 6, 5 Rider Boulevard, Rhodes, NSW 2138. www.zoetis.com.au 12/14 PAL1202
PAL1202_A_EmbxInovo_A4-v01.indd 1 15/12/2014 1:42 pm
10
RIRDC funded research enables quick and accurate on-farm testing for Adenovirus
This paper describes the possibilities for accurate and speedy testing for Adenovirus but also the possibility to test on-farm using the Genie III instrument manufactured by Optigene in the UK.
The next stage in the research was to take the instrument onto a farm suggested by Poultry Digest and conduct tests on bird tissue samples and shed dust material.
We chose to once again visit the Graham Fripp farm, managed by Peter Cashman.
This farm appears in another article in this issue of Poultry Digest on the subject of litter management.
First Katrin demonstrated the unit and how it is used in her lab at UNE and then we travelled to Peats Ridge in NSW to repeat the process on-farm.
The six shed farm still had one shed full of birds that were a short period to pick-up, and thus ideal for Katrin’s tests.
First, dust samples were taken and then some birds were selected for sacrifice including a bird in poor condition and examples in good health.
Overall the batch of Cobb birds were in excellent condition and the shed was remarkably free of odour or wet areas.
Having watched the test preparation in pristine lab conditions at UNE it
was interesting to watch Katrin work on a steel bench in the machinery shed washing the birds used for organ samples on the deck under a corner tap outdoors.
The Genie III has an internal battery that lasts for a reasonable periods but we plugged into a mains charger to ensure that we had enough power to conduct a few test cycles that last between 30 to 45 minutes.
Interesting to observe both in the lab at UNE and later on the Peat’s Ridge farm, was Katrin’s sharp focus on her work and preparation: hardly surprising given Katrin’s DNA, her father being a senior engineer with one of Germany’s premium car makers.
In 2007 Katrin won an award for best presentation by a post grad student at that year’s APSS.
Her PhD was based on the study of Marek’s Disease.
After the samples were prepared, Katrin ran the first test on samples seeking to establish the presence of Chicken Anemia Virus (CAV).
About 35 minutes later we have a result and Katrin is as excited as a kid with a new X Box!
We reload the Genie for a second run, this time running the cycle while driving back to Gosford.
The readouts from the Genie can be exported as a JPG as seen on page
By PETER BEDWELL
w
D r Katrin Renz, a researcher
at the University of New England, has developed faster yet accurate methodology to test for Avian Adenovirus.
Her paper, which was delivered at the Australian Poultry Science Symposium in February 2015, ‘A Loop Isothermal Amplification Assay to Detect Fowl Adenovirus - 8 in a variety of poultry materials’, attracted quite a lot of interest, including from Poultry Digest.
Following this article is her paper in full, which explains the nature of her research and its potential for early disease identification and as a key step to protect the poultry food chain.
Dr Katrin Renz demonstrates how to use the Genie III instrument in her lab at UNE.
Ross ® 308 is Simply the Better Bird
The Ross 308 facts:
• Leading FCR
• Excellent Meat Yield
• Low Cost Production
Choose the better bird.
www.Aviagen.com/Ross
Ross 308 Better Bird_Poultry Digest.indd 1 8/11/14 11:55 AMPoultry Digest Magazine 210mm X 297mm
12
14. Katrin Renz’s research and her use of state of the art technology offers the broiler industry a vital opportunity to identify potentially troublesome pathogens quickly, thus giving integrator management the opportunity to take whatever remedial methods are called for.
Katrin reckons that the little Genie unit is not only more accurate than the PCR unit back at her lab but costs far less.
“This advance in technology can significantly shorten the time taken to identify potential disease threats and thus give poultry industry management the opportunity to intervene on farm earlier and reduce the risk of costly bird health and welfare issues,” Katrin said.
The RIRDC supported program should also deliver a confidence boost for consumers who are constantly bombarded by negative messages from publicity seeking animal welfare groups.
Katrin’s research offers a clear example of a sensible scientifically based aid to better welfare and production safety outcomes.
At this stage it is important to observe that the Loop technology research is specifically aimed at assisting existing integrator management and relevant field staff as well as vets to achieve a quick yet robust indicator of disease presence on farm.
At this stage it is not intended to be used by the farmers themselves though in the case of really experienced managers like Peter Cashman, the Farm Manager on the Peats Ridge property we visited, who watched the whole testing procedure from gathering samples to preparing the Genie tests there may be opportunities in the future.
Poultry Digest asked Katrin a simple question. Could someone with Peter’s extensive experience conduct the tests we had just completed?
“With a little training – absolutely,” Katrin replied.
“The Loop Isothermal Amplification Assay is not the ultimate answer to disease detection but it can give an indication that further tests and actions need to be taken and the time saved in the initial LOOP test shortens the time in which to develop solutions,” she said.
Poultry Digest wants to acknowledge the time and valuable assistance given by Graham Fripp in allowing access to his farm and Peter Cashman, his Farm Manager who assisted Katrin in preparing the on-farm test.
Thanks also to UNE for providing a vehicle to get us from Armidale to Peats Ridge and to RIRDC for providing funding for this valuable program.
Sean McDonald, genome analyst and product manager for GeneWorks,
1. Katrin collects dust samples. 2. Genie III runs a test sysle in the laboratory at UNE. 3. Katrin prepares tissue samples on-farm. 4. Farm Manager Peter Cashman observes procedures with interest.
v
w4
3
1
2
LEADING SUPPLIERS OF CAGE FREE POULTRY EQUIPMENT
www.potterspoultry.com
Long life, strong and stable Flexible design - maximises stocking density
Australasian Agricultural Services,18 Lennox Street, Redlands Business Park,
Redland Bay, Queensland, 4165
Office phone number: 07 3829 3242Office facsimile: 07 3829 1906
MULTI-TIER AVIARYFOR FREE RANGE AND BARN SYSTEMS
NESTING SYSTEMSFOR BREEDERS AND LAYERS
SLATS SINGLE AND TWO TIER NESTSFOR LAYERS
Rack & Pinion lifting floor with original AstroturfProbably the strongest and most stable available
14
the Australian agent for the UK based company OptiGene, which manufacture the Genie units, has been generous beyond belief in lending Katrin a valuable and much in demand Genie III unit. Both Katrin and Poultry Digest thank him for this.
Finally there is Katrin herself who is a tireless and enthusiastic worker in advancing the cause of poultry science.
The OptiGene Genie III that features in the article on Katrin Renz’s research program is distributed by Adelaide based Geneworks.
“GeneWorks Pty Ltd is an Australian supplier of leading edge molecular biology research products,” said Sean McDonald, Product Manager for the OptiGene products.
“Based in Adelaide, GeneWorks has a diverse business which includes manufacture and supply of custom oligonucleotides, distribution of innovative technologies, and a genomic services laboratory facility,” Sean explained.
“Since mid-2013, GeneWorks has represented OptiGene Limited in Australia.
“Based in the UK, OptiGene develops innovative products that support sensitive and specific detection of bacteria and viruses for use in the fields of plant health, food safety, veterinary medicine, environmental monitoring, healthcare and bio-defence.
“OptiGene has developed the Genie instrument, a sophisticated open platform instrument that will support all isothermal amplification methods,” Sean said.
“Ultra-sensitive molecular detection can now be deployed to point of application and run with very little training, producing results in minutes.
“The OptiGene Genie III offers great savings over other currently available technology designed to achieve the same ends.
“Further, as a result of being portable and battery powered, it can be used on-farm to get a diagnosis in less then 45 minutes,” Sean said.
“Cost depends on the specification but typically is around the $20k mark per unit.
“We are considering leasing plans for clients who want to test the Genie unit for themselves and those plans depend on the length of time requested by a client.
“Interest in the Genie from many areas of both food and crop industries has been strong,” Sean concluded.
So what now for Katrin’s research?“I do need more field samples to
test all my assays and I especially need samples that might contain Mycoplasma. Another week or two with the Genie would be perfect though I do appreciate that might not be possible as it is in such high demand,” she said.
Below: Readouts from the Genie III showing the results.v
1
2
Two Genie instrument options are manufactured by OptiGene, the Genie II and the Genie III.
Both are portable, robust, field-deployable instruments that allow molecular detection of nucleic acids at point of application.
Utilising fluorescence excitation and measurement, Genie instruments are used for isothermal amplification of DNA and RNA, and are controlled using a simple and intuitive touch-screen interface that requires minimal training.
Genie II is the larger of the two instruments, having two independent testing units.
This allows two completely separate tests of eight samples to be run at once, or 16 samples of the same test together.
Data can be easily transferred to a PC via USB interface.
Genie III is a more compact unit that can be held in one hand, having a single testing unit capable of running eight samples per run.
In addition to the features of the Genie II, the Genie III boasts wireless capabilities and also features satellite
Genie instruments from OptiGene
positioning via an integrated GPS receiver.
OptiGene instruments and consumables are available in Australia exclusively through its Australian distributor GeneWorks Pty Ltd which is based in Adelaide.
The OptiGene Genie III instru-ment available from GeneWorks Pty Ltd.
* Shed Wash Service* Spray Sanitise & Fumigation
* Beetle Spray Service* Water Sanitisation
(Chlorine Dioxide/Chlorine)* Brood Paper Supplies
* Feed Caddy * Litter Management* Litter Amendment * Odor Control
* pH Correction * Chemical Supplies* Ammonia Meters & Testing Equipment
* Personal Protective Equipment (PPE) * Drum Pumps
Office: 4942 3334 | Lisa: 0427 886 866 | www.prowashpoultry.com.au
BATCH TO BATCH POULTRY SPECIALISTS
012
221
012221 Prowash Full Page Ad 02.indd 1 15/12/2014 12:05:42 PM
BROOD PAPER ROLLSPro Wash Poultry now stocks a full range of Brood Paper Available in Single Rolls or by the Pallet
TISSUE & NEWS PRINTAll sizes available 900mm to 1500mm Wide and 250m to 1400m in Length
GREAT PRICES AND DISCOUNT DELIVERY TO PRO WASH POULTRY CUSTOMERS
The only supplier of Chlorine Dioxide to the Poultry Industry with direct industry experience and understanding!
• Effective Fast Acting Sanitation
• Eliminates Biofilm & Prevents Biofilm Re-Growth
• Eradicates Microbial Contamination: bacteria, viruses, fungi, mould and odour
• Effective Over a Wide pH Range
• Cost Efficient & Easy to Use
• Automatic Dosing Provides Continuous Protection
18
NEWS
1. Yes it’s big and this was a quiet time early in the day. 2. LtoR: Ruwald Berculo, VIV Project Manager; VIV Asia Poultry Personality Pak Don; Nigel Horrocks, Positive Action Publications. 3. Virginie Hervy from Idena at ‘Meet The Press’.
VIV Asia 2015 showcases complete global feed to meat supply chain
and waste recycling are growing in importance as the Asian food market becomes more broadly based and sophisticated in response to growing consumer demand for safe and affordable protein.
Other innovations that were welcome were the extentsion of hours that the exhibition halls were open until 8.00 p.m.
Given the sheer numbers of business attendees – at least 25,000 – just getting around the stands can be a challenge with so much to see and do.
The Exhibitors’ attitude to the extended hours was very positive.
For some time there has been an initiative by the organizers of VIV Asia, called ‘Meet the Press’.
Over the years this has been refined from a separate event that precedes the actual event to an integral part of the 3-day exhibition and conference.
‘Meet the Press’ this year was held on March 9 at the Bitec venue and 28 companies had a three minute window to tell the press who they were and what they did.
Following the presentations, journalists had a few minutes with each company’s representatives to discuss their activities in more detail.
Given the number of exhibitors and the limited time available to explore all the stands, ‘Meet the Press’ is a
The VIV Asia livestock exhibition and conference event was held once again at Bitec Bangkok, Thailand from March 11-13 this year.
The simple concept of VIV Asia is to showcase the complete global feed to meat supply chain.
“Consumer attitude and behaviour towards food is rapidly changing on a world wide scale,” the organisers of VIV stated.
“Today there is a strong focus on health issues, including healthier food.
“The demand for convenience food products, in smaller ‘ready to eat’ portions is on the rise,” said Ruwald Berculo, VIV Asia’s Project Manager.
“Consequently the importance of delivering fresh and safe meat products with an extended shelf life is increasing.
“Packaging is becoming more important in the selling process: fresh foods should be conveniently packaged and easy to store,” he said.
In the 10 years or so since Poultry Digest has been attending this event it has changed from a primarily Thai farmer driven event with international interests to a major global business to business focused event with a distinctly Thai flavour.
Initially focused on poultry and pork production, VIV Asia now includes dairy, aquaculture and whole of protein production from feed to meat.
Now, not only is it a truly international event but major agri producing countries take blocks of stands in the exhibition halls. This year it was the turn of Holland whose dominance in intensive livestock technology for a comparatively small nation was on display both in the trade halls and lecture theatres.
The country had its own pavilion, as did the USA at the 2015 event.
Many companies take advantage of the VIV Asia week to hold their own seminars both on and off site.
Poultry Digest attended events organized by US-based Animal Science Products, Alltech, Nutreco and recruitment organization AgJobs Asia.
Once again the number of exhibitors increased again in 2015; 863 participants filled the seven main exhibition areas.
Poultry still dominates but aquaculture, dairy and this year biogas w
1
2
3
Highly effective againstAvian Influenza including H7
NEWSvaluable tool to help journalists zero in on new and innovative products that will appeal to their readership base.
Journalists from 42 news and media organisations including Primary Media participated in the exercise.
Poultry Digest formed at least half a dozen useful contacts with companies whose products would have appeal in the Australasian market.
The opening ceremony on the morning of March 11, maintained the tradition of formality with keynote speakers and dignitaries from government.
For 2015 however, the formality was mixed with entertainment as talented young Thai musicians performed for guests at the official opening.
The presentation of the Personality Awards VIV Asia, an initiative of UK based Positive Action Publications and VIV Worldwide, included the 2015 Asian Poultry Breeding Personality which was Bahadur Ali.
“Mr Ali today operates the largest vertically integrated broiler operation in central India and from his well run breeder and hatchery operations produces broiler chicks which attain one of the best levels of FCR in his country,” stated Nigel Horrocks, Managing Director of Positive Action Publications as he presented the award.
The award for VIV Asian ‘Poultry Personality’ was given to Mr Don Poerjono Utoyo, known universally in the Indonesian poultry sector as Pak Don.
“Since 2004 he has been President of his country’s Poultry Society and in this role he has co-ordinated the activity of various industry associations such as breeders, feed mills, broiler, layer and processors.
“In this role he has been a father figure to many in the Indonesian poultry industry,” stated Nigel Horrocks as he presented the award.
There were many Australian and New Zealand identities present at VIV Asia 2015.
For the poultry industry there is a consistent emphasis on new technology including broiler cage systems, which the Australian broiler sector still studiously avoids.
Layer farming is big in Asia and equipment for that sector was very much in evidence at VIV 2015 as Asian egg consumption continues to rise.
Chinese influence at VIV Asia remains high, there was a little less emphasis on equipment at the 2015 event but more stands representing companies selling feed additives and
animal health products most of which would struggle entering Australia due to regulatory compliance.
VIV Asia consistently delivers a treasure trove of new products and innovation for the Australian industry.
For those who take the trouble to visit the event the rewards are plenty and then there is Bangkok’s vibrant nightlife and the opportunity to socialise and enjoy the bustle of an Asian mega city.
Not appreciated on this trip was an exchange rate (24 Baht to A$) that made many a diner gasp when the bill arrived.
The venue at Bitec is great as is the Skytrain that gets you there from the Bangkok CBD and hotel belt.
We noticed that overnight the construction workers building the new high rise multi story car park had added a complete extra floor level overnight!
Australia talks endlessly about infrastructure development whereas Thailand just gets on with it hurling real estate into the sky at a rate that shames our pedestrian progress.
VIV Asia 2015 was a great event and increases its depth and capabilities event by event – if you didn’t make the 2015 start planning for 2017.
A tip – get there a couple of days before and maybe stay a couple of days after the close of the event. You will meet a lot of people that you need more time with than can be managed in the frenetic exhibition halls.
Apart from the business aspect Poultry Digest enjoyed the company of friends from both Australia and overseas.
Also thanks from Poultry Digest team to Arne Overgaard and the Skov team for providing a great trip on the river and fabulous dinner.
The bus ride at ‘Rush Hour’ from Bitec to the river trip in the centre of Bangkok through what is possibly the world’s worst traffic was the stuff of legends!
Due to lack of space and the large number of events and trade show displays we would like to bring you, Primary Media has produced a 16 page special VIV Asia magazine which is available to view or download on our website.
Go to www.primarymedia.com.au/latestissues. Or click on the QR code to take you straight there.
20
v
1. Nick Nettle from Novus with Dr Santiago Ramirez 2. Simon Mckenzie and Peter Schreurs from Vencomatic. 3. Mike Button from Potters Poultry. 4. Jimmy Chand, Bromley Park, Peter Mathews AAS Pty Ltd and Jonathan Cloete, Bromley Park.
1
2
3
4
Call for a quote: Etienne Misfud on Mob: 0428 481 811 or 0417 481 811 Office: (02) 4774 8764
Fax: (02) 4774 8415 Email: [email protected]
R & E SHEDSBuilt to Last
• Over 20 years experience in building poultry and machinery sheds• All styles of sheds – conventional, free range and tunnel sheds• Well known reputation for fast and efficient erection time without
compromising good quality workmanship• As the owner of R&E Sheds, Etienne Misfud oversees the whole job from
start to finish• Repairs, extensions, insurance work to any existing sheds• All sheds can be customised to suit any clients’ needs• All structural steel work manufactured at R&E Sheds, so no delays on
completion of the project• No project too small or large• We travel to all areas of Australia and New Zealand• Fully licenced to build interstate or overseas
R & E SHEDS
Call for a quote: Etienne Mifsud on Mob: 0428 481 811or 0417 481 811 Office: (02) 4774 8764
Fax: (02) 4774 8415 Email: [email protected]
R & E SHEDSR & E SHEDSBuilt to Last
• Over 20 years experience in building poultry and machinery sheds• All styles of sheds – conventional, free range and tunnel sheds• Well known reputation for fast and efficient erection time without
compromising good quality workmanship• As the owner of R&E Sheds, Etienne Mifsud oversees the whole job from
start to finish• Repairs, extensions, insurance work to any existing sheds• All sheds can be customised to suit any client’s needs• All structural steel work manufactured at R&E Sheds, so no delays on
completion of the project• No project too small or large• We travel to all areas of Australia and New Zealand• Fully licenced to build interstate and overseas
Project5:R&E Shedsfinal 25/03/14 2:26 PM Page 1
22
AB Vista held its Inspire Seminar at the Royal Sydney Motor Yacht Club, Point Piper NSW on February 8 2015, just prior to the Australian Poultry Science Symposium 2015.
Australian AB Vista distributor Brett Ruth opened the seminar and Dr Mike Bedford, AB Vista’s Research Director explained the origins of Inspire Seminars, which were, “to deepen the understanding of Non-Starch Polysaccharides (NSP) enzymes by bringing experts from all over the world for open discussion on NSP enzymes,” he said.
“Further we want to clarify misunderstandings of xylanase modes of action, and, of how to assay and compare NSP degrading enzymes. Then we want to provide direction for future research,” Dr Bedford explained.
“Inspire has evolved into a series of events taking place across the world, and now combines high level research with practical end user applications.
“We want to share new knowledge and thinking on NSP use and discuss what this means in reality.
“Just as importantly – bring profitability to your business, and nutritional programs,” he concluded.
Next Professor Mingan Choct spoke on the topic of ‘Feed Carbohydrates: chemical structures and nutritional properties’.
“A typical poultry diet contains up to 70% cereal grain and 25% soybean with a digestibility level of 75-85%, also typically 14-25% is undigested,” he revealed.
In summarising nutritional properties of NSP he stated that “soluble NSP are anti-nutritive, depending on their viscous nature, and insoluble NSP at appropriate levels can positively affect gut health,” he said.
Future developments he predicted were , “enhancing gut health through the release of pre-biotics and degrading sufficient amounts of insoluble NSP to monomers through the use of enzymatic, mechanical and thermal processing,” he concluded.
Mike Bedford returned to the podium and posed the question ‘How do Xylanases work?’
“Typical modes of action were that xylanases reduce intestinal viscosity in wheat and barley diets and produce
NEWSAB Vista Inspire Seminar held at Royal Sydney Motor Yacht Club
oliogosaccharides, pre-biotics,” he said.“Do you need more than two
enzymes?” he asked.“In the example of lysine, 88%
digested (12% undigested) a first enzyme (phytase) can increase the digestibility of the undigested fraction by 25% (i.e. 3%) leaving 9% undigested.
“A second enzyme (xylanase) can increase digestibility of the undigested fraction by 25% (i.e. 2.25%) leaving 6.75% undigested.
“The addition of a third enzyme (e.g. glucanase) can increase the digestibility of the undigested fraction to 95% (i.e. 1.75%),” he revealed.
No event involving such matters as were raised at the Inspire Seminar would have been complete without a contribution by Dr Peter Selle.
His paper ‘Phytate as an Antinutrient: theories to explain the empirical effects of phytase on amino acid digestibility’ was prepared with the assistance of brilliant side kicks at Sydney University (Camden) Poultry Research Foundation, Ha Troung and Sonia Liu.
In a wide ranging review of current and past research into his topic Dr Selle suggested “if you make predictions ‘off goes your head and on goes a pumpkin’.
In discussing modes of action for ‘The Sodium Pump’ Dr Selle mentioned research conducted by Sonia Liu in 2008 ‘Phytase has been shown to enhance sodium pump activity (and increase glucose concentrations in gut mucosa) in broiler chickens’.
Dr Selle concluded with the proposition, “Phytase favourably manipulates starch and protein digestive dynamics to enhance the post – internal balance of glucose and amino acids.”
“Quantum Blue – Superdosing mechanisms’ was the next paper presented by Mike Bedford.
“A four point improvement in FCR worth around $7 per tonne of feed was indicated by six trials conducted on broilers from 0-35/42 days,” Dr Bedford stated.
In the final paper of the day Rob ten Doeschate, Technical Director EMEA, AB Vista spoke about specific benefits of ‘Superdosing with Quantum Blue,
which were, phytate destruction, the provision of micro nutrients (Ca, Mg, Zn, Fe and Se), provision of inositol and re-phosphotylation as revealed in commercial experience in US and Brazilian livestock industries.
The science done, participants repaired to the bar at the Royal Motor Yacht Club to enjoy the late afternoon sun, views of many millions of dollars worth of floating assets – and a few drinks!
1. Dr Mike Bedford, AB Vista. 2. Professor Mingan Choct. 3. Rob ten Doeschate, AB Vista.
1
2
3
DOL 539 Free-Range Climate and Production Computer
• Large graphic touch screen - navigation via icons on the screen• Special free-range functions
• Automatic change between free-range ventilation and normal ventilation• CO2 control, also in free-range mode• Basic and broiler production facilities
• Pop-holes to be opened automatically or manually (sensor on doors if manually)• Automatic ventilation turned off in free-range mode• Automatic change of alarm for high/low temperature
• CO2 ventilation active in free-range mode (will start ventilation if CO2 is too high)• Pressure alarm
• Fans only operate if needed (too high temperature or too high CO2)• When pop-hole door closes, the program changes back to “Normal ventilation”
All the required functions for ensuring optimum production under any climatic conditions.
Features
SKOV Free-Range Ventilation
santrev_double page_Jan15_O.indd 2 13/01/15 1:24 PM
santrev_double page_Jan15_O.indd 2 13/01/15 1:24 PM
26
PRODUCT FEATURE
The ten shed Inghams contract broiler farm owned by Graham Fripp and managed by Peter Cashman, practices litter reuse using an Italian manufactured Frantumix litter turning machine while birds occupy the shed.
Depending upon weather conditions and the stage in the grow out cycle, the farm turns the bedding once a week.
Eric Fellinkhof who runs Field Serve Pty Ltd, located in the broiler farm dense region of Mangrove Mountain in NSW, is the Sydney/Hunter region distributor for the Frantumix units that are imported by Tuff-Ass Machinery based near Lismore in NSW.
He invited Poultry Digest to visit the Peats Ridge NSW farm to watch Peter Cashman conduct litter treatment in one of their sheds with birds around 30 days of age in place.
As Peter prepared to turn the litter Eric explained the advantages of the Frantumix.
“As the blades run in a fully encased unit, dust is minimised and so there is less risk of foreign objects within the litter being turned into potentially dangerous projectiles,” he said.
“The Frantumix units function by scooping the litter from the floor by means of the patented lifting blade under the machine and then pulverising the material which aerates it, thus reducing odour and drying it out.
“As the majority of our clients run sheds with clay based floors, it is vital that litter treatment using powered equipment does not damage the flooring material,” Eric explained.
Quietness of operation is also an important consideration for turning litter with birds in place and this was an important feature when Graham and Peter decided on the Fantumix unit.
On the day Poultry Digest visited the Peats Ridge farm there had been a prolonged period of both heavy rain and high levels of humidity yet the bedding was dry with no sign of odour.
Peter told us that there had been two batches raised previously and the litter treated at weekly intervals.
With a venerable David Brown Tractor carrying the Frantumix 170FL4 (200 mm working depth- 1.7 m blade width) unit we followed Peter with the camera.
One of the shed managers walks slowly in front of the tractor to make
Broiler grower demonstrates effective, safe in-shed litter treatment with birds in place
sure the birds move out of the path of the operation and also to keep a look out for any loose foreign objects in the litter or clay floor base.
The birds part then just as quickly return to the processed litter path behind the Frantumix. The only noticeable odour is from the diesel exhaust of the long serving tractor!
The whole operation takes less than an hour and the birds seem hardly to notice.
“The blade works close to the floor turning in the reverse direction to the tractors path and it scoops the material and projects it toward a screen inside the cowling of the device: large particles that won’t pass through the screen are dropped back into the blades to be further pulverised,” Eric explained.
Peter Cashman stated they had
Top: LtoR: Farm owner Graham Fripp, Farm Manager Peter Cashman, Leading hand Michael Seymour and Eric Fellinkhof from Field Serve Pty Ltd. Above left: The Frantumix is quiet and causes little dust. Above right: The unit scoops litter from the floor base with minimal disturbance to the birds.
opted to acquire a Frantumix litter processor, “because it was quiet, safe and minimised dust levels during operation,” he said.
Our thanks to Graham Fripp, Peter Cashman and his staff for helping us to better understand the practicalities and practice of litter management using powered recycling machinery.
In the August/September 2014 issue of Poultry Digest we ran a story on the Frantumix range after an interview with Shaun Stead, the Managing Director of TuffAss Machinery which gives more detail on the product range, technical aspects and history behind the Frantumix design.
Go to http://issuu.com/primarymedia/docs/pdaug_sep2014lores, to catch up on that information.
FRANTUMIX POULTRY LITTER CONDITIONER
FRANTUMIX from TUFFASS litter conditioners are the only machines in the world designed specifically to prepare and maintain bedding and litter for poultry including chickens, turkeys and ducks.
These machines lift wet hard caked litter from the floor then crumbles, turns and aerates the material properly helping to overcome nearly all problems associated with litter, keeping it soft, dry and healthy which greatly reduces the smell and harmful gasses during the entire growing cycle, while producing stronger healthier birds.
Designed and patented in Italy, our Frantumix from TUFFASS litter conditioners have been developed from over 10 years of continuous use and collaboration with growers during that entire time. Over 10,000 machines sold globally, so look at the rest and then buy the best FRANTUMIX, when the right result matters. Visit the website to view videos of machines working with both chickens and turkeys.
FRANTUMIX FL4Our entry-level poultry litter conditioner for litter up to 200mm, including shavings, rice hulls, sawdust and chips
FRANTUMIX FM4A heavy duty poultry litter conditioner, up to 300mm litter depth, specifically designed to handle all bedding materials including wheat straw
TUFFASS Machinery Pty Ltd414 Davis Rd
Jiggi (via Lismore) NSW, 2480www.tuffass.com.au
Phone: 02 6688 8367 Mobile: 0429 668 881
East Coast Spreaderswww.eastcoastspreaders.com.au
Phone: 02 6688 8065 Mobile: 0429 668 881 Sydney/Hunter: Eric at Field Serve 0400428712QLD: Ben Mathew at Ag Services 0409054205
28
PRODUCT FEATURE
Thermal Equalisation De-Stratification Units
The Thermal Equalisation De-Stratification (TEDS) solution has proven to decrease the amount of gas required to heat a poultry shed, thus providing ongoing cost savings in terms of gas consumption and environment livability.
A significant reduction in the running costs was recorded for the gas consumption of up to 40%.
Additional perceived benefits to the operational aspect were observed:• A significant reduction in the mortality.• Feed consumption was reduced while on average the birds in the treated sheds had superior weight gain throughout the cycles.• An additional benefit to the operational aspect is the reduction in CO2 levels at the bird level.
Running costOne of the most exciting aspects of
the TEDS is its ability to offer significant savings with negligible running costs. The TEDS units tested operate at low wattage between 11 and 15 watts, or 110 to 150 watts for a shed with 10 operational units.
It must be stressed that only 21 types of fans were tested and represent only a small fraction of fan types and units out in the market. Other units in the current market may perform as well. A range of fans were tested from ceiling fans to existing poultry house stirring fans and current de-stratification units.
Selection criteria of TEDS• an ability to operate smoothly in the harshest conditions of the poultry shed environment. • easy to install and operate• cost of units and installation cost • economic benefits and health benefits directly associated with the use of the TEDS units.
IntroductionStratification is a term used
to describe the difference in air temperature between the floor and roof of an enclosed structure. De-stratification is achieved by efficiently balancing these temperatures from floor to roof.
This project aimed to implement a de-stratification solution in poultry sheds to capture and recycle heat from the roof, sending it back to the floor level. This required the installation of commercially available and specifically designed de-stratification units in
poultry sheds during entire growing cycles.
In the case of poultry growing sheds, this is costly in a shed being heated using gas heaters; first the roof is heated followed by the main cavity of the building and infrastructure and finally the floor is heated. As the birds are grown on the floor most of the heat is wasted on heating every other part of the building.
Through the implementation of a TEDS solution, ‘cleaner’ hot air in the roof is forced down to the floor continually. In this manner, the cleaner (e.g. less CO2), hotter air in the roof is recovered and forced down very gently at low speed and low volumes of air, to where it can provide use for the birds, the floor without creating a chill factor on the birds. Significant amounts of wasted hot air is recovered from the roof and recycled.
Project aimsThe project aimed to determine
whether the following benefits make this technology a cost effective commercial investment. • Determine the shift in temperature at the floor and at the roof to enforce ‘Thermal Equalisation’• Determine whether the change in Thermal Equalisation is able to reduce gas consumption in the heating of the shed and any equivalent savings in carbon emissions and quantify this potential saving.• Monitor the effect of the de-stratification on the birds throughout the growing period in terms of morbidity, feed consumption, growth rates and air quality at the bird level.
Trial methodology(a) Two poultry sheds were selected in the same location with the same dimensions and construct, housing the same number of birds (i.e. identical sheds). One was the control facility and the other implemented the strategic TEDS solution.(b) The TEDS solution was trialed across two growing periods in different seasonal conditions in:
i. Poultry test sheds ( Scolexia Animal Research Facility)
ii.Poultry Rearing sheds (commercial farm)(c) Any notable difference in the running of the sheds were recorded
including percentage gas consumption, temperature at bird level and apex of the shed, feed consumption, bird weights, mortalities and CO2 levels.(d) Shed cross-over testing was implemented to ensure that results were not due to any potential differences in shed conditions.
MeasurementsThe following categories of
measurements were applied:1) Air temperature in the roof,
body and floor of the sheds using temperature data loggers. The ambient air temperature was recorded daily during the experiment timeframe;
2) Landis & Gyr Gas meters (detail of supplier) were attached to the shed inlets measuring the amount of gas consumed in each shed;
3) Average feed consumption per bird during the trial;
4) Average weight gain per bird over the trial period;
5) Actual mortalities during the trial;6) Air quality in the form of CO2
levels at bird strata7) A general observation on bird
spreadAs this evaluation was conducted
in a commercially operated shed environmental changes are to be expected and are unavoidable. However, to try and mitigate this as much as possible data has been logged across several distinct growing periods to highlight any anomalies.
ResultsThree of the commercially available
units tested (excluding current poultry de-stratification systems), were identified having good results and ticking all the boxes as per the selection criteria.
These three – A, B and C – commercially available fans, outperformed all of the other fans tested with all three having a significant reduction in the gas consumption.
Additional perceived benefits to the operational aspect were observed:• A significant reduction in the mortality.• Feed consumption reduction was recorded, all while the birds on average outperformed the control and other sheds in regards to weight gain throughout the cycle.
By FERNANDO FERRAIRA, Scolexia Project Manager
w
AgriCool®
The Proven Destratifi cation Fan
The AgriCool® Destratification Fan is a specialised solution to reduce the temperature
differential between your shed’s ceiling and floor without affecting bird comfort.
The Destratification Fan moves the air on a constant basis from high, hot areas to lower,
cooler areas, and uses less power than a traditional light bulb. AgriCool® fans provide
effective and reliable growing conditions for broilers through even airflow and high efficiency.
www.agricool.com.au
Agri Ads ep Design_Destrat.indd 1 25/03/2015 4:44 pm
30
• An additional benefit to the operational aspect is a significant reduction in CO2 levels at the bird living strata, was recorded in the test sheds in relation to the control sheds.
Key atributes• Coverage diameter. The units tested are designed to cover a 10 to 14m diameter circle from a roof apex height of 4.3m • Minimal running costs. The units tested had low wattage motors (comparable to a single light bulb) between 8 and 15 watts / motor.• CFM. The tested units offer an air volume velocity of between 119 L and 310 L• Minimal noise. The units tested operates at 15dBA
Gas consumptionThe following graph gives an indication of the results
attained during the test periods.
Considering that the two sheds are identical and thermally rated, there is a significant reduction in the consumption of gas in the Test Shed when compared with the Control Shed.
TemperatureThe data shows that the environment temperature at
bird height was stable and effective while the TEDS were operational. For the start of each cycle the shed temperature was set at 32ºC in order to receive the day old chicks.
As the birds grew, the heat in the room was slowly reduced down to 22ºC from the starting temperature of 32ºC. The trial demonstrated that the required temperatures were met at bird height even during cold spell conditions.
TEDS operates in a unique manner as they force air down vertically and at a low air velocity (which does not affect the birds and does not dissipate the heat) unlike similar products on the market which force the air in a horizontal motion with a large amount of air flow that create a chilling effect and moves the heat away from the chicks on the floor.
When internal circulation fans are directed downward it causes a large amount of air flow over the birds with removal of heat being their primary function.
A concern was the potential for creating cold spots throughout the shed which would affect the birds’ health, forcing them closer to the walls away from the fans located at the center of the sheds.
A key indicator to the success of the TEDS in a poultry shed environment was noted with the birds brooding directly under the flow of the air.
Temperature & Analysis: Trial Period 23/12/10 - 14/01/11ON – OFF Cycles Tables: The de-stratification fans were
set to operate in ON-OFF Cycles: (see the table below)Trial - Three Cycles: (summary of all treated sheds). Note
the three cycles of on/off operation of the fans covered the first 16 days of brooding.
Cycle 1:
Cycle 2:
Cycle 3:
The test shed average for CO2 levels over 22 days was 0.139 vol% or 1390ppm at bird level
The control shed average over 22 days was 0.161 vol% or 1610ppm at bird level
The feed consumption reduction was reduced, while weight gain was increased in the birds in the treated sheds. This was an unforeseen outcome and more testing needs to be undertaken to verify this.
A further unforseen benefit was a significant reduction in the mortality rate in the test shed compared to the control shed. Once again, more testing needs to be performed to verify this result.
ConclusionDe-stratification in poultry sheds during brooding periods
led to significant savings in gas consumption, a more even temperature throughout the sheds and a re-distribution of heat from the roof to the bird level in the shed. During and after brooding a further air quality benefit was identified and tested with a reduction in CO2 levels at the bird level in the shed. Also during and after brooding additional perceived benefits were observed in reduced mortality, reduction in feed consumption with added weight gain of the birds.
Of the units tested the three models (A, B and C) provided the greatest savings in gas consumption. Other products similar in nature are commercially available but may not maximise potential efficiencies. Testing is ongoing.
PRODUCT FEATUREv Temp C
Cycle 1 Cycle 2 Cycle 3
Roof Floor Change Roof Floor Change Roof Floor Change
Min 20.374 17.125 2.726 25.335 21.603 3.452 27.529 23.662 3.156
FAN OFF Avg 25.28 20.325 4.958 29.163 24.071 5.092 30.125 25.385 4.74
Max 30.458 22.98 8.213 36.282 28.713 7.855 35.222 28.189 7.944
Min 21.442 19.246 1.368 23.251 21.714 1.131 27.72 24.517 1.752
FAN ON Avg 24.939 22.601 2.338 26.194 24.111 2.083 29.14 27.021 2.119
Max 29.927 25.771 4.724 29.513 25.934 3.809 30.472 28.02 3.861
32
HEALTH FEATUREA loop isothermal amplification assay to detect fowl adenovirus – 8 in a variety of poultry materials
A variety of molecular tests to detect avian adenoviruses are available, but they are either time-consuming or not specific to Fowl adenovirus serotype 8 (FAdV-8).
Therefore, the aim was to develop a loop isothermal amplification (LAMP) assay to specifically detect FAdV-8 in a variety of poultry samples, particularly dust, feaces and litter.
The LAMP assay is a particularly rapid, robust and a low cost molecular test yet with a sensitivity comparable with the real-time PCR technique. Samples were analysed from chickens experimentally infected with FAdV-8 and derived from both tissues and environmental samples, including dust, litter and faeces.
The LAMP results matched with those obtained from a generic FAdV real-time PCR test and the LAMP test has shown no cross-reactivity with FAdV serotypes 2, 9, or 11. I.
IntroductionAdenovirus infections are
ubiquitous in commercially farmed birds and probably in all avian species. The viruses belong to the family Adenoviridae, genus Aviadenovirus. Certain serotypes and species are known to be associated with primary diseases, such as inclusion body hepatitis (IBH) (Ojkić et al., 2008).
Commonly involved in IBH is Fowl adenovirus serotype 8 (FAdV-8) belonging to the species Fowl adenovirus E.
Signs of FAdV-8 infection typically include acute mortality induced by hepatitis in birds 3-7 weeks of age. Diagnosis can often be made based on post-mortem lesions, particularly in the liver, which appears swollen, yellow, mottled with petechiae and ecchymoses.
The duration of the infection usually ranges from 5–14 days with morbidity of 10–30% and a daily mortality of 3–5%.
A range of generic and serotype-specific tests to detect FAdV are available including ELISA (Calnek et al.,
By KR RENZ1 , RR ACHARI1, SW WALKDEN-BROWN1 AND ME KATZ2
1982; Saifuddin et al., 1990), real-time PCR (Romanova et al., 2009; Günes et al., 2012) and PCR followed by restriction enzyme analysis (Zsak and Kisary, 1984; Meulemans et al., 2010).
These tests, however, are either not FAdV-8 specific or expensive and time-consuming, so the aim of this study was to develop a rapid, low-cost and robust molecular test to specifically detect FAdV-8 in a variety of poultry sample materials, with a particular focus on environmental samples such as dust and litter or faeces.
The loop isothermal amplification (LAMP) method is not very recent (first reports from Notomi et al. 2000), but it is a rapid and a low cost yet sensitive method for detection of both DNA and RNA.
This method does not require a thermocycler as the target sequence is amplified at a constant temperature of 60-65 °C using polymerases with DNA strand displacement activity.
The method usually uses 4-6 specific primers resulting in fragmentation of the target sequence and relies on DNA/cDNA strand displacement and autocycling performed by specific DNA polymerases.
Due to the specific nature of the action of these primers, the amount of DNA produced in LAMP is considerably higher than PCR based amplification. The final amplification products are cauliflower-like structures with multiple loops, which result in visible turbidity due to precipitation and allow visualization via simple detection approaches (spectrophotometer, UV light). This method can deliver results that have similar sensitivity and specificity as real-time PCR assays.
For the LAMP assay, the aim was to develop a qualitative assay, without absolute quantification.
Materials and methodsPrimers were designed based
on the FAdV-8 sequence, GenBank accession no. GU734104, targeting the open reading frame (ORF) 33a, which is unique for the FAdV-8 serotype (Grgic et al., 2011).
The primers were designed using LAMP designer 1.10 (Premier Biosoft, USA) and are given in Table 1.
FAdV-8 standard material was prepared from a serotyped cell cultured virus kindly provided by Dr Edla Arzey, of the Elizabeth MacArthur Agricultural Institute, Camden, NSW, Australia. Genomic DNA was extracted using a
Table 1 - Primers used for the FAdv-8 Lamp assay
Primer name
primer sequence (5’ -3’) Primer location in GenBank acc.no. GU734104
F3 GGCAACTCCGAAGATCAC 40123- 40140
B3 GGCGTGGTAGCAATAAAGA 40334- 40352
FIP TCCGTAAGTGGAGCGTTGCGGTACTGTGACACCTTGC 40176- 40244
BIP GCGAGCGAACAATAAATCTGCGAAGAGTCGGCTTATATATTCCC 40263- 40332
LOOPF GGGTCGGGTTCCCTTTTC 40202- 40220
LOOPB GTGTGCTCTAGGCGGAAG 40289- 40307
w
33
GRIFCO WINCHES - THERE IS NO EQUIVALENT!
DON’T RISK IT! SPECIFY GRIFCO FOR ALL YOUR SHED WINCHING
MUSCLE
A GENUINE
4
4
100% Australian manufactured with comprehensive 2 year warranty
Super accuratelaser cut frame
– 6mm
K1045 high strength directional shaftTwin self aligning
bearing blocks
$20 million of productliability insurance
1 HP (750W) Grifcodesigned electric motor
Built in limits
Australianmade
reduction box
Genuine
GRIFCO
products
15 Dell Rd, West Gosford NSW 2250 Ph (02) 4323 3877 Fax (02) 4323 3882 Mob 0417 311 225
Email: [email protected] Website www.chamberlainanz.com.au
Full factory supportAustralian
made
Danisco Animal Nutrition
Copyright© 2014 DuPont or its affiliates. All rights reserved. The DuPont Oval Logo,
DuPont™ and all products denoted with ® or ™ are registered trademarks or
trademarks of DuPont or its affiliates.
Lower your feed costs, improve uniformity and increase raw material
flexibility, while reducing environmental impact with these innovative
feed solutions.
MORE PROFIT FROM IMPROVED NUTRITION
Contact our distributor Feedworks, Australia. Tel: 03 5429 2411
Email: [email protected] [email protected]
Used alone, or in combination, these reliable, heat stable enzyme and
natural betaine products are customized to increase nutrient availability
and improve profitability for poultry producers.
w
34
DNeasy blood and tissue kit (Qiagen, Australia) following the manufacturer’s instructions.
The DNA was quantified using a NanoDrop ND-1000 UV-Vis spectrophotometer (NanoDrop Technologies Wilmington, USA).
The absorbance ratio of the sample at 260 and 280 nm was assessed as a measurement of DNA quality. In order to determine the sensitivity, tenfold serial dilutions of FAdV-8 standard material starting from 5 ng/μl per reaction were prepared for standard serial dilutions.
To confirm the specificity of the LAMP assay, purified standard PCR product using the F3 and B3 primer were sequenced. The FAdV-8 LAMP was also performed using FAdV- 2, FAdV-9 and FAdV-11 DNA as a sample that was kindly provided from Dr. Eva Nagy, Guelph, Canada.
The mastermix per reaction consisted of 9 μl Isothermal mastermix (Optigene, UK), 1.8 μl molecular grade water, 3 pmoles of each F3 and B3, 12 pmoles of each FIP and BIP, 6 pmoles of each LOOPF and LOOPB in a total volume of 15 μl. The unknown DNA samples were diluted 1:10 and 2 μl of diluted sample was added to the reaction.
The LAMP assay was performed on a Genie II instrument (Optigene, UK) at 65 oC for 45 min. The amplification plots and annealing peaks were analysed using the Genie II software supplied with the instrument using the default settings.
The 20 samples tested with the FAdV-8 assay were obtained from specific pathogen free chickens that were experimentally infected with FAdV-8. The DNA from tissue and environmental samples were extracted using a GeneJet DNA and RNA extraction kit (ThermoScientific, Australia) and also analysed using a generic FAdV real-time PCR assay adopted from Günes et al. (2012).
ResultsAll primers for the LAMP assay were
designed successfully. Standard PCR products using the outer primer set F3 and B3 were sequenced and a BLAST search revealed 100% specificity for FAdV-8.
Based on gel electrophoresis of FAdV-8 standard PCR and FAdV-8 LAMP products, the FAdV-8 LAMP test has shown no cross-reactivity with DNA from FAdV-2, FAdV-9 and FAdV-11.
Tenfold serial dilutions of the standards were performed amplification of samples down to a dilution of 1:1000, achieving a sensitivity similar to that of a generic FAdV real-time PCR (qPCR) assay (230 viral copy numbers per reaction), adopted from Günes et al. (2012). A total of 18 samples originated
from faeces, litter and dust from SPF chickens with known FAdV-8 infection were analysed using the FAdV-8 LAMP and the qPCR tests (Table 2). The FAdV-8 LAMP results matched the qPCR test perfectly. None of the 20 FAdv-8 samples amplified in a FAdV-11 LAMP test; this test is being developed currently.
Discussion The majority of Adenovirus PCR
tests and sequencing data published to date relate to the hexon and fibre gene. These PCR assays detect a wide range of FAdV, and have to be used in combination with sequencing, restriction enzyme analysis or high resolution melt curve analysis to differentiate serotypes.
Many available serological tests such as ELISAs (Calnek et al., 1982; Saifuddin et al., 1990) also do not differentiate between serotypes of FAdV although some more recent commercial ELISA kits do. For this study, FAdV-8 specific primers were designed based on the ORF 33a. This was identified to be unique for FAdV-8 viruses (Grgic et al., 2011), and our findings support this as the specific FAdV-8 LAMP assay has to date not amplified FAdV-2, -9 or -11.
The LAMP technique is by nature highly specific to its target sequence, but potentially less sensitive than real-time PCR assays.
However, there are several
publications reporting LAMP tests as sensitive as real-time PCR assays (Notomi et al., 2000; Huang et al., 2010). The FAdV-8 LAMP test that we have developed has also shown similar sensitivity to a FAdV real-time PCR. Another major advantage of the LAMP technique is its robustness and speed.
Our FAdV-8 LAMP assay has been shown to reliably amplify the target sequence from poultry samples (faeces, dust, litter).
None of these samples were extracted with a commercial kit or any other laboratory method, but only treated with an alkali lysis buffer at room temperature for up to 40min.
Combined with the Genie II instrument (Optigene, UK) which can operate on battery power for up to one day, this would potentially allow to perform LAMP assays on poultry farms, with a molecular test result available within less than 2 hours and approximately 20-30% lower reagent costs compared to a real-time PCR test.
Ackowledgements: This work is funded by the RIRDC
under project PRJ-008714.References are available on request.
1 Animal Science, University of New England, Armidale, NSW, 2351; [email protected] 2 Science and Technology, University of New England, Armidale, NSW, 2351.
Sample ID Sample type Days post infection
Age of birds (days)
qPCR result (Log 10 VCN/mg or 10^6
cells)
LAMP result (+positive -negative)
A Litter 28 29 7.8 +
B Litter 28 29 8.7 +
C Litter 19 19 & 35 0.0 -
D Dust 14 15 0.0 -
E Dust 21 22 0.0 -
F Dust 28 29 0.0 -
G Dust 14 15 8.5 +
H Dust 21 22 8.1 +
I Dust 28 29 8.0 +
J Dust 14 15 8.2 +
K Dust 21 22 8.3 +
L Dust 28 29 8.3 +
M Dust 14 30 7.3 +
N Dust 21 37 7.2 +
O Dust 14 30 7.0 +
P Dust 21 37 0.0 -
Q Faeces 9 25 3.4 +
R Faeces 12 28 1.0 +
S Liver 21 37 0.0 -
T Liver 14 30 0.0 -
v
Table 2: Comparison of FAdV-specific qPCR results and those obtained with the FAdV-8 specific LAMP assay on 20 samples of different types.
35
For more information visit www.vencomaticgroup.com
Vencomatic Group is a global supplier of innovative and sustainable housing and egg collection systems for the poultry sector. We o� er solutions for the layer egg market and chicken meat industry.
With many years of experience, we are the expert in this � eld and a reliable partner for you. Vencomatic Group combines three strong brands in the poultry sector:
• Vencomatic - Housing equipment• Agro Supply - Climate control• Prinzen - Egg handling
36
NEWS
Trouw Nutrition presents ‘Feed to Food – Saftey in the Value Chain’
REDUCE YOUR ENERGY COSTS WITH...
BLOCKOUT BLINDS
• Fan Covers• Brooder/Air Control Curtains• Door Covers• Cool Cell Covers• Shelters/Shelter Covers
Project1:PoltexAd2 21/03/14 3:47 PM Page 1
On March 12, 2015 at the BITEC Centre during VIV Asia, Trouw Nutrition presented its seminar on ‘Feed to Food - Safety in the Value Chain’ to an international audience.
Trouw Nutrition Commercial Director for the Asia-Pacific region Ramakanta Nayak introduced the first speaker Dr Leo den Hartog, R&D Director of Nutreco, the parent company of Trouw Nutrition.
‘Ensuring Feed to Food Safety: from raw materials to your fridge’, was his topic.
Dr den Hartog defined the problem of feeding a growing population while maintaining the production efficiencies needed to produce more protein safely.
“Feed to food safety and quality is realized in Nutrace, our internal quality program to safeguard the quality of Nutreco products and services by using one consistent feed to food quality approach creating value to our customers, food chain partners, and Nutreco,” Dr den Hartog said.
“The quality program is based on five harmonised standards, namely: Certified quality and food safety; Ingredient and supplier assessment and management; monitoring & control; risk management, tracking and tracing.
“Nutrace standards are compatible with international standards,” he said.
“In conclusion, animal feed and
nutrition are crucial in livestock production.
“Innovations have the potential to meet the challenges and to result in resource efficiency, healthy livestock and people, responsible production systems and optimal profit through the value chain.
“Nutreco’s worldwide feed to food safety and quality programs ensures safety and quality from feed ingredients to finished products,” Dr den Hartog concluded.
Pierre van Zon, Trouw Nutrition, Global Product Manager for feed additives, spoke about the risks posed by moulds and mycotoxins and their impact on feed quality and safety.
“Trouw Nutrition’s mould control program includes diagnostic services to perform mould analysis, determine feed shelf life as well as free water available for mould growth.
“Fylax Forte is a feed additive solution, containing activated propionates that increases the porosity of the moulds, outer cell wall, enhancing the mould inhibiting effect of the product,” Pierre explained.
“Specific dosing equipment, including engineering, is also available to safeguard correct application of the product.
“Trouw Nutrition’s mycotoxin control program consists of a combination of a
mycotoxin analysis tool and an effective feed additive solution, branded TOXO, containing multiple animal protection mechanisms, including mycotoxin binding, intestinal protection and immunity support.
“Mycomaster is a rapid mycotoxin analysis tool that combines rapid, cost effective and user friendly analysis.
“Rapidly available analysis results enable raw material quality screening before processing into final feed.
“Mycomaster is packed into a portable toolbox, containing all equipment needed to perform the analysis.
“Mycomaster can also be used in the field, hence bringing ‘the lab to the sample’.
“All Mycomaster devices worldwide are connected to a central database allowing feed and raw material mycotoxin profile comparison, in and between region,” Pierre concluded.
Maarteen van der Heijden, Global Business Manager Feed Additives, Trouw Nutrition spoke about ‘Salmonella Feed and Food Safety Programs’ presenting an analysis of critical points in the feed and livestock
Above: Ramakanta Nayak. Next page, LtoR: Speakers Emma Teirlynck, Pierre van Zon, Dr Leon den Hartog and Maarteen van der Heijden.
37
NEWS
WATCH THE SMOKE TESTwww.ausagservices.com.au/reclaimer.html
NEW
RECLAIMER FANThe money saving way to warm your birds
Call 07 3829 3242 and ask for Scotty to find out more
18 Lennox Street, Redland Bay, 4165 QLD, Australia
IP65 AVAILABLE NOW• Uses de-stratification technology• Recycle hot air from your roof• Doesn’t need special installation• AAS supply hardware to suspend• Reclaim clean air, litter quality & money
industry.“Raw materials and feed are an important source of
salmonella vector in the animal production chain,” he said.“Feed additives can reduce the risk of Salmonella transfer
in feed and between animals.“The key to safeguarding food safety is to identify the
source of the Salmonella contamination.“”Selko offers its customers a unique concept of
Salmonella audits in the raw material and feed production chain, product, hygiene and management consultations to guarantee success with limited resources,” he explained.
“Critical points involving Salmonella risk in the feed mill were – raw materials intake, cooling after sterilisation, in the temperature conditioner/pelletize and cooler and the highest risk of Salmonella transfer in feed was in the cooler/dryer process,” he said.
“Salmonella can hide everywhere and we just need to find it,” he concluded.
The final speaker was Emma Teirlynck, Global Product Manager Feed Additives for Trouw Nutrition.
“The performance results of livestock in the last few decades have systematically improved, largely due to improved genetics.
“However this also implies that we demand that the animals put all their energy into growth and less in protection against pathogens,” Emma said.
“”One major issue we experience in poultry and pigs is impaired gut health.
“Gut health requires a close interaction between the animal itself, its microbiota and the feed and water we provide.
“It is our job to keep our animals healthy by providing them with the best possible care,” she said.
Emma then went on to describe a service tool developed by Trouw and its Selko division to provide service tools and gut health scoring to assist in achieving the ends of better overall health.
This paper was followed by a Q&A session in which all speakers and members of the audience interacted on points raised during the seminar.
PRODUCT NEWSFan performance testing for AgriCool fansAccurate fan performance measurements are essential information for everyone interested in fans for new and existing shed ventilation systems.
“At ebm-papst, the product documentation for all fans is based on measurements taken on certified precision chamber test rigs,” said Christopher Hauck, Sales Manager SA/WA.
“In the case of the AgriCool shed ventilation range, the complete EC tunnel fan assembly with cone and shutter was tested on the test rig for complete airflow and noise measurements.
“Constant internal monitoring of the test facilities used and the values obtained guarantees the consistently high levels of product quality and fan dependability you can always rely on.”
The procedureEngineers at ebm-papst use an aeroacoustic fan test
stand for the simultaneous recording of air performance data and noise values. Therefore the fans are installed in the test chamber with free inlet and free outlet in accordance with installation type A. The chamber (also called combination test rig) consists of two low-reflection half chambers with high-impedance floor conforming to accuracy class 1 for acoustic measurements.
On the combination test rig it is possible to conduct air performance measurements at an air flow of up to 100,000 m3/h with a static pressure increase of up to 3,000 Pa.
The characteristic curve of the fan is determined on the combination test rig by operating the test specimen at constant speed and gradually throttling the air flow.
The noise, air flow, static pressure increase, speed and reaction torque required to determine the power consumption are recorded in the various operating statuses. A characteristic fan curve is made up of at least 10 operating points. This measurement is then repeated at different speeds. The characteristic curves determined this way, yield the so-called fan map.
Endurance testing“ebm-papst conducts endurance tests all over the
world under the harshest of conditions, to fully ensure the impregnation and encapsulation of all internal electrical components or the optimum protection of external components through correct materials and special and specific coating methods,” said Mr Hauck.
Some, but not all of ebm-papst testing procedures
Top: ebm-papst AgriCool fan mounted on the test rig. Above: AgriCool fan mounted on the aeroacoustic test rig.
38
®
Aviagen Management Essentials De Wet Nortje
Technical Service Manager, Australia, New Zealand & Asia
De Wet has 23 years experience in a large integrated company before joining Aviagen ANZ in 2012.
“Monitoring hatchery hygiene is important for embryos and chicks during a period when they are susceptible to microbial challenge. It lays the foundation for a healthy
chick at placement,” comments De Wet.
Hatchery Hygiene MonitoringObjective
Maintain a hygienic hatchery environment to ensure good quality and Salmonella free chick supply.
Key Points
1. Cleaning and disinfection is a key daily process of the hatchery and its success should be monitored regularly (at least once a month), by taking samples for viral, bacterial, fungal and Salmonella testing.
2. Monitor hatchery hygiene by taking samples from each room of the hatchery. It is essential to include drains and exhaust fans.
3. Follow hatching egg movement, from clean to dirty rooms, use clean gloves in every room.
4. Sample interior surfaces, by use of sterile cotton swab (15cm by 20cm in size) or petrifilm and streak onto Macconky agar, Tripticase Soy Agar (TSA) and Sabouraud Dextrose Agar (SDA). Agars should be incubated at between 25 to 37°C depending on the type of agar and growth promotion requirements. (See manufacturer recommendations)
5. Sample the air for bacteria and fungi by use of open exposure sampling for 10-20 minutes or air sampler for 1 minute with TSA and SDA.
6. Sample water from humidifiers such as spray nozzles, disc and ultra sonic humidifiers together with tap water, cabinet sprayers for vaccination, thaw bath water and Marek’s vaccine diluents.
7. Examine embryonic fluid by doing egg breakouts at 11-14 days. A pinky colour in the embryonic fluid may be evidence of mild contamination. A severe contamination is usually easily identified by smell and appearance.
8. Check air flow from clean to dirty areas to check if any contaminated air is returning to clean areas.
9. Review general cleaning and disinfection procedures, egg fumigation both in hatchery and farm, water chlorination, air supply, humidifier maintenance, when any unacceptable results are found.
Photo 1. Surface monitoring with petrifilm
PRODUCT NEWS
include:• Humidity protections according to DIN EN ISO 6270-2, DIN EN ISO 60068-2-78• Spray water protection according to DIN EN 605295• Salt and corrosion protection according to DIN EN 60068-2-11, DIN 50021-SS, ASTM B117, Belcore TA-NWT-000487• Protection against cleaning and ammonia.
Accurate measurement results “To ensure consistently precise, reproducible
measurements, the test facilities and test equipment are subjected to regular checking,” said Mr Hauck.
“The routine monitoring of test equipment by Quality Assurance with measurement quantities traceable to national and international standards (German Calibration Service DKD, Germany’s national metrology institute PTB) is standard practice at ebm-papst. Determination of the air flow and regular leak testing are based on ISO 5801.
“Since the middle of 2014, calibration of the air flow measuring instruments and traceability to the national standard of the PTB have been part of the quality assurance process. The applicable range is from 100 m3/h to 40,000 m3/h with a reference measuring instrument accuracy of ± 0.5 % of the measured value.
External validation “As a certified manufacturer, ebm-papst fully conforms
Top: Alexandra Gray, Projects and Design Engineer and (above) Christopher Hauck, Sales Manager SA/WA, testing at Bacchus Marsh.
w
39
PRODUCT NEWS
Equipment, sales, install + service + parts• Complete Poultry equipment.• Feeders; silos; cross augers.• Drinkers.• Ventilation.• Controllers.• Heating.• Curtains exterior; interior; black out.• Evaporate cooling pads, paper, poly.• Layer cages & nesting systems, barn& free-range.• Building supplies bulk, steel;insulation: panel; roofliner.
Protective Fabrications1045 Silverdale Road, Werombi NSW 2570
Ph: (02) 4653 1293 (02) 4643 1013Fax: (02 4653 1130
Email: [email protected]
to the following criteria as specified for test stands by the guidelines of the AHU manufacturers’ association:
‘An expert report/test report for fans will be accepted if testing was performed in accordance with the latest standard DIN EN ISO 5801:12-2010 (ISO 5801:2007 incl. corr. 1:2008) by a named test body on a suction-side chamber test rig and the component is manufactured without any modifications.’
“The inspection authorities (TÜV Süd) have confirmed that the test stand satisfies all the requirements of DIN EN ISO 5801 in an air flow range of 500 m3/h to 39,000 m3/h with a pressure increase of up to 1,000 Pa (Fig. 3).
“Acceptance testing for the acoustic properties of the combination test stand was performed by the Fraunhofer Institute, Stuttgart. The institute confirmed the Class 1 rating for the ebm-papst noise measurement chamber. External and internal validation provide both assurance for the company and information for customers. The documentation is available for viewing at all times.
“The ebm-papst group is the world’s leading manufacturer of fans and motors and is a pioneer and pacesetter for ultra-efficient EC technology,” said Mr Hauck.
“ebm-papst fans and motors are represented in many industries, including ventilation, air-conditioning and refrigeration technology, household appliances, heating engineering, in IT/telecommunications, in medical technology and in applications in automotive and commercial vehicles engineering. ebm-papst EC motor technology, and the market leader’s engineering and logistics expertise will add value to your business.
“To find out more about ebm-papst A&NZ you can go to: www.ebmpapst.com.au
v
Above: ebm-papst endurance testing facilites.
Stockyard Industries rebranding with new logo and nameStockyard Industries is at the forefront in the supply of pig and poultry equipment to the Australian producer, according to Director Marcus Jones.
“After more than 20 years as a market leader in the supply of equipment into the pig industry and more than seven years in the poultry industry, Stockyard Industries has announced the launch of a new name and logo, signalling a fresh focus for the business.
“Stockyard Industries will now be known as ‘Stockyard’, said Mr Jones.
“In fact, many of our customers already refer to us as the ‘Stockyard’ team,” he said.
“The new logo is intended to reflect Stockyard’s continued growth in both the pig and poultry industries by combining all facets of the business.
“The image of the shed portrays to our customers that we are committed to providing all aspects of a building project from organising building drawings to installing the equipment.”
“Our name may have slightly changed but Stockyard will continue to be a trusted supplier of innovative and reliable agricultural equipment at competitive prices,” Mr Jones concluded.
Visit the company’s new website at www.stockyardindustries.com for more information.
40
PRODUCT NEWS
LESS THAN 10W/1000 m3/h @ 51.600 m3/h
MAGFAN OFFERS
• Intelligent variable speed drive plus three fixed speeds
• Higher flow rates than any other fan of equivalent size
• More than twice the efficiency of any other fan
• 100 % designed and produced in Denmark
• No belts, no pulleys - no maintenance
• Simple single/dual phase installation
• Soft start and acceleration
• 50/60Hz 190 to 240 VAC
• Plug-and-run
For further information: Tel. +45 7577 1922 l [email protected] I www.dacs.dk
LEARN MORE ABOUT DACS
Stockyard Industries54 King Street Clifton, QLD 4361 Tel: 07 4697 3344 Mail: [email protected]: www.stockyardindustries.com or www.dacs.dk
Primary Media is on the move again.The company that produces Poultry Digest and Pork Journal is heading back to Sydney to our old address.From February our address will be 250 Hawthorne Parade Haberfield
NSW 2045. Ph: 02 9797 2406
41
AAS announced as ‘The Reclaimer Fan’ distributorAustralasian Agricultural Services Pty Ltd (AAS) has announced that the company will be the distributor of the new and exciting Australian owned and manufactured ‘The Reclaimer Fan’.
AAS showcased early models of ‘The Reclaimer Fan’ at PIX 2014 with great success and it proved to be a real highlight at the AAS booth. Growers quickly took a liking to the De-Stratification technology and potential for maximising efficiencies in gas consumption, leading to significant cost savings.
Sam Kazatsky of The Reclaimer Fan was delighted that the team at AAS saw the potential for benefit to growers and had agreed to represent the locally manufactured De-Stratification solution.
Mr Kazatsky noted that it was pleasing to see the team at AAS embrace the underlying technology and the innovative Australian design of The Reclaimer Fan. When it was first presented, Peter noted that gas usage continues to be a large ongoing cost of operations for growers and the solution was neat, efficient and effective.
Peter Mathews, Managing Director of AAS was looking forward to bringing to market a proven Aussie solution which will positively affect the bottom line for Australian growers.
“Growers are aware of the need to implement energy efficiency initiatives to keep costs down and The Reclaimer Fan does just that,” Mr Mathews said.
Mr Kazatsky said that after years of local R&D, the fans are now proven to maximise efficiencies in reclaiming free heat trapped in the roof of the shed while meeting the unique needs of the poultry industry including bio-security and the need for electric components to be IP65 rated.
“The Reclaimer Fan is finding favour in the Australian market as growers are investing in its benefits and in the short time since launching in May 2014 at PIX, it is being discussed in key international markets,” said Mr Kazatsky.
A smoke test video demonstrating the effectiveness of the fan and technical data is available to view at https://www.ausagservices.com.au/reclaimer.html.
PRODUCT NEWS
On March 10, 2015, the day before the opening of VIV Asia 2015, US based Animal Science Products held a seminar at the Conrad Bangkok to introduce two major new product lines including Gel-Pac.
Gel-Pac is a new generation gel delivery system with stabilizer that aids in the administration of gel-delivered vaccines, probiotics and nutritional ingredients for poultry.
It is especially designed to prolong the viability and improve the effectiveness of reconstituted and diluted vaccines and probiotics in a gel that is convenient to prepare and easy for the birds to consume.
The president of Animal Science Products Bailey Reynolds opened the proceedings and in introducing Gel-Pac pointed out the advantages of the product to the poultry industry.
“Stable gel ensures uniform suspension; it is perfect for insoluble ingredients and individual gel drops are easily consumed,” he said.
“The product will not soak feathers, is readily visible to the birds and is ideal for use in gel delivery systems,” he added.
Ryan Izard, ASP’s Chief Scientific and Technology Officer, in explaining the development of Gel Pac, stated that its first adoption was, “for probiotic supply. The coccidiosis vaccines were added in combination followed by gut active respiratory virus vaccines then gut protective bacterial vaccines,” he said.
In summing up the advantages of Gel-Pac, Ryan pointed out that the product “aids hydration in perinatal chicks and is perfect
for delivering insoluble ingredients”.Next Peter Cargill who runs his consultancy Pharmsure
International Ltd, spoke about the practical experiences of gel delivery in the European market.
He showed examples of devices developed to deliver the gel in commercial situations.
“Gel-Pac has great potential in Europe but that there are still some practical issues to overcome,” he stated.
“There are many other possible applications in addition to those mentioned,”he added.
Identities from the Australian poultry sector were present at the presentation including Dr David Tinworth from Bioproperties as well as Brett and Trent Antonio from BEC who are currently agents for other ASP products.
Brett Antonio later confirmed that his company is looking at possibilities for Gel-Pac in the Australian market but have to establish regulatory requirements and market acceptability first.
FARMERS andFEED MILLERS
FOR ALL YOUR REQUIRMENTS OF:
Soya beans used in our meals are NOT genetically modified!
We buy whole soya beans, not gradings, to supply you with a quality meal
FULL FAT SOYA BEAN MEALEXTRUDED WHEATEXTRUDED CORN SOYA MEAL
CONTACT:
SOYA FEEDS
Ph (07) 4662 4333A/Hrs (07) 4663 5534
PTYLTD
Animal Science Products Seminar Bangkok
Gel-Pac – perfect for delivering insoluble ingredients.
42
The Recent Advances in Animal Nutrition Conference (RAAN) will be held at the University of New England, Armidale NSW October 26-28, 2015. The key focus will be on early life nutrition and long term animal productivity.
The organising committee is seeking submissions for papers with a cut off date of May 24, 2015.
In past years RAAN has been well supported by industry and the organisers have partnership programs available for the 2015 event.
“The RAAN Australia conference is an event where experts from the scientific community and leaders in industry have gathered for the past 36 years to discuss issues of importance to animal nutrition,” said Dr Bob Swick from the organising committee.
“Plenary speakers are encouraged to speculate on future trends and to explore new ideas.
“This conference is unique in Australia in that it facilitates interaction between commercial and research sectors: discussion and debate are encouraged,” he said.
For more details contact Bob Swick : [email protected] or phone 02 6773 5126, website: www.raan.com.au
RAAN Conference 2015
43
PRODUCT NEWS
TSA: Novel cool pad offer to growers
research.biomin.net
BIOMIN Research & Development Turning science into sustainable solutionsOur strong in-house research and development, and global coope-ration with leading institutions and organisations form the basis by which innovative solutions are developed for our customers.
Naturally ahead
BIOMIN Australia Pty Ltd, PO Box 2344, Carlingford NSW 2118 Tel: 02-9872 6324, Email: [email protected]
Martin Simmons, who runs Technical Services Australia (TSA) formerly known as OEC, has come up with a novel offer to growers who are looking to replace cool pads.
The offer is standard 2m x 600mm x 150mm thick evaporative cool pads (45 degree and 15 degree flute angles) at just $50 each plus GST.
The condition of this low priced offer is that buyers commit to a container load of the pads which will be delivered to your farm gate.
A 20 foot container holds 135 pads and a 40 foot holds 270 pads.
A combination of factors may be driving growing demand amongst Australia’s broiler growers and integrators.
The need for ever more stringent bio security protocols may mean that cool pads are getting more of a work out from the Gerni blaster these days.
Also a move RSPCA protocols where lower stocking densities are involved could be seen as prolonging the life of older sheds, most of which have been converted to tunnel ventilation.
Alternatives to the conventional waxed paper pads are viewed as less effective by some growers though the paper item has a shorter life span and is thought to hold more dust than the plastic option.
Whatever view growers hold, demand for replacement coolpads is on he rise and Martin, recognizing this, has come up with what he believes is a cost effective solution
Go to the website for more details: www.oec.biz
Vencomatic announces renewed Turkey nestsFor nearly 30 years Vencomatic Group has been automating the collection of turkey hatching eggs. The company’s latest version of the Turkey Nest provides increased robustness, animal friendliness and is easier to manage whilst still retaining the advantages of its predecessor.
Vencomatic’s Turkey Nest is designed to maintain the perfect egg quality after lay. Its unique features like the gravity trap, the tipping floor and the egg belt protect eggs on their journey resulting in more settable hatching eggs.
The gravity trap mechanism allows only one bird in the nest at a time. This results in less egg damage and helps to prevent broodiness. When the nest is empty there are no obstructions in front of the nest, which ensures easy accessibility.
The tipping floor is a reliable closing system that gently expels birds from the nest. This prevents broodiness and soiling of the nest.
Automatic expulsion also replaces manual removal of birds from nests. The new wing protectors on the sidewalls of the nest prevent injury to the birds.
Eggs that have just been produced, land on the Vencomat and roll directly onto the eggbelt to prevent any possible damage by the birds. The eggbelt has square holes ensuring minimum contact with the egg and a smooth transfer through the house. It is made of antistatic material for optimal hygiene.
Furthermore the nest is equipped with a new Clock Manager. This touch screen computer provides farm managers with clear overview and optimal control to manage the expulsion.
For more information please visit the website at www.vencomaticgroup.com
NEWS
44
v CONTINUED FROM PAGE 6 session ‘Energy vs Protein and Amino Acids - How to strike a balance’.
“In general terms, increasing usage of free amino acids will benefit chicken meat production because they will attenuate the impact of escalating protein meal prices, which is pivotal,” Dr Selle stated at the conclusion of his paper.
In the Food Safety and Bird Health (Session B) held on February 10, Dr Kylie Hewson, now R&D Manager at the Australian Egg Corporation (AECL) spoke about AECL’s Salmonella Initiative an important industry development in protecting consumers and the layer sector’s reputation.
Aaron Ray, a post graduate student from UNE presented his paper ‘An examination of eggshell pores structure and penetration by Salmonella Typhimurium’.
This paper earnt Aaron the CRC sponsored prize for best presentation by a post grad at APSS, thus bringing to an end a great run by the girls who have dominated the post grad levels of excellence in recent times. Not that the presentations by any of the post grads were less than excellent in the 2015 APSS.
One post grad who won the prize in 2007, Dr Katrin Renz now a researcher at UNE presented her paper, ‘A Loop Isothermal Amplification Assay to Detect Fowl Adenovirus - 8 in a variey of poultry material’.
This paper is published in full in this issue along with a story about the on-farm application’s of Katrin’s work.
In the Poultry Welfare session delivered on February 11, the keynote and invited speaker Professor Werner Bessei from the University Hohenheim Germany, spoke about ‘Feather pecking in layers – state of research and implications’.
“Feather pecking and cannibalism are considered the most important problems in egg producing flocks.
“Despite extensive research during the last five decades the cause of these damaging behaviours have not been identified and the problem still persists,” he said.
Professor Bessei delivered another paper in this session, ‘Welfare problems in laying hens in Europe’.
Professor Marian Dawkins is a Professor of Animal Behaviour in the Department of Zoology, University of Oxford and well known for her research and authorship in the field of animal welfare.
Her first paper, delivered as an invited keynote speaker was ‘Welfare
and Effeciency in Poultry Production’.She introduced this paper by
saying “The demand for chicken meat continues to rise across the world, leading to calls for greater efficiency and sustainable intensification.
“This has implications for poultry welfare through potential conflicts between welfare and economics.
“Reducing this conflict and ensuring that good welfare is an economically viable part of the sustainable, efficient poultry production needs – an agreed and workable definition of good welfare, also better ways of measuring and assessing welfare so that its financial advantages can be more clearly evaluated and integrated with other priorities such as human health, animal health, environmental protection, reduction in antibiotic use and financial viability.
“Important new developments include the use of technology that allows continuous monitoring of poultry health and welfare; higher standards of data analysis and research aimed at both finding solutions to the many pressures on the poultry industry and clearly showing the benefits of good welfare,” Professor Dawkins said.
Her second paper, ‘Automated assessment of health and welfare in commercial flocks using optical flow’ was a short but incisive description of technology that could readily assess overall flock health using currently available technology.
Later in this session a new speaker to APSS, Dr Isabelle Ruhnke, delivered an interesting if slightly disturbing paper, ‘Gut impaction in free range hens’.
“This case study reports the outcome of an extreme overconsumption of pasture by free range laying birds.
“It outlines the consequences of malnutrition due to animal behaviour and housing condition in free range laying hens, such as increased
mortality and morbidity, leading to reduced animal welfare outcomes and compromised bird performance.
“This paper suggests a number of practical solutions and outlines the significance of future studies on fibre intake in free range birds,” Dr Ruhnke exlpained.
“In general, the consumption of large amounts of fibrous fodder reduces the intake of a balanced feed, leading to undernourishment in energy and essential nutrients such as amino acids.
“This is particularly true in high performance animals like the modern laying hen and the mortality and morbidity concerns associated with gut impaction cannot be ignored,” she stated.
In tune with consumer demands, there is now a fair body of research being conducted by talented post grads and now those who have gained their Phds, into animal welfare and production issues concerning alternative production systems the retailers tell us consumers and regulators want in order to define production in line with anthrapmorphic expectations.
Our retails and regulators should spend a little more time looking at the available research so they can better understand that decisions made by them have not necessarily achieved desirable welfare outcomes.
Above: Peta Taylor, University of Melbourne. Left: Post graduate students tell us about their studies.
NEWSNew moves strengthen Cobb R&D team
EggsCargoSystem helps battle Avian Influenza
Two senior appointments have been annpunced by Cobb-Vantress in order to strengthen its research and development team.
Dr Anu Frank-Lawale, who has wide experience across a range of species, joins the team as Pedigree Geneticist, while Dr Frank Siewerdt moves from this role to become Director of Genetics responsible for the Cobb genetic program.
“As Cobb continues to grow and invest in our research and development program, we are excited to have Dr Anu Frank-Lawale join our team,” said Dr Mitch Abrahamsen, Cobb Vice President of R&D.
“Anu’s demonstrated professional successes and wide variety of experiences make him a key addition to our genetics team as we expand our efforts to meet the needs of an ever-changing market place.
“I am pleased that Dr Frank
Siewerdt has accepted promotion to Director of Genetics.
“His demonstrated leadership skills, and vision for the future of the Cobb breeding program provide the foundation for translating our significant investments in infrastructure and research programs into meaningful genetic progress for our current and future products.”
Dr Anu Frank-Lawale is based at the Three Springs pedigree farm in Oklahoma, where he will be responsible for the selection program in several commercial and experimental lines. He studied animal breeding at the universities of Nottingham and Edinburgh in the UK, and went on to gain a PhD for work on aquaculture genetics at Stirling University.
He worked as a biometrician at the Roslin Institute, Edinburgh, and then in 2007 moved to the United States as Breeding Research Manager for the
45
Aquaculture Genetics and Breeding Technology Center at Virginia Institute of Marine Science.
Dr Frank Siewerdt now has a team of seven PhD geneticists and a business engineer working with other areas of R&D and the business units to continue genetic progress on existing Cobb products and developing new ones to meet market needs.
He joined Cobb three years ago as the inaugural geneticist at the new Dry Creek complex in Deer Lodge, Tennessee, and became responsible for the genetic program in two of the pedigree farms.
Originally qualifying from the Federal University of Pelotas in Brazil, Dr Siewerdt obtained his PhD from North Carolina State University in the USA and has worked for more than 20 years in academic and industry positions including four years with Heritage Breeders / Perdue Farms.
AUSPAC INGREDIENTS Pty.LtdUnit 1, 84-92 Barnes Street Tamworth NSW 2340
T: +61 2 6762 7708 F: +61 2 6762 7709Contact: Christine Clark 0429 662 519
Twinpack, the supplier with the world’s most used and reliable egg transportation system, EggsCargoSystem, is going to help its customers in the battle against animal diseases such as avian influenza, according to Bert van Dijk, Project Manager at Twinpack.
“Only the best raw materials are used for the production of the EggsCargoSystem,” said Mr van Dijk.
“In order to considerably reduce the ability of bacteria to attach themselves to the plastic surface and so to prevent the spread of bacteria, Twinpack can provide the system with BioCide PT2.
“This addition is completely safe for food and is used globally on a large scale.
“With its use of BioCide PT2 in all parts of the EggsCargoSystem, Twinpack B.V. hopes to give its customers an extra weapon in the battle
against animal diseases. “Just like the EggsCargoSystem,
BioCide PT2 has a particularly long life. For more information you can
consult the following website (www.eggscargosystem.com) or you can contact Bert van Dijk, email: [email protected].
NEWS
Dr Pat Blackall
Don’tpoultrydigestSend this completed form to: Poultry Digest, 22 George St,East Gosford NSW 2251. Ph: (02) 4323 0005
Please send me the next six issues of POULTRY DIGESTEnclosed is my cheque for: A$55.00 (inc GST) or A$80.00
for overseas. Send your email address for a digital version.Cheques are to be made payable to Primary Media in Australian $
Please charge A$ to my: (please tick appropriate box) VisaCard MasterCard Bankcard
Expiry date Signature................................
(Please print all your details in BLOCK LETTERS)
NAME . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .ADDRESS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . P/CODE . . . . . . . . . . .
Don’t miss out on a single issue of Poultry Digest!
Fill out the coupon and send it in.
To view copies of the magazine on-line
go to our website www.primarymedia.
com.au and click on latest issues.
Serving the poultry industry in Australia and New Zealand
Send this completed form to: Poultry Digest, 250 Hawthorne Pde, Haberfield NSW 2045. Ph: (02) 9797 2406
Pat Blackall: Australian Poultry Award 2014Dr Pat Blackall was presented with the Australian Poultry Award for 2014 at the recent APSS dinner.
He graduated from the University of Queensland in 1973 with a degree in microbiology and joined the Department of Primary Industries Animal Research Institute, Yeerongpilly, Brisbane as a diagnostic bacteriologist.
Pat became a full time research scientist in 1980 and completed a PhD at University of Queensland in 1987. In 2010 he was seconded to the University of Queensland. His role as research scientist expanded to include editorship of the Journal of Applied Microbiology and the Journal of Veterinary Diagnostic Investigation, as well as Research Manager for the Poultry Co-Operative Research Centre.
Since 1977, Pat has been the leader of over 30 externally funded research projects with a total value of over four million dollars. Pat is also a member of the Editorial Boards of a number of scientific journals, including Avian
Diseases. Pat has been a member of the Chicken Meat Committee of RIRDC for around eight years.
From the start of his career, Pat has serviced the poultry industry, initially in the diagnosis of bacterial diseases but subsequently as a research scientist, particularly on infectious coryza, fowl cholera, bordetellosis, and Campylobacter.
Pat has published over 180 papers in peer-reviewed journals, written ten book chapters and delivered 245 conference papers. His contribution to science has been recognised by such awards as the Frank Fenner Research Award in 1993, the Queensland Poultry Award in 2000, a Queensland Public Service Medal in 2010 and membership of the World Veterinary Poultry Association Hall of Fame in 2013.
Pat’s research has had a major positive impact on the Australian poultry industries. His research has led to the development of vaccines and diagnostic tests for key poultry bacterial pathogens
and his work on Campylobacter has greatly helped industry to manage its food safety programs.
Pat Blackall is a unique individual – unique for the respect he has earned from his scientific and work colleagues; unique for his passion for science; unique in his desire to make a contribution in many areas of both strategic and applied science and to the poultry industries with which he works.
46
The Poultry House Barns Advantage
To find out more contact Poultry House Barns on 1300 234 321.
www.poultryhouse.com.au
Exceptionally Energy Efficient
High Return on Investment
Unique Curved Design
Enhanced Tunnel and Minimum Ventilation
75mm Composite Wall Panels
Outstanding Insulating Properties
Thermal Rated Rat Wall
Structural Hot Dipped Galvanized Frames
Fully Sealed Clean Lined Interior
Bird and Vermin Proof
Low Maintenance, User Friendly, Long Lasting
Available Delivered in a Container
INCREASE PROFITS
5531_PHB_A4FlyerInsert_V6.indd 2 7/11/2012 12:00:47 PM
www.poultryhouse.com.au
Poultry House Barns are designed to do one job really well - produce Bigger Birds Faster. Our barns have been refined to a precise science with the right combination of low maintenance, energy efficiency and vermin proofing to reduce costs and increase profits.
Reduce Energy Costs and Increase Growth
BIGGER BIRDS ...FASTER
Superior Energy Efficient Poultry Barns
CONTACT US TODAY ON 1300 234 321
9670 PHB A4 Flyer 2014.indd 1 11/07/2014 1:55 pm
