PI3K and Bcl-2 Inhibition Primes Glioblastoma Cells to ...mcr.aacrjournals.org/content/molcanres/12/7/987.full.pdf · Cell Death and Survival PI3K and Bcl-2 Inhibition Primes Glioblastoma

Cell Death and Survival

PI3K and Bcl-2 Inhibition Primes Glioblastoma Cells toApoptosis through Downregulation of Mcl-1 andPhospho-BAD

Fresia Pareja1, David Macleod1, Chang Shu1, John F. Crary1, Peter D. Canoll1, Alonzo H. Ross2, andMarkus D. Siegelin1

AbstractGlioblastomamultiforme (GBM) is a highlymalignant human brain neoplasmwith limited therapeutic options.

GBMs display a deregulated apoptotic pathway with high levels of the antiapoptotic Bcl-2 family of proteins andovert activity of the phosphatidylinositol 3-kinase (PI3K) signaling pathway. Therefore, combined interference ofthe PI3K pathway and the Bcl-2 family of proteins is a reasonable therapeutic strategy. ABT-263 (Navitoclax), anorally available small-molecule Bcl-2 inhibitor, and GDC-0941, a PI3K inhibitor, were used to treat establishedglioblastoma and glioblastoma neurosphere cells, alone or in combination. Although GDC-0941 alone had amodest effect on cell viability, treatment with ABT-263 displayed amarked reduction of cell viability and inductionof apoptotic cell death. Moreover, combinatorial therapy using ABT-263 and GDC-0941 showed an enhancedeffect, with a further decrease in cellular viability. Furthermore, combination treatment abrogated the ability of stemcell–like glioma cells to form neurospheres. ABT-263 andGDC-0941, in combination, resulted in a consistent andsignificant increase of Annexin V positive cells and loss of mitochondrial membrane potential compared with eithermonotherapy. The combination treatment led to enhanced cleavage of both initiator and effector caspases.Mechanistically, GDC-0941 depleted pAKT (Serine 473) levels and suppressedMcl-1 protein levels, lowering thethreshold for the cytotoxic actions of ABT-263. GDC-0941 decreased Mcl-1 in a posttranslational manner andsignificantly decreased the half-life of Mcl-1 protein. Ectopic expression of human Mcl-1 mitigated apoptotic celldeath induced by the drug combination. Furthermore, GDC-0941modulated the phosphorylation status of BAD,thereby further enhancing ABT-263–mediated cell death.

Implications:Combination therapy with ABT-263 andGDC-0941 has novel therapeutic potential by specificallytargeting aberrantly active, deregulated pathways in GBM, overcoming endogenous resistance to apoptosis. MolCancer Res; 12(7); 987–1001. �2014 AACR.

IntroductionGlioblastoma, themost commonprimarymalignant brain

tumor, displays a remarkable resistance toward therapy. Thecurrent mainstay of treatment is surgery followed by radi-ation/chemotherapy (1). In the last decade, the most prom-ising therapeutic regimens include the oral chemotherapeu-tic drug, temozolomide (Temodar). This DNA modifying

compound shows efficacy particularly in patients who havesilenced expression of the DNA—repair enzyme O6-methylguanine DNA methyltransferase (MGMT). Testingpatient samples for MGMT promoter methylation statuspredicts responses to temozolomide treatment. Certaintherapeutic regimens, involving temozolomide, offer slightsurvival benefits in the range of 3 months. Thus, there is anurgent need for novel pathway-related rational therapies.One of the mechanisms as to why glioblastoma escapes

various treatment modalities is the fact that they exhibit highresistant to apoptosis (2–4). Multiple factors mediating thisresistance have been described, including the aberrantexpression of the bcl-2 family of proteins. Glioblastomasdisplay high levels of bcl-2 (5) and bcl-xL (6). Therefore,these tumors are potential candidates for treatment withBH3 mimetics, such as ABT-263 (Navitoclax; ref. 7), anorally available inhibitor of bcl-2 and bcl-xL. From a mech-anistic point of view, BH3 mimetics bind to the inhibitorybcl-2 family of proteins and prevent their interaction withproapoptotic Bcl-2 family members, such as Bad, Bid, and

Authors' Affiliations: 1Department of Pathology & Cell Biology, ColumbiaUniversity Medical Center, New York, New York; and 2Department ofBiochemistry and Molecular Pharmacology, University of MassachusettsMedical School, Worcester, Massachusetts

Note: Supplementary data for this article are available at Molecular CancerResearch Online (http://mcr.aacrjournals.org/).

Corresponding Author:Markus D. Siegelin, Department of Pathology andCell Biology, Columbia University Medical Center, 630 West 168th Street,P&S 15-401, New York, NY 10032. Phone: 212-305-1993; Fax: 212-305-6596; E-mail: [email protected], [email protected],[email protected]

doi: 10.1158/1541-7786.MCR-13-0650

�2014 American Association for Cancer Research.

MolecularCancer

Research

www.aacrjournals.org 987

on December 25, 2019. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Published OnlineFirst April 22, 2014; DOI: 10.1158/1541-7786.MCR-13-0650

http://mcr.aacrjournals.org/

Bim. This allows them to drive intrinsic apoptosis withtranslocation of cytochrome c to the cytosol, formation of theapoptosome, cleavage of caspase-9, and subsequent activa-tion of effector caspase-3 to complete programmed celldeath. This class of molecules is more effective in tumorswith high levels of bcl-2/bcl-xL. ABT-263 is currently underinvestigation in various malignancies, either as a single drugcompound, or in combination with other antitumorreagents (8, 9) and has already reached clinical trials (10).Specifically, preclinical studies, involving ABT-263, haveshown that it has activity against small cell lung cancer(SCLC) as well as acute lymphoblastic leukemia (7). Espe-cially, the efficacy in SCLC, which despite treatment now-adays still have a poor prognosis, is of significant relevancebecause this type of lung cancer is not amenable to themodern approaches of personalized medicine so far ascompared with non–small cell lung cancer (NSCLC) inwhich certainmutations of theEGFR gene (deletions in exon19 and point mutations in exon 21) render these tumorssensitive to the tyrosine kinase inhibitors, gefitinib or erlo-tinib. The toxicity profile of ABT-263 is favorable comparedwith standard chemotherapies. However, one caveat ofABT-263 and related molecules is that tumors with highprotein expression levels of Mcl-1, another member of thebcl-2 family of proteins with antiapoptotic properties, exhib-it marked resistance against them. Glioblastomas displayhigh levels of Mcl-1 expression, which is driven by severalupstream cascades, such as NOTCH (11) or CREB3L2-ATF5 (12) signaling pathways. To overcome this resistance,several strategies have been devised, such as the targeting of asecond molecular pathway that allows the depletion of highlevels of endogenous Mcl-1 in cancer cells.Along these lines, we herein show that GDC-0941, a

recently developed and orally available thienopyrimidinederivative that inhibits PI3K in the nanomolar range(13), lowers Mcl-1 levels in glioblastoma cells, renderingthemmore sensitive to the apoptotic properties of ABT-263.In addition, GDC-0941 affects the phosphorylation statusof BAD, thereby modulating the sensitivity of glioblastomacells to BH3 mimetics.

Materials and MethodsCell lines and reagentsHuman glioblastoma cell lines, LN229 (p53 mutated,

PTEN wild-type), U87 (p53 wild-type, PTEN mutated),and U373 (p53 mutated, PTEN mutated) with definedmutation status were cultured as described previously (14)and were obtained from the American Type Culture Col-lection (ATCC). The ATCC confirmed the identities of theglioblastoma cells (except for U373, which is no longerverified by the ATCC). The stem cell-like glioma (neuro-sphere) NCH421K, NCH644, and NCH690 cells wereverified and obtained from Cell Line Services (Heidelberg,Germany) and were cultured in neural stem cell mediumcontaining DMEM/F12 (Gibco-Invitrogen), recombinanthuman epidermal growth factor (rhEGF, 20 ng/mL; Sigma),basic fibroblast growth factor (bFGF, 20 ng/mL; Upstate),BIT: bovine serum albumin, transferrin, insulin, and pen-

icillinG and streptomycin (Gibco-Invitrogen) in the absenceof serum as previously described (15, 16). Primary neuro-sphere GS9-6 stem-like glioma cells (12) are p53 wild typeand were cultured in the same media as NCH421K cells.Cycloheximide and MG132 were purchased from SigmaAldrich. GDC-0941 and ABT-263were purchased from LCLaboratories.

Neurosphere formation assayNCH421K cells were mechanically dissociated and plated

at a density of 500 cells per well in 24-well plates. Twenty-four hours later, cells were treated with GDC-0941 andABT-263, singly or in combination. Following 10 days,neurosphere formationwas assessed by counting the numberof neurospheres that harbor at least 25 cells per sphere asdescribed in refs. 17 and 18). Experiments were performed atleast in duplicates and statistical analysis was performed.

Antibodies and Western blotting/immunoblottingAntibodies to MCl-1 (1:500; CST), phospho-Akt [Serine

473 (Ser 473); 1:500; CST], pan Akt (1:1,000; CST),cleaved caspase-3 (1:250; CST), human caspase-9(1:1,000; CST), 14-3-3 (1:1,000; Santa Cruz Biotech),BAD (1:200; CST), phospho-BAD 112 (1:200; CST),phospho-BAD 136 (1:200; CST), and actin (1:2,000, cloneAC15; Sigma Aldrich) were used. Western blotting wasperformed as described previously. Samples were lysed eitherin RIPA cell lysis buffer (CST) supplemented with proteaseinhibitor cocktail and phosphatase inhibitors or directlylysed in Laemmli-sample buffer. Lysates were boiled andequal amounts of protein were loaded onto a gradient (4%–12%) poly-acrylamide precast-gel (Invitrogen). Sampleswere resolved at 120 V (constant voltage) for 15 minutesand subsequently for 45minutes at 180V (constant voltage).The gel was transferred (wet-transfer) to a PDVFmembrane(Bio-Rad) at 45V (constant) for 90minutes. Protein transferwas confirmed by Ponceau S staining. Membranes werewashed 3 times inTBS-T and blockedwith 5%milk in TBS-T. After blocking, membranes were washed once and incu-bated with the primary antibody according to the vendor'sinstructions. Secondary antimouse or anti-rabbit antibodiesconjugated with horseradish-peroxidase were used at dilu-tions ranging from 1:2,000 to 1:10,000. For immunodetec-tion, the Pierce ECLWestern blotting substrate was utilized.Membranes were developed either by exposure to afilm or byusing the C-DiGit Blot Scanner (LI-COR).

Real-time PCR and cDNA synthesisGlioblastoma cells were harvested after indicated treat-

ments and RNAwas isolated with a Column-Based IsolationKit (RNeasy Mini Kit; Qiagen), as described in the manualof instructions. Subsequently, 500 ng of cDNA was reversetranscribed, using the "First Strand cDNA Synthesis Kit"(Origene). Real-time PCR was performed, utilizing a"Omnimix HS Kit" (Cepheid). The following primers wereused: 18S forward: AGTCCCTGCCCTTTGTACACA;18S reverse: GATCCGAGGGCCTCACTAAAC;Mcl-1forward: CCA AGA AAG CTG CAT CGA ACC AT, and

Pareja et al.

Mol Cancer Res; 12(7) July 2014 Molecular Cancer Research988




Mcl-1 reverse: CAG CAC ATT CCT GAT GCC ACC T.The PCR cycle parameters are available upon request. Dataanalysis were performed by the "Delta-Delta CT METH-OD" and data are provided as percentages relative to thecontrol.

Analysis of cellular viability, apoptosis, andmitochondrial membrane potential3(4,5-Dimethyl-thyazoyl-2-yl)2,5 diphenyltetrazolium

bromide (MTT) colorimetric assay was conducted as pre-viously described. In brief, 2,000 cells per well were seeded in96-well plates at least in duplicate 24 hours before treatment.After treatment cells were incubated with MTT for 2 hoursat 37�C and assayed for absorbance at 570 nm. For apoptosisdetermination, cells were stained with Annexin V (FITC)/propidium iodide as described in themanufacturer's instruc-tions (BD Bioscience). Following staining, cells were run ona FACS Calibur machine (Becton Dickinson). Flow cyto-metric plots were generated by FlowJo software. To analyzemitochondrial membrane potential (MMP) in response totreatment, cells were stained with JC-1 (Molecular Probes)according to the manufacturer's instructions. Cells wereanalyzed on a FACS Calibur machine (Becton Dickinson)on FL1 (green channel) and FL2 (red channel) and thenumber/percentage of cells with loss of MMP was deter-mined as described in ref. 19.

Transfections, plasmids, and siRNAspcDNA-3, pcDNA3-hMcl1 (Addgene ID: 25375),

pcDNA3 Bad S112A S136A (phosphorylation deficient;Addgene ID: 8799), and pcDNA3 Bad (Addgene ID: 8778)were used. For transient transfections, glioblastoma cellswere seeded in 12-well dishes at a density of 50,000 cells perwell. Twenty-four hours later, cells were transfected with thedesignated plasmids, using Lipofectamine 2000 or FugeneHD according to the manufacturer's instructions. Cells wereassayed for protein expression 48 to 72 hours after trans-fection, and following confirmed ectopic expression of theprotein of interest experiments were performed. Nontarget-ing human siRNA pools and human siRNA Mcl-1 poolswere obtained from Thermo Fisher Scientific.

Immunohistochemistry of glioblastoma specimensTissue microarrays (TMA), containing 34 de-identified

glioblastoma specimens (in triplicate), were provided by theDivision of Neuropathology at the Columbia UniversityMedical Center. TMAs were created by removing 3 one-millimeter cores of glioblastoma tumors. Four-micrometer-thick sections were cut and deparaffinized in xylene. Forantigen, retrieval sections were pretreated by boiling samplesin 0.01M citrate buffer (pH 6.0) for 5 minutes. TMAs werestained with a dilution of 1:50 of phosphorylated Akt (ph-Akt; Ser 473; clone D9E; CST Inc.) 1 and with a dilution of1:100 of phosphorylated BAD (ph-BAD; Ser 112; clone40A9; CST, Inc.), respectively. The secondary antibodiesincluded anti-Rabbit IgG (1:200; purchased from VectorLaboratories), and antimouse polymeric antibodies (pur-chased from Dako) and diaminobenzidine was used as

chromogene. TMAswere scored by 3 board-certified pathol-ogists (J.F. Crary, P.D. Canoll, and M.D. Siegelin), using a3-tier scoring system (0: no expression, 1: weak expression,2: strong expression). When there was a disagreement, themajority of scores (�2 of 3 wins) was taken. In the rare case,where the pathologists span the full range (0, 1, 2), then ascore of 1 was assigned. A final score for each tumor wasreached based on the highest scoring core (out of 3 cores perglioblastoma specimen). Statistical analysis was performedby Spearman correlation analysis. Representative photo-graphs of the TMAs were taken.

Statistical analysisData were analyzed by 2-sided unpaired t tests using a

GraphPad Prism or one-way analysis of variance followed byTukey Multiple Comparison Test. Values are provided asmean� SD or mean� SEM of replicates of a representativeexperiment out of at least 2 independent determinations. APvalue of less than 0.05 (P < 0.05) was accepted as statisticalsignificant.

ResultsGlioblastoma cells display high expression of Mcl-1, ph-Akt, and ph-BADTo demonstrate that glioblastoma cells display high levels

of the antiapoptotic Bcl-2 family protein, Mcl-1, as well as aderegulated PI3K pathway, we determined the expressionlevels of ph-Akt (Ser 473) and Mcl-1 in 3 established and 3glioblastoma neurosphere cultures [NCH644, NCH690,and GS9-6 (a low passage ex vivo neurosphere cell line),respectively (Supplementary Fig. S1A)]. Consistent withtheir known PTEN mutation status, U87 and U373 glio-blastoma cells displayed higher levels of ph-Akt as comparedwith the wild-type LN229 glioblastoma cells. About theexpression status of Mcl-1, U373 revealed the lowest expres-sion, whereasU87 showed the highest levels (SupplementaryFig. S1A). The glioma neurosphere cells showed similarprotein levels ofMcl-1 (Supplementary Fig. S1A). BAD is animportant sensitizer for the intrinsic pathway of apoptosisand multiple phosphorylation sites were identified, forexample at amino acid 112 and 136, that when phosphor-ylated render cells more resistant to apoptosis. Our glioblas-toma cell line panel showed detectable levels of ph-BAD atS136 and S112 (Supplementary Fig. S1A), suggesting thatBAD is in a rather inactive state inmalignant glioma and thattargeting this molecule might counteract the intrinsic apo-ptotic resistance associated with high-grade gliomas.

The combination of GDC-0941 and ABT-263 elicitsenhanced loss in cellular viability in glioblastoma cellsFirst, we determined the effect of the single reagents,

GDC-0941 and ABT-263, on the viability of U373 andLN229 cells, respectively. Treatment of LN229 glioma cellswith increasing concentrations of GDC-0941 did not resultin a significant reduction in cellular viability after 24 hours(Fig. 1B). In contrast, increasing concentrations of ABT-263(1 mmol/L: 63.51% � 1.893, P ¼ 0.0064; 2 mmol/L:69.61% � 0.5927, P ¼ 0.0078; 4 mmol/L: 61.32% �

GDC-0941 Overcomes Intrinsic Apoptotic Resistance in Glioblastoma

www.aacrjournals.org Mol Cancer Res; 12(7) July 2014 989




1.528, P¼ 0.0046) statistically significantly reduced cellularviability in LN229 cells (Fig. 1A). Next, we aimed todetermine the effect of GDC-0941 and ABT-263 combi-nation therapy on cellular viability. Treatment of LN229cells with the combination of these drugs exerted a statis-tically significant decrease of cellular viability (38.76% �0.3905) compared with single treatments with either ABT-263 (P < 0.0001) or GDC-0941 (P < 0.0001; Fig. 1C).Contrasting the results in LN229 cells, treatment of U373glioma cells with increasing dosages of GDC-0941 (1 mmol/

L: 86.62� 0.9061, P¼ 0.0279; 2 mmol/L: 83.66� 2.039,P¼ 0.0210; 4 mmol/L: 75.74� 3.256, P¼ 0.0085) eliciteda mild, but statistically significant reduction in cellularviability with respect to the vehicle-treated cells (Fig. 1E).Increasing concentrations of ABT-263 (1 mmol/L: 87.40 �1.512, P¼ 0.0028; 2 mmol/L: 101.3� 2.867, P¼ 0.4285;4 mmol/L: 75.57 � 1.187, P ¼ 0.0001) resulted in aminimal reduction of cellular viability in U373 that wasnot as pronounced as in LN229 glioblastoma cells (Fig. 1D).The combination regimen revealed a statistical significant

Figure 1. Effects of the combinationtreatment of ABT-263 and GDC-0941 on cellular viability (A–F) andneurosphere formation (G–H). A–C,LN229 cells were treated withincreasing concentrations of ABT-263 (1, 2, and 4mmol/L), GDC-0941(1, 2, and 4 mmol/L), or acombination of both (2 mmol/LABT-263 and 2mmol/LGDC-0941),for 24 hours. Thereafter, MTTassays were performed todetermine cellular viability. Treatedcells were compared with controlcells (DMSO) and statisticalanalysis is provided (�, P < 0.05;��, P < 0.01; ��, P < 0.001; "ns,"nonsignificant). D–F, U373 cellswere treated with increasingconcentrations of ABT-263 (1, 2,and 4mmol/L), GDC-0941 (1, 2, and4 mmol/L), or a combination of bothfor 48 hours (4 mmol/L ABT-263and 4 mmol/L GDC-0941).Thereafter, MTT assays wereperformed to determine cellularviability. Treated cells werecompared with control cells(DMSO) and statistical analysis isprovided (�, P < 0.05; ��, P < 0.01;��, P < 0.001). G, NCH421K stemcell–like glioma cells were treatedwith ABT-263 (2 mmol/L), GDC-0941 (2mmol/L), or the combinationof both reagents (2 mmol/L of eachcompound) and assessed forneurosphere formation 2 weeksafter plating (G). The number ofneurospheres was counted and isrepresented in H. Values are givenas mean � SEM of representativeexperiments. ABT—ABT-263;GDC—GDC-0941; ABT þ GDC—combined treatment of ABT-263and GDC-0941. Numbersrepresent concentrations of theindicated compounds in mmol/L.A P value of less than 0.05 isindicatedbyone star "�",whereasaP value of less than 0.01 ishighlighted by 2 stars "��".A P-value less than 0.001 isindicated by a star triplet (��).Numbers represent concentrationsof the indicated compounds inmmol/L.

Pareja et al.





decrease of cellular viability (56.49� 2.861) compared withsingle treatments with either ABT-263 (P ¼ 0.0108) orGDC-0941 (P ¼ 0.0113; Fig. 1F).

The combination of GDC-0941 and ABT-263 is effectivein ex vivo glioblastoma neurosphere culturesGlioblastomas are bona-fide examples of heterogeneous

tumors, harboring different cell populations. Among these,the so-called "cancer stem cells" are of particular interest asthey are implicated in the rapid recurrence of glioblastomasin patients, and are highly resistant to treatment. To this end,we asked the question if stem cell–like glioblastoma cells aresusceptible to the ABT-263 and GDC-0941 combinationregimen.With this aim, we treated the neurosphere formingNCH421K glioblastoma cells with ABT-263 and GDC-0941, singly or in combination, and conducted nerosphereformation assays. Although single reagents had a modesteffect on the formation of NCH421K cell neurospheres, thecombination regimen had a marked inhibitory effect onneurosphere formation (Fig. 1G and H). This findingsuggests that combination treatment may influence tumor-igenicity of these glioblastoma cells and, more importantly,that it not only affects the bulk of the tumor, but also targetsthe potential stem cell–like cellular fraction within malig-nant gliomas.

The combination of GDC-0941 and ABT-263 as well asABT-199 causes enhanced apoptotic cell death withrapid loss of MMP and increased activation of initiatorand effector caspasesTo test the hypothesis that combination of GDC-0941

and ABT-263 works through enhanced apoptosis, we per-formed Annexin V staining with subsequent flow cytometryin one low-passage ex vivo glioblastoma neurosphere cell line,GS9-6, 3 glioblastoma neurosphere cell lines, NCH421K,NCH690, and NCH644, and in 1 established glioblastomacell line, LN229. Glioblastoma cells were treated with 2mmol/L of GDC-0941, ABT-263, or the combination ofboth reagents for 24 hours. Although single treatments withGDC-0941 and ABT-263 revealed modest induction ofapoptosis, the combination treatment induced a significantlyhigher proportion of Annexin V positive cells as comparedwith the single treatments in all cell lines tested (Fig. 2A andB). Furthermore we also tested as to whether another orallyavailable Bcl-2 inhibitor, ABT-199, which causes fewerside effects (thrombocytopenia) will induce enhanced celldeath in the presence of GDC-0941. To test this hypothesis,2 glioblastoma neurosphere cell lines, NCH644 andNCH690 as well as the established glioblastoma LN229cells were treated with suboptimal dosages of ABT-199 incombinationwithGDC-0941. Akin to ABT-263, ABT-199cooperates with GDC-0941 to enhance cell death (Fig. 2Cand D). Our findings again suggest that our proposedtreatment combination exerts activity against the stem-likecells fraction of glioblastoma. Apoptosis is accompanied byloss ofmitochondrial integrity, and because ABT-263 affectsintrinsic apoptotic signaling, we hypothesized that theenhanced apoptotic cell death induced by GDC-0941 and

ABT-263 could be accompanied by a concomitant loss ofMMP. LN229 cells were treated under the same conditionsas above, stained with JC-1 and subjected to flow cytometricanalysis. Although LN229 cells treated with ABT-263(mean: 46.33 � 1.667) and GDC-0941 (mean: 24.67 �0.8819) showed a modest loss in MMP, the combinedtreatment led to a significant higher proportion of cells withloss in MMP (mean: 80.33� 0.8819; <0.0001; n¼ 3; Fig.2E and F). Because the initiator and effectors of apoptosis arecaspases, we wished to determine if caspase-9 and caspase-3show activation in the various treatment settings. We the-orized that given that the combined treatment of GDC-0941 and ABT-263 caused more apoptosis, and more cellswith loss of MMP, cells treated with the drug combinationwould exhibit a stronger activation of initiator as well aseffector caspases. To this end, LN229 and U373 glioblas-toma cells were treated with ABT-263, GDC-0941, or thecombination of both reagents for 7 hours and subjected toimmunoblot analysis for cleavage/activation of caspases. Wefound a slight activation of both initiator caspase-9 andeffector caspase-3 in ABT-263–treated cells. However, thecombination of ABT-263 and GDC-0941 exerted furtheractivation of caspase-9 and caspase-3 compared with thesingle treatments in both LN229 and U373 glioblastomacells (Fig. 3C and D), in keeping with the enhancedapoptosis and loss of MMP observed.

GDC-0941 inhibits PI3K signaling in glioblastoma cellsTo elucidate the mechanism as to why ABT-263 and

GDC-0941 demonstrate enhanced apoptotic cell death, lossof MMP and activation of caspases when compared with thesingle treatments, we investigated if GDC-0941 could lowerthe apoptotic threshold by suppression of Akt signaling. All,U373, LN229 (Fig. 3A and B), and U87 (Fig. 4C) cellsshowed complete inhibition of Akt phosphorylation at Ser473 upon GDC-0941 treatment, in the presence or absenceof ABT-263, showing that GDC-0941 is a potent andinhibitor of the PI3K signaling cascade in malignant gliomacells.

GDC-0941 depletes Mcl-1 protein levels in aposttranscriptional manner in glioblastoma cellsABT-263 binds strongly to Bcl-2 and Bcl-xL, but weakly

to Mcl-1 (7). By interacting with these antiapoptotic mole-cules, proapoptotic bcl-2 family members, such as Bim andBax, are released and can initiate and facilitate intrinsicapoptosis. Because of the inefficient interaction of ABT-263 with Mcl-1, the latter is likely to mediate resistanceagainst ABT-263 therapy. Thereafter, we hypothesized thatGDC-0941 could cause a reduction in Mcl-1 levels andthereby primes glioblastoma cells to the cytotoxic actions ofABT-263. To clarify this, we treated stem cell–like gliomacells (grown as neurospheres), GS9-6 andNCH421K cells aswell as established glioblastoma cell lines LN229, U373, andU87 glioblastoma cells with increasing concentrations ofGDC-0941 and subjected them to Western blot analysis.Although GDC-0941 did not have an effect on Mcl-1protein levels in U373 glioma cells (Supplementary






0 85

150

57

43

0

0 74

260

0

0

0

77

23

Red

cha

nnel

Green channel

Pro

pidi

um io

dide

Annexin V

Control GDC-0941

ABT-263 ABT263+GDC-0941

Control GDC-0941

ABT-263 ABT-263+GDC-0941

BA

D

E

***

C2 11

285

Control GDC-09411 28

69 2

ABT-199+GDC-0941

643

32 1

ABT-1993 17

78 2

NCH644

F

Pro

pidi

um io

dide

Annexin V

89

0 6

5

4 43

530

0

84 8

8

85 7

80

NCH690

NCH421K GS9-6 NCH690 NCH644 LN2290

20

40

60

80

100

ControlGDC-0941 2 μmol/LABT-263 2 μmol/LABT+GDC 2 μmol/L+2 μmol/L

*

**

***

*** ***

% A

nnex

in V

–pos

itive

cel

ls

###

###

###

### ###

NCH644 NCH690 LN2290

20

40

60

80ControlGDC-0941 2 μmol/LABT-199 2 μmol/LABT+GDC 2 μmol/L+2 μmol/L

% A

nnex

in V

–pos

itive

cel

ls

***

******

###

######

Control GDC ABT ABT+GDC0

20

40

60

80

100

% o

f cel

ls w

ith lo

ss in

MM

P LN229

2 μmol/L

2 μmol/L

2 μmol/L2 μmol/L

Figure 2. Effects of the combination treatment of ABT-263/ABT-199 and GDC-0941 on apoptosis induction and MMP in LN229 glioblastoma cells. A and B,NCH644, NCH690, NCH421k, GS9-6, and LN229 cells were treated with 2 mmol/L ABT-263, 2 mmol/L GDC-0941, and the combination of both for 24 hours.Subsequently, cells were stained with Annexin V/propidium iodide (PI) and analyzed by flow cytometry. FL1 (Annexin V) and FL3 (propidium iodide) arerepresented on the x-axis and y-axis, respectively. One representative plot is shown in A. (Continued on the following page.)

Pareja et al.





Fig. S1B), treatment of LN229 andU87 glioblastoma cells aswell as the neurosphere formingNCH421K andGS9-6 cells(18), caused a marked reduction of Mcl-1 protein levels,which was observed to be dose dependent (Fig. 4A–D). Wethen asked the question as to whether the combinationtreatment of ABT-263 and GDC-0941 could also reduceMcl-1 levels. Confirming this notion, the combinationtherapy led to a further decrease of Mcl-1 levels in LN229cells in a time course experiment as early as 4 hours aftertreatment (Fig. 4E). The timeframe of the ABT-263/GDC-0941–mediated reduction of Mcl-1 protein levels coincidedwith the peak cleavage of both initiator caspase-9 and effectorcaspase-3 (Fig. 4E). Of note, phosphorylation of Akt at Ser473 was undetectable in the presence of GDC-0941 regard-

less of it being administered as a single reagent or incombination with ABT-263 (Fig. 4E). We then evaluatedthe effect of ABT-263 onMcl-1 levels.We did not detect anychanges of expression in Mcl-1 levels in LN229 upon ABT-263 treatment (Supplementary Fig. S1D), whereas in U373cells ABT-263 led to a marked increase in Mcl-1 proteinlevels (Supplementary Fig. S1C), the significance of whichremains to the elucidated. Phosphorylation of Akt wasminimal or not affected by ABT-263 in both LN229 andU373 glioblastoma cells 7 hours after treatment (Fig. 4A andSupplementary Fig. S1C). To determine if Mcl-1 is regu-lated at the transcriptional level by GDC-0941, LN229 cellswere exposed to increasing concentrations of GDC-0941 for7 hours. Despite a tendency to decrease, no statistically

DC

U373

20

0 2

0

0

Akt

ph-Akt

2

2

ph-Akt

Akt

LN229

2

0

0

2

0

0

2

2

U373

20

0 2

0

0 2

2

Actin

CP9

cCP3

LN229

GDC (μmol/L)

2ABT263 (μmol/L)

CP9

cCP3

Actin

0

0 2

0

0 2

2

BA

60 kDa

60 kDa

60 kDa

60 kDa

aDk 54aDk 54

17/19kDa

17/19kDa

4735/37kDa

4735/37kDa

GDC (μmol/L)

ABT263 (μmol/L)

GDC (μmol/L)

ABT263 (μmol/L)

GDC (μmol/L)

ABT263 (μmol/L)

Figure 3. Inhibition of PI3Ksignaling by GDC-0941 inmalignant glioma cells andenhanced activation of initiatorand effector caspases by thecombined treatment of ABT-263andGDC-0941 A–D) LN229 (A andC) andU373 (B andD)were treatedwith 2mmol/LGDC-0941, 2mmol/LABT-263 or the combination ofboth reagents for 7 hours andsubjected to immunoblotting.Shown are the results (A and B) forph-Akt (Ser 473; ph-Akt) and totalAkt. Whole cell lysates were alsoresolved by Western blot analysisand probed for initiator caspase-9(CP9) and effector caspase-3(cCP3) in both LN229 (C) andU373(D) cells. ABT—ABT-263; GDC—GDC-0941; ABT þ GDC—combined treatment of ABT-263and GDC-0941.

(Continued.) B, results are quantified and statistically analyzed. The number of Annexin V positive cells following combination treatment (2 mmol/L ABT-263and2mmol/LGDC-941) is different in a statistically significantmanner fromABT-263,GDC-0941, and the control treatment. Two-way analysis of variancewasconducted followed by Bonferroni posttests. Stars indicate statistical significance between ABT-263 vs. ABT-263 þ GDC-0941 (�, P < 0.05; ��, P < 0.01;��, P < 0.001), whereas "#" highlights statistical significance between GDC-0941 vs. ABT-263þGDC-0941 (#, P < 0.05; ##, P < 0.01; ###, P < 0.001). C and D,NCH644, NCH690, and LN229 glioblastomas cells were treated with 2 mmol/L ABT-199, 2 mmol/L GDC-0941, and the combination of both for 24 hours.Subsequently, cells were stained with Annexin V/PI and analyzed by flow cytometry. FL1 (Annexin V) and FL3 (PI) are represented on the x-axis andy-axis, respectively. One representative plot is shown inC. D, results are quantified and statistically analyzed. The number of Annexin V positive cells followingcombination treatment (ABT-263 andGDC-941) is different in a statistically significantmanner fromABT-263, GDC-0941, and the control treatment (two-wayanalysis of variance was conducted followed by Bonferroni posttests). Stars indicate statistical significance between ABT-199 vs. ABT-199 þ GDC-0941(�, P < 0.05; ��, P < 0.01; ��, P < 0.001), whereas "#" highlights statistical significance between GDC-0941 vs. ABT-199 þ GDC-0941 (#, P < 0.05;##, P < 0.01; ###, P < 0.001). E and F, LN229 glioblastomas cells were treated with 2 mmol/L ABT-263, 2 mmol/L GDC-0941, and the combination of both for24hours. Subsequently, LN229cellswere stainedwith themitochondrial dye JC-1, and analyzedby flowcytometry. FL1 (green channel) andFL2 (red channel)are represented on the x-axis and y-axis, respectively. F, results are quantified and statistically analyzed. The percentage of cells, demonstrating loss ofMMP, following the combination treatment (ABT-263 and GDC-941) is different, in an statistically significant manner, from ABT-263, GDC-0941, and thecontrol treatment (one-way analysis of variance was performed followed by Tukey Multiple Comparison Test). Values are given as mean � SEM ofrepresentative experiments. ABT—ABT-263 (Fig. 2B and E); ABT—ABT-199 (Fig. 2D); GDC—GDC-0941; ABT þ GDC—combined treatment of ABT-263and GDC-0941, MMP. A P value of less than 0.05 is indicated by 1 star "�", whereas a P value of less than 0.01 is highlighted by 2 stars "��". A P valueless than 0.001 is indicated by a star triplet (��).






significant alterations of Mcl-1 mRNA levels were detectedat 2, 4, and 8 mmol/L of GDC-0941 (P¼ 0.1441; Fig. 5A),which suggests that a posttranscriptional mechanism mayprimarily contribute to GDC-0941–mediated suppressionof Mcl-1 levels. Recent studies show that Mcl-1 is a proteinwith a short half-life, prone to degradation by the protea-some and caspases (20–22). Hence, we postulated that apotential mechanism for GDC-0941–driven depletion ofMcl-1 protein levels could be enhanced proteasomal degra-dation. To test this, we treated LN229 cells for 7 hours withdifferent concentrations of GDC-0941 in the presence orabsence ofMG132, a proteasomal inhibitor. TreatmentwithMG132 partially rescued GDC-0941–mediated Mcl-1depletion (Fig. 5B), in keeping with the hypothesis thatGDC-0941 enhances Mcl-1 degradation through the pro-teasome. We demonstrated that the combined treatment ofABT-263 and GDC-0941 induces apoptosis to a greaterextent than single treatments, it would be thus conceivablethat the combination treatment as well as GDC-0941

administered alone would impact the protein half-life ofMcl-1. To examine this postulate, we treated LN229glioblastoma cells with the protein synthesis inhibitor,cycloheximide in the presence or absence of ABT-263 andGDC-0941. Single treatment with GDC-0941, in thepresence of cycloheximide, significantly reduced the pro-tein half-life of Mcl-1, with a marked decrease of Mcl-1protein levels already after 1.5 hours of treatment (Fig.5C). Similarly, combination treatment of ABT-263 andGDC-0941 significantly altered protein half-life of Mcl-1,causing a decline of Mcl-1 levels starting 45 minutesfollowing treatment, with a substantial depletion 3 hoursof therapy (Fig. 5D). These results indicate the existenceof a posttranslational mechanism by which GDC-0941alone and in combination with ABT-263 depletes Mcl-1protein levels. Mcl-1 reduction by GDC-0941 was res-cued by the proteasome inhibitor MG132, indicating thatthat Mcl-1 protein levels are suppressed by enhancedproteasomal degradation.

Mcl-1

Akt

ph-Akt

cCP3

CP9

GDC

ABT

−

−

+

+

−

−

+

+

+

+

+

+

+

+

+

+

+

+

LN229

Mcl-1

0 2 4 8

LN229

ph-Akt

Akt

60 kDa

60 kDa

40 kDa

30 kDa

BA

C

Mcl-1

Actin

40 kDa

45 kDa

ABT

NCH421K

GDC − +

+

−

− −

D

rel. exp. 1.0 1.07 0.75

0 2 5

Mcl-1

ph-Akt

Akt

U87

60 kDa

60 kDa

40 kDa

30 kDa

60 kDa

60 kDa

40 kDa

30 kDa

30 kDa

17 kDa

35 kDa

47 kDa

E

rel. exp. 1.0 0.4 0.25

Time (h) 0 7 7 .5 1.5 2 3 5 7

14-3-3β

14-3-3β

14-3-3β

14-3-3β

ph-Akt

Mcl-1

Akt

Actin

60 kDa

60 kDa

40 kDa

45 kDa

0 2 4 8

GS9-6

GDC (μmol/L) GDC (μmol/L)

GDC (μmol/L)

Figure 4. Effects of ABT-263 andGDC-0941 on phosphorylation ofAkt, Mcl-1 levels, and cleavage ofcaspases 9 and 3. A, primary GS9-6 glioma stem cell–like cells weretreated with increasingconcentrations of GDC-0941(mmol/L) for 7 hours and subjectedto immunoblotting with antibodiesagainst ph-Akt (Ser 473), Akt, andMcl-1. Actin protein served asloading control. B and C, LN229,and U87 were treated withincreasing concentrations ofGDC-0941 (mmol/L) for 7 hoursand subjected to immunoblottingwith antibodies againstphosphorylated Akt (Ser 473), Aktand Mcl-1. 14-3-3 protein servedas loading control. D, NCH421Kcells were treated with 2 mmol/LGDC-0941 or 2 mmol/L ABT-263for 7 hours and subjected toimmunoblotting with antibodiesfor Mcl-1. Actin served as loadingcontrol. E, LN229 cells weretreated with suboptimal dosagesof GDC-0941 (1 mmol/L), ABT-263(2 mmol/L) or the combination ofboth for the depicted times andsubjected to immunoblotting forantibodies against Caspase-9,cleaved Caspase 3,phosphorylated Akt (Ser 473), Aktand Mcl-1. The antibody againstcaspase-9 detects its total form(47 kDa), as well as its cleaved(active) form at 35–37 kDa. 14-3-3served as a loading control. ABT –

ABT-263; GDC – GDC-0941;ABTþGDC – combined treatmentof ABT-263 and GDC-0941.

Pareja et al.





Ectopic overexpression of human Mcl-1 attenuatedapoptosis induced by the combination therapy of GDC-0941 and ABT-263To further confirm the notion that Mcl-1 mediates

apoptotic resistance, we tested 2 cell lines with high(U87) and low levels of Mcl-1 (LN229) protein expressionfor the sensitivity of ABT-263. Consistent with the expres-sion pattern, U87 cells were more resistant to the cytotoxiceffects of ABT-263 as compared with LN229 cells (Supple-mentary Fig. S2A).Next, we investigated if overexpression ofMcl-1 would attenuate ABT-263/GDC-0941–mediated

induction of apoptosis. In these experiments, LN229 cellswere transfected with a plasmid encoding the open readingframe of human Mcl-1. Forty-eight hours after transfec-tion with either a control empty pcDNA3 plasmid, or aplasmid encoding human Mcl-1, LN229 cells were har-vested, lysed, and analyzed by Western blotting for Mcl-1expression (Fig. 6A). After selection cells were subjected toABT-263 and GDC-0941 combination therapy (Fig. 6B).Moreover, LN229 cells overexpressing human Mcl-1displayed a statistically significant protection fromABT-263/GDC-0941–induced cell death as compared

30 kDa

40 kDa

Control GDC2 GDC4 GDC80

20

40

60

80

100

Mcl

-1 m

RN

A le

vels

(%

)7h

LN229

LN229

Mcl-1 40 kDa

GDC+ABT

Cycloheximide

14-3-3β 30 kDa

Time (h)

+

+ +++

+

− −−−

0 0

+ + + + + +

+

.75 .75 1.5 1.5 3.0 3.0

MG132 (μmol/L) 80

5 2

2

5

0

2

0

0

LN229

Mcl1

14-3-3β

B

C

A

Mcl-1 40 kDa

45 kDaActin

GDC

Cycloheximide

Time (h)

+

+

+

++ +− −− −

0 0

+ + + + + +

.75 .75 1.5 1.5 3.0 3.0

D

LN229

GDC (μmol/L)

(μmol/L) (μmol/L) (μmol/L)

Figure 5. Regulation of Mcl-1 by GDC-0941. A, LN229 cells were treated with increasing concentrations of GDC-0941 for 7 hours. Subsequently, mRNA wasisolated, transcribed into cDNA, and real-time PCR analysis with primers spanning theMcl-1 transcript was performed. Data are given as relative percentageto the Control and were calculated as described in the Materials and Methods section. Data were analyzed by using one-way ANOVA, followed by a TukeyMultipleComparison Test. B, LN229cellswere treatedwithGDC-0941, with orwithout the additional of the proteasome inhibitorMG132or the combination ofboth reagents for 7 hours and subjected to immunoblot analysis with antibodies againstMcl-1 or 14-3-3b (loading control). The vertical line on the immunoblotindicates that the first sample was noncontiguous, but run on the same gel simultaneously with the other samples. C, LN229 cells were incubated with theprotein synthesis inhibitor, cycloheximide (10 mg/mL), in the presence or absence of GDC-0941 (2 mmol/L) for the indicated time points and then subjected toimmunoblotting. Membranes were incubated with a Mcl-1–specific antibody as well as with b-actin, serving as a loading control. D, LN229 cells wereincubated with the protein synthesis inhibitor cycloheximide (10 mg/mL), alone or in combination with ABT-263/GDC-0941 (2 mmol/L each) for the indicatedtime points and then subjected to immunoblotting. Membranes were incubated with a Mcl-1–specific antibody as well as with 14-3-3b, serving as a loadingcontrol. Values are given as mean � SEM of representative experiments. GDC2, GDC4, and GDC8—2, 4, and 8 mmol/L of GDC-0941.






pcDNA-hMcl-1

Empty +

+−

−

Mcl-1 40 kDa

14-3-3β 30 kDa

LN229 BA

40 kDa

30 kDa

Actin

cCP3

CP935 kDa

47 kDa

17/19 kDa

45 kDa

Mcl-1 siRNA

n.t.-siRNA +

+−

−

− −ABT263 + +

+

+−

−

LN229

DC

Mcl-1

Bcl-xL

Actin 45 kDa

Actin

cCP3

CP935 kDa

47 kDa

17/19 kDa

45 kDa

Mcl-1 siRNA

n.t.-siRNA +

+−

− −

−

ABT199 + +

+

+−

−

LN229

Mcl-1 siRNA

n.t.-siRNA +

+−

−

ABT199 − − + +

+

+−

−

LN229

FE

GDC+ABT GDC+ABT0

5

10

15

20

25

30

Empty Mcl-1 Mcl-1empty

LN229

***

% D

ead

cells

Control Control ABT-199 ABT-1990

20

40

60

80

100

siRNA-Mcl-1

siRNA-Mcl-1

siRNA-n.t.

siRNA-n.t.

LN229

% P

I-po

sitiv

e ce

lls

***

***

***

2 μmol/L 2 μmol/L

2 μmol/L+2 μmol/L 2 μmol/L+2 μmol/L

Figure 6. Overexpression of Mcl-1 attenuates cell death induced by the combination treatment of ABT-263 and GDC-0941 and specific suppression of Mcl-1sensitizes glioma cells to ABT-263/ABT-199–mediated cell death. A, LN229 glioma cells were transfected with a plasmid encoding human Mcl-1 or withthe respective empty control plasmid. Forty-eight hours after transfection cells were harvested and subjected to immunoblotting. Membranes wereincubatedwith aMcl-1–specificantibodyor anantibodyagainst 14-3-3bas loading control. B, LN229cellswere transfected, selectedwithGeneticin andweretreated with the combination of ABT-263 (ABT; 2 mmol/L) and GDC-0941 (GDC; 2 mmol/L) for 24 hours. Thereafter, cells were harvested and analyzed forcellular viability by flowcytometric analysis. LN229cells, overexpressinghumanMcl-1, displayed less deadcells in response to treatmentwithABT-263/GDC-0941. A P value of less than 0.001 is indicated by 3 stars "��". (Continued on the following page.)

Pareja et al.





with the respective control. These results indicate thatMcl-1 is implicated in death induced by ABT-263 as amonotherapeutic as well as by the combination treatmentof ABT-263 and GDC-0941.

Specific suppression of Mcl-1 by siRNA sensitizesglioblastoma cells to ABT-263/ABT-199Next we assessed if specific suppression of Mcl-1 can

sensitize glioblastoma cells to the cytotoxic effects of ABT-263 and ABT-199, respectively. LN229 cells transfectedwith a Mcl-1–specific siRNA revealed a strong reduction ofendogenous Mcl-1 levels as compared with the nontargetingsiRNA (Fig. 6C). Furthermore, the Mcl-1 siRNA wasspecific for Mcl-1 as Bcl-xL was not affected (Fig. 6C).About cell death downregulation of Mcl-1 in LN229increased the number of dead cells as compared with LN229cells transfected with a nontargeting siRNA (Fig. 6D).Furthermore, a suboptimal dosage of ABT-199 had no effecton nontargeting siRNA-transfected LN229 cells, whereasLN229 cells with suppressed Mcl-1 protein levels showed aremarked induction of cell death after ABT-199 treatment(Fig. 6D). In addition, ABT-199 treatment furtherenhancedMcl-1 siRNA-mediated cell death (Fig. 6D). Nextwe tested as to whether ABT-263 and ABT-199 enhancecleavage of initiator/effector caspases-9/-3 in LN229 cellstransfected with a Mcl-1–specific siRNA. Indeed, bothABT-199 and ABT-263 revealed a marked cleavage ofcaspase-9/-3 under Mcl-1–depleted conditions (Fig. 6Eand F).

GDC-0941 dephosphorylates BAD and aphosphorylation-deficient BAD mutant enhances ABT-263–mediated cell deathBecause glioblastoma cells contain high levels of phos-

phorylated endogenous BAD (Supplementary Fig. S1A),which is considered to be inefficient tomediate apoptosis, weseek to determine as to whether GDC-0941 modulates thephosphorylation status of BAD at Ser 112 and Ser 136. Inaddition, GDC-0941 and ABT-263 also cooperated toinduce death of U373 glioma cells, even though there wasno suppression of Mcl-1 protein levels after GDC-0941treatment. We found that GDC-0941 led to a dephosphor-ylation of BADat Ser 112 and Ser 136, respectively (Fig. 7A–C). Consistently, GDC-0941 mediated a dramatic decreasein the phosphorylation status of Akt, paralleling the levels ofBAD Ser 112 and Ser 136. Given the dephosphorylation ofBAD we hypothesized that a phosphorylation-deficientBAD (S112A, S136A) should have stronger cell deathsensitizing/inducing properties. For this purpose we trans-fected wild-type BAD and a phosphorylation-deficient

mutant BAD (S112A, S136A) into LN229 glioblastomacells. Transfection of both wild-type and mutant BADincreased the percentage of dead cells. However, phosphor-ylation-deficient BADhad a significant stronger effect on celldeath as compared with wild-type BAD (Fig. 7D). Further-more, mutated BAD cooperated with ABT-263 in apoptosisinduction (Fig. 7D). These findings support the notion thatGDC-0941-mediated dephosphorylation of BAD is impli-cated in ABT-263/GDC-0941 enhanced cell death whencompared with each drug alone.

The protein expression levels of ph-Akt (Ser 473) and ph-BAD (Ser 112) correlate in glioblastoma tissue specimensTMAs, containing 34 glioblastoma tissue specimens, were

stained for the expression of ph-Akt and ph-BAD (Ser 112),respectively. Most glioblastomas tumor specimens showedexpression of ph-Akt (Ser 473) and ph-BAD (Ser 112),whereas a minority (ph-Akt) and small fraction (ph-BAD)of cases displayed no detectable staining (Fig. 8A–Cand Table 1). Although ph-Akt was both detected in thecytoplasm and nucleus of glioblastoma cells, the expressionof ph-BAD (Ser 112) was localized to the cytoplasm. Tumorvasculature seemed to be mostly negative for both ph-Aktand ph-BAD, respectively. Notably, the expression levels ofph-Akt (Ser 473) and ph-BAD (Ser 112) revealed a statis-tically significant positive correlation (n ¼ 34; Spearmancorrelation coefficient r¼ 0.5289; 95% confidence interval,0.2223–0.7403; P< 0.0013). These data support the notionthat the Akt pathway is active in glioblastoma and affectsBAD phosphorylation, thereby inhibiting its proapoptoticproperties.

DiscussionGlioblastoma WHO IV is a treatment-resistant cancer

with a short survival time after diagnosis. Despite a signif-icant increase in our understanding of the biology of thesetumors, effective treatment strategies to overcome this dis-ease are still unavailable. Given the heterogeneous nature ofthese neoplasms, it is unlikely for a "smoking-gun" therapyto be effective in all glioblastomas. A personalized approachtailored to each individual is more likely to be successful. Inthis context, our current understanding of glioblastoma mayallow us to stratify patients into groups according to thenature of molecular aberrations in their tumors. For exam-ple, many glioblastomas harbor aberrantly active PI3Ksignaling and high levels of bcl-2/bcl-xL, which suggeststhat these tumors depend on these pathways to achieve theirgrowth and resistance to therapy. In this work, we havetargeted the 2 above-mentioned signaling networks simul-taneously by administering 2 orally available drugs that

(Continued.) C, LN229 cells were transfected with a specific siRNA against Mcl-1 or with a nontargeting siRNA, respectively. Forty-eight hours aftertransfection cells were harvested and analyzed for protein expression of Mcl-1 and Bcl-xL by immunoblotting, respectively. Actin serves as a loading control.D, LN229 cells were transfectedwith a specific siRNA againstMcl-1 or with a nontargeting siRNA, respectively. Forty-eight hours after transfection cells wereeither untreated or exposed to a suboptimal dosage of ABT-199 (2 mmol/L) overnight. Flow cytometric analysis was performed to quantify the amount ofPropidium iodide positive cells (%PIpositive cells). Statistical analysiswasperformedbyone-wayANOVAanalysis. AP value of less than 0.001 is indicatedby3 stars "��". E and F, LN229were transfected as inC,were left untreated or treatedwith ABT-263 (E) or ABT-199 (F) and analyzed for CP9 (includes proform at47 kDa as well as cleavage products at 35 kDa) and caspase-3 cleavage (cCP3).






specifically inhibit either PI3K, GDC-0941, or Bcl-2/Bcl-xL, ABT-263. ABT-263 binds to a hydrophobic groove inBcl-2/Bcl-xL and thereby displaces proapoptotic moleculesof the Bcl-2 family of proteins, such as Bim. In turn, it elicitsa bax/bak-dependent cell death, which corresponds to rapidapoptosis. Similarly to ABT-737, a nonoral predecessor ofABT-263, ABT-263 reveals antiglioma activity and maythus be suitable for the treatment of glioblastoma. Plasmaticlevels of 5.4 to 7.7 mmol/L were achieved in mice and higherconcentrations of the compoundwere detected in the plasmaof dogs. In this study, we used relevant plasmatic concen-trations of ABT-263 to closely resemble the clinical scenario.Relevant plasma concentrations of ABT-263 had amild, butsignificant growth inhibitory effect on U373 and LN229glioblastoma cells. The major therapeutic mechanism ofABT-263 is rapid apoptosis induction, and at the highestdosage of ABT-263, the reduction of cellular viability wasless than 50%. Hence, we speculated that the addition of asensitizing reagent that inhibits an additional prosurvivalpathway may facilitate ABT-263–mediated cell death. Tothis end, we used GDC-0941, an orally available novel PI3Kinhibitor. Previous studies indicate that this compound is

predominantly cytostatic and only under certain circum-stances induces apoptosis. Combination therapies often-times include reagents that induce rapid apoptosis, whichare administered in conjunction with slow acting com-pounds as sensitizers. This is exemplified by molecules thatsensitize cancer cells to death receptor–mediated apoptosis,such as TNF-related apoptosis-inducing ligand (TRAIL;refs. 14, and 23–25). We found that the combinationtreatment of GDC-0941 and ABT-263 exerted a strongereffect on loss of cellular viability in glioblastoma cells ascompared with each compound alone. This effect seemed tobe independent of the TP53 status of the tumor cell, bothboth LN229 and U373 harbor mutated TP53 alleles,whereas GS9-6 harbors wild-type TP53. Moreover, combi-nation treatment not only had an effect in establishedglioblastoma cells grown in full serum, which represent thebulk of tumor cells, but also significantly inhibited neuro-sphere formation in stem cell–like glioma cells, suggestingthat this treatment regimen may be efficacious in both theinitial reduction of the tumoral, as well as reducing anddelaying tumor recurrence, by targeting the stem cell niche(26) within high-grade glial tumors. Mechanistically, ABT-

A

ph-BAD Ser112

0 2 4 8

LN229

ph-BAD Ser136

BAD

Actin 45 kDa

23 kDa

23 kDa

23 kDa

Akt

60 kDaph-AktSer473

60 kDa

BAD

BAD S112A/ S136A

ABT-263 1 μmol/L

0

10

20

30

40

50 ****

% D

ead

cells

Empty

−

−

−

−− − + + +

++

+ +

++

−

− −

−

−

− −

−

−

B

ph-AktSer473

Akt

ph-BAD Ser136

Actin

ph-AktSer473

Akt

ph-BAD Ser136

Actin

0 2 4

U87

BAD

BAD

0 2 4

U373 DC

60 kDa

60 kDa

23 kDa

23 kDa

45 kDa

60 kDa

60 kDa

23 kDa

23 kDa

45 kDa

ph-BAD Ser112

ph-BAD Ser112

23 kDa

23 kDa

GDC (μmol/L) GDC (μmol/L)

GDC (μmol/L)

Figure 7. GDC-0941 modulates thephosphorylation status of BAD atSer 112 and Ser 136 inglioblastoma cell lines. A–C,LN229, U87 and U373 cells weretreated with increasingconcentrations of GDC-0941(concentrations in mmol/L) for 7hours and subjected toimmunoblotting with antibodiesagainst phosphorylated Akt (Ser473), Akt, ph-BAD (Ser 112 andSer136), and total BAD. Actin proteinserved as loading control. D,LN229 glioblastoma cells weretransfected with plasmids,encoding wild-type BAD, aphosphorylation deficient BAD(S112A, S136A, Serine ! Alanine)or the respective control plasmid.Thereafter, cells were either leftuntreated or treated with asuboptimal concentration of ABT-263 (1 mmol/L) and cell death wasquantified by flow cytometry.Shown are the total percentages ofdead cells. A P value of less than0.01 is highlighted by 2 stars "��".

Pareja et al.





263 andGDC-0941 in combination induced higher levels ofapoptosis as compared with each reagent on its own. Par-alleling the enhanced apoptosis observed was our findingthat combination treatment provoked and increased loss ofMMP. This led us to propose that GDC-0941 primesglioblastoma cells by acting on mitochondrial antiapoptoticmolecules, such as the Bcl-2 family of proteins. In thiscontext, it is well known that Mcl-1 is a bona-fide inhibitorof intrinsic apoptosis playing a major role in resistance totreatment with BH3mimetics, such as ABT-737 (27, 28) orits derivative ABT-263 (7). Mcl-1, localized to the mito-chondrial outer membrane, is capable of inhibiting bax-mediated intrinsic apoptosis, and its levels in tumors corre-late with prognosis. Mcl-1 may, thereafter, serve both as atherapeutic marker and as a prognostic indicator. Prior

studies showed that interferingwith cyclin-dependent kinase(CDK) with compounds such as roscovitine, lowers Mcl-1protein levels, and thereby sensitizes cells to the cytotoxiceffects of ABT-737 (7). The effect of roscovitine wasrecapitulated by an shRNA-targeting Mcl-1 in humanleukemia cells (7). Suppression ofMcl-1 results in activationof the proapoptotic Bcl-2 family protein bak through aconformational change (28), in line with the fact thatMcl-1 avidly binds to bak. Sorafenib (BAY 43-9006) is acompound initially identified as a broad kinase inhibitor. Incontrast to other kinase inhibitors, which primarily elicitcytostasis, sorafenib also induces apoptosis in the low mmol/L range. Several molecular mechanisms have been proposedand recent studies in different tumor entities confirm that akey mechanism for cell death induction by sorafenib is thedownregulation of Mcl-1. Sorafenib-mediated suppressionof Mcl-1 occurs at different levels. Some reports suggest aposttranscriptional mechanism (20), whereas others favor atranscriptional one (12, 29). For instance, Yu and colleaguesshowed that sorafenib did notmodulateMcl-1mRNA levelsin breast cancer cells, colon cancer cells, and leukemia cells.Instead, sorafenib increased proteasomal degradation ofMcl-1 in these cells (20), in keeping with the fact thatMcl-1 was described as a protein with a short-half life andprone to proteasomal degradation. In glioblastoma, sorafe-nib seems to suppress Mcl-1 at the transcriptional level,involving ATF5, a transcriptional factor (12). Irrespective ofthe mechanism, lowering Mcl-1 levels seems to be aneffective strategy to sensitize tumor cells to therapy. Indeed,therapeutic strategies, targeting Mcl-1 by sorafenib, havealready reached clinical trials (clinicaltrials.gov). Our find-ings demonstrate that GDC-0941 lowers Mcl-1 levels inseveral established glioblastoma cell lines, as well as in stemcell–like glioma cells (neurosphere cultures). In addition, wealso showed that the combination of ABT-263/GDC-0941affected Mcl-1 levels. Our findings suggest that GDC-0941regulates Mcl-1 protein levels mainly in a posttranslationalmanner. This is supported by our experiments, using proteinsynthesis inhibitor cycloheximide, which showed that in thepresence of GDC-0941 the protein half-life of Mcl-1 issignificantly reduced. In addition, GDC-0941–mediatedsuppression of Mcl-1 protein levels was rescued by theproteasomal inhibitor, MG-132, corroborating the fact thatGDC-0941 regulates the proteasomal turnover of Mcl-1.GDC-0941–mediated Mcl-1 depletion occurs within acouple of hours of treatment, suggesting that the ABT-263 and GDC-0941 can be applied together without apreincubation period with the sensitizing reagent (GDC-0941). The concept of combining PI3K inhibitors or "pleio-tropic kinase inhibitors" (30) as well as mTOR inhibitorswith BH3 mimetics has also been exploited in other tumorentities, such as rhabdomyosarcomas (RMS) and non–smallcell lung carcinomas (30–33). For instance, akin to glio-blastomas, RMS harbor a deregulated PI3K pathway andtargeting these tumors with AZD8055 proved to be aneffective strategy to sensitize RMS cells to the cytotoxicaction of ABT-737 (31). Mechanistically, the sensitizingeffect of AZD8055 in this malignancy was because of

Figure 8. Glioblastoma TMAs, containing 34 tumor samples, were stainedwith antibodies against ph-Akt (Ser 473) or ph-BAD (Ser 112).Representative photographs were taken. A, 0: absent expression; B, 1:low expression; and C, 2: high expression. Three representativeglioblastomas (GBM1, GBM2, GBM3) are shown with differentexpression levels of ph-Akt (Ser 473) and ph-BAD (Ser 112).

Table 1. Expression levels of ph-Akt (Ser 473)and ph-BAD (Ser 112) in glioblastoma tissuespecimens

Protein Score Tumors (%)

ph-Akt (Ser 473) 0 2/34 (6%)1 15/34 (44%)2 17/34 (50%)

ph-BAD (Ser 112) 0 7/34 (21%)1 21/34 (62%)2 6/34 (18%)

NOTE: 0, no staining; 1, low expression; 2, high expression.






suppression of Mcl-1 (31), reminiscent of our findings withGDC-0941 in malignant glioma cells. Upstream of PI3Kare the membrane bound tyrosine kinase receptors. EGFRis a classic example, which is often mutated in both lungadenocarcinomas and glioblastomas. However, the muta-tion sites differ between these 2 mentioned tumor entities.Although glioblastomas often harbor the EGFRvIII muta-tion (34), lung adenocarcinomas have mutations in exons19 and 21, which in contrast to glioblastomas rendersthem remarkably sensitive to Gefitinib/Erlotinib. UponGefitinib treatment lung adenocarcinomas, harboringEGFR-inhibitor sensitizing mutations, undergo Bim-dependent apoptosis, which can be significantly augment-ed by BH3 mimetics (35). This underscores the fact thatcompounds interfering with molecules upstream of thePI3K signaling pathway, such as membrane bound recep-tors, may be favorably combined with BH3 mimeticdrugs. The rational for this combination is similar to theaddition of PI3K inhibitors to combinatorial regimens,because EGF, the natural ligand for EGFR, elevates Mcl-1protein levels (36).Currently, there are also small molecule inhibitors

under development that bind to Mcl-1 and inhibit itsantiapoptotic functions, for example Obatoclax (37).Therefore, it is conceivable that these compounds maybe used in conjunction with BH3 mimetics, such as ABT-199 or ABT-263 (this study). The disadvantage of thisstrategy compared with the one presented here (the drugcombination of ABT-263 þ GDC-0941) is that Obato-clax acts downstream and will not affect other downstreampathways. PI3K inhibitors lower Mcl-1 levels and affectother apoptosis modulating factors, such as BAD (thisstudy) and caspase-9. Our study nicely showed thatglioblastoma tissue specimens and cell line harbor highlevels of ph-BAD, that GDC-0941 has an effect on BADphosphorylation status and that dephosphorylated BADenhances apoptosis by BH3 mimetics. Thus, the advan-tage of the presented combination therapy in this study isclearly that it not only affects Mcl-1, but also additionalderegulated pathways linked to the PI3K signaling axis.This becomes particularly relevant in the context ofmalignant glioma, in which the PI3K pathway is com-monly hyperactive (primary glioblastoma).

Conclusion and RemarksIn summary, we have described a novel potential combi-

natorial therapy for glioblastoma, which includes the PI3Kinhibitor, GDC-0941, and the BH3-mimetic, ABT-263. Atclinically relevant concentrations when combined, these com-pounds have a significant anti-glioma effect that is strongerthan each compound on its own in both established and instem cell-like glioma cells. Furthermore, these reagents areorally available, facilitating their administration. Mechanisti-cally, this drug combination is rational because it targets 2aberrantly active pathways in glioblastomas. In addition,inhibition of one of these pathways (PI3K) affects the secondone by lowering the expression levels of a keymolecule,Mcl-1,which drives resistance to certain BH3 mimetics.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: F. Pareja, A.H. Ross, M.D. SiegelinDevelopment of methodology: F. Pareja, J.F. Crary, M.D. SiegelinAcquisition of data (provided animals, acquired and managed patients, providedfacilities, etc.): C. Shu, J.F. Crary, M.D. SiegelinAnalysis and interpretation of data (e.g., statistical analysis, biostatistics, compu-tational analysis): F. Pareja, J.F. Crary, P.D. Canoll, A.H. Ross, M.D. SiegelinWriting, review, and/or revision of the manuscript: F. Pareja, J.F. Crary, P.D. Canoll,A.H. Ross, M.D. SiegelinAdministrative, technical, or material support (i.e., reporting or organizing data,constructing databases): D. Macleod, A.H. Ross, M.D. SiegelinStudy supervision: M.D. Siegelin

AcknowledgmentsThe authors thank Dr. L. Greene for helpful discussions and providing laboratory

space and reagents. The authors also thank R.P. Moser for supporting isolation ofprimary glioma neurosphere cultures.

Grant SupportThis study was supported in part by grants from the American Brain Tumor

Association, Translational Grant 2013 (M.D. Siegelin; ABTACU13-0098), from the2013 AACR-National Brain Tumor Society Career Development Award for Trans-lational Brain Tumor Research, Grant Number 13-20-23-SIEG, and the CTO/CTSAPilot Award from the Irving Institute for clinical and translational research (ColumbiaUniversity Medical Center, New York, New York; M.D. Siegelin) and NINDS R01NS021716 (A.H. Ross).

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be herebymarked advertisement in accordance with18 U.S.C. Section 1734 solely to indicate this fact.

Received December 13, 2013; revised March 31, 2014; accepted April 13, 2014;published OnlineFirst April 22, 2014.

References1. Stupp R, Mason WP, van den Bent MJ, Weller M, Fisher B, Taphoorn

MJ, et al. Radiotherapy plus concomitant and adjuvant temozolomidefor glioblastoma. N Engl J Med 2005;352:987–96.

2. Eisele G, Weller M. Targeting apoptosis pathways in glioblastoma.Cancer Lett 2013;332:335–45.

3. Kogel D, Fulda S,MittelbronnM. Therapeutic exploitation of apoptosisand autophagy for glioblastoma. Anticancer Agents Med Chem2010;10:438–49.

4. Siegelin MD. Utilization of the cellular stress response to sensitizecancer cells to TRAIL-mediated apoptosis. Expert Opin Ther Targets2012;16:801–17.

5. Kouri FM, Jensen SA, Stegh AH. The role of Bcl-2 family proteins intherapy responses of malignant astrocytic gliomas: Bcl2L12 andbeyond. Sci World J 2012;2012:838916.

6. NaganeM,LevitzkiA,GazitA,CaveneeWK,HuangHJ.Drug resistanceof human glioblastoma cells conferred by a tumor-specific mutantepidermal growth factor receptor through modulation of Bcl-XL andcaspase-3-like proteases. Proc Natl Acad Sci U S A 1998;95:5724–9.

7. Tse C, Shoemaker AR, Adickes J, Anderson MG, Chen J, Jin S, et al.ABT-263: a potent andorally bioavailable Bcl-2 family inhibitor. CancerRes 2008;68:3421–8.

8. Faber AC, Coffee EM, Costa C, Dastur A, Ebi H, Hata AN, et al. mTORinhibition specifically sensitizes colorectal cancerswithKRASorBRAFmutations to BCL-2/BCL-XL inhibition by suppressingMCL-1. CancerDiscov 2014;4:42–52.

9. Levesley J, Steele L, Taylor C, Sinha P, Lawler SE. ABT-263 enhancessensitivity to metformin and 2-deoxyglucose in pediatric glioma bypromoting apoptotic cell death. PLoS ONE 2013;8:e64051.


Pareja et al.




10. Gandhi L, Camidge DR, Ribeiro de Oliveira M, Bonomi P, Gandara D,Khaira D, et al. Phase I study of Navitoclax (ABT-263), a novel Bcl-2family inhibitor, in patients with small-cell lung cancer and other solidtumors. J Clin Oncol 2011;29:909–16.

11. Fassl A, Tagscherer KE, Richter J, Berriel Diaz M, Alcantara LlagunoSR, Campos B, et al. Notch1 signaling promotes survival of glioblas-toma cells via EGFR-mediated induction of anti-apoptotic Mcl-1.Oncogene 2012;31:4698–708.

12. Sheng Z, Li L, Zhu LJ, Smith TW, Demers A, Ross AH, et al. A genome-wide RNA interference screen reveals an essential CREB3L2-ATF5-MCL1 survival pathway in malignant glioma with therapeutic implica-tions. Nat Med 2010;16:671–7.

13. Folkes AJ, Ahmadi K, Alderton WK, Alix S, Baker SJ, Box G, et al. Theidentification of 2-(1H-indazol-4-yl)-6-(4-methanesulfonyl-piperazin-1-ylmethyl)-4-morpholin-4-yl-t hieno[3,2-d]pyrimidine (GDC-0941) asa potent, selective, orally bioavailable inhibitor of class I PI3 kinase forthe treatment of cancer. J Med Chem 2008;51:5522–32.

14. Siegelin MD, Reuss DE, Habel A, Rami A, von Deimling A. Quercetinpromotes degradation of survivin and thereby enhances death-receptor-mediated apoptosis in glioma cells. Neuro Oncol 2009;11:122–31.

15. CapperD,Gaiser T,HartmannC,Habel A,MuellerW,Herold-MendeC,et al. Stem-cell-like glioma cells are resistant to TRAIL/Apo2L andexhibit down-regulation of caspase-8 by promoter methylation. ActaNeuropathol 2009;117:445–56.

16. Campos B, Wan F, Farhadi M, Ernst A, Zeppernick F, Tagscherer KE,et al. Differentiation therapy exerts antitumor effects on stem-likeglioma cells. Clin Cancer Res 2010;16:2715–28.

17. Mihaliak AM, Gilbert CA, Li L, Daou MC, Moser RP, Reeves A, et al.Clinically relevant doses of chemotherapy agents reversibly blockformation of glioblastoma neurospheres. Cancer Lett 2010;296:168–77.

18. Gilbert CA, Daou MC, Moser RP, Ross AH. Gamma-secretase inhibi-tors enhance temozolomide treatment of human gliomas by inhibitingneurosphere repopulation and xenograft recurrence. Cancer Res2010;70:6870–9.

19. Siegelin MD, Dohi T, Raskett CM, Orlowski GM, Powers CM, GilbertCA, et al. Exploiting the mitochondrial unfolded protein response forcancer therapy in mice and human cells. J Clin Invest 2011;121:1349–60.

20. YuC, Bruzek LM,Meng XW, Gores GJ, Carter CA, Kaufmann SH, et al.The role of Mcl-1 downregulation in the proapoptotic activity of themultikinase inhibitor BAY 43-9006. Oncogene 2005;24:6861–9.

21. Derouet M, Thomas L, Cross A, Moots RJ, Edwards SW. Granulocytemacrophage colony-stimulating factor signaling and proteasome inhi-bition delay neutrophil apoptosis by increasing the stability of Mcl-1.J Biol Chem 2004;279:26915–21.

22. Weng C, Li Y, Xu D, Shi Y, Tang H. Specific cleavage of Mcl-1 bycaspase-3 in tumor necrosis factor-related apoptosis-inducing ligand(TRAIL)-induced apoptosis in Jurkat leukemia T cells. J Biol Chem2005;280:10491–500.

23. Bagci-Onder T, Wakimoto H, Anderegg M, Cameron C, Shah K. Adual PI3K/mTOR inhibitor, PI-103, cooperates with stem cell-deliv-

ered TRAIL in experimental glioma models. Cancer Res 2011;71:154–63.

24. Opel D, Westhoff MA, Bender A, Braun V, Debatin KM, Fulda S.Phosphatidylinositol 3-kinase inhibition broadly sensitizes glioblasto-ma cells to death receptor- and drug-induced apoptosis. Cancer Res2008;68:6271–80.

25. Reuter S, Eifes S, Dicato M, Aggarwal BB, Diederich M. Modulation ofanti-apoptotic and survival pathways by curcumin as a strategy toinduce apoptosis in cancer cells. Biochem Pharmacol 2008;76:1340–51.

26. Singh SK, Hawkins C, Clarke ID, Squire JA, Bayani J, Hide T, et al.Identification of human brain tumour initiating cells. Nature 2004;432:396–401.

27. Oltersdorf T, Elmore SW, Shoemaker AR, Armstrong RC, Augeri DJ,Belli BA, et al. An inhibitor ofBcl-2 family proteins induces regressionofsolid tumours. Nature 2005;435:677–81.

28. Chen S, Dai Y, Harada H, Dent P, Grant S. Mcl-1 down-regulationpotentiates ABT-737 lethality by cooperatively inducing Bak activationand Bax translocation. Cancer Res 2007;67:782–91.

29. Sun NK, Huang SL, Chang TC, Chao CC. Sorafenib induces endo-metrial carcinoma apoptosis by inhibiting Elk-1-dependent Mcl-1transcription and inducing Akt/GSK3b-dependent protein degrada-tion. J Cell Biochem 2013;114:1819–31.

30. RussoM, Spagnuolo C, Volpe S, Tedesco I, Bilotto S, Russo GL. ABT-737 resistance in B-cells isolated from chronic lymphocytic leukemiapatients and leukemia cell lines is overcome by the pleiotropickinase inhibitor quercetin through Mcl-1 down-regulation. BiochemPharmacol 2013;85:927–36.

31. Preuss E, Hugle M, Reimann R, Schlecht M, Fulda S. Pan-mTORinhibitor AZD8055 primes rhabdomyosarcoma cells for ABT-737-induced apoptosis by downregulating Mcl-1. J Biol Chem 2013;288:35287–96.

32. Qian J, Zou Y, Rahman JS, Lu B, Massion PP. Synergy betweenphosphatidylinositol 3-kinase/Akt pathway and Bcl-xL in the controlof apoptosis in adenocarcinoma cells of the lung. Mol Cancer Ther2009;8:101–9.

33. Spender LC, Inman GJ. Phosphoinositide 3-kinase/AKT/mTORC1/2signaling determines sensitivity of Burkitt's lymphoma cells to BH3mimetics. Mol Cancer Res 2012;10:347–59.

34. Wikstrand CJ, McLendon RE, Friedman AH, Bigner DD. Cell surfacelocalization and density of the tumor-associated variant of the epider-mal growth factor receptor, EGFRvIII. Cancer Res 1997;57:4130–40.

35. Cragg MS, Kuroda J, Puthalakath H, Huang DC, Strasser A. Gefitinib-induced killing of NSCLC cell lines expressing mutant EGFR requiresBIM and can be enhanced by BH3 mimetics. PLoS Med 2007;4:1681–89.

36. Song L, Coppola D, Livingston S, Cress D, Haura EB. Mcl-1 regulatessurvival and sensitivity to diverse apoptotic stimuli in human non-smallcell lung cancer cells. Cancer Biol Ther 2005;4:267–76.

37. Nguyen M, Marcellus RC, Roulston A, Watson M, Serfass L, MurthyMadiraju SR, et al. Small molecule obatoclax (GX15-070) antagonizesMCL-1 and overcomes MCL-1-mediated resistance to apoptosis.Proc Natl Acad Sci U S A 2007;104:19512–7.






2014;12:987-1001. Published OnlineFirst April 22, 2014.Mol Cancer Res Fresia Pareja, David Macleod, Chang Shu, et al. through Downregulation of Mcl-1 and Phospho-BADPI3K and Bcl-2 Inhibition Primes Glioblastoma Cells to Apoptosis

Updated version

10.1158/1541-7786.MCR-13-0650doi:

Access the most recent version of this article at:

Material

Supplementary

http://mcr.aacrjournals.org/content/suppl/2014/04/22/1541-7786.MCR-13-0650.DC1

Access the most recent supplemental material at:

Cited articles

http://mcr.aacrjournals.org/content/12/7/987.full#ref-list-1

This article cites 37 articles, 16 of which you can access for free at:

Citing articles

http://mcr.aacrjournals.org/content/12/7/987.full#related-urls

This article has been cited by 5 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mcr.aacrjournals.org/content/12/7/987To request permission to re-use all or part of this article, use this link



http://mcr.aacrjournals.org/lookup/doi/10.1158/1541-7786.MCR-13-0650

http://mcr.aacrjournals.org/content/suppl/2014/04/22/1541-7786.MCR-13-0650.DC1

http://mcr.aacrjournals.org/content/12/7/987.full#ref-list-1

http://mcr.aacrjournals.org/content/12/7/987.full#related-urls

http://mcr.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mcr.aacrjournals.org/content/12/7/987


Documents

PI3K and Bcl-2 Inhibition Primes Glioblastoma Cells to ...mcr.aacrjournals.org/content/molcanres/12/7/987.full.pdf · Cell Death and Survival PI3K and Bcl-2 Inhibition Primes Glioblastoma