of D1 Serine-268 in Soybean Photosynthetic Cell Cultures ... · 1,1 -dimethylurea (50- and 3-fold, respectively, compared with the wild type). Sequencing of the psbA gene (coding

Plant Physiol. (1 996) 1 12: 1499-1 508

lnduced New Mutation of D1 Serine-268 in Soybean Photosynthetic Cell Cultures Produced Atrazine Resistance,

lncreased Stability of S,Q, and S,Q, States, and lncreased Sensitivity to Light Stress'

- -

Miguel Alfonso2, José J. Pueyo, Kamel Gaddour3, Anne-Lise Etienne, Diana Kirilovsky, and Rafael Picorei*

Estación Experimental de Aula Dei, Consejo Superior de lnvestigaciones Científicas, Apdo. 202, 50080 Zaragoza, Spain (M.A., J.J.P., K.G., R.P.); and Unité de Recherche Associée 1810, Centre National de Ia

Recherche Scientifique, Photorégulation et Dynamique des Biomembranes Vegétales, Ecole Normale Superieure, 46 rue d'Ulm, 75230 Paris Cedex 05, France (A.-L;E., D.K.)

W e have isolated severa1 herbicide-resistant cell lines from photosynthetic cell suspensions of soybean (Glycine max) that possessed different levels of herbicide resistance, photosystem II activity, and chlorophyll a/b ratio. W e have further studied the STR7 mutant, which showed the highest leve1 of resistance to atrazine as well as a cross-resistance to 3-(3,4-dichlorophenyI)- 1,1 -dimethylurea (50- and 3-fold, respectively, compared with the wild type). Sequencing of the psbA gene (coding for the D1 polypeptide of photosystem 11) from this mutant revealed a single change, serine-268 to proline, in the D1 protein. To our knowledge, this substitution has not previously been described in any photosynthetic organism. In addition to affecting atrazine resistance, this single amino acid change caused a decrease in the electron transfer rate between the secondary acceptors QA and Qe and a stabilization of the S,Q,- and S,Qs- states. The mutant also showed a larger antenna size, an increase in non-Q,-reducing centers, and a higher sensitivity to light stress. The unusual stability of the S,Q,- and S,Q,- states indicates that STR7 belongs to a new class of Q,-site mutants.

Higher plants, algae, and cyanobacteria are the main photosynthetic organisms responsible for oxygen and bio- mass production. To this end, these organisms use photosystems that convert light energy into chemical energy. In these photosystems, excitation of a series of protein-bound pigments causes charge separation in the RCs, followed by electron transport reactions that reduce NADP+ and create

' This work was supported by grants from the Dirección Gen- eral de Investigación Científica y Técnica (grant no. PB92-0125) to R.P. and from the Ministère National de l'Education et de la Recherche to A.-L.E. and D.K.

Present address: Unité de Recherche Associée 1810, Centre National de la Recherche Scientifique, "Photorégulation et Dy- namique des Biomembranes Vegétales," Ecole Normale Su- périeure, 46 rue d'Ulm, 75230 Paris Cedex 05 France.

Present address: Department of Biochemistry and Molecular Biology, Escuela Técnica Superior de Ingenieros Agrónomos, Uni- versidad Politécnica de Madrid, Spain.

* Corresponding author; e-mail [email protected]; fax 34-76- 575620.

a proton gradient utilized for ATP synthesis. PSII is the site where three essential reactions occur: charge separation, quinone reduction, and oxygen evolution (for a recent review, see Vermaas et al., 1993). Since no high-resolution structure is available for the PSII RC, the purple bacterial RC serves as a model for PSII (Michel and Deisenhofer, 1988). In both types of RCs, the core consists of a het- erodimer of two integral membrane protein subunits, called L and M in purple bacteria, and D1 and D2 in PSII. The pigments (Chls and pheophytins) that catalyze charge separation across the membrane are bound to these proteins in both cases, and there are significant sequence homologies between L and M from purple bacteria and D1 and D2 (Michel and Deisenhofer, 1988; Satoh, 1993). The D1 protein of the PSII RC provides the binding site for Q,, but also for numerous chemical compounds that block electron transfer between QA and Q,. These compounds compete for the Q,-binding site (Tischer and Strotmann, 1977; Hirsch- berg and McIntosh, 1983; Vermaas et al., 1989) and are used commercially as herbicides.

D1 is encoded by the p s b A gene in higher plants, algae, and cyanobacteria, and is highly conserved in a11 photosynthetic organisms. In higher plants the p s b A gene is present as a single copy (Spielman and Stutz, 1983). Char- acterizing the effects of single-amino-acid substitutions in p s b A has become important for elucidating the molecular mechanisms by which this protein functions. However, the mutagenesis approach in p s b A from higher plants has been difficult because of the lack of standard chloroplastic gene transformation procedures. Spontaneous herbicide-resistant D1 mutants are, therefore, invaluable in studying the PSII RC structure and function. The first studies of the

Abbreviations: Chl, chlorophyll; D1 and D2, protein subunits of PSII reaction center; DCBQ, 2,6-dichlorobenzoquinone; DCMU, 3-(3, 4-dichlorophenyl)-l,l-dimethylurea; DMQ, 2,6-dimethylben- zoquinone; F,, maximal fluorescence; F,, initial fluorescence; F,, variable fluorescence; I,,, concentration of herbicide that inhibits 50% of the photosynthetic activity; L and M, protein subunits of purple bacterium reaction center; QA, primary quinone electron acceptor; QB, secondary quinone electron acceptor; RC, reaction center; tl,*, half-time.

1499

https://plantphysiol.orgDownloaded on January 20, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

https://plantphysiol.org

1500 Alfonso et al. Plant Physiol. Vol. 11 2, 1996

molecular basis of herbicide resistance were carried out with field-resistant biotypes of Amavantkus (Hirschberg and McIntosh, 1983), green algae (Erickson et al., 1984, 1989; Johaningmeier et al., 1987), and cyanobacteria (Gold- en and Haselkorn, 1985; Kirilovsky et al., 1989; Ohad and Hirschberg, 1992). In these latter organisms, a set of mutations clustered around the QB niche have been shown to produce herbicide resistance. In contrast, the herbicide- resistant mutants so far described in higher plants carry mutations only at residue Ser-264 (S+G, N, or T; Hirsch- berg and McIntosh, 1983; Blyden and Gray, 1986; Bettiny et al., 1987; Pay et al., 1988; Mazur and Falco, 1989; Smeda et al., 1993).

Development of triazine-resistant varieties of higher plants has been thwarted by the reduction of photosynthetic efficiency and plant productivity (Holt, 1988) that are always present in herbicide-resistant biotypes with a modified D1 protein. Impairment of productivity has often been linked to the phenomenon of D1 turnover and light-stress damage (i.e. photoinhibition). The D1 protein has a very rapid turnover compared with other PSII proteins (Matoo et al., 1989). Exposure of photosynthetic organisms to light- stress conditions induces a quenching of fluorescence, inhibition of PSII activity, and specific damage to D1. This process can be reversible or irreversible, depending on the ability of cells to recover PSII activity when shifted to normal light conditions (for a recent review, see Aro et al., 1993). The initial site of D1 damage appears to be close to the Q,-binding site, as shown by the fact that herbicides such as phenylureas or triazines that specifically bind to this region of the protein can protect D1 from damage (Trebst and Depka, 1990), or by studies with spontaneous or engineered mutants of cyanobacteria (Kirilovsky et al., 1989; Perewoska et al., 1994; Maenpaa et al., 1995) that produce increased sensitivity to light stress. However, at present the molecular signal that triggers D1 damage and turnover and the reason why this process specifically af- fects D1 and not other components of PSII are unknown. Thus, herbicide-resistant mutants constitute a valuable tool with which to examine the molecular mechanisms of the photoinhibition phenomenon.

In this paper we describe the isolation of severa1 herbicide-resistant mutants from photosynthetic suspensions of soybean (Glycine max). We present a physiological characterization of some of these resistant cell lines that show alterations in their photosynthetic activity, and we describe in more detail the genotype and phenotype of STR7, the mutant that exhibits the highest levels of herbicide resistance. We characterize the effect of a new QB site mutation, S268P, on the antenna size, electron transfer, charge stabilization, and pool size of centers unable to reduce QB. The effect of this mutation on the sensitivity to photoinhibition and D1 polypeptide degradation is also described.

MATERIALS AND METHODS

Cell-Suspension Culture Conditions

Photosynthetic cell-suspension cultures from the higher- plant soybean (Glycine max var Corsoy) were started from

an inoculum kindly provided by Dr. Jack M. Widholm (University of Illinois at Urbana-Champaign). Liquid cultures were grown in KN' medium as described by Rogers et al. (1987) containing 0.1 mg L-' thiamine-HCl, 0.2 mg L-l kinetin, and NAA supplemented with 0.5% SUC. Cells were cultured at 24°C under continuous light (75 pE m-' s-') from cool-white fluorescent lamps on a rotatory shaker at 130 rpm in 125-mL flasks filled to 50 mL. Five percent CO, was flushed through the chamber that housed the cell cultures. Cell suspensions used for physiological and biochemical characterization were taken from cultures in the early stationary phase of growth. Solid cultures were maintained at 24°C for 4 weeks in 1.5% agar KN' medium in a growth chamber under the same light intensity as the liquid cultures with 72% RH and a daily photoperiod of 16-h light 18-h dark.

lsolation of Atrazine-Resistant Mutants from Soybean Cell Suspensions

Herbicide-resistant soybean cells were selected in medium containing 200 PM s-triazine under photomixotrophic growth conditions (i.e. 0.5% SUC and 75 pE m-' s-'). One-third of the cell-suspension culture volume was transferred every 4 weeks for 15 months without visual selection to fresh medium containing the herbicide. During the first transfers the cultures turned yellow, but in certain cases some cells remained green. After 15 months of growth these same cultures showed a deep green color in the presence of the herbicide (see "Results"). Aliquots of these cultures were diluted 100-fold and plated on agar containing 200 p~ herbicide to isolate colonies. After culturing for 1 month, healthy, green colonies were individually transferred again to liquid medium, always in the presence of the herbicide. The resistant suspensions isolated by this approach were routinely maintained in the presence of 200 p~ s-triazine to avoid the presence of revertant cell lines.

Cell Crowth

Cell growth rates were determined by inoculating 50 mL of culture medium with approximately 1 g fresh cell weight. One milliliter of the cell suspension was transferred to an Eppendorf tube, and the cell-packed volume was determined. Determinations of doubling time were based on the actual number of days required for a doubling of the fresh cell weight.

lsolation of Thylakoid Membranes

Cells from 3-week-old cultures were harvested by filtra- tion through a layer of Miracloth paper (Boehringer), resuspended in B1 buffer (400 mM NaC1,5 mM MgCl,, 20 mM Tricine, and 0.2% BSA, pH 8.0), and disrupted during 10 min with a Teflon homogenizer. To avoid heating, the cell suspensions were kept on ice and the homogenization process was stopped for 0.5 min every min. The resulting cell extract was gently stirred for 10 min at 4°C to promote the release of chloroplasts retained within the cell debris. The extract was centrifuged at 300g for 1 min and the supernatant was centrifuged again at 13,0008 for 10 min.



Herbicide-Resistant Mutants from Soybean Photosynthetic Cell Suspensions 1501

The sediment (chloroplasts) was resuspended in B2 buffer (150 mM NaC1, 5 mM MgCl,, and 20 mM Tricine, pH 8.0) and centrifuged again at 10,OOOg for 10 min. The sediment (thylakoids) was resuspended in buffer containing 300 mM Suc and kept at 4°C until use. Under these conditions, the activity of wild-type thylakoids was 240 pmol O, mg-I Chl h-I, assayed as described below using DCBQ as the electron acceptor.

Oxygen-Evolving Activity and Determination of I,,

The I,, was determined by measuring oxygen-evolving activity in the presence of varying amounts of herbicides (atrazine or DCMU). The activity was measured at 25°C with a Clark-type oxygen electrode fitted with a thermostatted water jacket (Hansatech, King's Lynn, UK). The standard assay medium consisted of 300 mM SUC, 10 mM NaCl, and 25 mM Mes-NaOH (pH 6.5). DCBQ or DMQ at a concentration of 0.5 mM was used as an artificial electron acceptor. Saturating actinic light was provided from two projector lamps placed on both sides of the electrode cuvette and filtered through 9.5 cm of water. DCBQ, DMQ, and herbicides were dissolved in ethanol and added just before illumination was measured. The final ethanol concentration in the sample was less than 0.1%.

Flash-lnduced Oxygen Evolution

The amount of oxygen produced per flash during a sequence of saturating flashes was measured with a rate electrode similar to that described by Joliot and Joliot (1968). Short, 5-ps saturating flashes were produced by a strobotac (General Radio Co., Concord, MA). The spacing between flashes was 0.5 s. Cells (500 pg Chl mL-') were dark-adapted for 5 min prior to each flash sequence (unless mentioned otherwise). The miss and double-hit parameters and the initial apparent concentrations of S, and S, were deduced by the "sigma method" of Lavorel (1976). Back reactions (S2QBp and S,QB-) were analyzed by varying the time between the first and subsequent flashes (Bougues- Bouquet et al., 1973).

Chl Fluorescence lnduction

Chl fluorescence induction curves were recorded with a photodiode detector (Hansatech, King's Lynn, UK) con- nected to a digital storage oscilloscope. The 15-pg Chl mL-l sample was illuminated with blue-green actinic light from a 150-W tungsten lamp passed through KG1 and KG3 Schott IR filters plus a 620-nm cut-off filter. Light was passed through a photographic shutter (Copal, Tokyo, Ja- pan) (2-ms opening time) and a fiberoptic guide (Scholly, Denzlingen, Germany). The detector was protected by a 3-mm filter (RG665, Schott, Mainz, Germany) plus a 680-nm (10-nm bandpass) interference filter. The sample was stirred in a Clark-type cuvette and the actinic light intensity was 1000 pE m-'s-' on the surface of the cuvette. PSII fluorescence was monitored for 1.5 s. In a11 cases the cells were incubated in the dark for a period of 15 min before the fluorescence measurements were carried out.

Electron Transport between QA- and Qe

Fluorescence relaxation was measured at 22°C with a pulse-amplitude fluorimeter (PAM 101, Walz, Effelrich, Germany) that was slightly modified to allow computer control of the measuring beam. A single turnover flash was generated with a Xenon flash lamp (XST-103, Walz). The measuring beam of the fluorimeter was computer- controlled to give a 10-ms burst. The measurement consisted of five bursts at 1 Hz to measure the F , value, followed by one saturating flash and 30 bursts (each 10 ms long) of the measuring beam at defined intervals during 400 s. Finally, F , was measured in continuous light. The short bursts of the measuring beam produced a stable F , level, and the 400-s period was long enough to allow fluorescence to relax to the original F , level.

Photoinhibitory Experiments

Three-week-old wild-type and STR7 cells were placed in a thermostatted cuvette at 24°C. Cells were stirred during illumination with 500 or 1000 pE m-, s-l white light filtered through 9.5 cm of water. At precise intervals cell aliquots monitored the variations in F , to F, ratio. For recovery experiments, treated cells were again placed in the incubator shaker under normal growth conditions, and the F , to F , ratio was monitored at later times.

Isolation, Cloning, and Sequencing of the psbA Gene from Wild Type and Mutant STR7

DNA lsolation

Total DNA from wild-type and STR7 cells was isolated from late-exponential cells stored in liquid nitrogen. Cells were lysed with 1% SDS and the lysate was digested with proteinase K. After removing the insoluble debris by cen- trifugation (10 min at 5,500g) at 4"C, total DNA was pre- cipitated with isopropanol and purified by a CsCl gradient run overnight at 300,OOOg at 20°C in the presence of 10 mg mL-l ethidium bromide. Plasmid extractions from overnight cultures of Escherichia coli were performed as described by Maniatis et al. (1982).

Hybridization Analyses

DNA restriction fragments were transferred from gels to nitrocellulose membranes (Hybond-N, 0.45 pm, Amer- sham) as described by Southern (1975). Membranes were prehybridized for 3 to 4 h at 65°C in 3X SSC (0.45 M NaCl, 0.045 M sodium citrate, pH 7.0), 0.1% SDS, and 50% form- amide for high-stringency hybridization. A nick-translated probe, obtained from a 0.7-kb fragment generated by KpnI digestion of genomic DNA from the cyanobacterium Syn- echocystis 6714, and containing the psbA gene, was used to detect the psbA gene from soybean. The probe was dena- tured by heating at 95°C for 5 min before addition to the hybridization solution. After 16 to 24 h of homologous hybridization at 58"C, the filters were washed twice for 1 h in 3X SSC, 0.1% SDS at 60"C, and autoradiograms were




made on XAR 5 film (Kodak) that had been exposed for 24 to 48 h at -70°C.

psbA Library Construction

A hybridization-positive 1.4-kb band obtained from the digestion of total soybean cell DNA with HindIII was eluted from 0.7% agarose gels and ligated to pUC18 previously digested with HindIII and dephosphorylated according to Maniatis et al. (1982). The DNA mixture was incubated with T4 DNA ligase for 18 h at 10°C. Ligation mixtures were used to transform E. coli GT869 (thrB 1004 pro thi rpsL hsdS lacZAM15 [F’lacZAM15 laclq traD36 pro A+B +I). Libraries were screened by colony hybridization using a nick-translated psbA gene probe from Synechocystis 6714. Positive clones were isolated from the plates and double-digested with HindIII and BglII to isolate the por- tion of the 1.4-kb HindIII fragment containing the psbA gene. The 0.5-kb fragment positive to the psbA probe was ligated into pBluescript previously digested with HindIII and BamHI to create the BglII restriction site extreme in pBluescript. Colonies containing the 0.5-kb psbA insert were isolated and plasmid DNA was purified by Qiagen (Chatsworth, CA). Plasmid preparations were used to per- form dideoxy chain termination sequencing on double- stranded templates, using the Sequenase kit (United States Biochemical). T3 and T7 were used as sequencing primers and several positive clones were used for sequencing.

lnmunoblotting

Polypeptide analysis of thylakoids from wild type and STR7 was carried out under denaturing conditions in 15% acrylamide gels in the presence of 6 M urea. Gels were electroblotted onto nitrocellulose membranes and probed with antiserum against the D1 protein. The antibody used in this study (anti-D1N) was raised against a synthetic peptide homologous to the following N terminus of the D1 protein acetyl-TAILERRESEDSLWGRFC-amide, and it was a kind gift from Dr. Autar K. Matoo (Plant Molecular Biol- ogy Laboratory, U.S. Department of Agriculture / Agricul- tural Research Service, Beltsville, MD). The bands were quantified by densitometry using a BioImager (Millipore).

RESULTS

Selection of Atrazine-Resistant Cell Lines

Herbicide-resistant cell lines were selected in the pres- ente of different amounts of s-triazine. During the selection process, almost a11 of the cells turned yellow but occasion- ally some cells remained green, and after 15 months of growth some cultures completely recovered a green and healthy color, indicating cell growth in the presence of 200 p~ s-triazine. Higher concentrations of the herbicide were lethal, whereas concentrations below 200 p~ were less effective (data not shown). The greenest cultures were tested for herbicide resistance by subculturing them in medium containing the herbicide and no Suc to allow photoautotrophic growth. Cultures that remained green

under these conditions were considered to be resistant to the herbicide. We also tested herbicide resistance in solid medium cultures. Highly diluted (100-fold) resistant and wild-type cell suspensions were plated in a solid medium containing 200 p~ s-triazine. The resistant cells were able to grow photosynthetically and remained green and healthy after 1 month, whereas wild-type cells died (not shown).

Once the herbicide-resistant cells were obtained, colonies from single cells were isolated. Higher-plant cells form aggregates of variable size in suspension. However, the aggregates from photosynthetic cells are much smaller than those from heterotrophic cultures. To solve this prob- lem, aggregates of young, actively dividing cells from a 4-d culture were disrupted by means of a sharp needle syringe, diluted (100-fold), and plated in agar KN1 medium containing the herbicide. After culturing for 1 month, several colonies were able to grow under these conditions. Each colony was individually transferred to liquid medium and to plate, producing 36 resistant cell lines from which the 10 with the highest Chl content and most vigorous growth were selected for further characterization.

Photosynthetic Growth, Oxygen-Evolving Activity, and Resistance to Herbicides

Ten herbicide-resistant cell lines were further characterized, and the results are shown in Table I. Doubling times were about 2 to 3 d for the wild type and 4 to 6 d for the mutant strains. The I,, for atrazine for each cell line was determined by measuring PSII activity in isolated thylakoid membranes in the presence of different concentrations of the herbicide. Oxygen-evolving activity under saturating light and without herbicides was lower in a11 mutants than in the wild type and may explain the slower growth of the mutant cells. The I,, for atrazine was 0.5 p~ in wild type, as reported in other higher plants. The STR7 mutant was the most atrazine-resistant cell line (about 50-fold). The STR8 and STR27 mutants showed lower but still significant resistance to atrazine (16- and 10-fold, respectively). Some cross-resistance to DCMU was also observed; STR7 showed 3-fold resistance to DCMU, STR8 and STR27 exhibited between 4- to 5-fold resistance to DCMU, and the STR3 mutant was the most resistant to the herbicide (6- fold). The STR5 mutant exhibited the lowest PSII activity, although its resistance to atrazine or DCMU was not high. The STR7 mutant, which exhibited the highest resistance to atrazine, was further characterized.

Cloning and Sequencing of the psbA Cene from the STR7 Mutant

Cloning and sequencing of the wild-type psbA gene from soybean has already been described by Spielmann and Stutz (1983), who showed that a 1.4-kb HindIII fragment contained approximately 525 bp of the COOH terminal sequence of the psbA gene, whereas a 2.4-kb fragment created by SmaI digestion contained the entire gene. Both fragments also contained the trnH gene and the beginning of the IR1 region of the soybean chloroplastic genome.



Herbicide-Resistant Mutants f rom Soybean Photosynthetic Cell Suspensions 1503

Table 1. Relative resistance, photosynthetic activity, Chl a/b ratio, and doubling time o f wild-type and resistant cell lines isolated from photosynthetic cell suspensions

Data were obtained from at least three independent experiments.

Relative Resistance

Atrazine DCMU Cell Line PSll Activitya Chl a/b Ratiob Doubling Time

Wild type STR7 STR2 STR3 STR4 STR5 STR7 STR8 STR26 STR27

234 135 149 131 120 89

137 129 146 142

1 5 4 3 3 2

42 16 3

10

1 5 3 6 3 1.3 2 4.5 1.3 4

3.00 2.49 2.50 2.56 2.50 2.03 2.4 2.54 2.39 2.45

d 2-3 4 -5 4 -5 5 5- 6 4 5- 6 5- 6 4-5 5- 6

a Activity measurements in Wmol O, mg Chl-’ h-’ were carried out in the presence of 0.5 mM DCBQ using thylakoids isolated after 14 d of cell growth. Chl a/b ratio was obtained after 14 d of cell culturing.

These genes are structural hallmarks of most higher-plant chloroplastic genomes. Since a11 mutations known to in- duce herbicide resistance are clustered in the QB site, in which the sequence is contained in a 0.5-kb HindIII-BglII psbA fragment of the 1.4-kb HindIII fragment, we decided to sequence this fragment. Total DNA from wild-type and STR7 cells was digested with HindIII, and a 1.4-kb fragment, which hybridized with the radioactive psbA-specific probe, was obtained (Fig. 1). The 1.4-kb HindIII fragment was eluted from the gel and cloned in a pUC18 plasmid. Positive colonies were identified and the plasmid containing the insert was then digested with BglII and subcloned in a Bluescript plasmid (see “Materials and Methods”) to obtain a 0.5-kb fragment of psbA gene containing the COOH terminal part of D1 protein. The sequencing strategy is shown in Figure 1 by the arrows under the 0.5-kb insert. Sequence analysis of the 0.5-kb psbA fragment of

4 2.4 kb Smal - 1.4 kb Hindll +

6 psbA 4

S H 0 H S

1 I I

i I

h - - - L

L A

100 b.p . Y

Figure 1. Partia1 restriction map of the two fragments of soybean DNA containing the psbA gene. 60th fragments resulted positive for the Synechocystis psbA probe. Upper, Smal 2.4-kb fragment; lower, Hindlll 1.4-kb fragment. Arrows under the 0.5-kb psbA gene fragment contained in the Hindlll 1.4-kb fragment indicate the sequencing strategy used in this study. The box inside the 0.5-kb psbA fragment shows the position of the Qe niche-coding region. H, Hindlll restriction site; B, Bglll site; S, Smal site.

STR7 showed a single nucleotide change in the mutant. As shown in Figure 2, this nucleotide change (TCT to CCT) resulted in the substitution of Ser-268 by Pro. To our knowledge, this D1 mutation has not previously been described.

Q,-Reducing and Non-Q-Reducing PSll Centers in STR7 and Wild-Type Cells

The PSII activity inhibition curves in the presence of variable amounts of atrazine showed a markedly two- phase character using DCBQ as an electron acceptor (data not shown). The appearance of two different phases sug- gested the presence of two atrazine-binding sites in PSII (Jursinic et al., 1991) or the existence of two types of centers with different affinities to atrazine. The crystallographic data of the bacterial RC in the presence of terbutryn (an analog of atrazine) obtained by Sinning et al. (1989) and

689 AGCTTTTCAGATGGTATGCCTCTAGGAATTTCAGGTACTTTCAA~TTATGA~GTATTT S F S D G M P L G I S G T F N F M I V F

750 CAGGCTGAGCATAATATTCTTATGCATCCATTTCACATGAGGTGTA~TGGTGTATTC Q A E H N I L M H P F H M L G V A G V F

811 GGCGGCTCCCTATTCAGTGCTATGCATGGTTCCTTGGTAACTTCTAGTTTGATCAGGGAA G G S L F S A M H G S L V T S S L I R E

872 ACCACAGALWLTGAATCTGCTAATGAAGGTTACAGATTTGGTCAAGAGGAAGAAACCTAT T T E N E S A N E G Y R F G O E E E T Y

V 933 A A T A T T G T A G C T G C T C A T G G T T A T T ~ G G C C G A T T G A T C T N I V A A H G Y F G R L I F O Y A S F B v

994 RATCCTCGTTCTTTACATTTCTTCTTAGCTGCTGCTTGGCC~TAGTAGGTA~TGGTTTACC N P R S L H F F L A A W P V V G I W F T

1055 GCTTTAGGTATCAGCACTATGGCTTTCAACTTAAATGGTTTCAATTTCAACCAATCCGTA A L G I S T M A F M L N G F N F N Q S V

1116 GTTGATAGTCAAGGTCGTGTAATTAATACCTGGGCTGATATTATTAACCGAGCTAACCTT V D S Q G R V I N T W A D I I N R A N L

1177 GGTATGGAAGTAATGCATGAACGTAATGCTCATAATTTCCCTCTAGAT G M E V M H E R N A H N F P L D

Figure 2. Nucleotide and deduced amino acid sequences obtained from the sequencing of the 0.5-kb Hindlll-Bglll psbA gene fragment cloned in pBluescript. The region of the sequence coding for the Qe pocket is underlined. Codon 268 coding for Pro in STR7 (Ser in wild type) is indicated (V). The position of Ser-264, the residue at which other herbicide-resistant mutations in higher plants have been described, is also indicated (V).




1 . , , / . , . , . , . , . -

O~ 9 - 8 11

STR7 -

W T

.---......_..-_- -----........--

" " ' ~ " ' ~ ' ' '

Sinning (1992) do not support the hypothesis of the pres- ente of two herbicide-binding sites. In addition, the two- phase character of the inhibition curves disappeared when the PSII activity was measured using DMQ, another artificial electron acceptor (data not shown). Although DMQ gives a lower maximal activity of electron transfer than DCBQ, the main difference between DCBQ and DMQ is that the latter accepts electrons only from Q,-reducing centers, whereas the former is less specific and can take. electrons from both Q,-reducing and non-Q,-reducing centers. Q,-reducing centers are defined as centers that are able to transport electrons from water to Q,, in contrast to non-Q,-reducing centers, which are able to catalyze electron transfer from water to QA but not to Q, (Graan and Ort, 1986; Cao and Govindjee, 1990; Hsu and Lee, 1991).

Figure 3 shows the light-saturation curves for PSII activity measured with DCBQ and DMQ in wild type and STR7. The saturation curves for wild type were quite similar, whereas those for STR7 were less similar. This result sug- gests that although some non-Q,-reducing centers were present in wild type, a significantly greater number of such centers were present in STR7. Moreover, the maximum oxygen-evolving activities of wild-type and STR7 thylakoids using DMQ were about 201 and 90 pmol O, mg.' Chl h-l, respectively, whereas DCBQ gave activities of 234

300

1 250 h

r c .

3 s .3" :- 200

150 õ o

al . 100

6 o 50

O

C

ON - v E,

W T DCBQ

2 4 6 8 10 12

Light intensity (pE. m- *. s- ') x 103

150 5

c . .- 0 - 120 5 'E = > o 90 o F C

;; Y E,

o .N 6 0

O 30 -

o y ' " ' " ' " " " ' ~ O 2 4 6 8 10 12 14

Light intensity (pE. m- *. s- ') x 103

Figure 3. Light-saturation curves of the oxygen-evolution activity in thylakoids obtained from wild type (WT, upper) and STR7 (lower). DCBQ or DMQ (0.5 mM) were used as artificial electron acceptors.

Time (ms)

Figure 4. Fluorescence decay yield measurements. Fluorescence decay curves for dark-adapted cells of soybean wi ld type (WT, solid line) and STR7 mutant (dashed line) following an actinic saturating flash. Curves are normalized to the same F,.

and 137 pmol O, mg-' Chl h-', respectively. Thus, the DMQ to DCBQ activity ratio was smaller in the mutant (0.65) than in the wild type (0.86), suggesting again that more non-Q,-reducing centers were present in STR7 cells.

Determination of the Photosynthetic Unit Size

The light-saturation curves (Fig. 3) also indicated the presence of a larger antenna in the mutant than in the wild type. In the latter, light saturation of PSII activity was reached at an intensity of about 6000 pE m-' s-', whereas in STR7 a light intensity of 3500 pE m-* s-' produced maximum oxygen-evolution activity. Moreover, the Chl alb ratio indicative of the antenna to RC ratio (since Chl b is mainly located in the peripheral antenna of PSII) was always lower in STR7 (2.45) than in wild type (3.00), also suggesting an increased antenna size in STR7 cells.

Electron Transfer from QA- to Qe

The kinetics of reoxidation of QA- in wild-type and STR7 cells were monitored by Chl fluorescence decay after a saturating flash (Fig. 4). The decay curves were resolved into two exponentials and a constant. Table I1 shows the values obtained by mathematical deconvolution of the reoxidation curve obtained from the PAM fluorimeter. The amplitude of the fast phase of fluorescence decay, which corresponds to the electron transfer from QA- to Q B or QB-, was smaller and the lifetime was longer than in wild type (Table 11). In addition, the amplitude of the slow phase, which reflects the establishment of a quasi-steady- state leve1 of QA- and which is influenced by the binding and release of Q,, was larger in STR7 than in wild type. These results show that as a result of the mutation, the electron transport properties are modified in the mutant. No conclusions can be drawn from the intermediate-phase parameters in the experiments shown.

Oxygen Oscillatory Patterns: S , and S, Dark Distribution, and Stability of S , and S , States

Activation of wild-type or STR7 dark-adapted cells by a train of short, saturating flashes produces oxygen with a yield per flash that oscillates with a periodicity of four (Kok et al., 1970). This is due to a cycle of five oxidation states




Table II. Biophysical parameters of wild type and STR7

matrix analysis of recorded oxygen sequences on samples dark-adapted for 5 min. Fluorescence decay parameters were determined from the average of 1 O different curves. Oxygen emission parameters were computed by

Fluorescence Decay Yield Oxygen Emission Oscillatory Parameters

Cell Line Fast phase lntermediate phase Slow phase

t1/2 (YS) % tl/2 (ms) % t1/2 % So (%I S i (%I t i l 2 SZQB- ( s ) t1/2 S 3 Q B - (SI a - Wild type 360 73 4.6 13 14 25-30 70-75 28 a

STR7 483 63.5 4.5 17.5 - 19 30-35 65-70 45 25

-, Not determined

(S-states, So-S,). The oscillation of oxygen produced per flash in dark-adapted cells was maximum on the third flash (data not shown). As flashes proceeded, the amplitude of the oscillations diminished until a constant oxygen yield per flash was reached. This is due to double turnovers (double hits) occurring during the flash, or to "misses" due to centers that have P+ or QA- before the flash or in which P+QA- recombination occurs between the flashes (Shinkarev and Wraight, 1993). The miss and double-hit parameters (data not shown) and the initial S, and SI concentrations of the wild type and mutant were similar (Table 11). Since misses were not increased and the O2 oscillation pattern from STR7 was similar to that of wild type, it is apparent that the kinetic properties of the water- oxidizing complex were not modified in STR7.

The S, state is deactivated in the dark by recombination with negative charges stored on the acceptor side. After stabilization, the negative charge is shared between QA and QB, and the recombination between S,Q,- is more rapid and needs less energy than the recombination between S2QB-. On the other hand, a destabilization of QB- binding would vary the energy stored in the SIQB- pair. These back reactions can be studied with the oxygen electrode by varying the time between the first and subsequent flashes for S,Q,- and between the second and subsequent flashes for S,QB- (Bouges-Bouquet et al., 1973). The f l / , for S,QB- recombination, determined by this method at 22"C, was 28 s for the wild type and 45 s for STR7. The t l / 2 of the S,QB- recombination was about 8 and 25 s for wild type and STR7, respectively (Table 11). Wild-type soybean values were similar to those reported for other higher plants, such as Ckenopodium or spinach (Miranda and Ducruet, 1995), or the cyanobacterium Synechocysfis (Perewoska et al., 1994).

Sensitivity to Light-Stress Damage

Exposure of photosynthetic organisms to high light intensity induces fluorescence quenching, inhibition of PSII activity, and specific damage to D1 polypeptide. Sensitivity of wild-type and STR7 cells to high light illumination was tested in vivo by measuring the rate of fluorescence quenching and D1 degradation. Wild-type and STR7 cells were exposed to 500 or 1000 p E m-' s-l white light for 2 h. Figure 5 shows the quenching of F, during exposure to these light intensities. The rate of F, quenching increased with intensity in both wild-type and STR7 cells but increased faster in the mutant cells. The decrease of F, was

due to a quenching of F,. Under the measurement conditions, no significant changes in F, were detected. Since the samples were dark-adapted for 15 min before the fluorescence measurements, any decrease of F, induced by non- photochemical quenching, or any increase of F, due to the closure of PSII centers, could not be detected. In vitro D1 degradation during photoinhibition was also characterized by inmunological detection of D1 in thylakoids isolated from photoinhibited wild-type and STR7 cells, as described in "Materials and Methods." Figure 6 shows that the rate of D1 degradation was similar in both mutant and wild-type cells.

D I SC U SSI ON

Few attempts have been made to take advantage of higher-plant photosynthetic suspensions as a system for obtaining herbicide-resistant mutants. But, as shown in

n. ~ " " ' " " " " " " " ' " ' '

500 pE.m- '.s- '

$ ? t

Time (min)

C .--y a n

70

6 0 . WT

5 0 w - .._.____ STR7

4 0 O 5 0 100 150 200 250

a-........

Time (min) Figure 5. In vivo photoinhibitory quenching of F, in wild type (WT) and STR7. Variation of the F, to F, ratio in whole cells of wild type and STR7 with the time of exposure to two different light intensities (500 and 1000 WE s-') at 22°C. Control F, to F, ratios were about 0.8 in wild type and STR7.




l o o h . , . , I , I ,

zol O 5 0 100 1 5 0 2 0 0

Time (min)

Figure 6 . Degradation of the D1 polypeptide in wild-type (13) and STR7 (O) mutant. Thylakoids were isolated from photoinhibited wild- type and STR7 cultures with 500 pE m-' s-' light intensity. D1 degradation was monitored by western blotting with a specific N-terminal D1 antibody (see "Materials and Methods").

"Results," this material can be used to obtain new D1 mutants with interesting properties. The decay kinetics of the transient fI uorescence yield after one saturating flash was slower in STR7 than in wild type (Table 11). The amplitude of the fast phase of the fluorescence decay was smaller and its lifetime was larger with respect to wild type. The amplitude of the slow phase, which reflects establishment of a quasi-steady-state leve1 of QA- and which is influenced by the binding and release of QB at its site, was also larger. A similar decrease of electron transfer rates between QA- and QB was also observed in atrazine- resistant biotypes of severa1 species such as Chenopodium, Amaranthus, and Brassica napus (Etienne et al., 1990; Taoka and Crofts, 1990; Sundby et al., 1993).

However, the STR7 mutant exhibits properties that contrast with other Q,-site mutations. For example, the S,Q,- and S,Q,- states are more stable than is generally observed in herbicide-resistant Q,-site mutants of cyanobacteria (Eti- enne et al., 1990; Gleiter et al., 1992; Perewoska et al., 1994). Recently, Miranda and Ducruet (1995) demonstrated a destabilization of the S,Q,- and S,Q,- states in atrazine- resistant Chenopodium plants. To our knowledge, the stabilization of the S2QB- and S,Q,- pairs observed in the STR7 mutant has never been reported in higher plant or green alga1 mutants with a modified QB site. However, a greater charge stabilization was also observed in the CA1 site- specific mutant of Synechocystis 6803 (Maenpaa et al., 1995), in which the QEEET sequence at the D-de loop of D1 was deleted and Gln-241 was replaced by His.

Etienne and Kirilovsky (1993) have proposed a classifi- cation of three categories for Q,-site mutants according to specific characteristics. The first category comprises mutations that have no significant effects on electron transfer or QB binding. The second category includes those mutations that affect equilibrium constants on the acceptor side at- tributed to a shift of the apparent equilibrium between QA-QB and QAQB- and destabilization of S,Q,- and S,Q,- recombination. The third category represents mutations of D1 that affect both acceptor and donor sides through modifications that render the donor side more accessible to reductants present in whole cells. The STR7

mutant from soybean described in this work, together with CA1 from Synechocystis 6803 (Maenpaa et al., 1993, 1995), should be included in a new, fourth category of Q,-site mutants. We propose that the mutations of this fourth category produce modifications in the redox couples involving QA and Q, so that reoxidation of QA- by forward or back reactions becomes more difficult. A summary of the different classes of Q,-site mutants is shown in Table 111.

There is evidence in the literature to support the pres- ente of Q,-reducing and non-Q,-reducing PSII centers (defined as centers that cannot reduce QB) in higher plants that can be balanced depending on growth and acclimation conditions, and that may have an important role in PSII turnover and function (Thielen and van Gorkom, 1981; Anderson and Melis, 1983; Graan and Ort, 1986; Cao and Govindjee, 1990; Guenther and Melis, 1990; Hsu and Lee, 1991). One characteristic of STR7 is the presence of an increased amount of non-Q,-reducing PSII centers, as monitored by the light-saturation activity curves in the pres- ente of different artificial electron acceptors (Fig. 3). Con- comitantly, STR7 also exhibits an increased sensitivity to light stress as monitored by the faster quenching of F , when light intensities of 500 or 1000 pE m-' s-' were used during the photoinhibitory treatment. In contrast, no dif- ferences in the D1 degradation rates were found between wild type and STR7. We conclude, therefore, that the S268P replacement induced a higher sensitivity to light stress but has no influence on the D1 degradation rate in the photoinhibitory conditions used in the present study; however, more work has to be done to further clarify this point. The increased sensitivity to light stress in STR7 might be due to a larger antenna size that increases the photon flux density into the RC and/or to a decrease of the rate of electron transport between QA and QB. In both situations the acceptor side of the PSII RC gets overreduced more rapidly in STR7, and formation of '0, sensitizer P680 triplet as a consequence of P680+pheophytin- charge recombination is more likely (Vass et al., 1992).

Based on the structural and functional homologies between PSII and purple bacteria, Ruffle et al. (1992) proposed a model in which Ser-268, located at the beginning of the E transmembrane a-helix of D1, is an active part of the Q,-binding pocket. In this model, the -0H group of Ser- 268 is oriented toward the Q,-binding site at a distance of 2 to 3 A from the -H of the quinone. Thus, Ser-268 might be a potential candidate to form a hydrogen bond with QB.

A Ser-268-to-Pro substitution would eliminate the -0H group implicated in QB binding. Ser-268 is a N-Cap residue, and work carried out with model proteins such as the barnase from E. coli has demonstrated that N-Cap residues of a-helix structures contribute to the overall stability of the protein structure (Serrano et al., 1992). We propose that the S268P substitution in STR7 may cause a conformational change in the QB site that leads to a change in the position of active groups involved in QB binding and stabilization. In addition, this substitution introduces a residue (Pro) that may increase structural rigidity in a charge / discharge area (i.e. QB/QBHZ exchange) of the protein that induces functional limitations. A Ser-268-to-Pro substitution should also




Table 111. Characteristics of D7 mutants a ' , , or indicates that the mutant has been obtained from green algae, cyanobacteria, or higher plants, respectively. Genotypes of mutants

presented in this table were first described in: 10x1, DCMUII,, and DCMUII, (Ajlani et al., 1989); Azl and AzV (Kirilovsky et al., 1989); M,, and M,, (Perewoska et al., 1993); E229D, E243K, and CA1 (Maenpaa et al., 1993); Dr2, Ar207, Br202, and Ar204 (Galloway and Mets, 1984); DCMU4 (Erickson et al., 1984); S264G (Hirschberg and Mclntosh, 1983); and S264T (Sato et al., 1988; Smeda et al., 1993).

Mutation Electron Transfer Photoinhibition Lifetime S 2 Q e -

and S , C X

First category: mutations with no effect on electron transfer 10x1 (N266T)' Normal Normal Not sensitive Azl (F21 1 S)' Normal Normal Not sensitive

(E229D)' Normal Normal Not sensitive (E243K)' Normal Normal Not sensitive

Normal Dr2 (V219V - - Ar207 (F255Y)" Normal - - Br202 (L275F)a Normal - -

DCMU4 (5264A)" Slow (+++)b Accelerated - DCMUII, (S264A)' Slow (+++) Accelerated Not sensitive DCMUII, (S264A) Slow (+++) Accelerated Not sensitive

a

Second category: mutations affecting only acceptor side

(S2 64C) Slow (+++) - Sensitive (S264T)h Slow (+++) - -

Ar204 (G256W)a Slow (+++) - -

Third category: mutations affecting acceptor and donor side M,, (A251V)' Slow (+++) Accelerated Sensitive M,, (1248T)' Slow (+++) Accelerated Not sensitive AzV (A251 V) Slow (+++) Accelerated Sensitive

CA1 (AE242-E244; 4241 H)' Slow (+)c Slowed Sensitive STR7 (S268P)h Slow (+) Slowed Sensitive

Fourth category: mutations affecting redox couples involving Q, and Q ,

'-, Not determined. +++, Very much slower than in the wild type. ' +, Slower than in the wild type.

eliminate a n -0H group that could interact with atrazine to form a hydrogen bond. This would lower the herbicide's affinity for its binding site. Such a substitution may also cause structural modifications of the QB site microenviron- ment, resulting in a steric hindrance that can diminish the affinity of the atrazine for the PSII RC.

ACKNOWLEDCMENTS

M.A. was a recipient of a predoctoral fellowship from the Go- bierno Vasco-Eusko Jaularitza. K.G. was a recipient of a fellowship from the International Center for Advanced Agronomic Mediter- ranean Studies. We are indebted to Maria V. Ramiro for technical assistance; Ramzi Beldhokja for assistance with some fluorescence experiments; Dr. C. Richaud for assistance in the DNA experiments; Dr. Jack M. Widholm for providing the soybean cell line; Dr. Autar K. Matoo for his kind gift of the anti-D1 antibody; and Dr. J.-C. Duval for his help in analyzing the fluorescence decay curves. We are also grateful to Dr. Charles F. Yocum for reading the manuscript.

Received April 17, 1996; accepted August 22, 1996. Copyright Clearance Center: 0032-0889/96/ 112/1499/ 10.

LITERATURE ClTED

Ajlani G, Kirilovsky D, Picaud M, Astier C (1989) Molecular analysis of psbA mutations responsible for various herbicide resistant phenotypes in Synechocystis 6714. Plant Mo1 Biol 13: 469479

Andersson JM, Melis A (1983) Localization of different photosystems in separate regions of chloroplast membranes. Proc Natl Acad Sci USA 80: 745-749

Aro EM, Virgin I, Andersson B (1993) Photoinhibition of photosystem 11: inactivation, protein damage and turnover. Biochim Biophys Acta 1143: 113-134

Bettiny P, McNally S, Sevignac M, Darmency M, Gasquez J, Dron M (1987) Atrazine resistance in Chenopodium album. Plant Physiol 84: 1442-1446

Blyden ER, Gray JC (1986) The molecular basis of triazine herbicide resistance in Senecio vulgaris L. Biochem SOC Trans 14: 62

Bougues-Bocquet 8, Benoun P, Taboury J (1973) Deactivation of oxygen precursors in the presence of 3-(3,4-dichlorophenyl)-l,l- dimethylurea and phenylurethane. Biochim Biophys Acta 325:

Cao J, Govindjee (1990) Chlorophyll a fluorescence transient as an indicator of active and inactive photosystem I1 in thylakoid membranes. Biochim Biophys Acta 1015: 180-188

Erickson JM, Pfister K, Rahire M, Togasaki RK, Mets L, Rochaix JD (1989) Molecular and biophysical analysis of herbicide resistant mutants of Chlamydomonas reinhardtii: structure-function relationships of the photosystem I1 D1 polypeptide. Plant Cell1:

Erickson JM, Rahire M, Bennoun P, Delepelaire P, Diner B, Rochaix JD (1984) Herbicide resistance in Chlamydomonas rein- havdtii results from a mutation in the chloroplast gene for the 32 kDa protein of PSII. Proc Natl Acad Sci USA 81: 3617-3621

Etienne A-L, Ducruet J-M, Ajlani G, Vernotte C (1990) Compar- ative studies on electron transfer in photosystem I1 of herbicide- resistant mutants from different organisms. Biochim Biophys Acta 1015: 435440

Etienne A-L, Kirilovsky D (1993) The primary structure of D1 near the QB pocket influences oxygen evolution. Photosynth Res

247-254

361-371

38: 387-394




Galloway RE, Mets L (1984) Atrazine, bromacil and diuron resistance in Chlamydomonas. A single non-mendelian genetic locus controls the structure of the thylakoid binding site. Plant Physiol 74: 469-474

Gleiter HM, Ohad N, Koike H, Hirschberg J, Renger G, Inoue Y (1992) Thermoluminescence and flash induced oxygen yield in herbicide resistant mutants of the D1 protein in Synechococcus PCC 7942. Biochim Biophys Acta 1140 135-143

Golden SS, Haselkorn R (1985) Mutation to herbicide resistance maps within the psbA gene of Anacystis nidulans R2. Science 229:

Graan T, Ort DR (1986) Detection of oxygen-evolving photosystem I1 centers inactive in plastoquinone reduction. Biochim Bio- phys Acta 852: 320-330

Guenther JE, Melis A (1990) The physiological significance of photosystem I1 heterogeneity in chloroplasts. Photosynth Res 23:

Hirschberg J, McIntosh L (1983) Molecular basis of herbicide resistance in Amaranthus kybridus. Science 222 1346-1349

Holt JS (1988) Reduced growth, competitiveness, and photosynthetic efficiency of triazine-resistant Senecio uulgaris from Cali- fornia. J Appl Eco1 25: 307-318

Hsu B-D, Lee J-Y (1991) Characterization of the photosystem I1 centers inactive in plastoquinone reduction by fiuorescence induction. Photosynth Res 27: 143-150

Johaningmeier U, Bodne U, Wildner GF (1987) A new mutation in the gene coding for the herbicide resistant mutant in Chlamydo- monas. FEBS Lett 211: 221-224

Joliot P, Joliot A (1968) A polarographic method for detection of oxygen production and reduction of Hill reagent by isolated chloroplasts. Biochim Biophys Acta 153: 625-634

Jursinic PA, McCarthy SA, Bricker TM, Stemler A (1991) Char- acteristics of two atrazine-binding sites that specifically inhibit photosystem I1 function. Biochim Biophys Acta 1059: 312-322

Kirilovsky D, Ajlani G, Picaud M, Etienne A-L (1989) Mutations responsible for high light sensitivity in an atrazine-resistant mutant from Synechocystis 6714. Plant Mo1 Biol 13: 355-363

Kok B, Forbusch B, McGloin M (1970) Cooperation of charges in photosynthetic O, evolution. I. A linear four step mechanism of the reaction in chloroplast. Photochem Photobiol 11: 457475

Lavorel J (1976) Matrix analysis of the oxygen evolving system of photosynthesis. J Theor Biol 57: 171-185

Maenpaa P, Kallio T, Mulo I', Salih G, Aro E-M, Tyystjarvi E, Jansson C (1993) Site-specific mutations in the D1 polypeptide affect the susceptibility of Synechocystis 6803 cells to photoinhibition. Plant Mo1 Biol 2 2 1-12

Maenpaa P, Miranda T, Tyystjarvi E, Tyystjarvi T, Govindjee, Ducruet JM, Etienne A-L, Kirilovsky D (1995) A mutation in the D-de loop of D, modifies the stability of S,Q,- and S,Q,- states in photosystem 11. Plant Physiol 107: 187-197

Maniatis T, Fritsch EF, Sambrook J (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY

Matoo AK, Marder JB, Edelman M (1989) Dynamics of the photosystem I1 reaction center. Cell 56: 241-246

Mazur BJ, Falco SC (1989) The development of herbicide resistance crops. Annu Rev Plant Physiol Plant Mo1 Biol40: 441470

Michel H, Deisenhofer J (1988) Relevance of the photosynthetic reaction center from purple bacteria to the structure of photosystem 11. Biochemistry 27: 1-7

Miranda T, Ducruet JM (1995) Effects of dark- and light-induced proton gradients in thylakoids on the Q and B thermoluminescence bands. Photosynth Res 43: 251-262

Ohad N, Hirschberg J (1992) Mutations in the D1 subunit of photosystem I1 distinguish between quinone and herbicide binding sites. Plant Cell 4: 273-282

Pay A, Smith MA, Nagy F, Marton L (1988) Sequence of the psbA gene from wild-type and triazine resistant Nicotiana plumbagini- folia. Nucleic Acids Res 16: 8176-8178

1104-1107

105-109

Perewoska I, Etienne A-L, Miranda T, Kirilovsky D (1994) SI destabilization and higher sensivity to light in metribuzin- resistant mutants. Plant Physiol 104: 235-245

Rogers SMD, Ogren WL, Widholm JM (1987) Photosynthetic characteristics of a photoautotrophic cell suspension culture of soybean. Plant Physiol 84: 1451-1456

Ruffle SV, Donelly D, Blundell TL, Nugent JHA (1992) A three- dimensional model of the photosystem I1 reaction centre of Pisum satiuum. Photosynth Res 34: 287-300

Sato F, Shigematsu Y, Yamada Y (1988) Selection of an atrazine- resistant tobacco cell line having a mutant psbA gene. Mo1 Gen Genet 24: 358-360

Satoh K (1993) Isolation and properties of the photosystem I1 reaction center. In J Deisenhofer, JR Norris, eds, The Photosyn- thetic Reaction Center, Vol I. Academic Press, San Diego, CA, pp

Serrano L, Sancho J, Hirschberg M, Ferscht AR (1992) Alpha helix stability in proteins. 1. Empirical correlation concerning substitution of side chains at the N- and C-CAPS and the replacement of alanine by glycine or serine at solvent-exposed surfaces. J Mo1 Biol 227: 554-559

Shinkarev V, Wraight C (1993) Oxygen evolution in photosynthesis: from unicycle to bicycle. Proc Natl Acad Sci USA 90: 1834- 1838

Sinning I (1992) Herbicide binding in the bacterial photosynthetic reaction center. Trends Biochem Sci 17: 150-154

Sinning I, Michel H, Mathis P, Rutherford AW (1989) Character- ization of four herbicide-resistant mutants of Rhodopseudomonas uiridis by genetic analysis, electron paramagnetic resonance, and optical spectroscopy. Biochemistry 28: 5544-5553

Smeda RJ, Hasegawa PM, Golsbrough PB, Singh NK, Weller SC (1993) A serine to threonine substitution in the triazine herbicide-binding protein in potato cell results in atrazine resistance without impairing productivity. Plant Physiol 103:

Southern E (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mo1 Biol 98:

Spielmann A, Stutz E (1983) Complete nucleotide sequence of the chloroplast psbA gene from soybean. Nucleic Acids Res 11:

Sundby C, Chow WS, Anderson JM (1993) Effects on photosystem I1 function, photoinhibition, and plant performance of the spontaneous mutation of serine 264 in the photosystem I1 reaction center D1 protein in triazine-resistant Brassica napus L. Plant Physiol 103: 105-113

Taoka S, Crofts AR (1990) Two-electron gate in triazine resistant and susceptible Amavanthus hybridus. Zn M Baltscheffsky, ed, Current Research in Photosynthesis, Vol I. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 547-550

Thielen APGM, van Gorkom HJ (1981) Quantum efficiency and antenna size of photosystem I1 and I in tobacco chloroplasts. Biochim Biophys Acta 635: 111-120

Tischer W, Strotmann M (1977) DCMU and atrazine binding in the photosynthetic apparatus. Biochim Biophys Acta 460:

Trebst A, Depka B (1990) Degradation of the D-1 protein subunit of photosystem I1 in isolated thylakoids by UV-light. Z Naturforsch 45c: 765-771

Vass I, Styring S, Hundall T, Koivaniemi A, Aro E-M, Andersson B (1992) Reversible and irreversible intermediates during photoinhibition of photosystem 11: stable reduced QA species promote chlorophyll triplet formation. Proc Natl Acad Sci USA 89:

Vermaas WFJ, Renger G, Arntzen CJ (1989) Herbicide/quinone interactions in photosystem 11. Z Naturforsch 139c: 368-373

Vermaas WFJ, Styring S, Schoder WP, Andersson B (1993) Pho- tosynthetic water oxidation: the protein framework. Photosynth Res 38: 249-263

289-318

911-917

503-517

7157-7167

113-125

1408-1412



Documents

of D1 Serine-268 in Soybean Photosynthetic Cell Cultures ... · 1,1 -dimethylurea (50- and 3-fold, respectively, compared with the wild type). Sequencing of the psbA gene (coding