Department of PathologyHaartman Institute and

HUSLAB

Hematology Research UnitDepartment of Medicine,Division of Hematology

Department ofClinicalGenetics

University of Helsinki andHelsinki University Central Hospital

University of Helsinki andHelsinki University Central Hospital

University ofOulu

Helsinki Helsinki Oulu

Novel prognostic factors

in chronic myeloid leukemia

Tuija Lundán

ACADEMIC DISSERTATION

To be presented, with the permission of the Faculty of Medicine, University ofHelsinki, for public examination in the lecture hall of the Department of Oncology,

Helsinki University Central Hospital, Haartmaninkatu 4, on June 6th, 2008, at 12 noon.

Helsinki 2008

2

Supervised by Docent Sakari Knuutila, Ph.D., Professor h.c.Department of PathologyHaartman Institute and HUSLABUniversity of Helsinki andHelsinki University Central HospitalHelsinki, Finland

Professor Kimmo Porkka, M.D., Ph.D.Hematology Research UnitDepartment of Medicine,Division of HematologyUniversity of Helsinki andHelsinki University Central HospitalHelsinki, Finland

Reviewed by Docent Tarja-Terttu Pelliniemi, M.D., Ph.D.Department of Clinical ChemistryUniversity of TurkuTurku, Finland

Docent Eeva-Riitta Savolainen, M.D., Ph.D.Department of Clinical ChemistryUniversity of OuluOulu, Finland

Official opponent Professor Bengt Simonsson, M.D., Ph.D.Department of Hematology,University Hospital,Uppsala, Sweden

ISBN 978-952-92-3924-5 (pbk.)ISBN 978-952-10-4721-3 (PDF)

Helsinki University Printing HouseHelsinki 2008

3

CONTENTSList of original publications .............................................................................................5

Abbreviations ...................................................................................................................6Abstract ............................................................................................................................7

Introduction .....................................................................................................................9Review of the literature ..................................................................................................10

1. History of CML..................................................................................................................10

2. Clinical characteristics of CML .........................................................................................122.1. Epidemiology ........................................................................................................................... 132.2. Clinical course of CML............................................................................................................. 132.3. Risk scores ............................................................................................................................... 142.4. Immunological background of CML.......................................................................................... 15

3. The cytogenetics of CML ...................................................................................................163.1. Standard Ph translocation.......................................................................................................... 163.2. Variant Ph translocations .......................................................................................................... 163.3. Ph negative, BCR-ABL fusion positive CML ............................................................................. 173.4. Deletions of the derivative chromosome 9 ................................................................................. 18

3.4.1. When are der(9) deletions formed? .................................................................................... 203.4.2. The clinical impact of der(9) deletions ............................................................................... 20

3.5. Clonal evolution ....................................................................................................................... 203.6. Clonal chromosomal changes in Ph negative cells ..................................................................... 213.7. Ph chromosome in other hematological malignancies ................................................................ 22

4. Molecular genetics and pathology of CML ........................................................................224.1. Oncogenic tyrosine kinases in hematological malignancies........................................................ 224.2. Abelson murine leukemia viral oncogene homolog 1 (ABL) gene............................................... 224.3. Breakpoint cluster region (BCR) gene........................................................................................ 244.4. The BCR-ABL fusion gene ........................................................................................................ 244.5. Cellular signaling pathways affected by BCR-ABL ................................................................... 26

5. The role of genetic analyses in diagnostics and follow-up of CML....................................275.1. Analyses performed at the diagnostic phase............................................................................... 275.2. Follow-up studies and minimal residual disease analyses ........................................................... 27

5.2.1. Cytogenetic follow-up analyses ......................................................................................... 275.2.2. Molecular genetic follow-up studies................................................................................... 285.2.3. International standardization of RQ-PCR assays in minimal residual disease analytics........ 29

6. Treatment of CML .............................................................................................................306.1. Imatinib: the current gold standard of CML treatment................................................................ 30

6.1.1. The mechanism of imatinib kinase inhibition ..................................................................... 316.1.2. The IRIS (International Randomized Study of Interferon and STI571) trial......................... 32

6.2. Allogeneic hematopoietic stem cell transplantation (alloHSCT)................................................. 33

7. Imatinib resistance.............................................................................................................337.1. BCR-ABL gene amplification .................................................................................................... 347.2. Mutations in the kinase domain of BCR-ABL............................................................................ 357.3. BCR-ABL independent resistance mechanisms ......................................................................... 37

8. Second generation tyrosine kinase inhibitors.....................................................................398.1. Dasatinib .................................................................................................................................. 398.2. Nilotinib ................................................................................................................................... 398.3. Other second generation tyrosine kinase inhibitors .................................................................... 408.4. Resistance against second generation tyrosine kinase inhibitors ................................................. 40

4

9. Recommendations for the management of CML: the current review of the expert panel ofthe European LeukemiaNet ...................................................................................................41

Aims of the study............................................................................................................ 43

Materials and methods................................................................................................... 441. Patients ..............................................................................................................................44

2. Methods .............................................................................................................................452.1. Cell culture (I-V) ......................................................................................................................452.2. Conventional cytogenetic analysis (I-V) ....................................................................................452.3. Fluorescence in situ hybridization (FISH) (I-IV)........................................................................ 452.4. Sample preparation, RNA extraction and the reverse transcription reaction (I, IV-V)..................472.5. Real time quantitative polymerase chain reaction (I, IV-V) ........................................................472.6. Bone marrow morphological analysis and immunophenotyping (IV)..........................................482.7. BCR-ABL kinase domain mutation analysis (V)........................................................................482.8. Statistical calculations...............................................................................................................49

3. Ethical permissions............................................................................................................50

Results ........................................................................................................................... 511. Assessment of minimal residual disease in CML (I, II)......................................................51

1.1. Comparison of molecular cytogenetic and molecular genetic techniques in detecting minimalresidual disease (I)...........................................................................................................................511.2. Model for converting laboratory specific data to the International Scale (I) ................................531.3. The effect of sample source on BCR-ABL transcript levels.........................................................531.4. Minimal residual disease after allogeneic hematopoietic stem cell transplantation (II) ................ 54

2. The frequency and influence of der(9) deletions on the outcome of allogeneichematopoietic stem cell transplantation (III) .........................................................................55

3. Factors associated with different responses during imatinib treatment (IV, V)..................573.1. Favorable: bone marrow lymphocytosis predicts optimal response to imatinib (IV)....................573.2. Unfavorable: BCR-ABL kinase domain mutations in patients resistant to imatinib (V)...............613.3. Other sequence variations detected (V)...................................................................................... 62

Discussion...................................................................................................................... 631. Assessing minimal residual disease....................................................................................63

1.1. Technical aspects of determining the level of residual disease in CML (I, II)..............................631.2. Detection of minimal residual disease from a clinical point of view (I, II) .................................. 65

2. The clinical and biological significance of der(9) deletions in CML (III)..........................66

3. Prognostic factors related to imatinib treatment ................................................................683.1. Bone marrow lymphocytosis as a predictive marker for optimal response (IV)...........................683.2. BCR-ABL kinase domain mutations (V) ...................................................................................69

4. Future prospects ................................................................................................................70

Summary and conclusions............................................................................................. 72

Acknowledgements ........................................................................................................ 74References ..................................................................................................................... 76

5

List of original publications

This thesis is based on the following articles, which will be referred to in the text by theirRoman numerals.

I Lundán T, Juvonen V, Martin C. Mueller MC, Mustjoki S, Lakkala T, KairistoV, Hochhaus A, Knuutila S, Porkka K. 2008. Comparison of bone marrow highmitotic index metaphase fluorescence in situ hybridization to peripheral bloodand bone marrow real time quantitative polymerase chain reaction on theInternational Scale for detecting residual disease in chronic myeloid leukemia.Haematologica 93:178-185.

II Lundán T, Volin L, Elonen E, Autio K, Knuutila S. 2004. Clinical and practicalvalue of metaphase fluorescent in situ hybridization in follow-up afterallogeneic stem cell transplantation in chronic myeloid leukemia.Haematologica 89:247-249.

III Lundán T, Volin L, Ruutu T, Knuutila S, Porkka K. 2005. Allogeneic stem celltransplantation reverses the poor prognosis of CML patients with deletions inderivative chromosome 9. Leukemia 19:138-140.

IV Mustjoki S, Lundán T, Knuutila S, Porkka K. 2007. Appearance of bonemarrow lymphocytosis predicts an optimal response to imatinib therapy inpatients with chronic myeloid leukemia. Leukemia 21:2363-2368.

V Gruber FX*, Lundán T*, Silye A, Mikkola I, Rekvig OP, Knuutila S, RemesK, Gedde-Dahl T, Hjorth-Hansen H*, Porkka K*. BCR-ABL isoformsassociated with intrinsic or acquired resistance to imatinib – moreheterogeneous than just ABL kinase domain point mutations? Submitted

* These authors contributed equally to the study.

6

Abbreviations

+ gain of a chromosome (arm)- loss of a chromosome (arm)ABL Abelson murine leukemia viral oncogene homolog 1 geneALL Acute lymphoblastic leukemiaalloHSCT Allogeneic hematopoietic stem cell transplantationATP Adenosine triphosphateBCR Breakpoint cluster region genebcr Breakpoint cluster regionbp Base pairCCyR Complete cytogenetic responseCD Cluster of differentiationCML Chronic myeloid leukemiaDAPI 4’, 6-diamidino-2-phenylindole-dihydrochrorideder Derivative chromosomeDLI Donor lymphocyte infusionEAC Europe Against CancerFISH Fluorescence in situ hybridizationFITC Fluorescein isothiocyanateGUS Beta glucuronidase genehOCT-1 Human organic cation transporter 1 genei IsochromosomeIS International Scalekb Kilobase (pair)kD KilodaltonMb Megabase (pair)M-bcr Major breakpoint cluster regionm-bcr Minor breakpoint cluster region

-bcr Micro breakpoint cluster regionMMR Major molecular responseMRD Minimal residual diseasep Short arm of the chromosomePCR Polymerase chain reactionPGP Permeability glycoproteinPh Philadelphia (chromosome)q Long arm of the chromosomeRQ-PCR Real time quantitative polymerase chain reactiont Translocation

Gene symbols not listed here can be found at http://www.ncbi.nlm.nih.gov/The amino acid abbreviations can be found e.g. athttp://www.ncbi.nlm.nih.gov/projects/collab/FT/index.html

7

Abstract

Chronic myeloid leukemia (CML) is a malignant clonal blood disease that originates froma pluripotent hematopoietic stem cell. The cytogenetic hallmark of CML, the Philadelphiachromosome (Ph), is formed as a result of reciprocal translocation between chromosomes9 and 22, which leads to a formation of a chimeric BCR-ABL fusion gene. The BCR-ABLprotein is a constitutively active tyrosine kinase that changes the adhesion properties ofcells, constitutively activates mitogenic signaling, enhances cell proliferation and reducesapoptosis. This results in leukemic growth and the clinical disease, CML. With the adventof targeted therapies against the BCR-ABL fusion protein, the treatment of CML haschanged considerably during the recent decade. In this thesis, the clinical significance ofdifferent diagnostic methods and new prognostic factors in CML have been assessed.

First, the association between two different methods for measuring CML diseaseburden (the RQ-PCR and the high mitotic index metaphase FISH) was assessed in bonemarrow and peripheral blood samples. The correlation between positive RQ-PCR andmetaphase FISH samples was high. However, RQ-PCR was more sensitive and yieldedmeasurable transcripts in 40% of the samples that were negative by metaphase FISH. Thestudy established a laboratory-specific conversion factor for setting up the InternationalScale when standardizing RQ-PCR measurements.

Secondly, the amount of minimal residual disease (MRD) after allogeneichematopoietic stem cell transplantation (alloHSCT) was determined. For this, metaphaseFISH was done for the bone marrow samples of 102 CML patients. Most (68%), had noresidual cells during the entire follow-up time. Some (12 %) patients had minor (<1%)MRD which decreased even further with time, whereas 19% had a progressive rise inMRD that exceeded 1% or had more than 1% residual cells when first detected. Residualcells did not become eradicated spontaneously if the frequency of Ph+ cells exceeded 1%during follow-up. The practical value of this 1% MRD level after alloHSCT and theusefulness of metaphase FISH analytics were examined.

Next, the impact of deletions in the derivative chromosome 9, a putative poorprognosis marker, was examined. Deletions were observed in 15% of the CML patientswho later received alloHSCT. After alloHSCT, there was no difference in the total relapserate in patients with or without deletions. Nor did the estimates of overall survival,transplant-related mortality, leukemia-free survival and relapse-free time show anydifference between these groups. When conventional treatment regimens are used, theder(9) status could be an important criterion, in conjunction with other prognostic factors,when allogeneic transplantation is considered. The significance of der(9) deletions forpatients treated with tyrosine kinase inhibitors is not clear and requires furtherinvestigation.

In addition to the der(9) status of the patient, the significance of bone marrowlymphocytosis as a prognostic factor in CML was assessed. Bone marrow lymphocytosisduring imatinib therapy was a positive predictive factor and heralded optimal response.When combined with major cytogenetic response at three months of treatment, bone

8

marrow lymphocytosis predicted a prognostically important major molecular response at18 months of imatinib treatment. Although the validation of these findings is warranted,the determination of the bone marrow lymphocyte count could be included in theevaluation of early response to imatinib treatment already now.

Finally, BCR-ABL kinase domain mutations were studied in CML patients resistantagainst imatinib treatment. Point mutations detected in the kinase domain were the sameas previously reported, but other sequence variants, e.g. deletions or exon splicing, werealso found. The clinical significance of the other variations remains to be determined.

9

Introduction

Leukemia is a malignant blood cell disease characterized by uncontrolled cellproliferation, by reduced apoptosis and, in certain types of leukemia, also by insufficientdifferentiation that leads to displacement of normal blood cells and accumulation ofmalignant cells into the bone marrow and in the peripheral blood. Leukemias are dividedinto acute and chronic and into myeloid and lymphatic forms, depending on the stage ofmaturation and the hematopoietic cell lineage that is pathological.

Cancer is a genetic disease in the sense that the tumor cells become malignant afteraccumulation of various genetic changes which give the cell a growth advantage overnormal cells; this leads to clonal proliferation. These acquired genetic aberrations occur atthe chromosomal level and they result in numerical and structural changes of the normalchromosome complement, or, on the molecular level, cause mutations in genes thatcontrol cell proliferation and differentiation.

The chromosomal changes of leukemias are nonrandom, i.e., specific abnormalities areoften observed in certain types of leukemias and have therefore diagnostic significance.Certain abnormalities also have prognostic significance. Some aberrations are also aprerequisite for targeted therapies. A good example of this is the translocationt(9;22)(q34;q11.2) which is necessary for successful imatinib treatment. The clonalaberration detected during the diagnostic workup may later be used as a leukemia-specificmarker when the response to the given treatment is evaluated.

The story of chronic myeloid leukemia (CML) is a classical example of howdiscoveries in the field of cancer genetics may eventually provide targeted tools for thetreatment of malignant diseases. The story begins with the initial observation of aconsistent chromosomal abnormality in CML patients. This was followed by theidentification of a chromosomal translocation that was the cause for this aberration. Thislead to molecular cloning of the genes involved in the translocation, characterization of aleukemogenic fusion gene and protein, and, finally, to a small molecule inhibitor targetedto inhibit that protein. This story has continued to other cancer types, and hopefully manyothers will follow. In CML the process from a recurrent chromosomal abnormality to atargeted drug took nearly 40 years, but the current use of high-throughput technologieswill hopefully ensure more rapid drug development.

In this study, the significance of novel prognostic factors in the treatment of CML wasassessed at a time when tyrosine kinase inhibitors became widely available for clinicaluse. The study focused on the technical and clinical applications of methods used to detectminimal residual disease and on determining the impact of other aberrations on theoutcome of patients after allogeneic hematopoietic stem cell transplantation. The factorsthat influence the variable response to imatinib treatment were also evaluated.

10

Review of the literature

1. History of CML

The first patients with CML were reported separately by John Bennett and soon after himby Rudolf Virchow in 1845. Bennett’s mentor David Craigie also had observed a patientwith unusual blood consistency and a splenic tumor already in 1841 but the case was notreported until a second case with similar features was presented. Bennett and Virchowboth described a patient who had enlarged spleen and liver and whose blood veins werefull of “material resembling thick pus”. Bennett’s conclusion for the cause of death of hispatient was therefore “suppuration of the blood”. Since techniques for staining blood werenot available in those days, microscopic observations were rather crude, but bothresearches described white or “colorless” cells that had nuclei of either granular or variousshape. Virchow used the term “Weißes Blut” to describe his observation and actuallyproposed the word “Leukämie” for delineating the condition, whereas “leucocythemia”was Bennett’s term for the disease. The attempts to classify different types of leukemiaincluded Virchow’s division of splenic and lymphatic types, referring to myeloid andlymphatic leukemia, respectively. The classification of myeloid and lymphatic leukemiawas made by Paul Ehrlich in 1887, who also supported the idea of common stem cellorigin of the different blood cell lineages (reviewed by Geary, 2000 and Tefferi 2008) 1-2.

The concept of myeloproliferative disorders - consisting of diseases like polycythemiavera, essential thrombocytosis, primary myelofibrosis and chronic myeloid leukemia - wasintroduced by William Dameshek in 1951. He defined these diseases as having similarfeatures and “proliferative activity of the bone marrow cells, perhaps due to a hithertoundiscovered stimulus” 3.

The cytogenetic hallmark of CML, the Philadelphia chromosome (Ph), is the firstconsistent chromosomal abnormality that has been associated to a certain cancer type. ThePh chromosome was first reported by Peter Nowell and David Hungerford in theUniversity of Pennsylvania in Philadelphia, United States after studying peripheral bloodsamples of patients with leukemia, including two CML patients (Figure 1). The minute Phchromosome was first interpreted as being a deleted or otherwise aberrant Y chromosomesince the first studied CML patients were both men 4. Later the size of the patientpopulation studied grew larger and the Ph chromosome was considered as deriving fromthe smallest autosome (other than sex chromosome), namely chromosome 21 5-6.

11

Figure 1 The cytogenetic hallmark of CML. Original findings from the article of Nowell andHungerford describing a minute Ph chromosome in a metaphase cell of a CMLpatient. The Ph chromosome is indicated with an arrow. Reprinted by permissionfrom Oxford University Press, J. Natl. Cancer Inst. ref. 4, copyright 1960.

The variability in describing the chromosomal origin of the Ph chromosome was mainlydue to lack of chromosome banding methods, first of which were developed in the late1960’s 7-8. Soon after this invention the Ph was identified as a chromosome 22 with adeletion in the long arm 9. Since banding methods made possible to distinguish eachchromosome pair from each other and determining the structure of normal chromosomesby their unique banding patterns, the origin of the Ph chromosome was finally discoveredas a reciprocal (two-way) translocation between the long arms of chromosomes 9 and 22.This translocation creates an elongated derivative chromosome 9 and a shortenedderivative chromosome 22, the latter of which is the Ph chromosome 10. High resolutioncytogenetic analyses refined the exact breakpoints to subbands 9q34.1 and 22q11.2, so thetranslocation is marked as t(9;22)(q34.1;q11.2) 11.

The molecular pathology of t(9;22)(q34;q11.2) rearrangement was identified in the1980’s. The c-ABL (ABL, ABL1), the human cellular homologue of the transformingsequence of Abelson murine leukemia virus (A-MuLV) previously mapped tochromosomal region 9q34, was found to be translocated to the Ph chromosome usingsomatic cell hybrid assays 12-13. This finding confirmed the reciprocal nature of the 9;22translocation and suggested the role of c-ABL in the pathogenesis of CML 13-14. Thetranslocation breakpoints in chromosome 22 were observed to be clustered within a regionof 5.8 kb that was termed the “breakpoint cluster region” (bcr), after which the genelocalized to this region was denominated 15-16. Characterization of an mRNA moleculespecific to CML later revealed the fusion of two genes: the 5´part of BCR and 3´ part ofABL. A chimeric protein product was therefore suspected to be involved in the malignantprocess 17-18. The fusion transcript was indeed translated to a novel 210 kD

12

phosphoprotein (P210) whose ABL part had an altered tyrosine kinase activity whencompared to normal c-ABL protein product 19-20.

The transforming potency of BCR-ABL fusion gene was later established by using amurine model. Bone marrow cells infected with retrovirus that encoded the BCR-ABLfusion gene were transplanted into lethally irradiated mice. The transplanted cells inducedhematologic malignancies in 40-50% of the recipients, of which the most prominent onewas a myeloproliferative disorder that resembled CML in humans 21-23. The stimulus thatlead to the uncontrolled proliferation of the bone marrow cells already thought byDameshek was thereby a fusion gene encoding a chimeric protein with increased tyrosinekinase activity.

2. Clinical characteristics of CML

Today it is known that the purulent-like material or white blood observed by Bennett andVirchow was actually composed of excess of white blood cells, leukocytes, which istypical of leukemias. Chronic myeloid leukemia (CML) is a malignant blood disease thatoriginates clonally from an aberrant pluripotent hematopoietic (blood forming) stem cellaffecting myeloid, monocytic, erythroid, megakaryocytic, B-cell and occasionally T-celllineages, even though the involvement of the last one is somewhat controversial 24-27. Theperipheral blood count in CML is characterized by a marked overrepresentation ofneutrophils and their precursors, but also the number of eosinophils and basophils isincreased. The platelet count is normal or increased and mild anemia is relatively common28.

The bone marrow is hypercellular due to the excess of granulocytic series. The blastcount is usually normal; <5% of the marrow cells. Megakaryocytes are smaller thannormal and have an aberrant nuclear morphology (minimegakaryocytes) 28. Thephotographs of peripheral blood and bone marrow samples of a patient with chronic phaseCML are presented in Figure 2.

Figure 2 Figures of peripheral blood (left) and bone marrow (right) smears of a CML patientin chronic phase, showing leukocytosis in the peripheral blood, and hypercellularityin the bone marrow due mainly to neutrophils in different stages of maturation. InCML bone marrow, typical megakaryocytes are smaller than normal and havehypolobulated nuclei. Courtesy of Dr. Satu Mustjoki.

13

2.1. Epidemiology

CML is one of the most common of the chronic myeloproliferative disorders, but still arare disease worldwide. It accounts for 15-20% of all leukemia cases. The annualincidence of the disease is approximately 1 case per 75 000 - 100 000 of population. Thereis a slight male predominance, with a male-to-female ratio 1.3 to 1. CML patients are mostoften diagnosed between the fourth and sixth decades of life 28-30, but the median age ofthe newly diagnosed CML patients is decreasing due to earlier time point of diagnosis. Asprognosis of CML is improving with current therapies, prevalence of the disease issteadily increasing. CML can also be diagnosed in children, but childhood CML isextremely rare, as it affects approximately one case per one million children annually 31.Factors predisposing to CML are not known. Exposure to ionizing radiation has beenimplicated in some cases 28, but majority of cases arise sporadically without any knowcausative factor.

2.2. Clinical course of CML

The disease course of CML can be divided in two or three phases: relatively indolentchronic phase, which is followed by more aggressive transformed stages, acceleratedphase and blast crisis. The blast crisis may not always be preceded by the acceleratedphase. The great majority of the patients are diagnosed in chronic phase. Currently mostpatients are asymptomatic at the time of diagnosis as they are diagnosed incidentallyduring routine blood tests showing abnormal blood counts. Common findings at the timeof diagnosis are fatigue, weight loss, anemia, night sweats and enlarged spleen (i.e.splenomegaly). If untreated, the chronic phase is inevitably followed by transformation toadvanced phases.Accelerated phase of CML is characterized by increase in total white blood cell count andspleen size and the disease is more refractory to the therapy (Table 1). The blast crisis isthe final phase of CML that resembles acute leukemia, which is characterized byaccumulation of immature blast cells in the bone marrow and blood. The blast crisis iseither myeloid or lymphatic of origin. The performance status of the patients intransformed stages of the disease is worse due to severe anemia, thrombocytopenia andspleen enlargement. The duration of the chronic phase is very variable lasting from a fewmonths to several years, which is due to differences in general heterogeneity in the diseasecourse or in the time point of diagnosing the disease 28, 32.

14

Table 1. Definitions for accelerated and blast phases of CML according to WHO criteria28.

Accelerated phase(one or more features present)

Blast phase(one or more features present)

Blasts 10-19% of peripheral blood whiteblood cells and/or of nucleated bonemarrow cells

Peripheral blood basophils 20% Persistent thrombocytopenia (<100x109/l)

that is unrelated to therapy or Persistent thrombocytosis (>1000x109/l)

that is unresponsive to therapy Increasing spleen size and white blood

cell count that are unresponsive to therapy Cytogenetic clonal evolution

Blasts 20% of peripheral bloodwhite blood cells or of nucleatedbone marrow cells

Extramedullary blast proliferation

Large foci or clusters of blasts inthe bone marrow biopsy

2.3. Risk scores

Because of variable disease course and duration of CP in CML patients a number ofscoring systems have been developed to evaluate the patient’s relative risk of diseaseprogression and death in addition to defining the phase of the disease. The Sokal systemclassifies the patients treated with conventional chemotherapy into three risk groupsaccording to significantly different survival patterns: low, intermediate and high riskgroups. The Sokal score is based on an algorithm that consists of following parametersmeasured at the time of diagnosis: patient age, spleen size, platelet count and percentageof circulating blasts. Sokal score may also be calculated using internet sites such as theEuropean LeukemiaNet CML pages 33 or ROC (Regionalt Onkologiskt Centrum/ RegionalOncology Center) in Uppsala, Sweden 34. In Sokal score hazard ratios 0.8 and 1.2 areassessed as boundary values to discriminate the low, intermediate and high risk groupsfrom each other 35.

The Hasford (Euro) score was developed to evaluate the survival of CML patientstreated with interferon-alpha –based regimens. Besides the parameters mentioned in Sokalsystem, calculation of Hasford score also takes into account basophil and eosinophilcounts and also discriminates the patients into three groups in respect to survival times.Hasford score may also be calculated at the European LeukemiaNet internet pages 33.Hasford score values below 780 indicate low, 780-1480 intermediate and values over 1480high risk, respectively 36.

The risk of patients directed to allogeneic hematopoietic stem cell transplantation(alloHSCT) is evaluated according to the European Group for Blood and MarrowTransplantation (EBMT) score which takes into consideration known pretransplant riskfactors: histocompatibility, disease stage at the time of transplantation, time fromdiagnosis to transplantation and age and sex of donor and recipient. The risk scores vary

15

from zero to 7 so that the higher the score the higher is the risk of transplant relatedmortality 37.

For patients who have failed interferon alpha treatment and who are subsequentlytreated with the current first-line treatment, imatinib, a new risk score has been developed.This scoring system, called the Hammersmith score after the hospital where it wasgenerated, is based on features determined after three months of imatinib treatment. Atthat time point low neutrophil count and 65% or more of Ph chromosome positive cellsdefined patients into three risk groups: low, intermediate and high risk of diseaseprogression at two years of treatment 38. However, this scoring system needs to bevalidated on a larger number of patients.

2.4. Immunological background of CML

Most if not all cancers become metastatic and lethal by virtue of escape from immunesystem mediated control of abnormal malignant cells. The detailed mechanisms of cancerimmune surveillance are unresolved, but include both humoral and cellular defenses 39.Different tumors vary considerably in their sensitivity to immune-mediated therapy, suchas vaccines and cytokine therapies.

CML is known to be a highly immunogenic malignancy based on both clinical andexperimental evidence. Donor immune system cures CML after alloHSCT. Upon relapseafter transplantation, donor lymphocyte infusion is a particularly effective immunotherapyin CML as compared to other leukemias as most patients re-enter remission 40.

A few patients also appear to be operatively “cured” following interferon alphatherapy, although many of these patients still have detectable minimal residual disease(MRD) 41. It is intriguing that the small numbers of patients who have remained inremission following imatinib discontinuation, were previously exposed to interferon 42. Itis thus likely that remissions induced by interferon alpha and imatinib areimmunologically distinct 43.

The recent immunotherapy approaches by BCR-ABL peptide vaccines also suggest anestablishment of immune surveillance by tumor specific cytotoxic T cells within thepatient 44. These patients have shown decreasing levels of MRD following theimmunotherapy vaccinations which goes beyond what might have been expected fromcontinuation of imatinib therapy alone. As yet these patients have not discontinuedimatinib treatment to determine whether remission will be maintained. Recent reports haveindicated that imatinib itself also has significant immunomodulatory effects, which mightbe important in the long-term control of CML 45.

BCR-ABL transcripts have also been detected in healthy individuals using sensitivePCR –based techniques 46-47, which further underlines the importance of loss of immunecontrol in individuals developing clinical disease.

16

3. The cytogenetics of CML

3.1. Standard Ph translocation

Chronic myeloid leukemia is cytogenetically characterized by presence of the Philadelphia(Ph) chromosome. Approximately 90-95% of CML patients are Ph chromosome positivein cytogenetic analysis of the bone marrow samples 18. The Ph chromosome is formed in areciprocal translocation between the long arms of chromosomes 9 and 22. After thetranslocation event the distal part of the Ph chromosome therefore contains material fromchromosome 9 and the distal part of the derivative chromosome 9 contains material fromchromosome 22, respectively. An example of a standard 9;22 translocation positive cell ispresented in Figure 3.

Figure 3 A G-banded karyogram of a CML patient with standard translocationt(9;22)(q34;q11.2). The Ph chromosome is indicated with an arrow.

3.2. Variant Ph translocations

In 5-10% of the CML cases the Philadelphia chromosome is formed as a result of a varianttranslocation, in which other chromosomes in addition to 9 and 22 are involved. Varianttranslocations can be divided into two groups in respective to the number of chromosomesparticipating in the aberration. In simple variant translocations most often chromosome 9(only rarely 22) has been replaced by some other chromosome so that cytogenetically theabnormality seems to involve only two chromosomes, one of which is chromosome 22(rarely chromosome 9) like t(V;22) or t(V;9) where V represents “the variantchromosome”. Complex variant translocations are aberrations that concern one or severalother chromosomes besides 9 and 22, like t(V;9;22) 48. Figure 4 depicts a case withcomplex variant translocation involving altogether four chromosomes. Still, whatever the

17

type of Ph translocation is detected, the key point is the same: the involvement ofchromosomal areas 9q34 and 22q11.2 that leads to the BCR-ABL gene fusion in thebreakpoint region. In fact, chromosomal region 9q34 is a participant also in simple varianttranslocations, even though this may not be cytogenetically discernible. All varianttranslocations are therefore truly complex ones 48.

Figure 4 A G-banded karyogram of a complex variant translocation involving fourchromosomes. The karyotype is assigned as 46,XX,t(2;9;22;12)(q13;q34;q11.2;q13).

The prognostic significance of the Ph translocation type has been a matter of debate formany years. Results supporting both equal prognosis and worse prognosis of CMLpatients with variant translocation compared to standard translocation have beenpublished. Current data is however largely based on relatively small series of patients orcase reports. In addition, the treatment modalities have been changed substantially overthe years. The most common interpretation seems to be that the translocation type itselfdoes not have a prognostic influence 49. However, the higher frequency of submicroscopicdeletions of derivative chromosome 9 (reviewed in chapter 3.4.) may have accounted forthe worse outcome in CML patients with variant translocations observed in some studies50-51. The advent of imatinib as the first-line treatment has changed the rates of responseand overall survival in CML when compared to other treatments 52-53. Therefore data onthe impact of Ph translocation type on the prognosis during imatinib treatment is ofinterest in current management of CML. One study focused on variant Ph translocationpatients and reported similar prognosis to standard Ph translocation patients when treatedwith imatinib therapy 54.

3.3. Ph negative, BCR-ABL fusion positive CML

Small proportion of patients has a clinical picture consistent with CML, but no Phchromosome can be cytogenetically observed. In these cases the chromosomal aberrationsare submicroscopic and in conventional cytogenetic studies the cases seem to be Phchromosome negative. These may also be called as cryptic translocations or masked Ph

18

chromosomes 48. However, even though cytogenetically no abnormality may be observed,at the molecular level the pathogenic BCR-ABL fusion gene characteristic for CML isdetectable. This condition is called Ph negative, BCR-ABL positive CML. The Phnegative, BCR-ABL positive cases do not otherwise differ from standard Ph positivepatients except that the chromosomal mechanism of the fusion gene formation is insteadof translocation most often insertion of 3´ABL or 5´BCR sequences to chromosome 22 or9, respectively 55-58. The latter one is exemplified in figure 5.

Figure 5 A mitotic cell of a Ph chromosome negative, BCR-ABL gene fusion positive CMLpatient studied by fluorescence in situ hybridization (FISH). The yellowish fusionsignal in the proximal part of chromosome 9 long arm represents BCR-ABL genefusion. Single red and green signals indicate normal ABL and BCR genes,respectively.

The “real” Ph negative cases that are also lacking BCR-ABL molecular rearrangement areregarded as separate entities: as chronic neutrophilic leukemia or atypical CML. Thesedisorders are classified as either other chronic myeloproliferative or myelodysplastic/myeloproliferative diseases according to WHO classification 59-60. Usually these diseasesare unresponsive to tyrosine kinase inhibitors and have a poor prognosis. Because ofunresponsiveness to these inhibitors the name (regardless of the prefix “atypical”) CML isslightly misleading.

3.4. Deletions of the derivative chromosome 9

The discovery of deletions in the translocated chromosome 9, i.e. derivative chromosome9, der(9), resulted from the development and further refinement of probes used in FISHassays. More distinguished probe sets were designed for detection of both the Phchromosome and the der(9) in minimal residual disease analyses in order to reduce the

19

number of false-positive findings that were relatively common when more conventionalprobes were used in the assay 61-62. However, in some patient samples an aberrant signalpattern was unexpectedly observed. The fusion signal indicating the BCR-ABL gene in thePh chromosome was visible, but der(9) chromosome was lacking a signal of its own. Thisfinding was indicative for a deletion in der(9), a phenomenon not reported earlier. Thepresence of a deletion was further confirmed by PCR targeting microsatellite loci andadditional FISH probes mapping on the deleted region 63-64.

Ever since the initial findings, large deletions in der(9) chromosome translocationregion have been identified in 10-15% of CML patients in Western countries 63-65. For anunknown reason the reported frequency of der(9) deletions is higher in Asian populations,being over 20% 66-68. Patients with variant translocation have more often der(9) deletionsthan patients with standard translocation, as the approximate frequency is 40% 50-51, 69.Der(9) deletions have also been observed in Ph chromosome positive ALL, with a similarfrequency as in CML 70.

The der(9) deletions have variable breakpoints and the size of the deleted region rangesfrom a few hundred kilobase pairs to several megabase pairs of DNA 63-64, 71. In most casesthe deletions span the translocation breakpoint and contain material from bothchromosomes 9 and 22. The other deletion types contain only chromosome 9 sequencesupstream the ABL gene, or only chromosome 22 derived sequences, respectively 72-73. Thedifferent deletion types detected by FISH are indicated in Figure 6 (B-D).

Figure 6 Different deletion types in der(9) as assessed by “dual color dual fusion” patternFISH probe. A) Conventional signal pattern in a Ph chromosome positive metaphasecell without a der(9) deletion. B) Der(9) deletion containing both the 5´ABL and3´BCR sequences. C) Der(9) deletion of only the 5´ABL, and D) containing only the3´BCR sequences.

20

3.4.1. When are der(9) deletions formed?

The der(9) deletions are commonly regarded as occurring at the time of the Phtranslocation, since distinct patient populations in different phases of CML have beenfound to exhibit nearly identical frequencies of cases with deletions. Likewise, pairedsamples taken at the time of diagnosis and at disease progression of the same patients havebeen analyzed with consistent results 63, 69, 74. In few reports though, the deletion has beendescribed as a secondary event, since cells with and without the deletion have beenobserved simultaneously 68, 75, but the majority of the current literature is in support ofsimultaneous translocation and deletion events.

3.4.2. The clinical impact of der(9) deletions

In the first published studies patients with der(9) deletions were found to confer poorerprognosis when compared to patients without deletions. Significant difference in overallsurvival was observed between the deleted or non-deleted groups. The deletion was foundto be an independent prognostic factor and more powerful than Sokal or Hasford scoringsystems 63, 69, 76. The size of deletion was observed to confer prognostic significance: thelarger deletions were associated with poor prognosis, whereas smaller ones have noprognostic impact 72-73.

The poor prognosis of der(9) deletions was discovered in patient populations treatedmainly with interferon-alpha based regimens. Since the advent of imatinib the prognosticsignificance of der(9) deletions has been re-evaluated in a few studies. In one study, therates of hematologic and cytogenetic response were lower in patients with deletions,although the difference was not significant when only newly diagnosed patients wereselected for analysis 77. In another study, no difference in response rates was observed,even if the der(9) deletion patients were receiving more often higher imatinib dose thancases without deletion 78. This finding has also been confirmed in studies with equalimatinib dose 79-80. However, results of deletion positive chronic phase CML patientstreated with second generation tyrosine kinase inhibitors may indicate worse survival, butthe reason for this disparity is not clear 81. As the prognostic significance of der(9) deletionis not so clear in CML treatment, it has been considered as a warning sign being onecandidate adverse prognostic factor 82.

3.5. Clonal evolution

The majority of CML patients develop secondary (i.e. additional) clonal aberrations in Phpositive cells in advanced phases of the disease. Additional abnormalities can be detectedin approximately 75-80% of CML patients in blast crisis. The appearance of secondarychanges is a phenomenon called cytogenetic clonal evolution. Clonal evolution is thoughtto be reflecting genetic instability of the leukemic cells and may be a sign of diseaseprogression 49, 57, 83.

Secondary chromosomal aberrations are clearly non-random, the most common onesbeing the isochromosome 17q, trisomy 8, additional Ph chromosome and slightly lessfrequently trisomy 19 [i.e. i(17)(q10), +8, +der(22)t(9;22)(q34;q11.2), +19]. The first three

21

changes constitute over 90% of the CML cases in whom secondary chromosomal changesare being detected. These and other aberrations occurring at frequencies exceeding 5% arecalled “major route” abnormalities. Other, less frequently seen abnormalities are called“minor route” changes, being for example trisomy 21 and monosomies of chromosomes 7and 17 49, 84.

The prognostic significance of specific secondary chromosome abnormalities isvariable. Many studies have reported that blast crisis without secondary abnormalitiesmight have a better prognosis. Other investigations have not found such a connection. Inall, the prognostic impact of secondary abnormalities is heterogeneous and most likelylinked to various other parameters, including time of appearance, types of aberrations andalso treatment modalities 49.

3.6. Clonal chromosomal changes in Ph negative cells

Other clonal chromosome aberrations can also be detected in Ph chromosome negativecells. This relatively new finding was observed during cytogenetic monitoring of CMLpatients treated with imatinib. The patients have achieved cytogenetic response to thetreatment, but unexpectedly other clonal chromosome aberrations were seen in Phnegative cells. The incidence of these other clonal aberrations is relatively low, being 2-15% of the imatinib treated patients depending on whether the patients have been studiedfrom selected or unselected cohorts. A small fraction of patients with Ph negativeabnormalities develop bone marrow myelodysplasia, or myelodysplastic syndrome. Mostfrequently observed chromosome abnormalities are numerical aberrations, mainly -Y, +8and -7. Structural changes are observed less frequently, out of which deletions of longarms of chromosomes 7 or 20 (7q-, 20q-) are more commonly seen 85-88.

The mechanism of the formation of aberrant Ph negative clones is not clear. In smallproportion of patients the presence of Ph negative clone has been shown in samplespreceding imatinib treatment. This would indicate the expansion of pre-existing clone aftereradication of Ph positive cells by imatinib. However, this has not been detected in allpatients, so direct effect of imatinib can not be totally excluded, even though it is unlikely87, 89-90. Ph negative clonal hematopoiesis has also been detected during dasatinibtreatment, so the phenomenon is not restricted only to imatinib therapy, but concerns othertyrosine kinase inhibitors as well 91-92.

Just like the origin, the clinical significance of clonal aberrations in Ph negative cells isnot unequivocal. The appearance of clonal abnormalities in Ph negative metaphases maybe transient, occurring only once, but the cells may also persist or even increase in time.The prognostic impact of Ph negative clonal aberrations needs further clarification, butchromosome 7 changes, in particular monosomy 7, appears to have the greatest risk ofdeveloping myelodysplastic syndrome or acute myeloid leukemia. Aneuploidies ofchromosomes Y and 8 (-Y and +8) seem more indolent 93. In practice, periodicalmonitoring of CML patients with conventional cytogenetics has clear importance becauseof the variable clinical significance of these abnormalities.

22

3.7. Ph chromosome in other hematological malignancies

The Philadelphia chromosome is not however, exclusively detected in CML. It has alsobeen reported in B-cell acute lymphoblastic leukemia (ALL) 94. About 25% of adults and5% of children diagnosed with ALL show Ph in chromosome analysis 95 In addition, rarecases (<1-4%) of acute myeloid leukemia present Ph chromosome at diagnosis 96-97. Someof the cases may actually represent CML diagnosed not until in the lymphoid or myeloidblast crisis. The prognosis of Ph chromosome positive acute leukemia is poor when treatedwith conventional cytotoxic therapy. Some patients may be cured by allogeneichematopoietic stem cell transplantation. The advent of broad-spectrum tyrosine kinaseinhibitors may dramatically change the prognosis of Ph+ ALL.

4. Molecular genetics and pathology of CML

At the molecular level, the primary genes affected in CML are ABL and BCR. The Phtranslocation gives rise to a chimeric fusion gene, BCR-ABL, with constitutive kinaseactivity leading to enhanced cell proliferation, resistance to apoptotic stimuli and alteredcell adhesion. The cellular functions of normal and fused genes in CML are reviewedbelow.

4.1. Oncogenic tyrosine kinases in hematological malignancies

Protein tyrosine kinases are enzymes that phosphorylate tyrosine residues of varioussubstrate proteins and thereby regulate their activity. The target of the phosphorylationmay be the kinase itself (autophosphorylation) or other proteins downstream of varioussignaling pathways. Tyrosine kinases regulate the intracellular signal-transductionpathways and therefore have an important role in cell proliferation and differentiation 98-99.

Constitutive activation of various tyrosine kinases has been described in many types ofmalignancies. Oncogenic tyrosine kinases can be products of chimeric fusion genesgenerated through chromosomal rearrangements such as translocations or deletions. Theycan also be formed through gene mutations leading to constitutive activation, or geneamplifications leading to overexpression. Tyrosine kinases can be divided intotransmembranic, ligand-binding receptors such as the stem cell factor receptor C-KIT, orcytoplasmic, intracellular non-receptor kinases like ABL 98, 100-101.

4.2. Abelson murine leukemia viral oncogene homolog 1 (ABL) gene

The tyrosine kinase ABL is encoded by the Abelson murine leukemia viral oncogenehomolog 1 (ABL, ABL1) gene located in the chromosome region 9q34.1. The ubiquitouslyexpressed ABL protein localizes to both the cytoplasm and nucleus of the cells and is ableto shuttle between these two compartments 102-105. The ABL gene contains a total of 11exons, of which the first one (1a or 1b) is alternatively spliced. The transcription of ABLgenerates two distinct messenger RNAs (mRNA) 5 kb and 6.5 kb of size which aretranslated to two 145 kD protein isoforms (Ia and Ib) differing in their first 19aminoterminal residues (reviewed by Van Etten) 106-107. The isoform Ib contains a C14

23

myristoyl fatty acid linked to its amino terminus and is expressed at higher levels than theunmyristoylated Ia form 108-110. The functional domains of ABL are presented in Figure 7.

ABL has been implicated in several cellular processes, such as regulation of cellproliferation, differentiation, adhesion, and cell death. ABL both promotes and inhibitscell growth. In quiescent cells ABL is kept inactive by binding to RB protein, which whenphosphorylated dissociates and activates ABL during the S phase of the cell cycle. ABL inturn, activates other genes in a growth-promoting way. However, some studies haveshown that overexpression of ABL induces cell-cycle arrest in G1 phase 106.

Nuclear ABL is involved in regulation of the cell cycle and response to genotoxicity,whereas cytoplasmic ABL has a role in signaling and cytoskeletal molding 111. NuclearABL has also been implicated in DNA damage-induced apoptosis. After DNA damageABL gets activated as a result of ATM function and RB inactivation. ABL-inducedapoptosis is then mediated through the p53 and the p53-homologue p73 protein leading togrowth arrest or apoptosis 112-114. ABL gets activated as a response to cellular stress, suchas ionizing radiation or oxidative stress. The stress-activated mitogen-activated proteinkinase (MAPK) family members JUN N-terminal kinase (JNK/SAPK) and p38 also havea role in mediating ABL-induced cell death 100, 106, 114. Cytoplasmic ABL associates withactin fibers, which form the basic structure of cytoskeleton, and is therefore involved inPDGF-induced response to motility and cell adhesion 100, 115.

The tyrosine kinase activity of normal ABL is tightly controlled. The residues at theextreme amino terminus of the ABL protein form a “cap” structure that is present in bothsplice variants. The cap structure inhibits the kinase activity of the protein byintramolecular binding to the SH3 and catalytic domains, leading to autoinhibition 116,reviewed in 117. The myristoyl modification in Ib isoform also has a role in regulating thekinase activity by binding to the catalytic domain 109, 118. The regulation of theunmyristoylated ABL Ia isoform remains to be determined 119.

Figure 7 Schematic structure of the ABL protein. ABL contains SRC homology domains SH1,SH2 and SH3, of which SH1 operates as the tyrosine kinase domain. SH2 and SH3serve as binding sites for different proteins, SH2 for phosphotyrosine residues andSH3 for proline-rich sequences. PxxP indicates proline-rich regions, which are ableto bind SH3 domains. Nuclear localizing signals (NLS) and one nuclear-export signal(NES) balance the amount of protein accumulating in the cell nucleus. The DNA-binding domain has a role in chromatin binding of the nuclear ABL. Binding of ABLto actin filaments in the cytoplasm is mediated by G- and F-actin binding domains(GBD, FBD). The saw-edged sign indicates the breakpoint region in ABL. The figureis modified from references 119 and 120 and the functions of the indicated domains arebased on references 104-105 and 121-123.

24

4.3. Breakpoint cluster region (BCR) gene

The normal functions of the Breakpoint cluster region (BCR) protein are known less thanthe ones of ABL. The BCR gene localized to chromosome 22q11.2 consists of 23 exons, ofwhich the first two have alternative exons in intron 1 124-126. Two different mRNAs 4.5 kband 7kb of size, coding for 130 kD and 160 kD proteins, respectively, have been found 18,

124, 127. The ubiquitously expressed BCR was first regarded as a cytoplasmic protein, butlater studies have shown its capability to associate with condensed DNA 128-130.

The BCR protein has a serine/threonine kinase activity encoded by the first exon of theBCR gene 131. It also interacts with G proteins, like GTP-binding protein p21Rac, involvedin intracellular signaling, cytoskeleton organization, cell growth and normal development111, 132. BCR has also been implicated in regulating the WNT signaling pathway 133 and hasa role in cellular trafficking of growth factor receptors 134. Additionally, BCR interactswith the xeroderma pigmentosum B (XPB) protein, possibly linking BCR to DNA repair111, 135. The functional domains of BCR are indicated in figure 8.

Figure 8 Schematic structure of the BCR protein. The amino terminus contains the coiled-coiloligomerization domain that mediates the tetramerization and activation of theprotein. Tyrosine 177 residue has a function in binding to growth factor receptor-bound protein 2 GRB2, an adapter molecule involved in the RAS pathway activation.The guanidine exchange factor (GEF) domain activates G-proteins, whereas thecarboxyterminal guanosine triphosphate-activating protein (GAP) domain inactivatesG proteins. The saw-edged markers indicate the breakpoint regions in BCR. Thefigure is modified from ref. 111 and the functions of the indicated domains are basedon references: 132, and 135-138.

4.4. The BCR-ABL fusion gene

The molecular basis of CML is the formation of the BCR-ABL fusion gene as a result ofPh translocation. The 5´part of the gene consists of BCR derived exons and the 3´end ofABL originating sequences. The breakpoints in ABL lie at the 5´part of the gene, upstreamof exon 2 (termed a2). In the vast majority of CML patients (95%) and approximately onethird of Ph+ ALL patients the BCR gene breaks in the 5.8 kb breakpoint cluster region(bcr) spanning exons 12 to 16 (formerly referred as exons b1-b5), termed the major bcr(M-bcr). As a result of alternative splicing, either b2a2 or b3a2 (also called e13a2 ande14a2, respectively) transcripts are formed (Figure 9). The 8.5 kb fusion mRNAs are thentranslated into chimeric 210 kD proteins (p210) 19-20, 139. In contrast to the normalcounterparts, the BCR-ABL protein isoforms are present exclusively in the cytoplasm 128.

25

Two other breakpoint cluster regions in the BCR gene have also been characterized:the minor-bcr (m-bcr) and micro-bcr ( -bcr) regions. The m-bcr is mainly associated withPh+ ALL (approximately two thirds of the cases) and is detected only occasionally inCML. The m-bcr breakpoint is situated proximally to M-bcr, between alternative exonse2´and e2 (Figure 9). Due to alternative splicing the 7.0 kb fusion transcript has an e1a2junction and is translated into a 190 kD protein (p190) 140-141. However, p190 can also bedetected at low levels in p210 positive CML 120, 142. In a small subset of CML patients theBCR breakage occurs distally downstream of exon 19 in the -bcr region generating a 9 kbmRNA that is translated into a 230 kD protein (p230) (Figure 9). This c3a2 (e19a2) typeof fusion is associated with a neutrophilic CML that is regarded as a more indolentdisease, but it has also been detected in classical CML 143-145.

In rare occasions (<5% of CML cases) other kind of BCR-ABL junctions, such as b2a3,b3a3, e1a3, e6a2 and e8a2 have been described. The breakpoints in ABL and BCR arevariable and they can even be located within exons 146. Some aberrant fusion transcriptsmay also contain small insertions or intervening sequences between BCR and ABL 147-149.The use of multiplex reverse transcriptase PCR techniques in the diagnosis of CML casesalso detects these unusual fusion transcripts 150-151.

Figure 9 BCR-ABL fusions on a genomic level. The genomic structures of ABL and BCR genesare represented in the upper part of the figure. The chimeric mRNAs derived from thefusion genes and proteins with their corresponding molecular weights are marked atthe lower part of the picture. The figure is modified from ref. 120.

26

4.5. Cellular signaling pathways affected by BCR-ABL

The structure of the BCR-ABL fusion protein (presented in Figure 10) and the signalingpathways affected by its expression have been widely studied 120, 151. Three mainmechanisms have been implicated in the transformation process of the BCR-ABL fusionprotein: altered adhesion to stroma cells and the extracellular matrix, constitutively activemitogenic signaling and reduced apoptosis.

During normal hematopoiesis, the hematopoietic progenitor cells adhere to bonemarrow stromal cells and the extracellular matrix which is considered essential for theregulation of hematopoiesis through cytokine mediated signaling. As BCR-ABL proteinexpression leads to altered adhesion, the CML cells are lacking the regulatory signals thatare provided to normal hematopoietic cells 152. One of the most prominentphosphorylation targets of BCR-ABL, the CRKL protein has been implicated in cellularmotility and in integrin-mediated adhesion by associating with focal adhesion proteins likepaxillin, FAK, p130CAS and HEF1 151, 153-156.

BCR-ABL activates several signaling pathways known to have mitogenic potential.Autophosphorylation of tyrosine 177 of the fusion protein promotes binding of the adaptermolecule GRB2 which in turn, through association with the SOS protein stabilizes RAS inits active form 157-158. Activation of RAS induces a signaling cascade via the mitogen-activated protein kinase (MAPK) pathway leading to antiapoptotic BCL2 expression 159-

160. BCR-ABL also activates other signaling pathways such as the signal transducer andactivator of transcription 5 (STAT5) and phosphatidylinositol 3-kinase (PI3K)/AKTpathways, leading to transcriptional activation of BCL-XL and antiapoptotic signaling andCML cell proliferation 161-163. In addition, CML cells inhibit apoptosis by phosphorylationof the proapoptotic BAD protein or by repressing the expression of interferon consensussequence binding protein (ICSBP) that regulates the expression of apoptosis related genes164-166. Even though much is known about the protein-protein interactions of BCR-ABLthe cellular mechanisms of action of the fusion protein, such as its critical effectormolecules, are still unknown. Therefore, further studies are needed to elucidate themolecular and cellular biology of CML 119, 167-168.

Figure 10 Schematic structure of the BCR-ABL fusion protein isoforms. The coiled coiloligomerization domain (OD) and the tyrosine residue 177 (Y177) in the BCR part ofthe fusion protein are essential for inducing CML-like myeloproliferative disease inmurine models 136, 169. The figure is modified from figures 7 and 8 and the referencestherein.

27

5. The role of genetic analyses in diagnostics and follow-up of CML

5.1. Analyses performed at the diagnostic phase

The diagnosis of CML is confirmed by the presence of Ph chromosome and/or BCR-ABLfusion transcripts. Additionally, other complementing tests may be performed, e.g.determination of the BCR-ABL transcript type or the deletion status of der(9).

The presence of the Ph chromosome is usually shown by conventional cytogenetics inbone marrow sample, using most often G-banding method. Conventional cytogenetics is“a genome-wide screen” at its own sensitivity level for detecting other abnormalities. Thetype of Ph translocation is also defined in G-banding study. Usually 20 mitotic cells areanalyzed in cytogenetic analysis. Conventional cytogenetics is often accompanied by afluorescence in situ hybridization (FISH) assay using a locus-specific BCR and ABLprobes labeled with different fluorescent dyes. FISH detects the presence and localizationof BCR-ABL fusion gene also in cases with Ph negative BCR-ABL positive disease and thepossible presence and type of der(9) deletion 170-171. The latter is important not only as apotential prognostic marker but is also essential piece of information when consideringinterphase FISH as a follow-up technique due to low mitotic index.

Molecular genetic analyses at the diagnostic phase focus on demonstration of the BCR-ABL fusion transcript. This is usually performed with RQ-PCR or with qualitativemultiplex-PCR systems that also detect more rare fusion types. Molecular genetic analyseson diagnostic sample based on RQ-PCR offer the patient-specific baseline for molecularmonitoring and defining the level of treatment response.

5.2. Follow-up studies and minimal residual disease analyses

The response to the given therapy - whether it is a tyrosine kinase inhibitor such asimatinib or an allogeneic hematopoietic stem cell transplantation (alloHSCT) - isevaluated with cytogenetic and molecular genetic tests 172-175. Especially during tyrosinekinase inhibitor therapy the level of minimal residual disease (MRD) is regularly assessedduring follow-up. MRD describes a situation in which the conventional laboratoryanalyses, such as morphological studies and chromosome analyses performed withstandard G-banding, are unable to detect leukemic cells, but when more sensitivetechniques are used, residual CML cells are observed. Metaphase FISH and RQ-PCRassays are the techniques used for MRD detection in CML.

5.2.1. Cytogenetic follow-up analyses

The current first-line treatment, imatinib (reviewed in detail in chapter 6.1.) inducescomplete cytogenetic responses (CCyR, i.e. no Ph positive cells detected in the cellpopulation analyzed) in over 70% of CML patients during the first 18 months of treatmentand nearly 90% during five-year follow-up 52, 176. These analyses were performed withconventional cytogenetics, which is a rather crude tool for investigating residual disease asthe analysis of 20 metaphase cells excludes only 14% level of mosaicism (i.e. presence ofcells with different karyotype in a same sample) 177. The levels of cytogenetic response are

28

presented in Table 2. Conventional cytogenetics is irreplaceable in detecting clonalevolution in Ph positive cells or other clonal abnormalities in Ph negative hematopoiesis.

Table 2. The terms and levels of cytogenetic response. The data is adopted from Baccaraniet al.2006 82.

Level of cytogeneticresponse

Frequency of Ph positivemetaphases (%)

Complete (CCyR) 0 %

Partial <35 %Major cytogeneticresponse

Minor 36-65 %

Minimal 66-95 %

None >95 %

Cytogenetic response and MRD status may be defined more extensively than conventionalkaryotyping with FISH methods targeting the BCR and ABL genes at the chromosomallevel. Metaphase FISH monitors the presence of mitotic i.e. dividing leukemic cells 178.Prolonged treatment with colcemid and sufficiently high number of nucleated cells in cellculture provides the acquisition of high number of mitotic cells for MRD analyses 179. Theterm “hypermetaphase FISH” has also been used in this technique 180. Different cytokinecocktails in cell culture in addition to long-term mitotic arrest with colcemid can also beapplied 181-182.

Conventional karyotyping or metaphase FISH require dividing cells and therefore abone marrow aspirate as a sample for analyses. Peripheral blood sampling would provideless invasive method of assessing disease burden, but the lack of mitotic cells does notallow extensive analyses at chromosomal level. Interphase nuclei in blood cells may beanalyzed with locus-specific FISH probes, but the relatively high rate of false positivefindings (1-5% depending on the probe and laboratory specific factors) may complicatethe interpretation of low-level Ph positivity. The presence of der(9) deletion complicatesthe analysis of interphase cells and makes the interpretation of rare positive-looking cellseven more difficult. The addition of third probe may improve the quantification ofminimal residual disease in these cases 183.

5.2.2. Molecular genetic follow-up studies

Techniques based on the PCR method are the most sensitive way of assessing residualdisease in CML patients. The most commonly used method is nowadays RQ-PCR whichenables the determination of actual BCR-ABL transcript copy numbers in proportion to thecopy numbers of a reference gene. Some years ago the “Europe Against Cancer” (EAC)Concerted Action published a standardization and quality control study for detecting ninefusion gene transcripts for residual disease in different types of leukemia with RQ-PCR.For CML and Ph+ ALL the most common BCR-ABL fusion transcript types wereincluded; namely M-bcr (b2a2 and b3a2) for p210 and m-bcr (e1a2) for p190 codingsequences, respectively. This published protocol and the accompanying publication about

29

the recommended reference genes are followed by many molecular genetic laboratories184-185.

The importance of molecular monitoring of CML patients with RQ-PCR becameevident after the advent of imatinib treatment and the phase III trial (reviewed in chapter6.1.2.). In 57% of the patients who had achieved CCyR during the 12 months of imatinibtreatment, the levels of residual BCR-ABL transcripts had fallen by 3 logarithmic units ormore, indicating major molecular response (MMR) to the treatment. In this patient groupthe probability of remaining progression free was 100% at 24 months 172. This progressionfree time was actually extended to 60 months of treatment when the 5-year follow-up dataof the phase III trial was published 52. The three-log reduction by 18 months has thereforebecome a prognostically significant value indicating optimal response to imatinibtreatment.

5.2.3. International standardization of RQ-PCR assays in minimal residual diseaseanalytics

The RQ-PCR methodologies used for detecting residual BCR-ABL transcripts are variable,including the type of PCR-machinery, chemistry, the origin of samples and the choice ofthe reference gene. Additionally, the results can be reported either as a BCR-ABL/reference gene copy number ratio, a percentage of the ratio, difference between Ctvalues ( Ct), or a logarithmic reduction of transcripts compared to a baseline value. Allthis variability complicates the comparison of RQ-PCR results obtained from differentlaboratories 172, 186-189.

Recently, detailed recommendations on harmonizing RQ-PCR assays have beenpublished aiming for world-wide standardization of this technique. The recommendationsincluded a variety of practical issues concerning laboratory technical part of the assays,but also sample types and the way on reporting the results were discussed 190-191.

Three equally suitable reference genes were proposed: ABL, BCR or GUS. Of theseABL is the most widely used despite of concurrent amplification of BCR-ABL with ABLprimers in the assays 191. A minimum of 5 to 10 ml of peripheral blood was recommendedas the sample type. Only one tissue type sample should be used consistently formonitoring MRD, not to interchange of blood and bone marrow because of consistentdifferences in BCR-ABL expression levels in different tissue types observed in somepatients 190. RNA extraction should be performed on total leucocytes, not fractionatedcells. Reverse transcription should be performed using random hexamers. Primers andprobes for the RQ-PCR assay should be RNA specific and take into account thepolymorphic site in BCR exon 13 192-194. Quality control samples of negative, high and lowexpression levels of BCR-ABL should be included in the assays. Calibration standardssuch as DNA plasmids are used for constructing standard curves and they should beincluded in each assay to compensate for the variation due to probe degradation,differences in reagent batches and also for the run to run variation observed even when thesame reagents are used 190.

Besides the recommendations for technical performance of the RQ-PCR assays, anInternational Scale (IS) was proposed for expressing the MRD results in a standardizedway. The IS is anchored to two values defined in the phase III study: the standardized

30

baseline represents 100% and the 3-log reduction corresponding to MMR equals to 0.10%of BCR-ABL transcript level on the IS 191. Since the 30 diagnostic samples used fordetermining the baseline in the phase III study 172 are no longer available and nocommercial reference samples are this far available, the standardization may be performedby studying reference samples of known MRD level obtained from a reference laboratoryalready applying the IS. This allows other laboratories to determine their own MRD valueof these reference samples. The difference between the values of the reference laboratoryand the laboratory studying the reference samples may be adjusted with a laboratory-specific conversion factor so that after multiplying the MRD results with the conversionfactor the values would be comparable to the reference laboratory 191.

6. Treatment of CML

Treatment modalities of CML have changed considerably over the years. The treatment ofCML with cytotoxic chemotherapies such as busulfan and hydroxyurea lead tohematological responses and reduction of disease-related symptoms, but did not provideany survival advantage, so the disease inevitably progressed to advanced phases.Interferon-alpha treatment produced not only hematological remissions but alsocytogenetic responses in approximately 20-60% of patients which was associated toprolonged survival, but the use of interferon-alpha was also hampered by toxic side effectsfor a proportion of patients 195-197. Molecularly targeted therapy with tyrosine kinaseinhibitors, most often imatinib, and allogeneic hematopoietic stem cell transplantation arethe therapeutic options reviewed below.

6.1. Imatinib: the current gold standard of CML treatment

Imatinib (Glivec®, Gleevec™, formerly STI571 or CGP57148B, also called imatinibmesylate) is a selective small molecule tyrosine kinase inhibitor used in targeted treatmentof CML and Ph chromosome positive ALL 198. Imatinib is a 2-phenylaminopyrimidinecompound that in preclinical studies showed a 92-98% decrease in the number of BCR-ABL positive colony formation but had no inhibition on normal colonies. This observationsuggested the potential utility of the compound in the treatment of BCR-ABL-positiveleukemias 199.

In addition to BCR-ABL and ABL inhibition, imatinib also has affinity for the ABLrelated ARG protein 200 and for the receptor protein-tyrosine kinases PDGFR , PDGFRßand C-KIT 199, 201-202. This makes imatinib an active drug for treating also other diseasesaffected by aberrant kinase activity, such as gastrointestinal stromal tumors (C-KIT genemutations) 203, hypereosinophilic syndrome or chronic eosinophilic leukemia (FIP1L1-PDGFR gene fusion) 204. Chronic myeloproliferative disorders associated with e.g.t(5;12)(q33;p13) or several other chromosome 5q33 aberrations, may result in therearrangements of PDGFRß gene that are also sensitive to imatinib 205. In addition,patients with systemic mastocytosis positive with FIP1L1-PDGFR fusion and with a raresoft tissue sarcoma dermatofibrosarcoma protuberans (characterized by COL1A1-PDGFßgene fusion that leads to autocrine stimulation of PDGFRß) may benefit from imatinibtreatment 206-208.

31

6.1.1. The mechanism of imatinib kinase inhibition

The high specificity of imatinib in inhibiting the tyrosine kinases mentioned above isachieved by its ability to bind the kinase molecule in its closed (inactive) conformation. Inthe closed conformation the centrally located activation loop of the kinase is notphosphorylated and therefore inactive. When phosphorylated, the activation loop extendsto the open (active) conformation which enables binding of substrate molecules to thekinase and subsequently their phosphorylation. The active conformation is very similar inall known kinases 209. In contrast, the inactive conformation has great diversity amongprotein kinases, explaining the specificity of imatinib. Imatinib occupies the ATP bindingsite of the BCR-ABL kinase domain and acts as a competitive inhibitor of BCR-ABL withrespect to ATP. The side chain of threonine residue at position 315 (T315) forms ahydrogen bond with the imatinib molecule. This residue is replaced by methionine inmany kinases which is not able to form such a bond, which makes T315 a key element forimatinib to inhibit BCR-ABL 209-210. When imatinib occupies the ATP binding pocket itstabilizes the inactive form of BCR-ABL, thus preventing autophosphorylation of thekinase itself and subsequently phosphorylation of its substrates. This consequently resultsin inhibition of the signaling cascades downstream of BCR-ABL, inhibition of cellproliferation, and eventually apoptosis (Figure 11) 199, 211-212.

Figure 11 The mechanism of imatinib mediated signal transduction inhibition. Imatiniboccupies the ATP binding pocket of BCR-ABL fusion protein and stabilizes theinactive non-ATP-binding conformation of the kinase thereby contributing itsinhibitory actions towards BCR-ABL. The figure is adapted from the article of Savageand Antman 2002 213. Copyright © 2002 Massachusetts Medical Society. All rightsreserved.

32

6.1.2. The IRIS (International Randomized Study of Interferon and STI571) trial

The efficacy of imatinib in newly diagnosed CML patients was determined in a pivotalphase III study, also called the IRIS (International Randomized Study of Interferon andSTI571) trial 176. A total of 1106 newly diagnosed chronic-phase CML patients wererandomized to receive either 400 mg of imatinib or interferon-alpha and cytarabine. Thedata demonstrated superiority of imatinib over interferon and cytarabine in the treatmentof newly diagnosed disease. At 12 months of treatment the rates of major and completecytogenetic response (CCyR) were 85% and 74% in patients treated with imatinib,compared to 22% and 9% in patients receiving combination therapy 176.

The IRIS trial also included a study evaluating the frequency of major molecularresponses (MMR) in patients who had achieved a CCyR to the treatment. In this study, areduction of 3 logarithmic units of BCR-ABL transcript levels from the diagnostic baselinewas detected in 57% of imatinib and 24% of interferon plus cytarabine treated patients at12 months of treatment. The estimated rates of all study patients in achieving MMR was39% in the imatinib group and 2% in combination therapy group, respectively. The CCyRcombined with 3-log reduction at 12 months indicated 100% of progression free survivalat 24 months compared to 95% of such patients with a reduction less than 3 log units and85% for patients who had not achieved CCyR at 12 months 172.

Five-year follow-up results of the IRIS trial were published in 2006 52 and furtherupdated in 2007 214. At five years of follow-up there were only 16 (3%) patients left in theinterferon and cytarabine treatment group, so the report mainly focused on the patientstreated with imatinib as the initial therapy. By five years of treatment, the estimated rate ofevent-free survival was 83% and for progression-free survival 93%, the number remainingunchanged at six-year update. For long-term outcomes achievement of both CCyR andMMR at 12 months indicated 100% progression free survival at 60 months of imatinibtreatment 52.

In a subset of the IRIS patients the long-term molecular follow-up results and the ratesof undetectable BCR-ABL levels were reported. During the first 18 months the BCR-ABLlevels reduced rapidly to MMR in the majority of patients and after that the BCR-ABLtranscripts continued to decline, if only at slower rate. The 12-month time point was thebest predictor for achieving undetectable BCR-ABL levels. The probability of achievingundetectable BCR-ABL at 6 years for patients having a MMR at 12 months was 72%compared to a probability of 5% in patients without a MMR at one year time point. Lossof MMR was observed only in patients with constantly detectable BCR-ABL levels 215.

Imatinib has induced remarkable responses in early chronic phase CML patients.However, the response rates have been lower and less durable in advanced phases of thedisease. Higher starting dose of imatinib (600mg) has proven superior to standard doseboth in accelerated and blast phases of CML and induced even CCyR in some patients, butresponses have been transient, lasting for some months in blastic phase CML 216-217.

33

6.2. Allogeneic hematopoietic stem cell transplantation (alloHSCT)

The introduction of imatinib has changed the indications of hematopoietic stem celltransplantation in the treatment of CML. The graft is composed of stem cells originatingfrom peripheral blood, bone marrow or cord blood. Stem cell grafts may be collected fromthe patients themselves (autologous transplant) or from healthy family or unrelated donorsfor alloHSCT. The transplanted patients are first treated with high-dose chemotherapy orchemo- and radiotherapy which is followed by transfusion of hematopoietic stem cellsfrom a healthy donor. The transfused stem cells engraft and reconstitute the patient’shematopoietic system. Before tyrosine kinase inhibitors were available, newly diagnosedchronic phase CML patients under 60 years of age with a HLA-matched sibling orunrelated donor, were often transplanted. Although the number of hematopoietic stem celltransplantations has decreased during the years it is one treatment option in situationswhen imatinib or other tyrosine kinase inhibitor therapy has failed 218.

Despite the remarkable response rates of the TKI therapy, alloHSCT is still the onlycurative treatment option. It is however, associated with a significant risk of morbidity andmortality and is also eligible only to a restricted patient population: relatively youngpatients with a HLA-matched donor (reviewed by Goldman) 219. In addition, relapse ofCML after alloHSCT is affecting approximately 10-30% of CML patients transplanted intheir first chronic phase, and are more common in patients transplanted in advancedphases of the disease, as reviewed by Dazzi and Fozza 220. Therefore, alloHSCT is not aguarantee of definitive cure, either. Disease relapse after alloHSCT may be treatedimmunologically with donor lymphocyte infusions (DLI) with response rates of 60-100%220. Synergism between DLI and imatinib treatments in managing relapses after alloHSCThas also been suggested 221.

7. Imatinib resistance

While the majority of CML patients have an excellent response to imatinib treatment,there are still a proportion of patients who do not achieve optimal or, any kind of responseor lose the earlier achieved response. This implies to treatment resistance. Resistance ismore common in patients with long disease history and advanced phase disease, as initialresponses are usually poorer and the achieved responses are prone to be only transient inadvanced phases of CML (Figure 12). Development of imatinib resistance in Phchromosome positive ALL is even more common due to higher level of genetic instabilityand more aggressive nature of the disease 222. Imatinib resistance can be classified intoprimary or secondary resistance or; according to the type of lacking response: intohematologic, cytogenetic or molecular resistance. Primary resistance, or refractoriness,describes a situation where no treatment response of any kind or not a sufficient one hasever been achieved. If a patient first responds to the treatment but then loses the responsewithout any obvious reason, secondary, or acquired, resistance may have developed(reviewed in e.g. 223-225).

34

Figure 12 Emergence of primary and secondary hematologic resistance at two years of imatinibtherapy. The frequency of primary resistance is indicated with gray bars andsecondary resistance with black bars. The abbreviations CP, AP and BC denotechronic phase, accelerated phase and myeloid blast crisis of CML, respectively.Adapted by permission from Macmillan Publishers Ltd; Leukemia ref. 223, copyright2004.

The mechanisms that confer CML cell resistance against imatinib can be divided intoBCR-ABL dependent and BCR-ABL independent mechanisms. BCR-ABL dependentmechanisms include BCR-ABL gene amplification and subsequent overexpression andpoint mutations in the region coding for BCR-ABL kinase domain. Resistancemechanisms independent of BCR-ABL fusion gene are processes involved in drugtransport in and out of the cells or activation of other signaling pathways 223, 225.

7.1. BCR-ABL gene amplification

Earlier cell line studies described the BCR-ABL gene amplification and overexpression asone mechanism for CML cells to escape the inhibition of imatinib 226-227. In the first reportof 11 patients with acquired imatinib resistance the gene amplification was detected inthree patients 228, but in a larger patient population the amplification was observed in twopatients only 229. The reason why BCR-ABL gene amplification is more commonly seen incell lines than clinical samples is not known, but potential toxicity of BCR-ABLoverexpression to the cells has been suggested as one possible explanation 230. Examplesof metaphase cells with an extra copy of BCR-ABL gene are presented in Figure 13.

35

Figure 13 BCR-ABL gene amplification through formation of an isochromosome of the Phchromosome as observed in standard G-banding (left) or acquisition of additional Phchromosome indicated by FISH (right). The Ph chromosomes are indicated witharrows. Courtesies of Drs Katrin Rapakko and Marja-Leena Väisänen.

7.2. Mutations in the kinase domain of BCR-ABL

Acquired resistance to imatinib is most often due to point mutations in the region codingfor tyrosine kinase domain of BCR-ABL. Primary resistance is less commonly associatedwith mutations. The frequency of mutations in imatinib resistant patients varies between40-90% depending on the disease phase, the methodology applied for the detection and thecriteria used for defining imatinib resistance 229, 231-232.

The mutations can be categorized into two groups depending on their effect in imatinibbinding: 1) those that directly interfere the binding of imatinib resulting in reduced affinityor steric hindrance and 2) those that alter the three-dimensional structure of BCR-ABLand destabilize the inactive conformation of BCR-ABL that is required for imatinibbinding 209, 232. The first report of acquired resistance to imatinib detected only a singlepoint mutation in the kinase domain in six out of nine analyzed patients, a threonine 315substitution to isoleucine, i.e. T315I 228. This mutation was later found to be completelyresistant to tyrosine kinase inhibitors available today 233-235. Several other point mutationshave since been described, the total number exceeding 50. However, some mutations aremore frequently seen than others, as 15 amino acid substitutions account for more than85% of the mutations and only seven mutated residues are responsible for 66% of thereported cases, namely G250, Y253, E255, T315, M351, F359 and H396, as reviewed byJane Apperley 225.

The mutations tend to cluster into four regions in the kinase domain (Table 3). Thefirst region is the P-loop (amino acids 248-256), a highly conserved region that binds theATP phosphate group and also interacts with imatinib. These mutations alter the flexibilityof the P-loop and destabilize the conformation needed for imatinib binding. The secondcluster is directly responsible for the imatinib binding containing the T315 and F317contact residues. This is followed by the catalytic domain (amino acids 350-363) which

36

has a possible role in autoregulation of kinase activity or imatinib binding. The fourthcluster is located in the activation loop starting with a conserved three amino-acid DFGmotif and ending with APE motif (amino acids 381-407). Mutations in the activation loopdestabilize the kinase to adopt the inactive conformation and therefore favor the active,open conformation that imatinib is incapable of binding 232, reviewed in 225, 236-238.

Different mutations confer different degrees of resistance. The “gatekeeper” T315Imutation and the mutations in the P-loop induce complete resistance to imatinib – and inthe case of T315I, also to second generation tyrosine kinase inhibitors – and is anindication for cessation of imatinib and change of therapy 239-240. Some mutations, on theother hand, remain biologically sensitive to imatinib and may be overcome by doseescalation 239. Mutations have also been detected in imatinib-naïve patients using sensitiveallele-specific oligonucleotide-PCR techniques 241-242. These pre-existing mutationsindicate that imatinib itself does not induce the mutations but rather selects the mutatedclones by giving them growth advantage over the non-mutated, imatinib sensitive cells.However, the mutations detected at low levels may not always explain the clinicalresistance to imatinib, but other mechanisms are contributing to the resistant phenotype243.

37

P

A

C

IB

Table 3. Some point mutations conferring resistance to imatinib and their locations in theBCR-ABL kinase domain. Adapted from Martinelli et al. 2005 and Baccarani etal. 2008 244-245 and the references therein.

Imatinib IC50 (nM) Imatinib IC50 (nM)Location in thekinase domain BCR-ABL

Biochemical inhibition Cellular growth inhibition

Unmutated 300 260-500

M244V 380 2000

L248V NA 1500

G250E 1000 1350-3900

Q252H NA 1200-2800

Y253F >5000 3475

Y253H >5000 >10000

E255K 2800 4400-8400

E255V >5000 NA

F311L 775 480

T315I >5000 >10000

F317L 900 810-1500

M351T 820 930

E355G NA 400

F359V 4700 1200

V379I 800 1630

H396R 1950 1750Locations in the kinase domain: P, phosphate binding (P-) loop; IB, imatinib binding region; C, catalytic domain;A, activation loop. The IC50 values indicate the concentration of imatinib that inhibits the biochemical tyrosinekinase activity of BCR-ABL and suppresses cell growth in Ph positive cell lines by 50%.

7.3. BCR-ABL independent resistance mechanisms

In addition to direct resistance mechanisms linked to BCR-ABL gene copy number orstructure, indirect mechanisms for resistance are also known. Too low a concentration ofimatinib inside the CML cells may be the cause for inadequate or lacking response.

Intracellular imatinib concentration is partly mediated by drug transporter proteins,called the ATP-binding cassette (ABC) proteins that transfer different substrates in(influx) and out (efflux) of the cells 246-248. ABC transporters also have a role in multidrugresistance (MDR), a phenomenon of simultaneous resistance to various anti-cancer drugs.Permeability glycoprotein (PGP), encoded by multidrug resistance 1 gene (MDR1, orABCB1), is an ABC transporter that is normally involved in excreting toxic agents out ofcells 247. Imatinib is a substrate for PGP and therefore overexpression of PGP maytherefore result in excess transport of imatinib out of the cells conferring intrinsicresistance to the treatment 249-252. However, conflicting results have also been presentedsuggesting not significant contribution of PGP expression to imatinib response 253-254.

38

Proteins affecting drug influx, or uptake, may also have an important role in efficacyof drug treatment. The human organic cation transporter 1 (hOCT-1) is an influx proteinthe activity of which is the key mechanism for imatinib uptake into the cells 250, 255. Recentstudies have shown that the hOCT-1 gene expression levels have a wide interpatientvariability and the expression levels may differ significantly between cytogeneticresponders and non-responders 254, 256. The level of hOCT-1 activity has an effect on themolecular response so that patients with high hOCT-1 activity achieve significantly bettermolecular response than those who have low activity. The molecular response in patientswith low hOCT-1 activity is dependent on the imatinib dose so that molecular responsesmay be improved with higher doses of imatinib. Determination of hOCT-1 activity levelmay therefore identify patients who most probably will have good response to standarddose of imatinib and patients who may benefit from higher doses of imatinib treatment 257.

In addition to drug transporters, a plasma protein called alpha1 acid glycoprotein(AGP) is in some reports suggested as one factor contributing to imatinib resistance bybinding to imatinib and preventing the access of the drug into the cells 258-259. However,this finding has been challenged by other studies indicating that AGP does not abrogatethe antileukemic effect of imatinib 260-261. The role of AGP in imatinib resistance seems tobe somewhat controversial and needs further studies to be clarified.

Loss of BCR-ABL signaling may also be compensated of by activating other kinasesignaling pathways as another mechanism of resistance 262. That is, activation andoverexpression of secondary tyrosine kinases may turn the cells independent of BCR-ABL. A member of SRC kinase family, the LYN kinase, has been found to be markedlyoverexpressed in cell lines and patient samples resistant to imatinib 263-264. Inhibition ofLYN overexpression with short interfering RNA or a SRC kinase inhibitor has triggeredapoptosis in resistant cells providing basis for new therapeutic options 264-265.

39

8. Second generation tyrosine kinase inhibitors

Second generation tyrosine kinase inhibitors have been developed for the treatment ofimatinib resistant or intolerant CML or Ph+ ALL. These inhibitors are more potent ininhibiting BCR-ABL than imatinib and some of them are more flexible in binding todifferent BCR-ABL conformations. Some inhibitors also have a broader inhibition targetspectrum which may have additional advantage in growth inhibition through othersignaling pathways 244, 266.

8.1. Dasatinib

Dasatinib (Sprycel®, formerly BMS-354825) is a so called dual tyrosine kinase inhibitortargeting ABL, BCR-ABL, C-KIT, PDGFRß, ephrin family kinases and also most SRCfamily kinases (SRC, FGR, FYN HCK, LCK, LYN and YES) 267-268. In vitro, dasatinib is325 times more potent inhibitor of BCR-ABL than imatinib. It is also capable of bindingto both active and inactive conformations of BCR-ABL and inhibiting most of themutations causing resistance to imatinib, with the exception of T315I 234-235, 269-270. Unlikeimatinib, dasatinib does not appear to be a substrate for drug influx protein hOCT-1 271-272.Whether or not the drug efflux occurs through PGP, has conflicting results 271-273.Dasatinib induces notable hematologic and cytogenetic responses in patients resistant orintolerant to imatinib at various phases of CML or Ph+ ALL 274-278. The inhibition of SRCfamily kinases has a role in the efficacy of dasatinib in the treatment of blast crisis CMLand Ph+ ALL, since these kinases are activated by BCR-ABL in leukemic cells oflymphatic origin and involved in development of Ph chromosome positive B-cell ALL 279-

280. Recent studies indicate the efficacy of dasatinib in the treatment of central nervoussystem leukemia i.e. neuroleukemia. Neuroleukemia emerges in approximately in 12% ofBCR-ABL positive patients who relapse during imatinib monotherapy 281. As imatinibpasses poorly the blood-brain barrier and has modest activity against neuroleukemia,dasatinib may be a useful alternative for treatment of these patients 282-284.

8.2. Nilotinib

Nilotinib (Tasigna®, formerly AMN107) is a second generation tyrosine kinase inhibitordesigned to bind the inactive conformation of the BCR-ABL. It is 20 times more potentinhibitor than imatinib. Nilotinib is capable of inhibiting the same kinases as imatinib andclinically relevant BCR-ABL mutant isoforms except T315I 234, 285. Additionally, thecellular uptake of these drugs seems to have a different mechanism as nilotinib influx isnot mediated by hOCT1, or the drug efflux by PGP 255, 286. Nilotinib has proven effectivein imatinib resistant or intolerant patients in chronic and accelerated phases of CML 287-288.However, the level of response in chronic phase patients may be affected by the baselineBCR-ABL mutation status or emergence of new mutations, as the less sensitive mutationsare associated with less favorable response 289.

40

8.3. Other second generation tyrosine kinase inhibitors

Bosutinib (previously SKI-606), a dual inhibitor for SRC family kinases and ABL, hasdemonstrated antiproliferative activity against BCR-ABL positive cell lines in preclinicalstudies 290. In contrast to imatinib and dasatinib, it does not have inhibitory activity againstC-KIT or PDGFRs, which may reduce the side effects of the drug. Bosutinib is capable ofbinding both active and inactive, as well as intermediate conformations of BCR-ABL andinhibiting several clinically important mutated forms of BCR-ABL, except T315I 291.

INNO-406 (also known as CNS-9 and NS-187) inhibits primarily ABL and LYN, butalso ARG and FYN kinases being 25-55 times more potent in inhibiting ABL thanimatinib 292. Like other kinase inhibitors presented this far, T315I mutation is resistantagainst this drug as well. INNO-406 is a substrate for PGP which reduces its concentrationin the central nervous system to be only one tenth of the concentration in plasma.However, even this amount of drug seems to be sufficient in inhibiting BCR-ABL positiveneuroleukemia in mouse models making INNO-406 a potential drug againstneuroleukemia 293.

8.4. Resistance against second generation tyrosine kinase inhibitors

Kinase domain point mutations conferring resistance against to the second generationinhibitors have been studied in various in vitro mutagenesis assays 233, 269, 294-295. Some ofthe mutations are the same regardless of the inhibitor, such as T315I, but some are uniqueto the inhibitor being used. In general, the spectrum of mutations arising in the presence ofdasatinib or nilotinib is more limited than during imatinib. Nilotinib resistance is mainlyassociated to mutations in the P-loop or T315I 294-295, whereas mutations recoveringthrough dasatinib are often concentrated at contact residues (L248, V299, T315, F317).Some of the dasatinib resistant mutations remain sensitive to imatinib or nilotinib, such asV299L, T315A, or F317L/V/I, but T315I has complete resistance against all of the drugs233-234, 269.

As the use of second generation tyrosine kinase inhibitors after imatinib failure isgetting longer, the clinical resistance has also emerged. Mutations characterized this farduring dasatinib treatment are the ones described in in vitro assays 296-298. However, theselection of compound mutations (i.e. two or more mutations in the same BCR-ABLmolecule) in patients treated sequentially with different inhibitors hampers thereintroduction of imatinib to treat dasatinib-resistant, imatinib-sensitive mutants. Thecompounded mutations can additionally increase the oncogenic potential of the leukemiccells. This data suggests a role for combined, instead of sequential, use of differentinhibitors 299.

41

9. Recommendations for the management of CML: the current review ofthe expert panel of the European LeukemiaNet

In 2006, an expert panel appointed by the European LeukemiaNet (ELN) publishedrecommendations for the CML management based on the literature published since 199882. The previous guidelines had been developed in 1998 by the American Society ofHematology and covered more conventional treatment strategies such as chemotherapy,interferon-alpha and alloHSCT 300. However, tyrosine kinase inhibitors were not discussedthen. Therefore, in addition to updating results of the interferon-alpha and HSCTtreatments the panel of experts also reviewed the current situation of tyrosine kinaseinhibitor (mainly imatinib) therapy based on the present data available.

The expert panel defined parameters for optimal and suboptimal response as well asfor treatment failure. The timelines, by which certain response categories are expected tobe achieved, were also included (Figure 14, Table 4). These categories are nowadays usedfor evaluating the level of treatment response and also in selecting patients to new studiesfor other treatment modalities.

Figure 14 Timelines for reaching parameters defined for the optimal imatinib (IM) response.Modified from Baccarani et al 2006 82.

As late responses to imatinib have been also reported 52, some patients may achieve theresponse timepoints later than depicted in Figure 14. Still for practical purposes it is usefulto follow the timepoints to be able to evaluate whether the response is satisfactory or not.This aids to decide whether to continue the current treatment with current dose or toconsider a change in the therapeutic strategy. In situations where the response is notsatisfactory the terms “suboptimal response” and “failure” have been defined. Suboptimalresponse means that a patient may still benefit from imatinib treatment, but in the long runthe outcome may not be as good as it is being expected. In failure cases it is evident thatimatinib treatment with the current dose is not anymore appropriate and that the patientwould benefit from other therapeutic options, if available. Imatinib dose escalation,alloHSCT or investigational treatments are therefore recommended for patients havingfailed the standard imatinib treatment. The same options are also worth considering inpatients with suboptimal response. For patients diagnosed with a ”warning sign” listed in

42

Table 4, the standard dose of imatinib treatment may not necessarily be sufficient and thatthese patients may require more careful monitoring 82.Since the publication of ELN recommendations, more knowledge on treating imatinibresistant or intolerant patients have been gained in various studies. The approval andcommence of second generation tyrosine kinase inhibitors has provided more options inthe treatment of CML 218, 225. In addition, newer drugs targeting for T315I inhibition arecurrently being studied 301. The ELN recommendations will be updated in the near futuremost possibly covering also these treatment modalities.

Table 4. Definition of suboptimal response and treatment failure for CML patients in earlychronic phase treated upfront with 400mg imatinib (IM) daily. Adapted from fromBaccarani et al 2006. 82 and the CML Pocket Card by European LeukemiaNet 302.

Time Suboptimal response Treatment failure Warning signs

Diagnosis N/A N/A High risk score

der(9) deletion

Clonal evolutionin Ph+ cells

+3 months ofIM therapy

Less than CHR No hematologic response N/A

+6 months Less than partial cytogeneticresponse (>35% Ph+ cells)

Less than CHR

No cytogenetic response

N/A

+12 months Less than CCyR Less than partialcytogenetic response

Less than MMR

+18 months Less than MMR Less than CCyR N/A

Any time Cytogenetic clonal evolution § Loss of CHR * Rise in BCR-ABLtranscript levels

Loss of MMR § Loss of CCyR * * Chromosomeaberrations inPh cells

Kinase domain mutation # Kinase domain mutation ##N/A, not applicable; CHR, complete hematologic response; CCyR, complete cytogenetic response;MMR, major molecular response;§ To be confirmed on two occasions unless associated with loss of CHR or CCyR;* To be confirmed on two occasions unless associated with progression to accelerated phase/blastcrisis;* * To be confirmed on two occasions unless associated with loss of CHR or progression toaccelerated phase/blast crisis;# Low level of insensitivity to imatinib; ## High level of insensitivity to imatinib

43

Aims of the study

The aim of this study was to assess the clinical significance of novel prognostic factors inthe treatment of CML during the advent of tyrosine kinase inhibitors.

In detail, the specific aims of this study were:

1. To compare the efficiency and correlation of molecular cytogenetic (high mitotic indexmetaphase-FISH) and molecular genetic (RQ-PCR) techniques in monitoring MRD andpresent a model for converting the laboratory specific MRD data to the International Scale

2. To investigate the predictive value of metaphase FISH technique in detecting Ph+minimal residual cells for CML patients after the allogeneic HSCT

3. To determine the impact of der(9) deletions in the disease course and treatmentresponse after allogeneic HSCT

4. To study whether bone marrow lymphocytosis is a prognostic marker for cytogenetic ormolecular response to imatinib treatment

5. To define the mutation spectrum BCR-ABL kinase domain in Finnish and NorwegianCML patients resistant to imatinib.

44

Materials and methods

1. Patients

The Study I comparing different follow-up techniques included altogether 96 CMLpatients whose MRD level was investigated with various techniques after alloHSCT orduring imatinib treatment. The patients had been treated in Helsinki University CentralHospital or in Turku University Central Hospital.

Both Studies II and III consisted of a total of 102 (II) or 110 (III) CML patients whounderwent an alloHSCT at Helsinki University Central Hospital between the years 1990and 2003. Bone marrow aspirates were taken after alloHSCT for follow-up studies (II) orbefore transplantation for determination of der(9) deletion status (III).

The patient population investigated in Study IV consisted of a total of 37 adult CMLpatients treated in the Helsinki University Central Hospital. All the patients were inchronic phase and received standard dose of imatinib as a first-line therapy or as a second-line treatment after hydroxyurea or interferon (7 patients).

The Study V characterizing the BCR-ABL mutation spectrum in two Nordic CMLpatient populations composed of a total of 77 CML patients (49 Norwegian, 28 Finnishpatients) resistant to imatinib. The classification of imatinib primary and secondaryresistance was defined after adjusted recommendations of European LeukemiaNet 82 andis shown in Table 5.

Table 5. Definitions for imatinib primary and secondary resistance in Study V.

Resistance type Definition

Primary, complete No cytogenetic response at 6 months (>95% Ph+ cells), or

No partial cytogenetic response at >12 months of therapy

(>65% Ph+ cells in bone marrow)

Primary, partial Partial, but not complete cytogenetic response at 12 months of therapy(1-65% Ph+ cells in bone marrow)

Secondary Loss of complete or major cytogenetic response;

Loss of hematologic response, or progression to accelerated phase orblast crisis

Other Does not fulfill any of the criteria above

45

2. Methods

2.1. Cell culture (I-V)

Bone marrow aspirates were taken for cytogenetic (conventional G-banding or FISH)analyses. Cell culturing was performed according to standard methods as previouslydescribed 179. Briefly, bone marrow cells (20x106 nucleated cells) were cultured overnightfor 17 h at 37oC in 5% CO2 incubator in 50 ml flasks within 10 ml culture mediumincluding 2 ml of fetal calf serum and of 8 ml RPMI medium containing 1% L-glutamine,1000 IU streptomycin and 1000 IU penicillin (Gibco, Invitrogen Corporation). Anelongated 17 hour exposure to colcemid (0.1 g/ml) was used to obtain maximum numberof metaphases. Harvesting was done with hypotonic solution (0.075 M KCl, 20 min+37 C) and fixation with freshly prepared methanol: acetic acid fixative (3:1). Thechromosome preparations were done by dropping the cell suspension onto warmmicroscope slides in a humidified (50%) conditions. The sufficient spreading of thechromosomes was checked under a phase microscope and the technique of making thepreparations was adjusted if needed. Metaphase-FISH preparations were done in the sameway as in standard cytogenetics but the cell density on the slides was higher than inpreparations used for standard karyotyping.

2.2. Conventional cytogenetic analysis (I-V)

Conventional karyotyping of the CML samples was performed with standard G- bandingby using trypsin – Giemsa technique 303. A total of 20 mitotic cells were analyzed by usingthe Ikaros Karyotyping System software (MetaSystems GmbH, Altlussheim, Germany).The karyotypes were assigned according to the international system for human cytogeneticnomenclature 304.

2.3. Fluorescence in situ hybridization (FISH) (I-IV)

The FISH probes used in the studies

Whole chromosome painting probe specific to chromosome 22 or locus-specific probemixture specific for BCR and ABL genes were used for detection of Ph positive minimalresidual cells (I, II, IV) or for identification of der(9) deletions (III). Chromosome 22painting probe was a commercial, fluorescein isothiocyanate (FITC) labeled product(Cambio Ltd, Cambridge, UK). The locus-specific LSI® BCR-ABL Dual Color DualFusion Translocation Probe was labeled with Spectrum Green™ (BCR) and SpectrumOrange ™ (ABL) and purchased from Vysis (Downers Grove, IL, USA). Additionalprobes were used for complementing the interpretation of ambiguous results (III). Thesewere LSI® 9q34 labeled with Spectrum Aqua™ (Vysis), rhodamine/ dGreen –labeledt(9;22) D-FISH™ Translocation DNA Probe and digoxigenin- and biotin-labeled M-bcr/abl Translocation DNA probe that was used for the exclusive detection of BCR-ABL

46

fusion (Appligene Oncor®, Qbiogene Illkirch Cedex, France). The hybridizations andpost-hybridization washes were performed according to manufacturers’ instructions orwith modifications listed below.

Slide pretreatments (I, III-IV)

Fresh cytogenetic preparations made from the stored cell suspensions on previous daywere pre-treated by incubating the slides in 0.01 N HCl containing 20 l pepsin (20mg/ml) for three minutes at +37 C, rinsing in PBS for three minutes and then proceedingaccording to the FISH protocol.

The pretreatment of archival G-banded preparations was performed as described 305,with minor modifications. Briefly, Entellan (Merck, Darmstadt, Germany) mounted slideswere soaked in toluene for 3 to 7 days at room temperature until the cover slipsspontaneously detached. The slides were rinsed in fresh toluene and immersed in 100%,96% and 70% ethanol series, 5 minutes each, and air dried. After drying the slides werefixed in a cold (+4 C) buffered formaldehyde-acetone fixative (10 mg Na2HPO4, 15 mldistilled water, 33.75 ml acetone and 12.5 ml formaldehyde) for one minute, washed underrunning cold tap water for two minutes and air dried again. Then the slides were incubatedin 2xSSC/0.2% Tween 20 solution for 2x 15 minutes at +42 C, washed under runningwarm (35-40 C) tap water for two minutes, and air dried gently. Then the slides wereincubated in 0.01 N HCl/ 250 l pepsin (20 mg/ml) pepsin for three minutes at +37 C andthen rinsed in PBS for another three minutes.

FISH protocol for locus-specific probes

The protocol used for locus-specific FISH was adopted from previous works 306-307. Theslides were incubated in a coplin jar containing 2x SSC at +70 C for 30 minutes in a waterbath. The coplin jar was taken out from the water bath and let cool down at roomtemperature for 20 minutes, after which the slides were transferred to 0.1x SSC for oneminute at room temperature. The slides were denatured in 0.07N NaOH for one minute atroom temperature. After the denaturation the slides were incubated in cold (+4 C) 0.1xSSC and 2x SSC for one minute each and finally dehydrated in 70%, 85% and 100%ethanol series, one minute each, and air dried. The denaturation of the probe mixture,hybridization and post-hybridization washes were performed according to themanufacturers' instructions. The slides were mounted counterstained with Vectashield®mounting medium with DAPI (4’,6-diamidino-2-phenylindole-dihydrochroride)counterstain (Vector laboratories, Inc. Burlingame, CA, USA).

Analysis

For minimal residual disease analysis (MRD), a median of 792 (I) 996 (II), and 525 (IV)mitotic cells were analyzed. In study III, the number of analyzed metaphases was lower(median 31), since der(9) deletion is regarded as occurring simultaneously to Phtranslocation, not as a secondary event and therefore is not assessed as an MRD setting.The normal and derivative chromosomes 9 were recognized both by the normal red ABL

47

signal and the fusion signal (or abnormal variations thereof) in 9q34, and by stronglyfluorescent heterochromatin block in 9q near the centromeric region. Image acquisitionand analysis was performed using a Zeiss Axioplan 2 imaging microscope and the ISISdigital image analysis software (MetaSystems GmbH, Altlussheim, Germany) or a LeicaDMRB microscope and the Cytovision software (Newcastle Upon Tyne, UK).

2.4. Sample preparation, RNA extraction and the reverse transcription reaction (I,IV-V)

Total RNA was extracted from mononuclear cells from bone marrow or peripheral bloodsamples. Bone marrow or peripheral blood samples were collected to cell preparationtubes (BD Vacutainer® CPT™, Becton Dickinson New Jersey, USA) that enable theseparation of mononuclear cells by centrifugation. The blood volume collected was 2x 8ml and bone marrow volume 2x 4 ml, respectively. Centrifugation (1600xg, 30 minutes atroom temperature) was performed within 30 minutes of sample collection to segregatemononuclear cells from granulocytes including eosinophils containing eosinophil derivedneurotoxin, which is the major source of leukocyte RNase activity 308. This enabledstandard sample shipment without significant loss in RNA yield. A total of 6-10 x106

mononuclear cells were used for RNA extraction using RNeasy Mini Kit (Qiagen, HildenGermany) according to manufacturer’s instructions. The reverse transcription reaction wasperformed according to standardized protocols published by the EAC program 184. Onemicrogram of total RNA was reverse transcribed using 100 U of MMLV enzyme(Amersham Biosciences, Little Chalfont, UK) with 25 M of random hexamers(Amersham Biosciences) in a final volume of 20 l. After the reaction the cDNA wasdiluted with 30 l of water.

2.5. Real time quantitative polymerase chain reaction (I, IV-V)

Real time quantitative polymerase chain reaction (RQ-PCR) assays for detection ofresidual BCR-ABL transcripts, including the primer and probe sequences used in thereactions were performed according to the standardized protocols of the EAC program 184.Five micro liters corresponding to 100 ng of cDNA was used in the real time quantitativePCR reactions. The 1x Taqman® Universal Master Mix reagent (Applied Biosystems,Foster City, USA), 300 nM of each primer and 200nM of Taqman probe were used in thefinal reaction volume of 25 l. The PCR reactions were performed on an ABI 7700platform (Applied Biosystems). The reactions consisted of 50 amplification cycles. Thebaseline was set between cycles 3-15 and the threshold at 0.1 within the exponentialgrowth region of the amplification curve.

The beta glucuronidase (GUS) was used as the reference gene to normalize thevariability of the RNA quality and the reverse transcription reaction efficiencies betweendifferent samples 185. Absolute quantification of the transcripts was obtained usingcommercial plasmid standards (Ipsogen, Marseille, France). For follow-up samples thelog10-reduction value as compared to the median diagnostic baseline was calculated usingthe formula: 0-[log10(median of diagnostic BCR-ABL/GUS ratio) – log10(follow-up BCR-ABL/GUS ratio)]. Logarithmic reduction of the residual disease was calculated against the

48

laboratory median BCR-ABL/GUS value of a total of 27 (peripheral blood, median ratio0.35) and 32 (bone marrow, median ratio 0.34) pretreatment samples, respectively.Logarithmic decline in respect to the median values of EAC were also calculated asindicated in the article of Gabert et al. (0.22 for peripheral blood and 0.12 for bonemarrow, respectively) 184. The level of sensitivity of the PCR assay was calculated insamples that had undetectable levels of residual BCR-ABL transcripts.

2.6. Bone marrow morphological analysis and immunophenotyping (IV)

Bone marrow aspirate samples were taken according to normal clinical treatmentprotocols usually every three months during imatinib therapy. Two representative smearpreparations from the samples were stained with May-Grünwald-Giemsa staining. Onehundred cells were calculated from four microscope fields per preparation, i.e. a total ofeight fields (800 cells) were evaluated in a brightfield microscope equipped with 100xobjective and 10x oculars. The percentages of lymphocytes were based on the meannumber of lymphocytes in these eight fields. The upper limit for normal bone marrowlymphocyte count was regarded as 24% of the nucleated cells 309.

Immunophenotyping was done using a panel of monoclonal antibodies againstfollowing cell surface antigens: CD3, CD4, CD5, CD7 (eBioscience, San Diego, CA,USA), CD8, CD11c, CD14, CD16, CD19, CD20, CD25, CD34, CD38, CD16/56, CD45,CD56, CD57, CD117 (DAKO, Glostrup, Denmark), CD133 (Miltenyi Biotech, BergischGladbach, Germany), CD206, TCR- /ß, TCR- , and kappa and lambda light chains(DAKO). Dendritic cells were analyzed using antigens CD303, CD141 and CD1cidentifying plasmacytoid dendritic cells, type-1 myeloid dendritic cells, and type-2myeloid dendritic cells with the blood dendritic cell enumeration kit (Miltenyi Biotech).FoxP3 antibody (clone PCH101, eBioscience) and CD25 staining were used forcharacterization of regulatory T-cells. Five samples from CML patients taken at the timeof diagnosis were used as controls. The flow cytometric analysis was performed using theBD FACSCalibur™ (BD Biosciences, San Jose, CA USA) system. A total of 1-5 x 105 ofcells were analyzed depending of the cell type. The data was analyzed with Winlist™ 6.0(Verity Software House, Topsham, ME, USA) or FACSDiva™ 4.1 (BD Biosciences)programs. The control values for normal bone marrow B cell compartment were obtainedfrom a study performed by BIOMED-1 Concerted Action 310.

2.7. BCR-ABL kinase domain mutation analysis (V)

Total RNA was extracted from the mononuclear cells of peripheral blood or bone marrowsamples and reverse transcribed to cDNA according to EAC protocols as described inchapter 4.2.4., without diluting the cDNA preparation with 30 l of water. BCR-ABLfusion transcript was first amplified from 2 - 5 l of cDNA with primers (nM) indicated inTable 6 using Phusion™ DNA polymerase with GC Buffer (Finnzymes, Espoo, Finland).After agarose gel electrophoresis the PCR product was diluted (1:1000 or 1:100)depending on the intensity of the amplified BCR-ABL fragment on the gel and on theabsolute number of BCR-ABL copies in simultaneous RQ-PCR assay. The diluted PCRproduct was then used as a template for three partially overlapping nested/seminested PCR

49

reactions (fragments B, C and D, Table 6) covering the kinase domain (amino acidresidues 209-498). These PCR products were then purified (QIAquick PCR purificationkit, Qiagen, Hilden Germany) and sequenced in both directions using the same primers. Ifmore than one band of the expected size was observed on the gel, both bands were cut outof the gel, purified separately with QIAquick Gel extraction kit (Qiagen, Hilden Germany)and sequenced in both directions. The Norwegian CML patient samples were analyzed asdescribed by Gruber et al. 2006 311 and by further expanding the region with another set ofprimers. In addition, single samples were cloned into a pCR 2.1 vector.

Table 6. The primer sequences, expected amplicon size, primer binding sites and referencesfor primers used in the KD mutation screening assays of Finnish imatinib resistantCML patients.

PCRreactions

Ampliconsize bp,

(b3a2 / b2a2)

Primer bindingsite

Primer sequences (5´- 3´) Ref.

BCR-ABL 1579 / 1502 BCR exon 13

ABL exon 9/10

TGACCAACTCGTGTGTGAAACTC

TCCACTTCGTCTGAGATACTGGATT

312

Nested

PCR

B 393 ABL ex 4-6 CATCATTCAACGTGTGCCGACGG

GTTGCACTCCCTCAGGTAGTC

313

C 492 ABL ex 4-7 GAAGAAATACAGCCTGACGGTG

CGTCGGACTTGATGGAGAA

313

D 483 ABL ex 6-9 GATCTCGTCAGCCATGGAGT

reverse as in BCR-ABL PCR

2.8. Statistical calculations

Correlations between different follow-up analyses were defined by calculating theSpearman rank order correlation (rs). The statistical significance of differences wasassessed with Mann-Whitney U or Kruskall-Wallis nonparametric tests for continuousvariables and with Fisher’s Exact test for categorical variables. The results wereconsidered statistically significant at p 0.05 (I, IV).

In Study III, overall survival was defined from date of transplantation until date ofdeath or of last follow-up. Leukemia-free survival was defined from date oftransplantation until date of death or relapse, or date of last follow-up. Relapse-free timewas defined from date of transplantation until date of relapse or date of last follow-up.Differences in diagnostic or pre-transplant characteristics were assessed with the Fisher'sExact Mann-Whitney U tests. Survival calculations were based on Kaplan-Meierestimates. Differences in significance were tested with the log-rank test. Survival datafrom the two groups of patients were also used for constructing a Cox proportional hazard

50

model. Variables considered were der(9) deletion status, age at the time of transplantation,patient sex, percentage of blasts in peripheral blood and platelet count at the time ofdiagnosis, donor-recipient sex mismatch (female to male), donor type (sibling or matchedunrelated), disease stage at the time of transplantation and time from diagnosis totransplantation. Only the last three variables had a p value less than 0.20 in univariateanalyses and were included in the multivariate analysis along with the deletion status. Abackward stepping procedure was used to derive the most significant model. The hazardratio of the deletion status as a univariate analysis was compared to the hazard ratiosfollowing adjustment for the most significant model. All calculations were done usingSPSS software (versions 11.0, 14.0 and 14.0.1 for Windows, SPSS Inc., Chicago, IL,USA).

3. Ethical permissions

Approvals for patient sample collection and laboratory analysis were obtained fromHUCH ethical committee (Dnro 361/E5/02 and 49/E5/07). Many patients were treatedaccording to clinical drug study protocols with appropriate competent authority and ethicscommittee approvals.

51

Results

1. Assessment of minimal residual disease in CML (I, II)

1.1. Comparison of molecular cytogenetic and molecular genetic techniques indetecting minimal residual disease (I)

A total of 291 bone marrow high-mitotic index metaphase FISH assays, 173 peripheralblood and 222 bone marrow RQ-PCR analyses were performed. The total number of RQ-PCR tests also included 27 peripheral blood and 32 bone marrow samples that were takenat the time of diagnosis. The median number of analyzed metaphases in FISH analyseswas 540, and for the actual MRD setting (none or <1% of residual cells) the median was792 mitotic cells (Table 7). Peripheral blood and bone marrow RQ-PCR assays gave apositive result in a total of 101 in 118 follow-up samples, respectively. The majority of theRQ-PCR negative samples were taken from patients who had undergone alloHSCT.

The RQ-PCR samples taken at the time of diagnosis were used for determining themedian diagnostic BCR-ABL/GUS ratio that for peripheral blood samples was 35% (27samples) and for bone marrow 34% (32 samples). No statistical difference was observedbetween the sample types. Likewise, no difference in the relation of bone marrow BCR-ABL/GUS transcript levels and prognostic factors such as Sokal or Hasford scores, bonemarrow of peripheral blood cell counts, or imatinib response (when applicable), wasobserved.

Table 7. Metaphase FISH analyses in 291 follow-up samples of 82 patients in Study I. Themedian number of analyzed metaphases in samples with none or <1% of residualcells (MRD setting) is marked with an asterisk.

Cytogenetic results(% of Ph positive cells)

Number of samples (%) Median number of analyzedmetaphases (range)

0% 167 (57%) 804 (6-1300)

<1% 35 (12%) 792 (178-1028)

1-34.9% 48 (17%) 200 (41-1013)

35-95% 24 (8%) 50 (20-360)

>95% 17 (6%) 40 (10-102)

Total 291 (100%) 540 (6-1300)

MRD* 202 (62%) 792* (6-1300)

52

The Spearman rank order correlation coefficient (rs) between concurrent FISH andperipheral blood RQ-PCR MRD positive sample pairs (n=62) was 0.769 (p<0.001).Simultaneous FISH and bone marrow RQ-PCR analyses (altogether 68 positive samples)also correlated well with each other (rs 0.91, p<0.001). Peripheral blood RQ-PCR stilldetected BCR-ABL fusion transcripts in 30 and bone marrow RQ-PCR in 44 samples thataccording to simultaneous metaphase FISH analyses were considered representingcomplete cytogenetic response. The logarithmic decline from the median diagnosticbaseline in these samples was in most cases more than 2.3 log units in peripheral bloodand >2.6 log units in bone marrow samples (Figure 15). No metaphase FISH positive, RQ-PCR negative cases were detected.

Figure 15 The correlation of positive follow-up samples between bone marrow metaphase FISHand RQ-PCR assays performed from peripheral blood (gray line and circles) or bonemarrow samples (dashed black line and triangles) in Study I. The horizontal linesrepresent the amount of residual disease detected by RQ-PCR in metaphase FISHnegative samples (blood with gray and bone marrow with black color, respectively).

Concurrent peripheral blood and bone marrow RQ-PCR data was available from 104sample pairs, altogether 66 of them being positive with a correlation of 0.82 (p<0.001).Both samples were negative in 25 cases, whereas 13 sample pairs gave discordant results.In ten peripheral blood samples that were RQ-PCR negative the corresponding bonemarrow RQ-PCR sample still detected residual transcripts and in three samples thesituation was the other way round. The level of MRD detected was between -3 and -4 logunits indicating only marginal residual disease. The majority of samples had undetectablelevel of BCR-ABL transcripts with RQ-PCR, were from patients that had undergonealloHSCT.

53

1.2. Model for converting laboratory specific data to the International Scale (I)

The samples taken at the time of CML diagnosis were analyzed with RQ-PCR. Themedian values of the BCR-ABL/GUS transcript ratio (35% for peripheral blood and 34%for bone marrow) were used for converting the RQ-PCR data to the International Scale.The baseline values were set as 35% and 34% and a three-log reduction accordingly to0.035% and 0.034% for peripheral blood and bone marrow, respectively. This produced aconversion factor of 2.86 for both sample types. The data was also compared to theInternational Scale by using distinct standardization samples prepared at the RQ-PCRreference laboratory in Mannheim. Mannheim laboratory also calculated the preliminaryconversion factor to the International Scale, which was 1.8446.

In addition, the data obtained from bone marrow high mitotic index metaphase FISHwas used for building a regression model for predicting the frequency of Ph chromosomepositive mitotic cells in bone marrow based on the values on the International Scale. Thevalues based on the analysis are indicated in Table 8.

Table 8. Correspondence of the International Scale to the percentage of Ph positive cells inbone marrow as assessed by FISH. The percentages of Ph positive cells werecalculated according to the equation shown in Study I Supplementary data, Figure3.

International Scale Ph positive cells in bonemarrow by metaphase FISH

Log % %

0.0 100 81.1

-0.3 50 46.8

-1.0 10 13.0

-1.3 5 7.5

-2.0 1 2.1

-2.3 0.5 1.2

-3.0 0.1 0.33

-3.3 0.05 0.19

-4.0 0.01 0.05

1.3. The effect of sample source on BCR-ABL transcript levels

The transcript levels were very similar in bone marrow and peripheral blood. However,when individual patient MRD values of concurrent blood or bone marrow RQ-PCR assayswere compared, two groups of patients appeared with a consistent difference between theblood or bone marrow values in repeated follow-up samples. One group had consistentlyhigher MRD levels in peripheral blood than in the bone marrow and the other group hadthe opposite situation (Figure 16). Similar results were found when the peripheral bloodRQ-PCR data was compared to bone marrow FISH data, reflecting a true difference in

54

relative tumor burden. In a few patients, the difference was substantial (>2 logs, data notshown), but for most patients it was in the range of ±0.5 log.

Figure 16 Relation of bone marrow and peripheral blood BCR-ABL/GUS transcript ratios infour representative patients in Study I.

1.4. Minimal residual disease after allogeneic hematopoietic stem cell transplantation(II)

A total of 361 bone marrow follow-up samples of 102 transplanted CML patients wereanalyzed. The overall follow-up time of the patients was 2-111 months, median 28 monthsafter transplantation. A median of 996 (range 10 – 2148) mitotic cells were analyzed usingmetaphase FISH technique. Residual cells were observed in altogether 33 patients (32%)after alloHSCT. Seventeen (52%) of them had less than one percent of Ph positive residualcells, which became undetectable in 12 (71%) of them without any intervention exceptwithdrawal of immunosuppression as routinely scheduled. Nineteen patients experiencedcytogenetic relapse during the first year after alloHSCT. For further description, thepatients were divided in two groups depending on whether minimal residual cells wereseen during the first four months after alloHSCT or not.

Residual disease detected within the first four months after alloHSCT

Residual cells were detected in single or consecutive samples during the first four monthsafter transplantation in 18 patients (17.6%). In 13 of them cells were detected atfrequencies below 1%. During the first year after transplantation the residual cells becameundetectable without any intervention in eight patients. In five patients residual cells were

55

first observed at a frequency of less than 1%, but after four months the number ofabnormal cells increased beyond the frequency of 1% indicating metaphase-FISH relapse.Five patients had more than 1% of residual cells when first detected.

Residual cells were detected from 3 weeks to 8 months (median 2.5) months prior todetection of cytogenetic relapse evident by conventional karyotyping. The relapsedpatients were treated with interferon-alpha, DLI, chemotherapy and with imatinib.

No minimal residual cells detected during the first four months after alloHSCT

In the other group of 84 patients no residual cells were detected in the bone marrowsamples during the first four months after alloHSCT. Most of the patients (altogether 69,67.6% of the total patient population) achieved and also remained in complete cytogeneticand hematologic remission. No minimal residual cells were detected in their samples atany time of the follow-up.

Residual cells emerging later than four months after transplantation were observed in15 patients (14.7%). Four patients showed less than 1% of Ph positive cells at 12 monthsafter alloHSCT in one or more samples. In these patients the residual cells disappearedwhen immunosuppression was discontinued as routinely scheduled, and the patientsstayed in complete remission 27-111 months after transplantation.

In nine patients no residual cells were detected in samples preceding FISH orcytogenetic relapse, which was evident within one year after alloHSCT. The therapyadministered to the relapsed patients was discontinuation of immunosuppression,administration of interferon, imatinib or DLI. Two patients (2.4%) relapsed late, 54 and 59months after transplantation, respectively.

2. The frequency and influence of der(9) deletions on the outcome ofallogeneic hematopoietic stem cell transplantation (III)

Deletions in derivative chromosome 9 were found in altogether 18 patients (15% of allpatients). In 11 patients the deletions spanned both to 5´ABL and 3´BCR sequences inder(9). The deletion of 5´ABL region was observed in six patients and the rare deletion of3´BCR region only in one CML patient. In each patient with a deletion in der(9), thedeletion could be seen in every Ph positive metaphase. If a relapse sample was availablefor FISH studies, it gave congruent results with the diagnostic or pre-transplantationsample: no deletion in der(9) was seen in relapse if the deletion had not been identified inearlier samples. These findings give support to the hypothesis that the deletions areprobably not related to disease progression. No deletions were observed in any of the ninepatients with variant Ph translocation. The Ph negative, BCR-ABL positive patient in thecurrent cohort showed two fluorescent signals when studied with the 9q34 probe, one inchromosome 9q, the other in chromosome 22, as a sign of insertion without deletion.

56

Disease characteristics at diagnosis and before transplantation according to deletionstatus

No clinically significant differences were observed at the time of diagnosis in patientswith or without deletions. Before alloHSCT, the transplantation outcome-relatedprognostic variables, like the EBMT risk score, were evenly distributed between patientswith or without deletions. However, the cytogenetic responses to an interferon-alpha -containing therapy tended to be poorer in patients with deletions, though the differencewas not statistically significant.

Transplantation outcome by deletion status

As the median follow-up time was not different in patients with deletions or withoutdeletions, the comparisons between deletion status groups are relevant. The total relapserate during follow-up was of the same frequency in patients with or without deletions(17% and 22%, respectively, p=0.76). Likewise, the Kaplan-Meyer outcome estimates foroverall survival, transplant-related mortality, leukemia-free survival and relapse-free timewere nearly identical in the deletion status groups (Figure 17). Multivariate analysis with abackward stepping model and using known factors associated with overall survivalresulted in the elimination of the deletion status at the first step, indicating that it wasaffecting the survival the least in the model. When the deletion status was forced in themultivariate model along with significant prognostic factors (donor type, disease stage atthe time of transplantation and time from diagnosis to transplantation) the adjusted hazardratio for deletion status was 0.75 (95% confidence interval 0.31-1.83) as compared tounivariate hazard ratio of 0.85 (0.36-2.04).

57

Figure 17 Transplantation outcome by deletion status in Study III. (A) Overall survival, (B)transplant-related mortality, (C) leukemia-free survival and (D) cumulative relapserate by der(9) deletion status.

3. Factors associated with different responses during imatinib treatment(IV, V)

3.1. Favorable: bone marrow lymphocytosis predicts optimal response to imatinib(IV)

A total of 37 CML patients in chronic phase were enrolled in this study In 18 patients thetherapy response was regarded as optimal, in seven patients as suboptimal and in eightpatients as failure. Four patients were not classifiable in any of the above mentionedgroups due to too short a follow-up time. The median follow-up time during imatinibtherapy was 18 months. No statistically significant differences were observed between theresponse groups and blood cell counts, spleen size or patient age at the time of diagnosis.The median follow-up time during imatinib therapy and the mean doses of imatinib didnot differ between various response groups.

BA

C D

58

Morphological changes in bone marrow aspirates

All patients, except one failure patient, achieved complete hematological response by 6months of imatinib treatment. In some patients, increased amounts of lymphocytes wereobserved in follow-up samples during imatinib therapy. The morphology of lymphocytesvaried in size and shape and also included immature forms. At the time of diagnosis noneof the patients had increased amounts of lymphocytes in the bone marrow as the meanpercentage of lymphocytes was 3%. After three months of imatinib therapy, the bonemarrow cellularity had decreased and was normal in 36/37 patients. The medianpercentage of lymphocytes was 17%, but there was a marked variability between differentpatients. Two groups in relation to the amount of lymphocytes were distinguished: patientswith clearly increased lymphocyte counts and patients with normal lymphocyte counts.

Flow cytometric analyses

The immunophenotyping of the bone marrow lymphocytes was assessed with flowcytometry. Based on immunophenotyping, the lymphocytes detected in optimallyresponding patients showed no expansion of only one cell type but consisted of T-, B-, andNK cell populations as in normal samples. At the time of diagnosis, the CML patients haddecreased number of B cells in the bone marrow when compared to normal control values(7% of lymphocytes vs. 20% and no immature or maturating forms were detected. Patientswith suboptimal or failed response to imatinib also had decreased number of B cells in thebone marrow, whereas patients having optimal response and bone marrow lymphocytosishad normal or increased amounts of B cells and immature forms were also detectable. Inmature B cells the kappa and lambda light chain expression was polyclonal. In T cells theCD4/CD8 ratio was normal and the proportion of regulatory T cells (Tregs) in bonemarrow was comparable in different groups. The number of myeloid and plasmacytoiddendritic cells was decreased in samples taken at the time of diagnosis and in poorlyresponding patients, whereas the numbers were comparable to normal levels in patientswith optimal response to imatinib treatment. The flow cytometric data is presented inTable 9.

59

Table 9. The flow cytometric data on immunophenotyping the bone marrow samples of 21CML patients in Study IV. The data presented comprises of samples taken at amedian of 12 months of imatinib therapy (range 6-30 months for optimal and 3-24months for suboptimal response or treatment failure, respectively).

Diagnostic phasesamples (n=5)

Optimalresponse (n=11)

Suboptimal response/failure (n=5)

Median % (range) Median % (range) Median % (range)Total BM WBC count * 181 (149-314) 31 (5-51) 23 (7-83)Lymphocytes 2 (1-3) 18 (5-22) 11 (5-18)Monocytes 2 (0.3-5) 5 (4-8) 4 (2-9)Granulopoietic cells 89 (85-95) 66 (55-75) 74 (60-84)Erythropoietic cells 1 (1-5) 12 (5-14) 10 (5-16)BM lymphocytes

T cells (CD3pos) 61 (51-72) 55 (32-65) 68 (50-84)NK cells(CD3negCD16/56pos) 15 (5-34) 15 (7-28) 9 (6-17)B cells (CD19) 6 (2-13) 24 (14-30) 15 (4-37)

T cellsCD8pos 39 (27-63) 43 (35-56) 40 (29-57)CD4pos 52 (31-70) 47 (33-59) 55 (33-67)CD57pos 29 (10-46) 13 (6-29) 13 (7-31)TCR /ß 93 (72-98) 96 (82-99) 92 (75-97)TCR / 7 (2-28) 4 (1-18) 8 (3-24)Treg 1 (1-4) 1 (1-2) 1 (0.2-2)

B cellsMature 96 (80-100) 71 (46-86) 80 (50-100)Maturating 0 (0-15) 24 (6-42) 14 (0-33)Immature 0 (0-0) 5 (3-15) 2 (0-8)Kappa 54 (45-61) 60 (48-62) 54 (44-63)Lambda 39 (31-48) 39 (36-48) 43 (39-53)

Dendritic cells(of total WBCs)

Myeloid, type1 0.00 (0-0.03) 0.11 (0.10-0.19) 0.09 (0.07-0.14)Myeloid, type2 0.00 (0-0) 0.02 (0.02-0.04) 0.01 (0-0.02)Plasmacytoid 0.01 (0-0.03) 0.11 (0.09-0.27) 0.11 (0.05-0.20)

*) Total BM WBC count is marked as absolute numbers (109/l); the other variables are reported aspercentages. BM, bone marrow; WBC, white blood cells; TCR /ß, T cell receptor alpha/ betachain; TCR / , T cell receptor gamma/delta chain; Treg, regulatory T cell.

60

Predictive value of lymphocytosis to cytogenetic and molecular responses

Patients having either optimal, suboptimal or failure response to imatinib treatment haddifferent amounts of bone marrow lymphocytes at three months and six months of therapythe optimal responders having a median of 25% and 26% of lymphocytes compared tosuboptimal and failure patients with 19% and 11%, and 10% and 11% at three and sixmonths of therapy, respectively (p<0.05). To exclude random variations in lymphocytecounts, only patients who had had increased lymphocyte count in at least two bonemarrow samples during 12 months of follow-up, were regarded as patients withlymphocytosis. With this specification, 56, 29 and 0% of patients with optimal,suboptimal and failure imatinib response had detectable bone marrow lymphocytosis,respectively (p<0.005, Figure 18).

Prognostically bone marrow lymphocytosis detected in three months of imatinibtherapy indicated the probabilities of 83% for the patients to reach CCyR in 12 monthsand 89% for MMR in 18 months of treatment, respectively. If a patient had reached atleast partial cytogenetic response ( 35% of Ph+ cells) in three months and simultaneouslyexhibited bone marrow lymphocytosis, the probability of reaching MMR in 18 monthswas 100% (p<0.001). The absence of both of these factors also resulted in the lack ofMMR in 18 months of therapy in all patients. The positive predictive values of moreestablished prognostic parameters, such as Sokal or Hasford scores, were clearly lowerand not significant.

Figure 18 The distribution of bone marrow lymphocytosis among different response groups toimatinib treatment in Study IV.

61

3.2. Unfavorable: BCR-ABL kinase domain mutations in patients resistant toimatinib (V)

Point mutations in the BCR-ABL kinase domain were found in a total of 32 out of 77(42%) CML patients. Altogether 18 different mutations were detected, four patientshaving two point mutations (Figure 19). All the mutations were located in the amino acidresidues previously known to confer resistance to imatinib. The most common mutationswere M351T and G250E, the first one being observed seven times, the other in five cases.The same residue had a different mutation in two cases: E255K and E255V (both in thesame patient), and F359V and F359I (three patients, two having a F359V and one patientwith a F359I). The P-loop and the catalytic domain were the most frequently mutatedregions in the kinase domain, as 67% of the detected mutations localized into theseregions, respectively. No patients with the multiresistent T315I mutation were detected.

Figure 19 The spectrum of point mutations detected in the BCR-ABL kinase domain in imatinibresistant CML patients in Study V. The black stars represent patients with theparticular mutations. The smaller grey stars indicate the double mutations detectedsimultaneously with some other mutation. P, phosphate binding (P-) loop; IB,imatinib binding region; C, catalytic domain; A, activation loop.

The frequency of point mutations according to the resistance type is presented in Table 10.Point mutations were detected in both types of resistance. The group “other” includedpatients with suboptimal molecular response, or patients having discordance betweencytogenetic and molecular responses.

62

Table 10. BCR-ABL kinase domain point mutations detected in imatinib resistant patientsaccording to the resistance type.

Resistance type n No of patientswith mutations

%

Primary, complete 23 10 43

Primary, partial 16 8 50

Secondary 19 10 53

Other 19 4 21

Total 77 32 42

3.3. Other sequence variations detected (V)

Additional sequence variations were observed in seven subjects representing 19% of allpositively tested patients. Two patients had a rare BCR-ABL transcript of intermediatelength fusing the first six BCR exons to ABL exons 2-11 (e6a2 transcript). One patientexpressed the e19a2 fusion transcript type. The other patients represented the mostcommon e14a2 (b3a2) or e13a2 (b2a2) transcript types. During the analysis of ABL exons6 to 10, two PCR products of different size were detected after gel electrophoresis in threepatients: one was of the expected size and the other was a smaller one. Separatesequencing of these products indicated the splicing out of exon 7 sequences ( 362-444,out of frame) in the shorter PCR product. In addition, a deletion in conjunction with akinase domain point mutation was detected in two patients: the presence of L248Vinduced a splice site to generate an in-frame deletion in ABL exon 4 ( 248-274) andanother variant joining BCR sequences to ABL exon 4 ( 27-183, out of frame) inconjunction with a F317L mutation.

63

Discussion

1. Assessing minimal residual disease

1.1. Technical aspects of determining the level of residual disease in CML (I, II)

Quantitative monitoring of minimal residual disease in CML is of the utmost importancein the course of current therapeutic strategies. The reduction of >3 logarithm units of BCR-ABL transcript levels within the first 18 months of imatinib treatment is associated with anextended progression free survival. Increasing levels of BCR-ABL transcripts may indicatedevelopment of imatinib resistance 52, 314. Similarly, residual BCR-ABL transcriptsdetected at low level after alloHSCT do not necessarily indicate forthcoming relapse,whereas higher levels of BCR-ABL are more likely to confer a risk of disease recurrence315-316. Since different techniques used for assessing MRD status measure differentvariables, i.e. quantitative expression of BCR-ABL transcripts on a molecular level orpercentage of Ph positive mitotic cells on cytogenetic level, it is necessary to evaluate theconcordance of these methods on simultaneously taken samples.

Bone marrow metaphase FISH with high mitotic index and RQ-PCR assays analyzedfrom simultaneously taken bone marrow or peripheral blood samples had a goodcorrelation. Especially FISH and RQ-PCR tests both performed on bone marrow samplescorrelated particularly well (rS=0.91, p<0.001). The greater sensitivity of RQ-PCR wasevident in approximately 40% of samples, in which FISH indicated CCyR but which werenevertheless MRD positive when studied with bone marrow or blood RQ-PCR. Themedian BCR-ABL reduction in these samples was 3 logarithm units, irrespective of theRQ-PCR sample type. Significant correlation between bone marrow and peripheral bloodanalyses, as well as the superiority of RQ-PCR in detecting low level MRD, has also beenreported by others 181-182, 317.

The selection of reference genes in RQ-PCR assays has varied widely in differentstudies. Recent recommendations for harmonizing the methodology used for monitoringresidual disease in CML regarded three genes as valid for normalizing the RQ-PCR data,namely ABL, BCR and GUS 191. Although ABL was proposed to be used as a calibrator inRQ-PCR assays by the EAC program 185, quantitative monitoring of CML is notstraightforward with this reference gene. The primers for ABL also amplify BCR-ABL,thus preventing the meaningful determination of high BCR-ABL/ABL ratio at the time ofdiagnosis. In addition, co-amplification of ABL and BCR-ABL at higher levels of residualdisease (>10%) affect the linearity of the RQ-PCR assay. In Study I, the GUS was chosenas the reference gene, as it can be used for more accurate determination of diagnostictranscript ratio. A median baseline BCR-ABL/GUS ratio can also be obtained from thepretreatment samples and used in a similar way in evaluating the molecular response asthe median BCR-ABL/BCR baseline value was used in the IRIS study 172.

The median baseline BCR-ABL/GUS ratios 35% and 34% consisted of 27 and 32 pre-treated peripheral blood and bone marrow samples, respectively. The median ratios were

64

clearly higher than the reported EAC median values obtained from a slightly lowernumber of diagnostic samples (22% from 14 peripheral blood and 12% from 15 bonemarrow samples) 184. Therefore, it is important that the median baseline BCR-ABL/GUSratio for inter-laboratory and intra-laboratory use is based on a sufficiently large numberof patients.

RQ-PCR standardization and conversion of the results to International Scale

The most sensitive techniques used quantitative monitoring of minimal residual disease inCML are RQ-PCR methods most often measuring the quantity of BCR-ABL mRNA in thefollow-up samples. However, the RQ-PCR methodologies and choice of reference genesvary between laboratories. This complicates the comparison of results obtained fromdifferent laboratories. Therefore, the published recommendations on performing RQ-PCRdirected at world-wide standardization of the technique are of great importance 190-191.

Due to current unavailability of commercial standardization assays the InternationalScale (IS) has been established by studying samples obtained from a reference laboratoryalready applying the IS and determining a conversion factor that converts the laboratory-specific data into the same scale In Study I, another kind of approach was used inconverting the data into the IS. Since the median baseline value for e.g. peripheral bloodsamples was 35% indicating 100% in the IS, the major molecular response corresponding3-log-reduction of BCR-ABL transcript levels would be 0.035%, indicating 0.01% in theIS. This produced a conversion factor of 2.864 for peripheral blood samples. This methodalso enabled to predict the percentage of Ph chromosome positive cells in concurrentmetaphase FISH assay on the basis of RQ-PCR result on the IS. The reference laboratory-based approach was also applied in this study, producing a preliminary conversion factorof 1.8446. The difference between these two conversion factors may be due to differentleukocyte fractions used as the RNA source, namely mononuclear cells in the patientsamples and total leukocytes in standardization samples obtained from the referencelaboratory. The methods used for RNA isolation were also different. These both factorsmay have an effect on the sensitivity of the RQ-PCR assay. In addition, thestandardization samples consisted of dilutions from only three CML patients. If thesepatients had constant differences in the expression of ABL, BCR or GUS, this it may haveaffected the conversion factors between different reference genes.

Metaphase FISH in defining the level of minimal residual disease

Molecular cytogenetic (FISH) follow-up analyses are also efficient in detecting residualcells during tyrosine kinase inhibitor treatment or after alloHSCT. Even though thesensitivity of the analysis does not reach to the level of RQ-PCR assays, high mitoticindex metaphase FISH still has some advantages. Quantitative molecular follow-upstudies are not always possible for patients with rare BCR-ABL transcript types in routinediagnostic laboratories whereas metaphase FISH provides a comprehensive way ofmonitoring the disease burden irrespective of the transcript – or translocation type.Therefore, a close collaboration between the cytogenetic and molecular geneticlaboratories is warranted before diagnosing a patient as BCR-ABL negative. The detection

65

of hybridization signals on actual chromosomes enables a morphological analysis of themetaphase chromosomes. The method does not cause false positive results and also allowsperforming karyotype analysis and detecting additional chromosome aberrations referringto clonal evolution 318. When cytogenetic response is evaluated only on a standardchromosome analysis of 20 metaphases, it statistically excludes a level of 14% residualdisease (“mosaicism”) with 95% confidence, whereas high mitotic index metaphase FISHanalysis of 1000 metaphases excludes 0.3% of residual disease with the same confidenceinterval 177. Therefore the conclusion of complete cytogenetic response determined withconventional karyotyping may include a significant degree of residual cells. In Studies Iand II the median number of analyzed metaphase cells for MRD setting was 792 and 996,respectively, thus excluding the mosaicism present at frequency of <1%.

Metaphase FISH, as well as conventional karyotyping, requires dividing cells andtherefore a bone marrow aspirate as a sample for analysis. Peripheral blood samplingwould provide a much less invasive method of assessing the disease burden, but the lackof mitotic cells does not allow extensive analyses at chromosomal level. In shortage ofmitotic cells interphase nuclei may also be analyzed with FISH using locus-specificprobes. Correlation of interphase FISH analyses to chromosomal studies has beenevaluated in various works with varying results. When studying samples taken frompatients treated with conventional regimens, the correlation has been very good, but this ismost likely due to higher frequency of BCR-ABL positive cells in the samples 319-320. Thereported correlation of interphase analytics to bone marrow cytogenetics in imatinibtreated patients has been poorer even when using the same sample source (rS 0.40,p<0.0001) 182. Likewise, peripheral blood interphase FISH compared to bone marrowcytogenetics had a weak correlation (r 0.64, p=0.013) in imatinib treated patientpopulation with major discrepancies in several cases. The correlation got better byanalyzing flow sorted peripheral blood neutrophils, but the analysis still produceddiscrepant results in some patients 321. In all, the FISH analysis of interphase cellsespecially in imatinib treated patient samples is not without problems and the detection oflow level Ph positivity is dependent on the probe type, the cut-off level of false positivefindings used in the laboratory and naturally, the expertise of the analyzer.

1.2. Detection of minimal residual disease from a clinical point of view (I, II)

The monitoring of treatment response in CML needs quantitative and sensitive techniquesfor evaluation of low level residual disease. Metaphase FISH analyses require a bonemarrow aspirate as the sample, which is an invasive procedure. In Study I the correlationbetween peripheral blood and bone marrow samples in defining the BCR-ABL transcriptlevels was good, which also has been observed in other studies 181-182. These findingsfavor peripheral blood as the sample of choice in MRD follow-up studies, since peripheralblood samples enable easier and also more frequent monitoring of MRD by RQ-PCR.

Overall in Study I, the residual BCR-ABL transcript levels were very similar in bonemarrow and peripheral blood. However, some patients had a consistent difference betweenthe blood or bone marrow MRD values in repeated follow-up samples. Some patients hadconsistently higher levels of residual disease in peripheral blood than in the bone marrow,whereas other patients had the opposite situation. The dependence of the transcript level

66

on the cell source has been noted earlier 190, but the biological causes remain yet unknown.However, in some patients this difference may have an effect on the MRD estimates,which should be taken into account. Additionally, in these patients the follow-up shouldpreferably be based on one sample type only. Further studies concentrating on thisvariation in BCR-ABL transcript levels are warranted, as it may reflect significantdisparities in CML pathobiology between patients.

Due to lack of world-wide use of the IS in reporting the molecular follow-up data, thecomparability of RQ-PCR results between different laboratories is not straightforward. Inthe future, this constraint will hopefully not be an issue in MRD studies. As the durationof imatinib therapy is getting longer, so does the number of patients whom no BCR-ABLtranscripts can any longer be detected with RQ-PCR 215. However, the level of sensitivitythat each RQ-PCR reaction reaches varies from every run to run depending on the qualityof the sample and efficiency of the reverse transcription and the PCR reactions. The actualexisting amount of low level minimal residual disease in RQ-PCR negative samples alsovaries due to the factors mentioned above. Therefore, in cases which turn out negative inmolecular follow-up studies the term “complete molecular remission” should be avoidedin order not to draw the conclusion of complete eradication of the disease. The expression“BCR-ABL transcripts undetectable” describes the biological situation more accurately 82.

The clinical significance of BCR-ABL fusion transcripts or Ph chromosome positivemetaphases after alloHSCT varies, depending on the level and kinetics of residual cellsdetected after transplantation. In Study II, most of the patients (68%) had no Ph positiveresidual cells detected during the first four months or the entire follow-up time. This is incontrast to studies in which BCR-ABL transcripts can be detected early aftertransplantation in more than half of the patients when studied with more sensitive RQ-PCR technique 315. In Study II, 19 patients had a cytogenetic relapse within the first yearafter alloHSCT. The rising level of MRD was detectable in five of the early MRD positivecases being below 1% when first detected, but exceeding the level of 1% and turning intoan overt relapse. Like also indicated in other studies, low and falling frequencies ofresidual cells are not necessarily a sign of forthcoming relapse, since low level residualcells may disappear as a result of graft-versus-leukemia effect. Follow-up of MRDpositive patients is however warranted to monitor the kinetics of MRD level 175, 316, 322.

2. The clinical and biological significance of der(9) deletions in CML (III)

The clinical impact of der(9) deletions has changed over the years being when firstdetected an adverse prognostic factor and then later turning into a “warning sign” with sofar unclear significance during the era of tyrosine kinase inhibitors. In Study III, theclinical impact of der(9) deletions was evaluated in CML patients after alloHSCT.

Deletions in der(9) were detected in 16% of evaluable patients, which is in line withprevious data 64. At the time of diagnosis, no clinically significant differences wereobserved between the study groups. Prior to alloHSCT, patients with deletions tended tohave a lower cytogenetic response rate to drug therapy containing interferon-alpha,probably reflecting the poorer outcome of these patients with conventional CML therapy.After alloHSCT with a median follow-up time of more than two years, the relapse rate,overall and leukemia-free survival and transplant-related mortality were similar in patients

67

with and without deletions. Previously, in a smaller cohort, the relapse rate after alloHSCTwas higher in patients with deletions than in patients without deletions. However, the rateof relapse in the non-deleted patients was exceptionally low (4%) indicating a potentialuneven distribution of prognostic variables or too short a follow-up time 76.

Biological significance of der(9) deletions

Several mechanisms behind the worse prognosis in der(9) deletion cases to conventionaltherapies have been proposed. Deletions can result in a formation of new fusion genes, butdue to the wide heterogeneity of the localization of the breakpoints this hypothesis seemsunlikely. Der(9) deletion results in a loss of the reciprocal ABL-BCR fusion gene formedin the translocation. The lack of ABL-BCR and presence of der(9) deletion are still notconcordant, as 65% of the ABL-BCR non-expressing patient do not have a der(9) deletiondetectable by FISH 323. When combined with the clinical data, the ABL-BCR expression isnot correlated with reduced survival or shorter duration of chronic phase 323-324. It ispossible that the ABL-BCR protein modulates the activity of the BCR-ABL protein, butthe data on stable ABL-BCR expression at the protein level are yet lacking 64, 325.

Chromosomal deletions can abolish tumor suppressor genes, which when inactivateddue to “the second hit” in the non-deleted allele, change the cells malignant.Haploinsufficiency, a situation in which the reduction of gene dosage causes an aberrantphenotype, is another mechanism contributing to tumor formation. The biologicalconsequence of der(9) deletions can be either of these. The chromosomal regions affectedin der(9) deletions are gene rich and the critical target genes are yet to be identified 64.Der(9) deletions can also reflect general genomic instability causing predisposition ofaccumulating additional genetic changes in the leukemic cell population. The deletionscould then act as a surrogate marker for additional genomic deletions. The biologicaleffect of the deletions though yet unknown are most probably highly complex, potentiallyinvolving several of the mechanisms presented above 69.

The frequency of der(9) deletions in patients with variant Ph translocation

Deletions in der(9) have previously been detected with greater frequency (40%) in CMLpatients with variant Ph translocations 50, 63. This has been considered as an explanationfor the conflicting results obtained from survival analyses 50. However, in Study III, nodeletions in patients with variant Ph translocations were observed. The lack of variant Phtranslocations in patients with deletions in the study material can be a chance finding, asthe expected number of such patients was only four. By the beginning of March 2008 atotal of 19 CML patients with variant translocation are evaluable regarding their der(9)deletion status. Only three patients (16%) have been diagnosed with a deletion, othershaving a signal pattern characteristic of a variant translocation without a deletion. Thus thefrequency of der(9) deletions in variant translocations appears to be similar to the standardtranslocations in Finnish CML patients. The reason to this difference is unknown.However, the small number of deletions could reflect a real and intriguing difference inthe genetic background of CML.

68

The impact of der(9) deletions during the era of tyrosine kinase inhibitors

The advent of first and second generation tyrosine kinase inhibitors has revolutionizedthe treatment of CML and also affected the impact of der(9) deletions as an adverseprognostic marker. Due to somewhat diverse results on the deletion status duringtreatment with tyrosine kinase inhibitors, as reviewed in chapter 3.4.2., more studies areneeded to resolve the current significance of der(9) deletions. Unless otherwise indicated,the deletion status should therefore be determined consistently as a part of routinediagnostics.

3. Prognostic factors related to imatinib treatment

3.1. Bone marrow lymphocytosis as a predictive marker for optimal response (IV)

Imatinib treatment induces rapid hematologic responses in nearly all patients. However, aproportion of these patients fail to achieve any kind of cytogenetic response. The reasonfor this type of cytogenetic resistance is unknown. Similarly, it is not known why amongpatients having a favorable response to imatinib therapy, some achieve the MMR withinoptimal time, indicating long-term progression free survival, as others do not. Onepotential factor contributing to the optimal treatment response could be the patient’simmune system, participating in the eradication of leukemic cells. The findings of StudyIV could support the idea of immune response in the clearance of leukemic clone, sincelymphocytes are the principal effector cells of the immune system.

Studies assessing the effects of imatinib on the immune system have resulted incontrasting findings. Some studies found imatinib an immunostimulating drug, whereasother studies suggested that imatinib has suppressive effects on immune system.Activating effects of imatinib have been observed through a significant rise in thefrequency of interferon-gamma producing T cells after a median of three-month imatinibtherapy. In addition, vaccination studies with a p210-derived peptide in combination withimatinib have shown no impairment of specific anti-leukemia T cell responses and therebyvaccine efficacy. Immunosuppressive effects of imatinib have been observed in otherstudies. Inhibition of the proliferation of activated T cells after addition of imatinib hasbeen described. Negative impact of imatinib on the formation of dendritic cells andincomplete recovery of these cells in peripheral blood has also been proposed, as reviewedby Mohty et al 2005 45. Based on these findings, the immunological effects of imatinibappear to be extremely diverse. Therefore more studies are warranted to clarify theimplications of imatinib and immune system on tumor elimination.

The bone marrow lymphocytosis detected in Study IV was superior in predictingcytogenetic and molecular genetic responses compared to conventional prognosticmarkers. When the appearance of bone marrow lymphocytosis was combined withcytogenetic data, the combination of lymphocytosis and major cytogenetic response atthree months of imatinib therapy predicted a MMR at 18 months of therapy with a positivepredictive value of 100%. The appearance of bone marrow lymphocytosis thus proved tobe a novel, powerful predictive factor for an optimal response to imatinib treatment. Whenput together with cytogenetic data, suboptimally or poorly responding patients could be

69

distinguished as early as three months of therapy. Due to a limited number of patients inthis study these findings need to be confirmed in a larger setting. However, the evaluationof bone marrow lymphocyte count could be included in the evaluation of early response inimatinib treated patients.

3.2. BCR-ABL kinase domain mutations (V)

Point mutations in the region encoding the BCR-ABL kinase domain are one importantmechanism of resistance to imatinib or other tyrosine kinase inhibitor treatment. Most ofthe mutations conferring imatinib resistance may be overcome by a second generationinhibitor, such as dasatinib or nilotinib. However, the “gatekeeper” mutation, T315I,causes resistance to all inhibitors currently available and is therefore problematic inclinical practice. The lack of T315I in this study was surprising, as T315I is one of themost common single mutations detected in previous studies 228-229, 232. More recently, theT315I substitution has been shown to count for approximately 20% of imatinib resistantcases 326. The reason for variable incidence of T315I in different reports may be related tostudy design, or differences in genetic background of the study population 327.

In previous reports, mutations were less frequently regarded as a causative factor forprimary resistance and other mechanisms of resistance are regarded more common 229, 328.In contrast, results in the Study V indicate that the kinase domain mutations were alsosignificant for resistance in patients who are refractory upfront to imatinib therapy. Thismay be related to the length of disease history, since many of the patients analyzed were inlate chronic phase or in advanced phase at the time of starting imatinib. Putatively, cellclones harboring pre-existent mutants with high proliferative potential were selected uponimatinib treatment in these subjects, rapidly resulting in a significant tumor load whichupon cytogenetic evaluation at six months might be interpreted as primary resistancerather than a rapid development of a pre-existing clone.

The impact of BCR-ABL deletions and alternative splicing on imatinib resistanceremains to be determined. Alternative splicing of BCR-ABL transcripts has also beenreported by others and it seems to be relatively common phenomenon in CML 329-331.Many of the deletions and splice variants break the open reading frame of the gene andresult in a premature termination of protein synthesis. P-loop deletion mutants thatpreserve the reading frame, like 248-274 in conjunction with L248V point mutation, arealso catalytically inactive. This was hypothesized as having a dominant –negative effecton the oncogenic potential of the mutant and native BCR-ABL dimers. However, thegrowth factor independence and activation of signaling was retained in cells coexpressingdeleted and native forms of BCR-ABL. But when treated with imatinib, the cells had anincreased sensitivity to imatinib, which refers to a dominant-negative effect with respect todrug sensitivity 331. Therefore the deletions and alternative splicing appear unlikely to bethe causative factor for resistance. However, more studies are needed to clarify thesignificance of deletions and exon splicing in context of resistance, but also in the biologyof CML.

70

Mutation analyses: when and how?

Appearance of primary or secondary resistance as defined in the present work is a clearindication for mutation testing. First signs of secondary resistance may be detected by aserial increase in MRD as detected by BCR-ABL RQ-PCR from peripheral blood 332. Aconfirmed half-log increase or a rise of more than two-fold in BCR-ABL RQ-PCR levelshave also been proposed as indicators for higher risk of relapse and kinase domainmutations 314 333. In previous studies, no precise definitions for primary resistance havebeen presented. Our definition of primary resistance as used in Study V appears clinicallyuseful and can be used as a guideline for selecting patients for mutational analyses.

The methodology used for mutation screening is variable. One of the most often usedmethod is the BCR-ABL fusion specific PCR followed by nested-PCR and directsequencing of the region encoding the kinase domain 229, 312. Direct sequencing has asensitivity limit of 10-30% which hampers the early detection of resistant clones.Denaturing high performance liquid chromatography (DHPLC) and pyrosequencing aremore sensitive methods with sensitivity levels of 10-15%, or even below 1%.Pyrosequencing also enables the quantification of the mutated clone 243, 334-335.

Allele specific oligonucleotide (ASO-) or amplification refractory mutation system(ARMS-) based PCR assays are also highly sensitive techniques for mutation detection.They are useful mutation-specific methods for detecting low level mutations or inquantitative follow-up of a previously detected mutated clone 242, 336. Assays designed forfollow-up studies may be as sensitive as detecting 0.1% of the mutated clone 336.However, when the mutation causing resistance is unknown, the screening techniqueshould be unbiased, detecting all kinds of sequence variations.

In addition to mutation screening, both conventional karyotyping and BCR-ABL FISHshould be performed at the time of resistance. These assays detect cytogenetic clonalevolution and BCR-ABL amplification which are also mechanisms for drug resistance.

4. Future prospects

The detailed molecular knowledge on targeted therapies and the emerging resistanceagainst these drugs has increased over the years and provided new tools and strategies forhandling clinical situations associated with drug resistance. However, inhibition of themultidrug-resistant T315I mutation positive BCR-ABL remains one of the mainchallenges. New promising agents that are either targeted against BCR-ABL or areactivating other, suppressed proteins in advanced phases of the disease are in clinicalstages of development 301, 337-338. New treatment options will also create a need for novelprognostic factors assessing and predicting treatment response, such as bone marrowlymphocytosis during imatinib treatment. Pharmacodynamic assessments, such asdetermination of the in vitro and in vivo activity of new drugs against BCR-ABL isoformswill have increasing importance, and they provide important endpoint data forcombinations of various treatment strategies, such as tyrosine kinase inhibitors, immunetherapy and drugs targeting epigenetic alterations 339-340.

71

The need for predictive factors for drug resistance is also a subject for further studies.The determination of baseline mutations or other mechanisms of resistance could bevaluable in choosing the most efficient treatment for the patients. In de novo Phchromosome positive ALL, pre-existing kinase domain mutations are detected at low levelin at least 40% of the newly diagnosed patients with no exposure to imatinib and thesemutations were the ones that were responsible for relapse of the disease 341. Thisemphasizes the need of highly sensitive techniques for mutation detection and monitoring242, 336, 342 and also the necessity to understand the determinants of growth advantage ofboth mutated and unmutated leukemic clones over healthy bone marrow cells.

Despite the growing knowledge of new treatments and the discovery of new prognosticfactors, the conventional prognostic variables are remarkably tenable. The Sokal score,developed in the 1980’s for patients treated with single-agent chemotherapy (mostcommonly busulfan), is valid for imatinib treated patients as well, and predicts lower ratesof CCyR and higher estimated risk of disease progression for Sokal high risk patients atfive years of treatment 52. Similarly, conventional karyotyping with standard G-bandinghas been sufficient in illustrating 97% progression free survival at five years of imatinibtherapy 52. Therefore, the advent of new prognostic factors does not necessarily renderolder variables obsolete, but complement the assessment of prognosis of CML patients.

The efficacy and good correlation of RQ-PCR and metaphase FISH methods as well asthe concordance of bone marrow and peripheral blood samples in detecting MRD havebeen proven in many reports. This makes the utilization of peripheral blood as the primarysample source for the RQ-PCR follow-up analyses reasonable. However, the situation isnot that straightforward in all patients, as some individuals exhibit a marked discordancebetween RQ-PCR and metaphase FISH - or conventional cytogenetic - studies. Forexample, in one chronic phase, low Sokal-risk CML patient, the 18-month follow-upsample showed CCyR by FISH analysis from 1000 metaphase cells, whereassimultaneously taken peripheral blood or bone marrow RQ-PCR assays indicate less than1-log reduction from the diagnostic baseline referring to suboptimal response. Thebiological mechanisms and clinical significance of these ambiguous cases is subject forfurther studies.

Although the efficacy of currently used tyrosine kinase inhibitors has been documentedon several occasions, they all have the same limitation: leukemic quiescent (out of cellcycle) stem cell compartment is insensitive to these inhibitors 343-345. This has also beenobserved in clinical setting as patients relapse after imatinib discontinuation, althoughBCR-ABL has been undetectable by PCR in samples prior to discontinuation 346.However, this is not the case in all patients, possibly reflecting long-term benefit of earliertherapies (i.e. interferon) or other heterogeneity among the patients. Nevertheless, thecessation of imatinib treatment is not recommended at the present time 42. New drugstargeting cancer stem cells are being developed constantly. One such agent, BMS-214662,has recently been reported as inducing apoptosis in leukemic stem cells while sparingnormal stem cells 347.

The aim of current and upcoming prognostic markers will remain the same: aid in theselection of right therapies for right patients. In the future, some CML patients may becured with a combination of powerful targeted therapy strategies and accurate laboratorytools measuring their effect.

72

Summary and conclusions

The story of chronic myeloid leukemia describes comprehensively the developmental spanof how the detection of consistent chromosomal abnormality eventually leads to a targeteddrug and its second generation successors used for treating the emerged resistance. CMLis aptly regarded as a model disease for cancer that may have implications for thedevelopment of targeted therapies for other malignancies as well.

This thesis was constructed during the advent of tyrosine kinase inhibitors. Imatinib asthe first generation inhibitor has become the first-line treatment for newly diagnosed CMLpatients. However, conventional therapies such as alloHSCT have still a role in thetreatment of CML, although their role as the first-line treatment option has changed. Theemergence of new prognostic factors related to the new regimens, such as the level ofMRD after 18 months of imatinib therapy, emphasize the importance of precise MRDanalytics even more than before. Sensitive and quantitative methods are a prerequisite fortoday’s genetic laboratories performing follow-up studies for CML patients.

The correlations between various techniques monitoring minimal residual disease fromdifferent sources of material were assessed in Study I. Bone marrow metaphase FISH andRQ-PCR assays performed from bone marrow or peripheral blood mononuclear cellscorrelated well with each other. The better sensitivity of RQ-PCR analyses was evident inapproximately 40% of the metaphase FISH negative samples still indicating low levelMRD with RQ-PCR with a median log-reduction of three units. A model or converting thedata into the International Scale was presented, yielding the conversion factor of 2.86. Inaddition, the data enabled the conversion of bone marrow metaphase FISH results into thesame scale, as well.

The clinical and practical significance of bone marrow metaphase FISH in the follow-up analyses of CML patients after alloHSCT was evaluated in Study II. Ph chromosomepositive cells were observed in 32% of the patients during the entire follow-up time. Atotal of 12% of the patients showed low-level (<1% of residual cells) and falling MRD,whereas 19% had a serial rise in MRD level exceeding 1% or had at once more than 1% ofPh chromosome positive cells when detected for the first time. In all, no spontaneouseradication of residual cells was detected when the frequency of Ph positive cellsexceeded 1% at any time during the follow-up. The threshold of 1% has practical value inmetaphase FISH analytics but its clinical significance needs to be validated in larger trials.

The impact of derivative chromosome 9 deletions on the disease course and treatmentresponse after alloHSCT was determined in Study III. Deletions were found in 15% of allpatients, which is in line with previously published reports. Curiously, in contrast to otherpublications, no deletions were observed in patients with variant translocations. In theupdated analyses made by the end of February 2008, the frequency of der(9)deletionsseems to be similar to standard translocations in Finnish CML patients, as only three outof 19 evaluable patients with a variant translocation have been diagnosed as having ader(9) deletion (16%). The frequency is still clearly lower than expected in patients withvariant translocations and it may reflect some kind of difference in the genetic background

73

of the disease in Finnish CML patients. Prior to transplantation the patients with deletionstended to have a poorer cytogenetic response to an interferon-alpha -containing therapy,though the finding was not statistically significant. After transplantation, no difference inthe total relapse rate during follow-up was observed in patients with or without deletions.Neither did the Kaplan-Meyer outcome estimates for overall survival, transplant-relatedmortality, leukemia-free survival and relapse-free time show any difference between thesepatient groups. Therefore, during conventional treatment regimens, the der(9) status couldbe an important criterion in conjunction with other prognostic factors, such as the EBMTscore, when considering allogeneic transplantation. However, the prognostic significanceof der(9) deletions in the era of tyrosine kinase inhibitors is not clear, requiring furtherstudies in this field.

Factors associated with favorable or unfavorable response to imatinib treatment wereassessed in Studies IV and V. The appearance of bone marrow lymphocytosis duringimatinib therapy (IV) proved to be a powerful predictive factor for optimal treatmentresponse. When combined with the results of conventional cytogenetics, the patients withsuboptimal or failed response to imatinib could be distinguished as early as at threemonths of therapy. Similarly, bone marrow lymphocytosis and major cytogenetic responseat three months predicted prognostically important major molecular response at 18 monthsof imatinib treatment. The validation of these findings with a larger patient material iswarranted. However, the evaluation of bone marrow lymphocyte count could easily beincluded in the evaluation of early response.

Acquired mutations in the BCR-ABL kinase domain are unfavorable factors associatedwith imatinib treatment (V). The patient material consisted of CML patients experiencingeither primary or secondary resistance against imatinib treatment. All the point mutationsdetected in the kinase domain were previously reported ones, known to confer imatinibresistance. However, in contrast to many other studies, no multi-drug resistant T315Imutations were found. In addition, other sequence variants besides point mutations,namely deletions and exon splicing, were found. Most of the deletion mutants were out-offrame mutations that resulted in a premature stop codon in the BCR-ABL transcript. Theclinical significance of these deletion mutants remains to be determined. In all, mutationtesting should be done predominantly from patients fulfilling criteria for primary orsecondary resistance.

This thesis has provided information on novel prognostic markers in Finnish andNorwegian CML patients and also has indicated some special features observed in thispatient group. In addition, a new marker predicting optimal response to imatinib treatmentwas described. Many of these observations are clinically applicable and also provide basisfor further research work with the aim of developing curative drug therapy strategies forCML.

74

Acknowledgements

This work was carried out in the Department of Pathology in Haartman Institute and HematologyResearch Unit in the Department of Medicine, Division of Hematology, University of Helsinki andin collaboration with the Department of Clinical Genetics, University of Oulu during the years2002-2008. I wish to express my sincere gratitude to all those who have made this work possible,especially to:

Professor Veli-Pekka Lehto, the present Head of the Department of Pathology for providingme excellent research facilities. The former Heads of the Department as well as the Heads of theDepartment of Medical Genetics are also gratefully acknowledged.

Professor Tapani Ruutu, the Head of the Division of Hematology for his supportive attitudetowards my research work and for his efforts as a collaborator in Study III.

Emeritus Professor Jaakko Leisti, my “unofficial supervisor”, the former Head of theDepartment of Clinical Genetics, University of Oulu for all the encouragement he gave me when Iwas starting my research work. I also want to thank the present head of the Department, ProfessorJaakko Ignatius for his positive attitude towards my study.

Docent Sakari Knuutila, my supervisor, for deepening my knowledge on cancer cytogenetics.His supportive guidance during these years has been most valuable to me. I appreciate I had theopportunity to join his research group and learn so many things during this period.

Professor Kimmo Porkka, my second supervisor, for inspirational guidance throughout thiswhole project. It has been a privilege to work in his group. His experience in both basic researchand clinical issues has been the leading force in this study and has impressed me a lot. He hasalways been there for me when needed, no matter how small a thing has been troublesome for me.His guidance has been crucial for me to eventually finalize this thesis project.

Docent Tarja-Terttu Pelliniemi and Docent Eeva-Riitta Savolainen, the official reviewers, fortheir careful pre-examination and for constructive comments which helped me to improve mythesis. I was lucky to have them as the reviewers of this thesis.

This work would not have been possible without the great input of my coauthors. I am mostindebted to Professor Andreas Hochhaus and Dr. Martin Müller for their valuable contribution inStudy I; Docents Erkki Elonen, Tobias Gedde-Dahl, Henrik Hjorth-Hansen, Kari Remes, ProfessorTapani Ruutu and Docent Liisa Volin for providing the clinical data for Studies II, III and V;Docent Veli Kairisto and Drs. Kirsi Autio, Franz Gruber, Vesa Juvonen, Taina Lakkala, IngvildMikkola, Satu Mustjoki, Ole Petter Rekvig and Aleksandra Silye for their contribution andcollaboration in different studies. I especially thank Satu for all her support and patience inteaching me the basics of cell morphology, flow cytometry and hematopoiesis in general. Herefforts in Study IV are indispensable. Franz is acknowledged not only for sharing a thesis-publication and for his expertise and enthusiasm in mutation studies but also his great sense ofhumor that always cheered me up. Vesa and Veli have had an invaluable input to the RQ-PCRstudies which I gratefully acknowledge.

I thank Docent Robert Paul for his expert linguistic assistance in finalizing the thesis.Mrs. Eeva Mäkinen and Pirjo Pennanen are acknowledged for their valuable help in numerous

matters, and for their friendship during all these years.

75

The always so joyful and hard-working HRU team: Anna, Kirsi, Mika, Minna, Perttu, Peter,Sari, Sari, Sari and Taru for sharing happy moments both inside and outside the lab work. SariNikkola is acknowledged for her skilful help in collecting the clinical data for Study V.

The former and present members of the CMG group: Anna, Anne, Anu, Asta, Eeva, Haiju,Hanna, Kowan, Samuel, Salla, Sanna, Sippy, Suvi, Tarja, Penny, Pamela, Linda, Yan, Ying andmany others for their friendship and for creating such a positive working environment. I thankHanna for being “the promoter” for me to write the thesis and many useful advices on the way ofdoing research. Sippy, thanks for our refreshing Sunday walks and lively discussions on scientificand especially: not-so-scientific matters.

The personnel in the diagnostic laboratories of Molecular Pathology in HUSLAB and TheGenetics Laboratory in Oulu University Hospital are acknowledged for their kind help, optimismand great sense of humor that had a huge impact on me enjoying working in both laboratories.

My colleagues and friends Tarja Salonen and Minja Laulajainen, my ”walking meter person”and ”domain person” for always cheering me up in the cloudy mornings – and turning them intosunny days! I also thank Tarja for all the guidance she has given me in the laboratory work. Minja,thank you for all the comments on molecular part of the thesis, without them the writing processwould have been much harder. Tarja Koskialho, my office-mate of many years' back, for all thepatience she had towards my constant, horrible habit of talking by myself… Thank you for alsosharing my everyday joys and sorrows and for your empathy during the hard times.

Kirsi Autio, a colleague but most importantly a dear friend whose enormous support andencouragement have been invaluable for me. Thanks for always being there for me, even duringthe busiest days. The numerous discussions with you helped me to get through the hardest times.

My other friends outside the laboratory; thanks for reminding me that there are other aspects inlife, too. Especially I want to thank Raili for sharing these last hectic months with me “exactly inthe same boat”. I sincerely thank Tapio for all the patience, support and his help in countless thingsduring my studies.

The greatest thanks go to my dear mother and late father, to whom this work is dedicated to,for never-ending love and encouragement wherever I have been, whatever I have been doing in mylife. You have always had faith in me, also in those moments when I did not have it myself. Yoursupport has been irreplaceable.

This work has been financially supported by grants from the Blood Disease Foundation, theFinnish Society of Hematology, the Biomedicum Helsinki Foundation, the Finnish Cancer Society,the Finnish Cultural Foundation, and the Research Funds of Helsinki University Central Hospitaland Oulu University Hospital, all of which I gratefully acknowledge.

Helsinki, May 2008

76

References

1. Geary, CG. The story of chronic myeloid leukaemia. Br J Haematol. 2000; 110:2-11.2. Tefferi, A. The history of myeloproliferative disorders: before and after Dameshek.Leukemia. 2008; 22:3-13.3. Dameshek, W. Editorial: Some Speculations on the Myeloproliferative Syndromes. Blood.1951; 6:372-375.4. Nowell, PC, Hungerford, DA. Chromosome studies on normal and leukemic humanleukocytes. J Natl Cancer Inst. 1960; 25:85-109.5. Nowell, PC, Hungerford, DA. A Minute Chromosome in Human Chronic GranulocyticLeukemia Science. 1960; 132:1497.6. Nowell, PC, Hungerford, DA. Chromosome studies in human leukemia. II. Chronicgranulocytic leukemia. J Natl Cancer Inst. 1961; 27:1013-1035.7. Caspersson, T, Farber, S, Foley, GE, Kudynowski, J, Modest, EJ, Simonsson, E, et al.Chemical differentiation along metaphase chromosomes. Exp Cell Res. 1968; 49:219-222.8. Caspersson, T, Zech, L, Johansson, C. Differential binding of alkylating fluorochromes inhuman chromosomes. Exp Cell Res. 1970; 60:315-319.9. Caspersson, T, Gahrton, G, Lindsten, J, Zech, L. Identification of the Philadelphiachromosome as a number 22 by quinacrine mustard fluorescence analysis. Exp Cell Res. 1970;63:238-240.10. Rowley, JD. A new consistent chromosomal abnormality in chronic myelogenousleukaemia identified by quinacrine fluorescence and Giemsa staining. Nature. 1973; 243:290-293.11. Prakash, O, Yunis, JJ. High resolution chromosomes of the t(9;22) positive leukemias.Cancer Genet Cytogenet. 1984; 11:361-367.12. Heisterkamp, N, Groffen, J, Stephenson, JR, Spurr, NK, Goodfellow, PN, Solomon, E, etal. Chromosomal localization of human cellular homologues of two viral oncogenes. Nature. 1982;299:747-749.13. Heisterkamp, N, Stephenson, JR, Groffen, J, Hansen, PF, de Klein, A, Bartram, CR, et al.Localization of the c-abl oncogene adjacent to a translocation break point in chronic myelocyticleukaemia. Nature. 1983; 306:239-242.14. de Klein, A, Kessel, AGv, Grosveld, G, Bartram, CR, Hagemeijer, A, Bootsma, D, et al. Acellular oncogene is translocated to the Philadelphia chromosome in chronic myelocyticleukaemia. Nature. 1982; 300:765-767.15. Groffen, J, Stephenson, JR, Heisterkamp, N, de Klein, A, Bartram, CR, Grosveld, G.Philadelphia chromosomal breakpoints are clustered within a limited region, bcr, on chromosome22. Cell. 1984; 36:93-99.16. Heisterkamp, N, Stam, K, Groffen, J, de Klein, A, Grosveld, G. Structural organization ofthe bcr gene and its role in the Ph´ translocation. Nature. 1985; 315:758-761.17. Gale, RP, Canaani, E. An 8-kilobase abl RNA transcript in chronic myelogenous leukemia.Proc Natl Acad Sci U S A. 1984; 81:5648-5652.18. Shtivelman, E, Lifshitz, B, Gale, RP, Canaani, E. Fused transcript of abl and bcr genes inchronic myelogenous leukaemia. Nature. 1985; 315:550-554.19. Konopka, JB, Watanabe, SM, Witte, ON. An alteration of the human c-abl protein in K562leukemia cells unmasks associated tyrosine kinase activity. Cell. 1984; 37:1035-1042.20. Ben-Neriah, Y, Daley, GQ, Mes-Masson, AM, Witte, ON, Baltimore, D. The chronicmyelogenous leukemia-specific P210 protein is the product of the bcr/abl hybrid gene. Science.1986; 233:212-214.21. Daley, GQ, Van Etten, RA, Baltimore, D. Induction of chronic myelogenous leukemia inmice by the P210bcr/abl gene of the Philadelphia chromosome. Science. 1990; 247:824-830.

77

22. Elefanty, AG, Hariharan, IK, Cory, S. bcr-abl, the hallmark of chronic myeloid leukaemiain man, induces multiple haemopoietic neoplasms in mice. Embo J. 1990; 9:1069-1078.23. Kelliher, MA, McLaughlin, J, Witte, ON, Rosenberg, N. Induction of a chronicmyelogenous leukemia-like syndrome in mice with v-abl and BCR/ABL. Proc Natl Acad Sci U SA. 1990; 87:6649-6653.24. Fialkow, PJ, Denman, AM, Jacobson, RJ, Lowenthal, MN. Chronic myelocytic leukemia.Origin of some lymphocytes from leukemic stem cells. J Clin Invest. 1978; 62:815-823.25. Martin, PJ, Najfeld, V, Hansen, JA, Penfold, GK, Jacobson, RJ, Fialkow, PJ. Involvementof the B-lymphoid system in chronic myelogenous leukaemia. Nature. 1980; 287:49-50.26. Bartram, CR, Raghavachar, A, Anger, B, Stain, C, Bettelheim, P. T lymphocytes lackrearrangement of the bcr gene in Philadelphia chromosome-positive chronic myelocytic leukemia.Blood. 1987; 69:1682-1685.27. Raanani, P, Trakhtenbrot, L, Rechavi, G, Rosenthal, E, Avigdor, A, Brok-Simoni, F, et al.Philadelphia-Chromosome-Positive T-Lymphoblastic Leukemia: Acute Leukemia or ChronicMyelogenous Leukemia Blastic Crisis. Acta Haematol. 2005; 113:181-189.28. Vardiman, J, Pierre, R, Thiele, J, Imbert, M, Brunning, RD, Flandrin, G. Chronicmyelogenous leukaemia. In: World Health Organization Classification of Tumours: Pathology andGenetics of Tumours of Haematopoietic and Lymphoid Tissues. Jaffe, E, Harris, NL, Stein, H,Vardiman, JW eds. Lyon, France: IARC Press, 2001:20-26.29. Faderl, S, Talpaz, M, Estrov, Z, Kantarjian, HM. Chronic Myelogenous Leukemia:Biology and Therapy. Ann Intern Med. 1999; 131:207-219.30. Faderl, S, Talpaz, M, Estrov, Z, O'Brien, S, Kurzrock, R, Kantarjian, HM. The biology ofchronic myeloid leukemia. N Engl J Med. 1999; 341:164-172.31. Millot, F, Traore, P, Guilhot, J, Nelken, B, Leblanc, T, Leverger, G, et al. Clinical andBiological Features at Diagnosis in 40 Children With Chronic Myeloid Leukemia. Pediatrics.2005; 116:140-143.32. Sawyers, CL. Chronic Myeloid Leukemia. N Engl J Med. 1999; 340:1330-1340.33. European LeukemiaNet, W. Calculation of Relative Risk of CML Patients. http://eln.zms-hosting.com/sites/leukemia-net/content/e58/e495/e1733 ed. Baccarani, M., 2006.34. ROC. Calculate Sokal score. http://www.roc.se/KML/Sokal.asp ed. Regional OncolocyCenter, 2008.35. Sokal, JE, Cox, EB, Baccarani, M, Tura, S, Gomez, GA, Robertson, JE, et al. Prognosticdiscrimination in "good-risk" chronic granulocytic leukemia. Blood. 1984; 63:789-799.36. Hasford, J, Pfirrmann, M, Hehlmann, R, Allan, NC, Baccarani, M, Kluin-Nelemans, JC, etal. A new prognostic score for survival of patients with chronic myeloid leukemia treated withinterferon alfa. Writing Committee for the Collaborative CML Prognostic Factors Project Group. JNatl Cancer Inst. 1998; 90:850-858.37. Gratwohl, A, Hermans, J, Goldman, JM, Arcese, W, Carreras, E, Devergie, A, et al. Riskassessment for patients with chronic myeloid leukaemia before allogeneic blood or marrowtransplantation. Chronic Leukemia Working Party of the European Group for Blood and MarrowTransplantation. Lancet. 1998; 352:1087-1092.38. Marin, D, Marktel, S, Bua, M, Szydlo, RM, Franceschino, A, Nathan, I, et al. Prognosticfactors for patients with chronic myeloid leukaemia in chronic phase treated with imatinibmesylate after failure of interferon alfa. Leukemia. 2003; 17:1448-1453.39. Smyth, MJ, Dunn, GP, Schreiber, RD. Cancer immunosurveillance and immunoediting:the roles of immunity in suppressing tumor development and shaping tumor immunogenicity. AdvImmunol. 2006; 90:1-50.40. Simula, MP, Marktel, S, Fozza, C, Kaeda, J, Szydlo, RM, Nadal, E, et al. Response todonor lymphocyte infusions for chronic myeloid leukemia is dose-dependent: the importance ofescalating the cell dose to maximize therapeutic efficacy. Leukemia. 2007; 21:943-948.41. Mahon, FX, Delbrel, X, Cony-Makhoul, P, Faberes, C, Boiron, JM, Barthe, C, et al.Follow-up of complete cytogenetic remission in patients with chronic myeloid leukemia aftercessation of interferon alfa. J Clin Oncol. 2002; 20:214-220.

78

42. Rousselot, P, Huguet, F, Rea, D, Legros, L, Cayuela, JM, Maarek, O, et al. Imatinibmesylate discontinuation in patients with chronic myelogenous leukemia in complete molecularremission for more than 2 years. Blood. 2007; 109:58-60.43. Nakayama, S, Nagamura-Inoue, T, Yokoyama, K, Ohno, N, Ooi, J, Takahashi, S, et al.Cytogenetic remissions induced by interferon alpha and imatinib mesylate are immunologicallydistinct in chronic myeloid leukemia. Int J Hematol. 2007; 86:208-211.44. Bocchia, M, Gentili, S, Abruzzese, E, Fanelli, A, Iuliano, F, Tabilio, A, et al. Effect of ap210 multipeptide vaccine associated with imatinib or interferon in patients with chronic myeloidleukaemia and persistent residual disease: a multicentre observational trial. The Lancet. 2005;365:657-662.45. Mohty, M, Blaise, D, Olive, D, Gaugler, B. Imatinib: the narrow line between immunetolerance and activation. Trends Mol Med. 2005; 11:397-402.46. Bose, S, Deininger, M, Gora-Tybor, J, Goldman, JM, Melo, JV. The presence of typicaland atypical BCR-ABL fusion genes in leukocytes of normal individuals: biologic significanceand implications for the assessment of minimal residual disease. Blood. 1998; 92:3362-3367.47. Biernaux, C, Sels, A, Huez, G, Stryckmans, P. Very low level of major BCR-ABLexpression in blood of some healthy individuals. Bone Marrow Transplant. 1996; 17 Suppl 3:S45-47.48. Huret, JL. Complex translocations, simple variant translocations and Ph-negative cases inchronic myelogenous leukaemia. Hum Genet. 1990; 85:565-568.49. Johansson, B, Fioretos, T, Mitelman, F. Cytogenetic and molecular genetic evolution ofchronic myeloid leukemia. Acta Haematol. 2002; 107:76-94.50. Reid, AG, Huntly, BJ, Grace, C, Green, AR, Nacheva, EP. Survival implications ofmolecular heterogeneity in variant Philadelphia-positive chronic myeloid leukaemia. Br JHaematol. 2003; 121:419-427.51. Gorusu, M, Benn, P, Li, Z, Fang, M. On the genesis and prognosis of variant translocationsin chronic myeloid leukemia. Cancer Genet Cytogenet. 2007; 173:97-106.52. Druker, BJ, Guilhot, F, O'Brien S, G, Gathmann, I, Kantarjian, H, Gattermann, N, et al.Five-Year Follow-up of Patients Receiving Imatinib for Chronic Myeloid Leukemia. N Engl JMed. 2006; 355:2408-2417.53. Kantarjian, H, O'Brien, S, Cortes, J, Giles, F, Shan, J, Rios, MB, et al. Survival Advantagewith Imatinib Mesylate Therapy in Chronic-Phase Chronic Myelogenous Leukemia (CML-CP)after IFN-{alpha} Failure and in Late CML-CP, Comparison with Historical Controls. Clin CancerRes. 2004; 10:68-75.54. El-Zimaity, MM, Kantarjian, H, Talpaz, M, O'Brien, S, Giles, F, Garcia-Manero, G, et al.Results of imatinib mesylate therapy in chronic myelogenous leukaemia with variant Philadelphiachromosome. Br J Haematol. 2004; 125:187-195.55. Bartram, CR, Kleihauer, E, de Klein, A, Grosveld, G, Teyssier, JR, Heisterkamp, N, et al.C-abl and bcr are rearranged in a Ph1-negative CML patient. Embo J. 1985; 4:683-686.56. Hagemeijer, A, Buijs, A, Smit, E, Janssen, B, Creemers, GJ, Van der Plas, D, et al.Translocation of BCR to chromosome 9: a new cytogenetic variant detected by FISH in two Ph-negative, BCR-positive patients with chronic myeloid leukemia. Genes Chromosomes Cancer.1993; 8:237-245.57. Chase, A, Huntly, BJP, Cross, NCP. Cytogenetics of chronic myeloid leukaemia. BestPract Res Clin Haematol. 2001; 14:553-571.58. Fugazza, G, Garuti, A, Marchelli, S, Miglino, M, Bruzzone, R, Gatti, AM, et al. MaskedPhiladelphia chromosome due to atypical BCR/ABL localization on the 9q34 band and duplicationof the der(9) in a case of chronic myelogenous leukemia. Cancer Genet Cytogenet. 2005; 163:173-175.59. Imbert, M, Bain, B, Pierre, R, Vardiman, JW, Brunning, RD, Flandrin, G. Chronicneutrophilic leukaemia. In: World Health Organization Classification of Tumours: Pathology andGenetics of Tumours of Haematopoietic and Lymphoid Tissues. Jaffe, E, Harris, NL, Stein, H,Vardiman, JW eds. Lyon, France: IARC Press, 2001:27-28.

79

60. Vardiman, J, Imbert, M, Pierre, R, Bain, B, Brunning, RD, Flandrin, G. Atypical chronicmyeloid leukaemia. In: World Health Organization Classification of Tumours: Pathology andGenetics of Tumours of Haematopoietic and Lymphoid Tissues. Jaffe, E, Harris, NL, Stein, H,Vardiman, JW eds. Lyon, France: IARC Press, 2001:53-54.61. Sinclair, PB, Green, AR, Grace, C, Nacheva, EP. Improved Sensitivity of BCR-ABLDetection: A Triple-Probe Three-Color Fluorescence In Situ Hybridization System. Blood. 1997;90:1395-1402.62. Dewald, GW, Wyatt, WA, Juneau, AL, Carlson, RO, Zinsmeister, AR, Jalal, SM, et al.Highly sensitive fluorescence in situ hybridization method to detect double BCR/ABL fusion andmonitor response to therapy in chronic myeloid leukemia. Blood. 1998; 91:3357-3365.63. Sinclair, PB, Nacheva, EP, Leversha, M, Telford, N, Chang, J, Reid, A, et al. Largedeletions at the t(9;22) breakpoint are common and may identify a poor-prognosis subgroup ofpatients with chronic myeloid leukemia. Blood. 2000; 95:738-743.64. Huntly, BJ, Bench, A, Green, AR. Double jeopardy from a single translocation: deletionsof the derivative chromosome 9 in chronic myeloid leukemia. Blood. 2003; 102:1160-1168.65. Herens, C, Tassin, F, Lemaire, V, Beguin, Y, Collard, E, Lampertz, S, et al. Deletion of the5'-ABL region: a recurrent anomaly detected by fluorescence in situ hybridization in about 10% ofPhiladelphia-positive chronic myeloid leukaemia patients. Br J Haematol. 2000; 110:214-216.66. Lee, DS, Lee, YS, Yun, YS, Kim, YR, Jeong, SS, Lee, YK, et al. A study on the incidenceof ABL gene deletion on derivative chromosome 9 in chronic myelogenous leukemia byinterphase fluorescence in situ hybridization and its association with disease progression. GenesChromosomes Cancer. 2003; 37:291-299.67. Tien, SL, Rudduck-Sivaswaren, C, Lim, P, Lim, E, Lie, DK, Tan, PH, et al. Highincidence of derivative chromosome arm 9q deletions in Asian chronic myelogenous leukemia.Genes Chromosomes Cancer. 2005; 42:433-434.68. Xinh, PT, Vu, HA, Nghia, H, Binh, NT, Van Be, T, Van Binh, T, et al. Coexistence ofPhiladelphia chromosome positive cells with and without der(9) deletion in a patient with chronicmyelogenous leukemia. Cancer Genet Cytogenet. 2006; 164:122-127.69. Huntly, BJ, Reid, AG, Bench, AJ, Campbell, LJ, Telford, N, Shepherd, P, et al. Deletionsof the derivative chromosome 9 occur at the time of the Philadelphia translocation and provide apowerful and independent prognostic indicator in chronic myeloid leukemia. Blood. 2001;98:1732-1738.70. Specchia, G, Albano, F, Anelli, L, Storlazzi, CT, Zagaria, A, Mancini, M, et al. Deletionson der(9) chromosome in adult Ph-positive acute lymphoblastic leukemia occur with a frequencysimilar to that observed in chronic myeloid leukemia. Leukemia. 2003; 17:528-531.71. Storlazzi, CT, Specchia, G, Anelli, L, Albano, F, Pastore, D, Zagaria, A, et al. Breakpointcharacterization of der(9) deletions in chronic myeloid leukemia patients. Genes ChromosomesCancer. 2002; 35:271-276.72. Fourouclas, N, Campbell, PJ, Bench, AJ, Swanton, S, Baxter, EJ, Huntly, BJ, et al. Sizematters: the prognostic implications of large and small deletions of the derivative 9 chromosome inchronic myeloid leukemia. Haematologica. 2006; 91:952-955.73. Kreil, S, Pfirrmann, M, Haferlach, C, Waghorn, K, Chase, A, Hehlmann, R, et al.Heterogeneous prognostic impact of derivative chromosome 9 deletions in chronic myelogenousleukemia. Blood. 2007; 110:1283-1290.74. Cohen, N, Rozenfeld-Granot, G, Hardan, I, Brok-Simoni, F, Amariglio, N, Rechavi, G, etal. Subgroup of patients with Philadelphia-positive chronic myelogenous leukemia characterizedby a deletion of 9q proximal to ABL gene: expression profiling, resistance to interferon therapy,and poor prognosis. Cancer Genet Cytogenet. 2001; 128:114-119.75. Rudduck-Sivaswaren, C, Tien, SL, Lim, P, Lim, E, Lie, DK, Tan, PH, et al. Evidence fordeletion of 9q as a two-step process in chronic myeloid leukemia. Clin Genet. 2005; 68:461-465.76. Kolomietz, E, Al-Maghrabi, J, Brennan, S, Karaskova, J, Minkin, S, Lipton, J, et al.Primary chromosomal rearrangements of leukemia are frequently accompanied by extensivesubmicroscopic deletions and may lead to altered prognosis. Blood. 2001; 97:3581-3588.

80

77. Huntly, BJ, Guilhot, F, Reid, AG, Vassiliou, G, Hennig, E, Franke, C, et al. Imatinibimproves but may not fully reverse the poor prognosis of patients with CML with derivativechromosome 9 deletions. Blood. 2003; 102:2205-2212.78. Quintas-Cardama, A, Kantarjian, H, Talpaz, M, O'Brien, S, Garcia-Manero, G, Verstovsek,S, et al. Imatinib mesylate therapy may overcome the poor prognostic significance of deletions ofderivative chromosome 9 in patients with chronic myelogenous leukemia. Blood. 2005; 105:2281-2286.79. Castagnetti, F, Marzocchi, G, Luatti, S, Buontempo, F, Baldazzi, C, Palandri, F, et al.Deletions of the Derivative Chromosome 9 Do Not Influence Response to Imatinib of EarlyChronic Phase Chronic Myeloid Leukemia Patients (A GIMEMA Working Party Analysis).Abstract. The American Society of Hematology 2006 Annual Meeting. Orlando, Florida, USA:Blood; 2006; 108:2112.80. Kim, DH, Sriharsha, L, Kamel-Reid, S, Chang, H, Messner, H, Lipton, J. No Significanceof Derivative Chromosome 9 Deletion on the Clearance Kinetics of BCR/ABL Fusion Transcripts,Cytogenetic or Molecular Response, Loss of Response or Treatment Failure to Imatinib MesylateTherapy for Chronic Myeloid Leukemia. Abstract. The American Society of Hematology 2007Annual Meeting. Atlanta, Georgia, USA: Blood; 2007; 110:1950.81. Quintas-Cardama, A, Kantarjian, H, Thomas, D, Koller, C, Shan, J, Cortes, J. PrognosticImpact of Deletions of Derivative Chromosome 9 on Patients (pts) with Chronic MyelogenousLeukemia (CML) in Chronic Phase Treated with Nilotinib or Dasatinib. Abstract. The AmericanSociety of Hematology 2007 Annual Meeting. Atlanta, Georgia, USA: Blood; 2007; 110:1955.82. Baccarani, M, Saglio, G, Goldman, J, Hochhaus, A, Simonsson, B, Appelbaum, F, et al.Evolving concepts in the management of chronic myeloid leukemia: recommendations from anexpert panel on behalf of the European LeukemiaNet. Blood. 2006; 108:1809-1820.83. Cortes, J, O'Dwyer, ME. Clonal evolution in chronic myelogenous leukemia. HematolOncol Clin North Am. 2004; 18:671-684.84. Heim, S, Mitelman, F. Cancer Cytogenetics. 2nd ed. New York: John-Wiley & Sons, Inc.,1995.85. Bumm, T, Muller, C, Al-Ali, HK, Krohn, K, Shepherd, P, Schmidt, E, et al. Emergence ofclonal cytogenetic abnormalities in Ph- cells in some CML patients in cytogenetic remission toimatinib but restoration of polyclonal hematopoiesis in the majority. Blood. 2003; 101:1941-1949.86. Meeus, P, Demuynck, H, Martiat, P, Michaux, L, Wouters, E, Hagemeijer, A. Sustained,clonal karyotype abnormalities in the Philadelphia chromosome negative cells of CML patientssuccessfully treated with Imatinib. Leukemia. 2003; 17:465-467.87. Terre, C, Eclache, V, Rousselot, P, Imbert, M, Charrin, C, Gervais, C, et al. Report of 34patients with clonal chromosomal abnormalities in Philadelphia-negative cells during imatinibtreatment of Philadelphia-positive chronic myeloid leukemia. Leukemia. 2004; 18:1340-1346.88. Jabbour, E, Kantarjian, HM, Abruzzo, LV, O'Brien, S, Garcia-Manero, G, Verstovsek, S,et al. Chromosomal abnormalities in Philadelphia chromosome negative metaphases appearingduring imatinib mesylate therapy in patients with newly diagnosed chronic myeloid leukemia inchronic phase. Blood. 2007; 110:2991-2995.89. Wiktor, A, Rybicki, BA, Piao, ZS, Shurafa, M, Barthel, B, Maeda, K, et al. Clinicalsignificance of Y chromosome loss in hematologic disease. Genes Chromosomes Cancer. 2000;27:11-16.90. Maserati, E, Aprili, F, Vinante, F, Locatelli, F, Amendola, G, Zatterale, A, et al. Trisomy 8in myelodysplasia and acute leukemia is constitutional in 15-20% of cases. Genes ChromosomesCancer. 2002; 33:93-97.91. De Melo, VAS, Milojkovic, D, Khorashad, JS, Marin, D, Goldman, JM, Apperley, JF, etal. Philadelphia-negative clonal hematopoiesis is a significant feature of dasatinib therapy forchronic myeloid leukemia. Blood. 2007; 110:3086-3087.92. Fabarius, A, Haferlach, C, Muller, MC, Erben, P, Lahaye, T, Giehl, M, et al. Dynamics ofcytogenetic aberrations in Philadelphia chromosome positive and negative hematopoiesis duringdasatinib therapy of chronic myeloid leukemia patients after imatinib failure. Haematologica.2007; 92:834-837.

81

93. Deininger, MW, Cortes, J, Paquette, R, Park, B, Hochhaus, A, Baccarani, M, et al. Theprognosis for patients with chronic myeloid leukemia who have clonal cytogenetic abnormalitiesin philadelphia chromosome-negative cells. Cancer. 2007; 110:1509-1519.94. Propp, S, Lizzi, FA. Brief Report: Philadelphia Chromosome in Acute LymphocyticLeukemia. Blood. 1970; 36:353-360.95. Pui, C-H, Relling, MV, Downing, JR. Acute Lymphoblastic Leukemia. N Engl J Med.2004; 350:1535-1548.96. Paietta, E, Racevskis, J, Bennett, JM, Neuberg, D, Cassileth, PA, Rowe, JM, et al. Biologicheterogeneity in Philadelphia chromosome-positive acute leukemia with myeloid morphology: theEastern Cooperative Oncology Group experience. Leukemia. 1998; 12:1881-1885.97. Soupir, CP, Vergilio, JA, Dal Cin, P, Muzikansky, A, Kantarjian, H, Jones, D, et al.Philadelphia chromosome-positive acute myeloid leukemia: a rare aggressive leukemia withclinicopathologic features distinct from chronic myeloid leukemia in myeloid blast crisis. Am JClin Pathol. 2007; 127:642-650.98. Chase, A, Cross, NC. Signal transduction therapy in haematological malignancies:identification and targeting of tyrosine kinases. Clin Sci (Lond). 2006; 111:233-249.99. Macdonald, D, Cross, NC. Chronic Myeloproliferative Disorders: The Role of TyrosineKinases in Pathogenesis, Diagnosis and Therapy. Pathobiology. 2007; 74:81-88.100. Blume-Jensen, P, Hunter, T. Oncogenic kinase signalling. Nature. 2001; 411:355-365.101. Krause, DS, Van Etten, RA. Tyrosine kinases as targets for cancer therapy. N Engl J Med.2005; 353:172-187.102. Witte, ON, Dasgupta, A, Baltimore, D. Abelson murine leukaemia virus protein isphosphorylated in vitro to form phosphotyrosine. Nature. 1980; 283:826-831.103. Van Etten, RA, Jackson, P, Baltimore, D. The mouse type IV c-abl gene product is anuclear protein, and activation of transforming ability is associated with cytoplasmic localization.Cell. 1989; 58:669-678.104. Van Etten, RA, Jackson, PK, Baltimore, D, Sanders, MC, Matsudaira, PT, Janmey, PA.The COOH terminus of the c-Abl tyrosine kinase contains distinct F- and G-actin binding domainswith bundling activity. J Cell Biol. 1994; 124:325-340.105. Taagepera, S, McDonald, D, Loeb, JE, Whitaker, LL, McElroy, AK, Wang, JY, et al.Nuclear-cytoplasmic shuttling of C-ABL tyrosine kinase. Proc Natl Acad Sci U S A. 1998;95:7457-7462.106. Van Etten, RA. Cycling, stressed-out and nervous: cellular functions of c-Abl. Trends CellBiol. 1999; 9:179-186.107. Van Etten, RA. Mechanisms of transformation by the BCR-ABL oncogene: newperspectives in the post-imatinib era. Leuk Res. 2004; 28 Suppl 1:S21-28.108. Jackson, P, Baltimore, D. N-terminal mutations activate the leukemogenic potential of themyristoylated form of c-abl. Embo J. 1989; 8:449-456.109. Hantschel, O, Nagar, B, Guettler, S, Kretzschmar, J, Dorey, K, Kuriyan, J, et al. Amyristoyl/phosphotyrosine switch regulates c-Abl. Cell. 2003; 112:845-857.110. Van Etten, RA. c-Abl regulation: a tail of two lipids. Current Biol. 2003; 13:R608-R610.111. Kurzrock, R, Kantarjian, HM, Druker, BJ, Talpaz, M. Philadelphia chromosome-positiveleukemias: from basic mechanisms to molecular therapeutics. Ann Intern Med. 2003; 138:819-830.112. Baskaran, R, Wood, LD, Whitaker, LL, Canman, CE, Morgan, SE, Xu, Y, et al. Ataxiatelangiectasia mutant protein activates c-Abl tyrosine kinase in response to ionizing radiation.Nature. 1997; 387:516-519.113. Shafman, T, Khanna, KK, Kedar, P, Spring, K, Kozlov, S, Yen, T, et al. Interactionbetween ATM protein and c-Abl in response to DNA damage. Nature. 1997; 387:520-523.114. Wang, JY. Regulation of cell death by the Abl tyrosine kinase. Oncogene. 2000; 19:5643-5650.115. Plattner, R, Kadlec, L, DeMali, KA, Kazlauskas, A, Pendergast, AM. c-Abl is activated bygrowth factors and Src family kinases and has a role in the cellular response to PDGF. Genes Dev.1999; 13:2400-2411.

82

116. Pluk, H, Dorey, K, Superti-Furga, G. Autoinhibition of c-Abl. Cell. 2002; 108:247-259.117. Sawyers, CL. Disabling Abl-perspectives on Abl kinase regulation and cancer therapeutics.Cancer Cell. 2002; 1:13-15.118. Nagar, B, Hantschel, O, Young, MA, Scheffzek, K, Veach, D, Bornmann, W, et al.Structural basis for the autoinhibition of c-Abl tyrosine kinase. Cell. 2003; 112:859-871.119. Hantschel, O, Superti-Furga, G. Regulation of the c-Abl and Bcr-Abl tyrosine kinases. NatRev Mol Cell Biol. 2004; 5:33-44.120. Deininger, MW, Goldman, JM, Melo, JV. The molecular biology of chronic myeloidleukemia. Blood. 2000; 96:3343-3356.121. Wen, ST, Jackson, PK, Van Etten, RA. The cytostatic function of c-Abl is controlled bymultiple nuclear localization signals and requires the p53 and Rb tumor suppressor gene products.Embo J. 1996; 15:1583-1595.122. Kipreos, ET, Wang, JY. Cell cycle-regulated binding of c-Abl tyrosine kinase to DNA.Science. 1992; 256:382-385.123. McWhirter, JR, Wang, JY. An actin-binding function contributes to transformation by theBcr-Abl oncoprotein of Philadelphia chromosome-positive human leukemias. Embo J. 1993;12:1533-1546.124. Heisterkamp, N, Knoppel, E, Groffen, J. The first BCR gene intron contains breakpoints inPhiladelphia chromosome positive leukemia. Nucleic Acids Res. 1988; 16:10069-10081.125. Romero, P, Beran, M, Shtalrid, M, Andersson, B, Talpaz, M, Blick, M. Alternative 5' endof the bcr-abl transcript in chronic myelogenous leukemia. Oncogene. 1989; 4:93-98.126. Romero, P, Colombatti, A. The first intron of the BCR gene contains two minor alternativeexons. Leuk Res. 1995; 19:963-970.127. Dhut, S, Dorey, EL, Horton, MA, Ganesan, TS, Young, BD. Identification of two normalbcr gene products in the cytoplasm. Oncogene. 1988; 3:561-566.128. Wetzler, M, Talpaz, M, Van Etten, RA, Hirsh-Ginsberg, C, Beran, M, Kurzrock, R.Subcellular localization of Bcr, Abl, and Bcr-Abl proteins in normal and leukemic cells andcorrelation of expression with myeloid differentiation. J Clin Invest. 1993; 92:1925-1939.129. Wetzler, M, Talpaz, M, Yee, G, Stass, SA, Van Etten, RA, Andreeff, M, et al. Cell cycle-related shifts in subcellular localization of BCR: association with mitotic chromosomes and withheterochromatin. Proc Natl Acad Sci U S A. 1995; 92:3488-3492.130. Laurent, E, Talpaz, M, Wetzler, M, Kurzrock, R. Cytoplasmic and nuclear localization ofthe 130 and 160 kDa Bcr proteins. Leukemia. 2000; 14:1892-1897.131. Maru, Y, Witte, ON. The BCR gene encodes a novel serine/threonine kinase activitywithin a single exon. Cell. 1991; 67:459-468.132. Diekmann, D, Brill, S, Garrett, MD, Totty, N, Hsuan, J, Monfries, C, et al. Bcr encodes aGTPase-activating protein for p21rac. Nature. 1991; 351:400-402.133. Ress, A, Moelling, K. Bcr is a negative regulator of the Wnt signalling pathway. EMBORep. 2005; 6:1095-1100.134. Olabisi, OO, Mahon, GM, Kostenko, EV, Liu, Z, Ozer, HL, Whitehead, IP. Bcr interactswith components of the endosomal sorting complex required for transport-I and is required forepidermal growth factor receptor turnover. Cancer Res. 2006; 66:6250-6257.135. Maru, Y, Kobayashi, T, Tanaka, K, Shibuya, M. BCR binds to the xerodermapigmentosum group B protein. Biochem Biophys Res Commun. 1999; 260:309-312.136. McWhirter, JR, Galasso, DL, Wang, JY. A coiled-coil oligomerization domain of Bcr isessential for the transforming function of Bcr-Abl oncoproteins. Mol Cell Biol. 1993; 13:7587-7595.137. Ma, G, Lu, D, Wu, Y, Liu, J, Arlinghaus, RB. Bcr phosphorylated on tyrosine 177 bindsGrb2. Oncogene. 1997; 14:2367-2372.138. Laurent, E, Talpaz, M, Kantarjian, H, Kurzrock, R. The BCR Gene and PhiladelphiaChromosome-positive Leukemogenesis. Cancer Res. 2001; 61:2343-2355.139. Melo, JV. The diversity of BCR-ABL fusion proteins and their relationship to leukemiaphenotype. Blood. 1996; 88:2375-2384.

83

140. Clark, SS, McLaughlin, J, Crist, WM, Champlin, R, Witte, ON. Unique forms of the abltyrosine kinase distinguish Ph1-positive CML from Ph1-positive ALL. Science. 1987; 235:85-88.141. Hermans, A, Heisterkamp, N, von Lindern, M, van Baal, S, Meijer, D, van der Plas, D, etal. Unique fusion of bcr and c-abl genes in Philadelphia chromosome positive acute lymphoblasticleukemia. Cell. 1987; 51:33-40.142. van Rhee, F, Hochhaus, A, Lin, F, Melo, JV, Goldman, JM, Cross, NC. p190 BCR-ABLmRNA is expressed at low levels in p210-positive chronic myeloid and acute lymphoblasticleukemias. Blood. 1996; 87:5213-5217.143. Saglio, G, Guerrasio, A, Rosso, C, Zaccaria, A, Tassinari, A, Serra, A, et al. New type ofBcr/Abl junction in Philadelphia chromosome-positive chronic myelogenous leukemia. Blood.1990; 76:1819-1824.144. Pane, F, Frigeri, F, Sindona, M, Luciano, L, Ferrara, F, Cimino, R, et al. Neutrophilic-chronic myeloid leukemia: a distinct disease with a specific molecular marker (BCR/ABL withC3/A2 junction). Blood. 1996; 88:2410-2414.145. Wilson, G, Frost, L, Goodeve, A, Vandenberghe, E, Peake, I, Reilly, J. BCR-ABLtranscript with an e19a2 (c3a2) junction in classical chronic myeloid leukemia. Blood. 1997;89:3064.146. How, GF, Lim, LC, Kulkarni, S, Tan, LT, Tan, P, Cross, NC. Two patients with novelBCR/ABL fusion transcripts (e8/a2 and e13/a2) resulting from translocation breakpoints withinBCR exons. Br J Haematol. 1999; 105:434-436.147. Branford, S, Rudzki, Z, Hughes, TP. A novel BCR-ABL transcript (e8a2) with theinsertion of an inverted sequence of ABL intron 1b in a patient with Philadelphia-positive chronicmyeloid leukaemia. Br J Haematol. 2000; 109:635-637.148. Hirota, M, Hidaka, E, Ueno, I, Ishikawa, M, Asano, N, Yamauchi, K, et al. Novel BCR-ABL transcript containing an intronic sequence insert in a patient with Philadelphia-positive acutelymphoblastic leukaemia. Br J Haematol. 2000; 110:867-870.149. Shiratsuchi, M, Muta, K, Minami, R, Motomura, S, Suehiro, Y, Abe, Y, et al. AberrantBCR-ABL transcript with intronic insertion in a patient with philadelphia chromosome-positivechronic myeloid leukemia: implications for disease progression. Leuk Lymphoma. 2001; 41:411-415.150. Cross, NC, Melo, JV, Feng, L, Goldman, JM. An optimized multiplex polymerase chainreaction (PCR) for detection of BCR-ABL fusion mRNAs in haematological disorders. Leukemia.1994; 8:186-189.151. Barnes, DJ, Melo, JV. Cytogenetic and molecular genetic aspects of chronic myeloidleukaemia. Acta Haematol. 2002; 108:180-202.152. Gordon, MY, Dowding, CR, Riley, GP, Goldman, JM, Greaves, MF. Altered adhesiveinteractions with marrow stroma of haematopoietic progenitor cells in chronic myeloid leukaemia.Nature. 1987; 328:342-344.153. Oda, T, Heaney, C, Hagopian, JR, Okuda, K, Griffin, JD, Druker, BJ. Crkl is the majortyrosine-phosphorylated protein in neutrophils from patients with chronic myelogenous leukemia.J Biol Chem. 1994; 269:22925-22928.154. Salgia, R, Uemura, N, Okuda, K, Li, JL, Pisick, E, Sattler, M, et al. CRKL linksp210BCR/ABL with paxillin in chronic myelogenous leukemia cells. J Biol Chem. 1995;270:29145-29150.155. Uemura, N, Griffin, JD. The adapter protein Crkl links Cbl to C3G after integrin ligationand enhances cell migration. J Biol Chem. 1999; 274:37525-37532.156. Uemura, N, Salgia, R, Ewaniuk, DS, Little, MT, Griffin, JD. Involvement of the adapterprotein CRKL in integrin-mediated adhesion. Oncogene. 1999; 18:3343-3353.157. Pendergast, AM, Quilliam, LA, Cripe, LD, Bassing, CH, Dai, Z, Li, N, et al. BCR-ABL-induced oncogenesis is mediated by direct interaction with the SH2 domain of the GRB-2 adaptorprotein. Cell. 1993; 75:175-185.158. Puil, L, Liu, J, Gish, G, Mbamalu, G, Bowtell, D, Pelicci, PG, et al. Bcr-Abl oncoproteinsbind directly to activators of the Ras signalling pathway. Embo J. 1994; 13:764-773.

84

159. Sanchez-Garcia, I, Grutz, G. Tumorigenic Activity of the BCR-ABL Oncogenes isMediated by BCL2. Proc Natl Acad Sci U S A. 1995; 92:5287-5291.160. Quintas-Cardama, A, Kantarjian, H, Cortes, J. Flying under the radar: the new wave ofBCR-ABL inhibitors. Nat Rev Drug Discov. 2007; 6:834-848.161. de Groot, RP, Raaijmakers, JA, Lammers, JW, Jove, R, Koenderman, L. STAT5 activationby BCR-Abl contributes to transformation of K562 leukemia cells. Blood. 1999; 94:1108-1112.162. Horita, M, Andreu, EJ, Benito, A, Arbona, C, Sanz, C, Benet, I, et al. Blockade of the Bcr-Abl kinase activity induces apoptosis of chronic myelogenous leukemia cells by suppressing signaltransducer and activator of transcription 5-dependent expression of Bcl-xL. J Exp Med. 2000;191:977-984.163. Skorski, T, Bellacosa, A, Nieborowska-Skorska, M, Majewski, M, Martinez, R, Choi, JK,et al. Transformation of hematopoietic cells by BCR/ABL requires activation of a PI-3k/Akt-dependent pathway. Embo J. 1997; 16:6151-6161.164. Fernandez-Luna, JL. Bcr-Abl and inhibition of apoptosis in chronic myelogenous leukemiacells. Apoptosis. 2000; 5:315-318.165. Gabriele, L, Phung, J, Fukumoto, J, Segal, D, Wang, IM, Giannakakou, P, et al. Regulationof Apoptosis in Myeloid Cells by Interferon Consensus Sequence–Binding Protein. J Exp Med.1999; 190:411-422.166. Hao, SX, Ren, R. Expression of Interferon Consensus Sequence Binding Protein (ICSBP)Is Downregulated in Bcr-Abl-Induced Murine Chronic Myelogenous Leukemia-Like Disease, andForced Coexpression of ICSBP Inhibits Bcr-Abl-Induced Myeloproliferative Disorder. Mol CellBiol. 2000; 20:1149-1161.167. Mughal, T, Cortes, J, Cross, NCP, Donato, N, Hantschel, O, Jabbour, E, et al. Chronicmyeloid leukemia - some topical issues. Leukemia. 2007; 21:1347-1352.168. Ren, R. Mechanisms of BCR-ABL in the pathogenesis of chronic myelogenous leukaemia.Nat Rev Cancer. 2005; 5:172-183.169. He, Y, Wertheim, JA, Xu, L, Miller, JP, Karnell, FG, Choi, JK, et al. The coiled-coildomain and Tyr177 of bcr are required to induce a murine chronic myelogenous leukemia-likedisease by bcr/abl. Blood. 2002; 99:2957-2968.170. Haferlach, C, Rieder, H, Lillington, DM, Dastugue, N, Hagemeijer, A, Harbott, J, et al.Proposals for standardized protocols for cytogenetic analyses of acute leukemias, chroniclymphocytic leukemia, chronic myeloid leukemia, chronic myeloproliferative disorders, andmyelodysplastic syndromes. Genes Chromosomes Cancer. 2007; 46:494-499.171. Landstrom, AP, Tefferi, A. Fluorescent in situ hybridization in the diagnosis, prognosis,and treatment monitoring of chronic myeloid leukemia. Leuk Lymphoma. 2006; 47:397-402.172. Hughes, TP, Kaeda, J, Branford, S, Rudzki, Z, Hochhaus, A, Hensley, ML, et al.Frequency of major molecular responses to imatinib or interferon alfa plus cytarabine in newlydiagnosed chronic myeloid leukemia. N Engl J Med. 2003; 349:1423-1432.173. Muller, MC, Gattermann, N, Lahaye, T, Deininger, MW, Berndt, A, Fruehauf, S, et al.Dynamics of BCR-ABL mRNA expression in first-line therapy of chronic myelogenous leukemiapatients with imatinib or interferon alpha/ara-C. Leukemia. 2003; 17:2392-2400.174. Seong, D, Giralt, S, Fischer, H, Hayes, K, Glassman, A, Arlinghaus, R, et al. Usefulness ofdetection of minimal residual disease by 'hypermetaphase' fluorescent in situ hybridization afterallogeneic BMT for chronic myelogenous leukemia. Bone Marrow Transplant. 1997; 19:565-570.175. Seong, CM, Giralt, S, Kantarjian, H, Xu, J, Swantkowski, J, Hayes, K, et al. Earlydetection of relapse by hypermetaphase fluorescence in situ hybridization after allogeneic bonemarrow transplantation for chronic myeloid leukemia. J Clin Oncol. 2000; 18:1831-1836.176. O'Brien, SG, Guilhot, F, Larson, RA, Gathmann, I, Baccarani, M, Cervantes, F, et al.Imatinib compared with interferon and low-dose cytarabine for newly diagnosed chronic-phasechronic myeloid leukemia. N Engl J Med. 2003; 348:994-1004.177. Hook, EB. Exclusion of chromosomal mosaicism: tables of 90%, 95% and 99% confidencelimits and comments on use. Am J Hum Genet. 1977; 29:94-97.

85

178. el-Rifai, W, Ruutu, T, Vettenranta, K, Temtamy, S, Knuutila, S. Minimal residual diseaseafter allogeneic bone marrow transplantation for chronic myeloid leukaemia: a metaphase-FISHstudy. Br J Haematol. 1996; 92:365-369.179. El-Rifai, W, Ruutu, T, Elonen, E, Volin, L, Knuutila, S. Prognostic value of metaphase-fluorescence in situ hybridization in follow-up of patients with acute myeloid leukemia inremission. Blood. 1997; 89:3330-3334.180. Seong, DC, Kantarjian, HM, Ro, JY, Talpaz, M, Xu, J, Robinson, JR, et al.Hypermetaphase fluorescence in situ hybridization for quantitative monitoring of Philadelphiachromosome-positive cells in patients with chronic myelogenous leukemia during treatment.Blood. 1995; 86:2343-2349.181. Schoch, C, Schnittger, S, Bursch, S, Gerstner, D, Hochhaus, A, Berger, U, et al.Comparison of chromosome banding analysis, interphase- and hypermetaphase-FISH, qualitativeand quantitative PCR for diagnosis and for follow-up in chronic myeloid leukemia: a study on 350cases. Leukemia. 2002; 16:53-59.182. Paschka, P, Muller, MC, Merx, K, Kreil, S, Schoch, C, Lahaye, T, et al. Molecularmonitoring of response to imatinib (Glivec) in CML patients pretreated with interferon alpha. Lowlevels of residual disease are associated with continuous remission. Leukemia. 2003; 17:1687-1694.183. Smoley, SA, Brockman, SR, Paternoster, SF, Meyer, RG, Dewald, GW. A novel tricolor,dual-fusion fluorescence in situ hybridization method to detect BCR/ABL fusion in cells witht(9;22)(q34;q11.2) associated with deletion of DNA on the derivative chromosome 9 in chronicmyelocytic leukemia. Cancer Genet Cytogenet. 2004; 148:1-6.184. Gabert, J, Beillard, E, van der Velden, VH, Bi, W, Grimwade, D, Pallisgaard, N, et al.Standardization and quality control studies of 'real-time' quantitative reverse transcriptasepolymerase chain reaction of fusion gene transcripts for residual disease detection in leukemia - aEurope Against Cancer program. Leukemia. 2003; 17:2318-2357.185. Beillard, E, Pallisgaard, N, van der Velden, VH, Bi, W, Dee, R, van der Schoot, E, et al.Evaluation of candidate control genes for diagnosis and residual disease detection in leukemicpatients using 'real-time' quantitative reverse-transcriptase polymerase chain reaction (RQ-PCR) -a Europe against cancer program. Leukemia. 2003; 17:2474-2486.186. Bustin, SA, Nolan, T. Pitfalls of quantitative real-time reverse-transcription polymerasechain reaction. J Biomol Tech. 2004; 15:155-166.187. Huggett, J, Dheda, K, Bustin, S, Zumla, A. Real-time RT-PCR normalisation; strategiesand considerations. Genes Immun. 2005; 6:279-284.188. Livak, KJ, Schmittgen, TD. Analysis of relative gene expression data using real-timequantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001; 25:402-408.189. Muller, MC, Hordt, T, Paschka, P, Merx, K, La Rosee, P, Hehlmann, R, et al.Standardization of preanalytical factors for minimal residual disease analysis in chronicmyelogenous leukemia. Acta Haematol. 2004; 112:30-33.190. Branford, S, Cross, NC, Hochhaus, A, Radich, J, Saglio, G, Kaeda, J, et al. Rationale forthe recommendations for harmonizing current methodology for detecting BCR-ABL transcripts inpatients with chronic myeloid leukaemia. Leukemia. 2006; 20:1925-1930.191. Hughes, T, Deininger, M, Hochhaus, A, Branford, S, Radich, J, Kaeda, J, et al. MonitoringCML patients responding to treatment with tyrosine kinase inhibitors: review andrecommendations for harmonizing current methodology for detecting BCR-ABL transcripts andkinase domain mutations and for expressing results. Blood. 2006; 108:28-37.192. Branford, S, Hughes, TP, Rudzki, Z. Monitoring chronic myeloid leukaemia therapy byreal-time quantitative PCR in blood is a reliable alternative to bone marrow cytogenetics. Br JHaematol. 1999; 107:587-599.193. Meissner, RDV, Dias, PMB, Covas, DT, Job, F, Leite, M, Nardi, NB. A polymorphism inexon b2 of the major breakpoint cluster region (M-bcr) identified in chronic myeloid leukaemiapatients. Br J Haematol. 1998; 103:224-226.

86

194. Saussele, S, Weisser, A, Muller, MC, Emgi, M, La Rosee, P, Paschka, P, et al. Frequentpolymorphism in BCR exon b2 identified in BCR-ABL positive and negative individuals usingfluorescent hybridization probes. Leukemia. 2000; 14:2006-2010.195. Baccarani, M, Russo, D, Rosti, G, Martinelli, G. Interferon-alfa for chronic myeloidleukemia. Semin Hematol. 2003; 40:22-33.196. Hehlmann, R, Hochhaus, A, Baccarani, M. Chronic myeloid leukaemia. The Lancet. 2007;370:342-350.197. Kujawski, LA, Talpaz, M. The role of interferon-alpha in the treatment of chronic myeloidleukemia. Cytokine & Growth Factor Reviews. 2007; 18:459-471.198. Goldman, JM, Melo, JV. Targeting the BCR-ABL Tyrosine Kinase in Chronic MyeloidLeukemia. N Engl J Med. 2001; 344:1084-1086.199. Druker, BJ, Tamura, S, Buchdunger, E, Ohno, S, Segal, GM, Fanning, S, et al. Effects of aselective inhibitor of the Abl tyrosine kinase on the growth of Bcr-Abl positive cells. Nat Med.1996; 2:561-566.200. Okuda, K, Weisberg, E, Gilliland, DG, Griffin, JD. ARG tyrosine kinase activity isinhibited by STI571. Blood. 2001; 97:2440-2448.201. Buchdunger, E, Cioffi, CL, Law, N, Stover, D, Ohno-Jones, S, Druker, BJ, et al. Ablprotein-tyrosine kinase inhibitor STI571 inhibits in vitro signal transduction mediated by c-kit andplatelet-derived growth factor receptors. J Pharmacol Exp Ther. 2000; 295:139-145.202. Heinrich, MC, Griffith, DJ, Druker, BJ, Wait, CL, Ott, KA, Zigler, AJ. Inhibition of c-kitreceptor tyrosine kinase activity by STI 571, a selective tyrosine kinase inhibitor. Blood. 2000;96:925-932.203. Joensuu, H, Roberts, PJ, Sarlomo-Rikala, M, Andersson, LC, Tervahartiala, P, Tuveson, D,et al. Effect of the tyrosine kinase inhibitor STI571 in a patient with a metastatic gastrointestinalstromal tumor. N Engl J Med. 2001; 344:1052-1056.204. Cools, J, DeAngelo, DJ, Gotlib, J, Stover, EH, Legare, RD, Cortes, J, et al. A tyrosinekinase created by fusion of the PDGFRA and FIP1L1 genes as a therapeutic target of imatinib inidiopathic hypereosinophilic syndrome. N Engl J Med. 2003; 348:1201-1214.205. Apperley, JF, Gardembas, M, Melo, JV, Russell-Jones, R, Bain, BJ, Baxter, EJ, et al.Response to imatinib mesylate in patients with chronic myeloproliferative diseases withrearrangements of the platelet-derived growth factor receptor beta. N Engl J Med. 2002; 347:481-487.206. Greco, A, Roccato, E, Miranda, C, Cleris, L, Formelli, F, Pierotti, MA. Growth-inhibitoryeffect of STI571 on cells transformed by the COL1A1/PDGFB rearrangement. Int J Cancer. 2001;92:354-360.207. Sjoblom, T, Shimizu, A, O'Brien, KP, Pietras, K, Dal Cin, P, Buchdunger, E, et al. Growthinhibition of dermatofibrosarcoma protuberans tumors by the platelet-derived growth factorreceptor antagonist STI571 through induction of apoptosis. Cancer Res. 2001; 61:5778-5783.208. Pardanani, A, Ketterling, RP, Brockman, SR, Flynn, HC, Paternoster, SF, Shearer, BM, etal. CHIC2 deletion, a surrogate for FIP1L1-PDGFRA fusion, occurs in systemic mastocytosisassociated with eosinophilia and predicts response to imatinib mesylate therapy. Blood. 2003;102:3093-3096.209. Schindler, T, Bornmann, W, Pellicena, P, Miller, WT, Clarkson, B, Kuriyan, J. Structuralmechanism for STI-571 inhibition of abelson tyrosine kinase. Science. 2000; 289:1938-1942.210. Nagar, B, Bornmann, WG, Pellicena, P, Schindler, T, Veach, DR, Miller, WT, et al.Crystal structures of the kinase domain of c-Abl in complex with the small molecule inhibitorsPD173955 and imatinib (STI-571). Cancer Res. 2002; 62:4236-4243.211. Deininger, MW, Goldman, JM, Lydon, N, Melo, JV. The tyrosine kinase inhibitorCGP57148B selectively inhibits the growth of BCR-ABL-positive cells. Blood. 1997; 90:3691-3698.212. Gambacorti-Passerini, C, le Coutre, P, Mologni, L, Fanelli, M, Bertazzoli, C, Marchesi, E,et al. Inhibition of the ABL kinase activity blocks the proliferation of BCR/ABL+ leukemic cellsand induces apoptosis. Blood Cells Mol Dis. 1997; 23:380-394.

87

213. Savage, DG, Antman, KH. Imatinib mesylate--a new oral targeted therapy. N Engl J Med.2002; 346:683-693.214. Hochhaus, A, Druker, BJ, Larson, RA, O'Brien, SG, Gathmann, I, Guilhot, F. IRIS 6-YearFollow-Up: Sustained Survival and Declining Annual Rate of Transformation in Patients withNewly Diagnosed Chronic Myeloid Leukemia in Chronic Phase (CML-CP) Treated with Imatinib.Abstract. The American Society of Hematology 2007 Annual Meeting. Atlanta, Georgia, USA:Blood; 2007; 110:25.215. Branford, S, Seymour, JF, Grigg, A, Arthur, C, Rudzki, Z, Lynch, K, et al. BCR-ABLMessenger RNA Levels Continue to Decline in Patients with Chronic Phase Chronic MyeloidLeukemia Treated with Imatinib for More Than 5 Years and Approximately Half of All First-LineTreated Patients Have Stable Undetectable BCR-ABL Using Strict Sensitivity Criteria. ClinCancer Res. 2007; 13:7080-7085.216. Talpaz, M, Silver, RT, Druker, BJ, Goldman, JM, Gambacorti-Passerini, C, Guilhot, F, etal. Imatinib induces durable hematologic and cytogenetic responses in patients with acceleratedphase chronic myeloid leukemia: results of a phase 2 study. Blood. 2002; 99:1928-1937.217. Sawyers, CL, Hochhaus, A, Feldman, E, Goldman, JM, Miller, CB, Ottmann, OG, et al.Imatinib induces hematologic and cytogenetic responses in patients with chronic myelogenousleukemia in myeloid blast crisis: results of a phase II study. Blood. 2002; 99:3530-3539.218. Apperley, JF. Part II: Management of resistance to imatinib in chronic myeloid leukaemia.Lancet Oncol. 2007; 8:1116-1128.219. Goldman, JM. How I treat chronic myeloid leukemia in the imatinib era. Blood. 2007;110:2828-2837.220. Dazzi, F, Fozza, C. Disease relapse after haematopoietic stem cell transplantation: Riskfactors and treatment. Best Pract Res Clin Haematol. 2007; 20:311-327.221. Savani, BN, Montero, A, Kurlander, R, Childs, R, Hensel, N, Barrett, AJ. Imatinibsynergizes with donor lymphocyte infusions to achieve rapid molecular remission of CMLrelapsing after allogeneic stem cell transplantation. Bone Marrow Transplant. 2005; 36:1009-1015.222. Hofmann, WK, Komor, M, Hoelzer, D, Ottmann, OG. Mechanisms of resistance toSTI571 (Imatinib) in Philadelphia-chromosome positive acute lymphoblastic leukemia. LeukLymphoma. 2004; 45:655-660.223. Hochhaus, A, La Rosee, P. Imatinib therapy in chronic myelogenous leukemia: strategiesto avoid and overcome resistance. Leukemia. 2004; 18:1321-1331.224. Hochhaus, Erben, Ernst, Mueller. Resistance to Targeted Therapy in Chronic MyelogenousLeukemia. Semin Hematol. 2007; 44:15-24.225. Apperley, JF. Part I: Mechanisms of resistance to imatinib in chronic myeloid leukaemia.Lancet Oncol. 2007; 8:1018-1029.226. le Coutre, P, Tassi, E, Varella-Garcia, M, Barni, R, Mologni, L, Cabrita, G, et al. Inductionof resistance to the Abelson inhibitor STI571 in human leukemic cells through gene amplification.Blood. 2000; 95:1758-1766.227. Mahon, FX, Deininger, MW, Schultheis, B, Chabrol, J, Reiffers, J, Goldman, JM, et al.Selection and characterization of BCR-ABL positive cell lines with differential sensitivity to thetyrosine kinase inhibitor STI571: diverse mechanisms of resistance. Blood. 2000; 96:1070-1079.228. Gorre, ME, Mohammed, M, Ellwood, K, Hsu, N, Paquette, R, Rao, PN, et al. Clinicalresistance to STI-571 cancer therapy caused by BCR-ABL gene mutation or amplification.Science. 2001; 293:876-880.229. Hochhaus, A, Kreil, S, Corbin, AS, La Rosee, P, Muller, MC, Lahaye, T, et al. Molecularand chromosomal mechanisms of resistance to imatinib (STI571) therapy. Leukemia. 2002;16:2190-2196.230. Tipping, AJ, Mahon, FX, Lagarde, V, Goldman, JM, Melo, JV. Restoration of sensitivityto STI571 in STI571-resistant chronic myeloid leukemia cells. Blood. 2001; 98:3864-3867.231. Jabbour, E, Kantarjian, H, Jones, D, Talpaz, M, Bekele, N, O'Brien, S, et al. Frequency andclinical significance of BCR-ABL mutations in patients with chronic myeloid leukemia treatedwith imatinib mesylate. Leukemia. 2006; 20:1767-1773.

88

232. Shah, NP, Nicoll, JM, Nagar, B, Gorre, ME, Paquette, RL, Kuriyan, J, et al. MultipleBCR-ABL kinase domain mutations confer polyclonal resistance to the tyrosine kinase inhibitorimatinib (STI571) in chronic phase and blast crisis chronic myeloid leukemia. Cancer Cell. 2002;2:117-125.233. Bradeen, HA, Eide, CA, O'Hare, T, Johnson, KJ, Willis, SG, Lee, FY, et al. Comparison ofimatinib mesylate, dasatinib (BMS-354825), and nilotinib (AMN107) in an N-ethyl-N-nitrosourea(ENU)-based mutagenesis screen: high efficacy of drug combinations. Blood. 2006; 108:2332-2338.234. O'Hare, T, Walters, DK, Stoffregen, EP, Jia, T, Manley, PW, Mestan, J, et al. In vitroactivity of Bcr-Abl inhibitors AMN107 and BMS-354825 against clinically relevant imatinib-resistant Abl kinase domain mutants. Cancer Res. 2005; 65:4500-4505.235. Shah, NP, Tran, C, Lee, FY, Chen, P, Norris, D, Sawyers, CL. Overriding imatinibresistance with a novel ABL kinase inhibitor. Science. 2004; 305:399-401.236. Roskoski, R. STI-571: an anticancer protein-tyrosine kinase inhibitor. Biochem BiophysRes Commun. 2003; 309:709-717.237. Deininger, M, Buchdunger, E, Druker, BJ. The development of imatinib as a therapeuticagent for chronic myeloid leukemia. Blood. 2005; 105:2640-2653.238. Melo, JV, Chuah, C. Resistance to imatinib mesylate in chronic myeloid leukaemia.Cancer Lett. 2007; 249:121-132.239. Corbin, AS, La Rosee, P, Stoffregen, EP, Druker, BJ, Deininger, MW. Several Bcr-Ablkinase domain mutants associated with imatinib mesylate resistance remain sensitive to imatinib.Blood. 2003; 101:4611-4614.240. O'Hare, T, Eide, CA, Deininger, MW. Bcr-Abl kinase domain mutations, drug resistance,and the road to a cure for chronic myeloid leukemia. Blood. 2007; 110:2242-2249.241. Roche-Lestienne, C, Soenen-Cornu, V, Grardel-Duflos, N, Lai, JL, Philippe, N, Facon, T,et al. Several types of mutations of the Abl gene can be found in chronic myeloid leukemiapatients resistant to STI571, and they can pre-exist to the onset of treatment. Blood. 2002;100:1014-1018.242. Willis, SG, Lange, T, Demehri, S, Otto, S, Crossman, L, Niederwieser, D, et al. High-sensitivity detection of BCR-ABL kinase domain mutations in imatinib-naive patients: correlationwith clonal cytogenetic evolution but not response to therapy. Blood. 2005; 106:2128-2137.243. Khorashad, JS, Anand, M, Marin, D, Saunders, S, Al-Jabary, T, Iqbal, A, et al. Thepresence of a BCR-ABL mutant allele in CML does not always explain clinical resistance toimatinib. Leukemia. 2006; 20:658-663.244. Martinelli, G, Soverini, S, Rosti, G, Baccarani, M. Dual tyrosine kinase inhibitors inchronic myeloid leukemia. Leukemia. 2005; 19:1872-1879.245. Baccarani, M, Pane, F, Saglio, G. Monitoring treatment of chronic myeloid leukemia.Haematologica. 2008; 93:161-169.246. Heaney, NB, Holyoake, TL. Therapeutic targets in chronic myeloid leukaemia. HematolOncol. 2007; 25:66-75.247. Leonard, GD, Fojo, T, Bates, SE. The Role of ABC Transporters in Clinical Practice.Oncologist. 2003; 8:411-424.248. Raaijmakers, MHGP. ATP-binding-cassette transporters in hematopoietic stem cells andtheir utility as therapeutical targets in acute and chronic myeloid leukemia. Leukemia. 2007;21:2094-2102.249. Illmer, T, Schaich, M, Platzbecker, U, Freiberg-Richter, J, Oelschlagel, U, von Bonin, M,et al. P-glycoprotein-mediated drug efflux is a resistance mechanism of chronic myelogenousleukemia cells to treatment with imatinib mesylate. Leukemia. 2004; 18:401-408.250. Thomas, J, Wang, L, Clark, RE, Pirmohamed, M. Active transport of imatinib into and outof cells: implications for drug resistance. Blood. 2004; 104:3739-3745.251. Mahon, F-X, Belloc, F, Lagarde, V, Chollet, C, Moreau-Gaudry, F, Reiffers, J, et al.MDR1 gene overexpression confers resistance to imatinib mesylate in leukemia cell line models.Blood. 2003; 101:2368-2373.

89

252. Burger, H, Nooter, K. Pharmacokinetic resistance to imatinib mesylate: role of the ABCdrug pumps ABCG2 (BCRP) and ABCB1 (MDR1) in the oral bioavailability of imatinib. CellCycle. 2004; 3:1502-1505.253. Zong, Y, Zhou, S, Sorrentino, BP. Loss of P-glycoprotein expression in hematopoieticstem cells does not improve responses to imatinib in a murine model of chronic myelogenousleukemia. Leukemia. 2005; 19:1590-1596.254. Wang, L, Giannoudis, A, Lane, S, Williamson, P, Pirmohamed, M, Clark, RE. Expressionof the Uptake Drug Transporter hOCT1 is an Important Clinical Determinant of the Response toImatinib in Chronic Myeloid Leukemia. Clin Pharmacol Ther. 2007; 83:258-264.255. White, DL, Saunders, VA, Dang, P, Engler, J, Zannettino, ACW, Cambareri, AC, et al.OCT-1-mediated influx is a key determinant of the intracellular uptake of imatinib but notnilotinib (AMN107): reduced OCT-1 activity is the cause of low in vitro sensitivity to imatinib.Blood. 2006; 108:697-704.256. Crossman, LC, Druker, BJ, Deininger, MWN, Pirmohamed, M, Wang, L, Clark, RE.hOCT 1 and resistance to imatinib. Blood. 2005; 106:1133-1134.257. White, DL, Saunders, VA, Dang, P, Engler, J, Venables, A, Zrim, S, et al. Most CMLpatients who have a suboptimal response to imatinib have low OCT-1 activity: higher doses ofimatinib may overcome the negative impact of low OCT-1 activity. Blood. 2007; 110:4064-4072.258. Gambacorti-Passerini, C, le Coutre, P, Zucchetti, M, D'Incalci, M, Jorgensen, H, Elliott,M, et al. Binding of imatinib by alpha 1-acid glycoprotein. Blood. 2002; 100:367-369.259. Gambacorti-Passerini, C, Zucchetti, M, Russo, D, Frapolli, R, Verga, M, Bungaro, S, et al.{alpha}1 Acid Glycoprotein Binds to Imatinib (STI571) and Substantially Alters ItsPharmacokinetics in Chronic Myeloid Leukemia Patients. Clin Cancer Res 2003; 9:625-632.260. Jorgensen, HG, Elliott, MA, Allan, EK, Carr, CE, Holyoake, TL, Smith, KD. Alpha1-acidglycoprotein expressed in the plasma of chronic myeloid leukemia patients does not mediatesignificant in vitro resistance to STI571. Blood. 2002; 99:713-715.261. Jorgensen, HG, Elliott, MA, Paterson, S, Holyoake, TL, Smith, KD. Further observationson the depated ability of AGP to bind imatinib. Blood. 2002; 100:368-369.262. Daub, H, Specht, K, Ullrich, A. Strategies to overcome resistance to targeted proteinkinase inhibitors. Nat Rev Drug Discov. 2004; 3:1001-1010.263. Donato, NJ, Wu, JY, Stapley, J, Gallick, G, Lin, H, Arlinghaus, R, et al. BCR-ABLindependence and LYN kinase overexpression in chronic myelogenous leukemia cells selected forresistance to STI571. Blood. 2003; 101:690-698.264. Dai, Y, Rahmani, M, Corey, SJ, Dent, P, Grant, S. A Bcr/Abl-independent, Lyn-dependentForm of Imatinib Mesylate (STI-571) Resistance Is Associated with Altered Expression of Bcl-2. JBiol Chem. 2004; 279:34227-34239.265. Ptasznik, A, Nakata, Y, Kalota, A, Emerson, SG, Gewirtz, AM. Short interfering RNA(siRNA) targeting the Lyn kinase induces apoptosis in primary, and drug-resistant, BCR-ABL1(+)leukemia cells. Nat Med. 2004; 10:1187-1189.266. Weisberg, E, Manley, PW, Cowan-Jacob, SW, Hochhaus, A, Griffin, JD. Secondgeneration inhibitors of BCR-ABL for the treatment of imatinib-resistant chronic myeloidleukaemia. Nat Rev Cancer. 2007; 7:345-356.267. Lombardo, LJ, Lee, FY, Chen, P, Norris, D, Barrish, JC, Behnia, K, et al. Discovery of N-(2-chloro-6-methyl- phenyl)-2-(6-(4-(2-hydroxyethyl)- piperazin-1-yl)-2-methylpyrimidin-4-ylamino)thiazole-5-carboxamide (BMS-354825), a dual Src/Abl kinase inhibitor with potentantitumor activity in preclinical assays. J Med Chem. 2004; 47:6658-6661.268. Melnick, JS, Janes, J, Kim, S, Chang, JY, Sipes, DG, Gunderson, D, et al. An efficientrapid system for profiling the cellular activities of molecular libraries. Proc Natl Acad Sci U S A.2006; 103:3153-3158.269. Burgess, MR, Skaggs, BJ, Shah, NP, Lee, FY, Sawyers, CL. Comparative analysis of twoclinically active BCR-ABL kinase inhibitors reveals the role of conformation-specific binding inresistance. Proc Natl Acad Sci U S A. 2005; 102:3395-3400.

90

270. Tokarski, JS, Newitt, JA, Chang, CYJ, Cheng, JD, Wittekind, M, Kiefer, SE, et al. TheStructure of Dasatinib (BMS-354825) Bound to Activated ABL Kinase Domain Elucidates ItsInhibitory Activity against Imatinib-Resistant ABL Mutants. Cancer Res. 2006; 66:5790-5797.271. Giannoudis, A, Davies, A, Lucas, CM, Harris, RJ, Pirmohamed, M, Clark, RE. UnlikeImatinib, Dasatinib Uptake into Chronic Myeloid Leukaemia Cells Is Independent of hOCT1Expression. Abstract. The American Society of Hematology 2007 Annual Meeting. Atlanta,Georgia, USA: Blood; 2007; 110:3458.272. Hiwase, DK, White, DL, Saunders, VA, Dang, P, Venables, A, Eadie, L, et al. In Contrastto Imatinib, OCT-1 Mediated Influx Has Minimal Impact on Cellular Uptake of Dasatinib in CMLPatients at Diagnosis. Abstract. The American Society of Hematology 2007 Annual Meeting.Atlanta, Georgia, USA: Blood; 2007; 110:1937.273. Kamath, AV, Wang, J, Lee, FY, Marathe, PH. Preclinical pharmacokinetics and in vitrometabolism of dasatinib (BMS-354825): a potent oral multi-targeted kinase inhibitor against SRCand BCR-ABL. Cancer Chemother Pharmacol. 2008; 61:365-376.274. Cortes, J, Rousselot, P, Kim, D-W, Ritchie, E, Hamerschlak, N, Coutre, S, et al. Dasatinibinduces complete hematologic and cytogenetic responses in patients with imatinib-resistant or -intolerant chronic myeloid leukemia in blast crisis. Blood. 2007; 109:3207-3213.275. Guilhot, F, Apperley, J, Kim, D-W, Bullorsky, EO, Baccarani, M, Roboz, GJ, et al.Dasatinib induces significant hematologic and cytogenetic responses in patients with imatinib-resistant or -intolerant chronic myeloid leukemia in accelerated phase. Blood. 2007; 109:4143-4150.276. Hochhaus, A, Kantarjian, HM, Baccarani, M, Lipton, JH, Apperley, JF, Druker, BJ, et al.Dasatinib induces notable hematologic and cytogenetic responses in chronic-phase chronicmyeloid leukemia after failure of imatinib therapy. Blood. 2007; 109:2303-2309.277. Ottmann, O, Dombret, H, Martinelli, G, Simonsson, B, Guilhot, F, Larson, RA, et al.Dasatinib induces rapid hematologic and cytogenetic responses in adult patients with Philadelphiachromosome positive acute lymphoblastic leukemia with resistance or intolerance to imatinib:interim results of a phase 2 study. Blood. 2007; 110:2309-2315.278. Talpaz, M, Shah, NP, Kantarjian, H, Donato, N, Nicoll, J, Paquette, R, et al. Dasatinib inimatinib-resistant Philadelphia chromosome-positive leukemias. N Engl J Med. 2006; 354:2531-2541.279. Hu, Y, Liu, Y, Pelletier, S, Buchdunger, E, Warmuth, M, Fabbro, D, et al. Requirement ofSrc kinases Lyn, Hck and Fgr for BCR-ABL1-induced B-lymphoblastic leukemia but not chronicmyeloid leukemia. Nat Genet. 2004; 36:453-461.280. Hu, Y, Swerdlow, S, Duffy, TM, Weinmann, R, Lee, FY, Li, S. Targeting multiple kinasepathways in leukemic progenitors and stem cells is essential for improved treatment of Ph+leukemia in mice. Proc Natl Acad Sci U S A. 2006; 103:16870-16875.281. Pfeifer, H, Wassmann, B, Hofmann, WK, Komor, M, Scheuring, U, Bruck, P, et al. Riskand prognosis of central nervous system leukemia in patients with Philadelphia chromosome-positive acute leukemias treated with imatinib mesylate. Clin Cancer Res. 2003; 9:4674-4681.282. Takayama, N, Sato, N, O'Brien, SG, Ikeda, Y, Okamoto, S. Imatinib mesylate has limitedactivity against the central nervous system involvement of Philadelphia chromosome-positiveacute lymphoblastic leukaemia due to poor penetration into cerebrospinal fluid. Br J Haematol.2002; 119:106-108.283. Abdelhalim, A, Barcos, M, Block, AW, Sait, SN, Starostik, P, Wetzler, M, et al. Remissionof Philadelphia chromosome-positive central nervous system leukemia after dasatinib therapy.Leuk Lymphoma. 2007; 48:1053-1056.284. Koskenvesa, P, Rimpiläinen, J, Lundán, T, Mustjoki, S, Brethon, B, Hjorth-Hansen, H, etal. Dasatinib is an effective treatment of central nervous system Ph-positive leukemia. Abstract.12th Congress of the European Hematology Association. Vienna, Austria: Haematologica; 2007;92 (suppl.2):113.285. Weisberg, E, Manley, PW, Breitenstein, W, Bruggen, J, Cowan-Jacob, SW, Ray, A, et al.Characterization of AMN107, a selective inhibitor of native and mutant Bcr-Abl. Cancer Cell.2005; 7:129-141.

91

286. Davies, A, Giannoudis, A, Lucas, CM, Harris, RJ, Manley, PW, Pirmohamed, M, et al.Characterisation of Nilotinib Transport in Chronic Myeloid Leukaemia Cells. Abstract. TheAmerican Society of Hematology 2007 Annual Meeting. Atlanta, Georgia, USA: Blood; 2007;110:2364.287. le Coutre, P, Ottmann, OG, Giles, F, Kim, DW, Cortes, J, Gattermann, N, et al. Nilotinib(formerly AMN107), a highly selective BCR-ABL tyrosine kinase inhibitor, is active in patientswith imatinib-resistant or -intolerant accelerated-phase chronic myelogenous leukemia. Blood.2008; 111:1834-1839.288. Kantarjian, HM, Giles, F, Gattermann, N, Bhalla, K, Alimena, G, Palandri, F, et al.Nilotinib (formerly AMN107), a highly selective BCR-ABL tyrosine kinase inhibitor, is effectivein patients with Philadelphia chromosome positive chronic myelogenous leukemia in chronicphase following imatinib resistance and intolerance. Blood. 2007; 110:3540-3546.289. Hughes, T, Saglio, G, Martinelli, G, Kim, D-W, Soverini, S, Mueller, M, et al. Responsesand Disease Progression in CML-CP Patients Treated with Nilotinib after Imatinib Failure AppearTo Be Affected by the BCR-ABL Mutation Status and Types. Abstract. The American Society ofHematology 2007 Annual Meeting. Atlanta, Georgia, USA: Blood; 2007; 110:320.290. Golas, JM, Arndt, K, Etienne, C, Lucas, J, Nardin, D, Gibbons, J, et al. SKI-606, a 4-anilino-3-quinolinecarbonitrile dual inhibitor of Src and Abl kinases, is a potent antiproliferativeagent against chronic myelogenous leukemia cells in culture and causes regression of K562xenografts in nude mice. Cancer Res. 2003; 63:375-381.291. Puttini, M, Coluccia, AM, Boschelli, F, Cleris, L, Marchesi, E, Donella-Deana, A, et al. Invitro and in vivo activity of SKI-606, a novel Src-Abl inhibitor, against imatinib-resistant Bcr-Abl+ neoplastic cells. Cancer Res. 2006; 66:11314-11322.292. Kimura, S, Naito, H, Segawa, H, Kuroda, J, Yuasa, T, Sato, K, et al. NS-187, a potent andselective dual Bcr-Abl/Lyn tyrosine kinase inhibitor, is a novel agent for imatinib-resistantleukemia. Blood. 2005; 106:3948-3954.293. Yokota, A, Kimura, S, Masuda, S, Ashihara, E, Kuroda, J, Sato, K, et al. INNO-406, anovel BCR-ABL/Lyn dual tyrosine kinase inhibitor, suppresses the growth of Ph+ leukemia cellsin the central nervous system, and cyclosporine A augments its in vivo activity. Blood. 2007;109:306-314.294. Ray, A, Cowan-Jacob, SW, Manley, PW, Mestan, J, Griffin, JD. Identification of BCR-ABL point mutations conferring resistance to the Abl kinase inhibitor AMN107 (nilotinib) by arandom mutagenesis study. Blood. 2007; 109:5011-5015.295. von Bubnoff, N, Manley, PW, Mestan, J, Sanger, J, Peschel, C, Duyster, J. Bcr-Ablresistance screening predicts a limited spectrum of point mutations to be associated with clinicalresistance to the Abl kinase inhibitor nilotinib (AMN107). Blood. 2006; 108:1328-1333.296. Soverini, S, Martinelli, G, Colarossi, S, Gnani, A, Castagnetti, F, Rosti, G, et al. Presenceor the emergence of a F317L BCR-ABL mutation may be associated with resistance to dasatinib inPhiladelphia chromosome-positive leukemia. J Clin Oncol. 2006; 24:e51-52.297. Soverini, S, Colarossi, S, Gnani, A, Castagnetti, F, Rosti, G, Bosi, C, et al. Resistance todasatinib in Philadelphia-positive leukemia patients and the presence or the selection of mutationsat residues 315 and 317 in the BCR-ABL kinase domain. Haematologica. 2007; 92:401-404.298. Soverini, S, Martinelli, G, Colarossi, S, Gnani, A, Rondoni, M, Castagnetti, F, et al.Second-line treatment with dasatinib in patients resistant to imatinib can select novel inhibitor-specific BCR-ABL mutants in Ph+ ALL. Lancet Oncol. 2007; 8:273-274.299. Shah, NP, Skaggs, BJ, Branford, S, Hughes, TP, Nicoll, JM, Paquette, RL, et al. SequentialABL kinase inhibitor therapy selects for compound drug-resistant BCR-ABL mutations withaltered oncogenic potency. J Clin Invest. 2007; 117:2562-2569.300. Silver, RT, Woolf, SH, Hehlmann, R, Appelbaum, FR, Anderson, J, Bennett, C, et al. AnEvidence-Based Analysis of the Effect of Busulfan, Hydroxyurea, Interferon, and Allogeneic BoneMarrow Transplantation in Treating the Chronic Phase of Chronic Myeloid Leukemia: Developedfor the American Society of Hematology. Blood. 1999; 94:1517-1536.

92

301. Giles, FJ, Cortes, J, Jones, D, Bergstrom, D, Kantarjian, H, Freedman, SJ. MK-0457, anovel kinase inhibitor, is active in patients with chronic myeloid leukemia or acute lymphocyticleukemia with the T315I BCR-ABL mutation. Blood. 2007; 109:500-502.302. European LeukemiaNet, E. CML Pocket Card http://eln.zms-hosting.com/sites/leukemia-net/content/e58/e495/e5698/e5699 ed. Hellenbrecht, A. European Leukemia Information Center(ELIC), 2007.303. Verma, RS, Babu, A. Banding techniques: G-bands by trypsin using Giemsa (GTG). In:Human chromosomes: manual of basic techniques. New York: Pergamon Press, Inc., 1989:47-49.304. ISCN. ISCN 1995 An International System for Human Cytogenetic Nomenclature.Recommendations of the International Standing Committee on Human Cytogenetic NomenclatureBasel: S. Karger, 1995.305. el Rifai, W, Knuutila, S. Fluorescent in situ hybridization on archival G-banded slides.Cytogenet Cell Genet. 1996; 73:322-324.306. Fritz, B, Kuster, W, Orstavik, KH, Naumova, A, Spranger, J, Rehder, H. Pigmentarymosaicism in hypomelanosis of Ito. Further evidence for functional disomy of Xp. Hum Genet.1998; 103:441-449.307. Rieder, H, Bonwetsch, C, Janssen, LA, Maurer, J, Janssen, JW, Schwartz, S, et al. Highrate of chromosome abnormalities detected by fluorescence in situ hybridization using BCR andABL probes in adult acute lymphoblastic leukemia. Leukemia. 1998; 12:1473-1481.308. Hamalainen, MM, Eskola, JU, Hellman, J, Pulkki, K. Major interference from leukocytesin reverse transcription-PCR identified as neurotoxin ribonuclease from eosinophils: detection ofresidual chronic myelogenous leukemia from cell lysates by use of an eosinophil-depleted cellpreparation. Clin Chem. 1999; 45:465-471.309. Perkins, SL. Examination of blood and bone marrow. In: Wintrobe's Clinical Hematology.Greer, J, Foerster, J, Lukens, JN, Rodgers, GM, Paraskevas, F, Glader, BE eds. 11th ed.Philadelphia: Lippincott Williams & Wilkins, 2003.310. Lucio, P, Parreira, A, van den Beemd, MW, van Lochem, EG, van Wering, ER, Baars, E,et al. Flow cytometric analysis of normal B cell differentiation: a frame of reference for thedetection of minimal residual disease in precursor-B-ALL. Leukemia. 1999; 13:419-427.311. Gruber, FX, Hjorth-Hansen, H, Mikkola, I, Stenke, L, Johansen, T. A novel Bcr-Abl spliceisoform is associated with the L248V mutation in CML patients with acquired resistance toimatinib. Leukemia. 2006; 20:2057-2060.312. Branford, S, Rudzki, Z, Walsh, S, Grigg, A, Arthur, C, Taylor, K, et al. High frequency ofpoint mutations clustered within the adenosine triphosphate-binding region of BCR/ABL inpatients with chronic myeloid leukemia or Ph-positive acute lymphoblastic leukemia who developimatinib (STI571) resistance. Blood. 2002; 99:3472-3475.313. Soverini, S, Martinelli, G, Amabile, M, Poerio, A, Bianchini, M, Rosti, G, et al.Denaturing-HPLC-based assay for detection of ABL mutations in chronic myeloid leukemiapatients resistant to Imatinib. Clin Chem. 2004; 50:1205-1213.314. Branford, S, Rudzki, Z, Parkinson, I, Grigg, A, Taylor, K, Seymour, JF, et al. Real-timequantitative PCR analysis can be used as a primary screen to identify patients with CML treatedwith imatinib who have BCR-ABL kinase domain mutations. Blood. 2004; 104:2926-2932.315. Olavarria, E, Kanfer, E, Szydlo, R, Kaeda, J, Rezvani, K, Cwynarski, K, et al. Earlydetection of BCR-ABL transcripts by quantitative reverse transcriptase-polymerase chain reactionpredicts outcome after allogeneic stem cell transplantation for chronic myeloid leukemia. Blood.2001; 97:1560-1565.316. Kaeda, J, O'Shea, D, Szydlo, RM, Olavarria, E, Dazzi, F, Marin, D, et al. Serialmeasurement of BCR-ABL transcripts in the peripheral blood after allogeneic stem celltransplantation for chronic myeloid leukemia: an attempt to define patients who may not requirefurther therapy. Blood. 2006; 107:4171-4176.317. Branford, S, Rudzki, Z, Harper, A, Grigg, A, Taylor, K, Durrant, S, et al. Imatinibproduces significantly superior molecular responses compared to interferon alfa plus cytarabine inpatients with newly diagnosed chronic myeloid leukemia in chronic phase. Leukemia. 2003;17:2401-2409.

93

318. Nylund, SJ, Ruutu, T, Saarinen, U, Knuutila, S. Metaphase fluorescence in situhybridization (FISH) in the follow-up of 60 patients with haemopoietic malignancies. Br JHaematol. 1994; 88:778-783.319. Le Gouill, S, Talmant, P, Milpied, N, Daviet, A, Ancelot, M, Moreau, P, et al.Fluorescence In Situ Hybridization on Peripheral-Blood Specimens Is a Reliable Method toEvaluate Cytogenetic Response in Chronic Myeloid Leukemia. J Clin Oncol 2000; 18:1533-1538.320. Yanagi, M, Shinjo, K, Takeshita, A, Tobita, T, Yano, K, Kobayashi, M, et al. Simple andreliably sensitive diagnosis and monitoring of Philadelphia chromosome-positive cells in chronicmyeloid leukemia by interphase fluorescence in situ hybridization of peripheral blood cells.Leukemia. 1999; 13:542-552.321. Reinhold, U, Hennig, E, Leiblein, S, Niederwieser, D, Deininger, MW. FISH for BCR-ABL on interphases of peripheral blood neutrophils but not of unselected white cells correlateswith bone marrow cytogenetics in CML patients treated with imatinib. Leukemia. 2003; 17:1925-1929.322. Lange, T, Deininger, M, Brand, R, Hegenbart, U, Al-Ali, H, Krahl, R, et al. BCR-ABLtranscripts are early predictors for hematological relapse in chronic myeloid leukemia afterhematopoietic cell transplantation with reduced intensity conditioning. Leukemia. 2004; 18:1468-1475.323. Huntly, BJ, Bench, AJ, Delabesse, E, Reid, AG, Li, J, Scott, MA, et al. Derivativechromosome 9 deletions in chronic myeloid leukemia: poor prognosis is not associated with lossof ABL-BCR expression, elevated BCR-ABL levels, or karyotypic instability. Blood. 2002;99:4547-4553.324. de la Fuente, J, Merx, K, Steer, EJ, Muller, M, Szydlo, RM, Maywald, O, et al. ABL-BCRexpression does not correlate with deletions on the derivative chromosome 9 or survival in chronicmyeloid leukemia. Blood. 2001; 98:2879-2880.325. Wagner, WM, Ouyang, Q, Pawelec, G. Peptides spanning the fusion region of Abl/Bcr areimmunogenic and sensitize CD8(+) T lymphocytes to recognize native chronic myelogenousleukemia. Leukemia. 2002; 16:2341-2343.326. Nicolini, FE, Corm, S, Le, QH, Sorel, N, Hayette, S, Bories, D, et al. Mutation status andclinical outcome of 89 imatinib mesylate-resistant chronic myelogenous leukemia patients: aretrospective analysis from the French intergroup of CML (Fi(phi)-LMC GROUP). Leukemia.2006; 20:1061-1066.327. Nicolini, FE, Corm, S, Le, QH, Roche-Lestienne, C, Preudhomme, C. The prognosisimpact of BCR-ABL P-loop mutations: worse or not worse? Leukemia. 2007; 21:193-194.328. von Bubnoff, N, Peschel, C, Duyster, J. Resistance of Philadelphia-chromosome positiveleukemia towards the kinase inhibitor imatinib (STI571, Glivec): a targeted oncoprotein strikesback. Leukemia. 2003; 17:829-838.329. Khorashad, JS, Lipton, JH, Marin, D, Milojkovic, D, Cross, NCP, Dibb, N, et al.Abnormally Small BCR-ABL Transcripts in CML Patients before and during Imatinib Treatment.Abstract. The American Society of Hematology 2006 Annual Meeting. Orlando, Florida, USA:Blood; 2006; 108:2153.330. Volpe, G, Cignetti, A, Panuzzo, C, Kuka, M, Vitaggio, K, Brancaccio, M, et al. AlternativeBCR/ABL Splice Variants in Philadelphia Chromosome-Positive Leukemias Result in NovelTumor-Specific Fusion Proteins that May Represent Potential Targets for ImmunotherapyApproaches. Cancer Res. 2007; 67:5300-5307.331. Sherbenou, DW, Hantschel, O, Turaga, L, Kaupe, I, Willis, S, Bumm, T, et al.Characterization of BCR-ABL deletion mutants from patients with chronic myeloid leukemia.Leukemia. 2008; Advance online publication.332. Wang, L, Knight, K, Lucas, C, Clark, RE. The role of serial BCR-ABL transcriptmonitoring in predicting the emergence of BCR-ABL kinase mutations in imatinib-treated patientswith chronic myeloid leukemia. Haematologica. 2006; 91:235-239.

94

333. Press, RD, Galderisi, C, Yang, R, Rempfer, C, Willis, SG, Mauro, MJ, et al. A Half-LogIncrease in BCR-ABL RNA Predicts a Higher Risk of Relapse in Patients with Chronic MyeloidLeukemia with an Imatinib-Induced Complete Cytogenetic Response. Clin Cancer Res. 2007;13:6136-6143.334. Deininger, MW, McGreevey, L, Willis, S, Bainbridge, TM, Druker, BJ, Heinrich, MC.Detection of ABL kinase domain mutations with denaturing high-performance liquidchromatography. Leukemia. 2004; 18:864-871.335. Ernst, T, Erben, P, Muller, MC, Paschka, P, Schenk, T, Hoffmann, J, et al. Dynamics ofBCR-ABL mutated clones prior to hematologic or cytogenetic resistance to imatinib.Haematologica. 2008; 93:186-192.336. Gruber, FX, Lamark, T, Anonli, A, Sovershaev, MA, Olsen, M, Gedde-Dahl, T, et al.Selecting and deselecting imatinib-resistant clones: observations made by longitudinal,quantitative monitoring of mutated BCR-ABL. Leukemia. 2005; 19:2159-2165.337. Gumireddy, K, Reddy, MVR, Cosenza, SC, Nathan, RB, Baker, SJ, Papathi, N, et al.ON01910, a non-ATP-competitive small molecule inhibitor of Plk1, is a potent anticancer agent.Cancer Cell. 2005; 7:275-286.338. Neviani, P, Santhanam, R, Oaks, JJ, Eiring, AM, Notari, M, Blaser, BW, et al. FTY720, anew alternative for treating blast crisis chronic myelogenous leukemia and Philadelphiachromosome positive acute lymphocytic leukemia. J Clin Invest. 2007; 117:2408-2421.339. Luo, FR, Yang, Z, Camuso, A, Smykla, R, McGlinchey, K, Fager, K, et al. Dasatinib(BMS-354825) Pharmacokinetics and Pharmacodynamic Biomarkers in Animal Models PredictOptimal Clinical Exposure. Clin Cancer Res. 2006; 12:7180-7186.340. Fiskus, W, Pranpat, M, Bali, P, Balasis, M, Kumaraswamy, S, Boyapalle, S, et al.Combined effects of novel tyrosine kinase inhibitor AMN107 and histone deacetylase inhibitorLBH589 against Bcr-Abl-expressing human leukemia cells. Blood. 2006; 108:645-652.341. Pfeifer, H, Wassmann, B, Pavlova, A, Wunderle, L, Oldenburg, J, Binckebanck, A, et al.Kinase domain mutations of BCR-ABL frequently precede imatinib-based therapy and give rise torelapse in patients with de novo Philadelphia-positive acute lymphoblastic leukemia (Ph+ ALL).Blood. 2007; 110:727-734.342. Ernst, T, Gruber, F, Pelz-Ackermann, O, Mueller, MC, Mikkola, I, Porkka, K, et al. BCR-ABL Kinase Domain Mutations and Their Kinetics on Second Line Dasatinib or Nilotinib Therapyin CML Patients after Imatinib Failure: A Cooperative Evaluation of Four Different DetectionMethods. Abstract. The American Society of Hematology 2007 Annual Meeting. Atlanta, Georgia,USA: Blood; 2007; 110:321.343. Graham, SM, Jorgensen, HG, Allan, E, Pearson, C, Alcorn, MJ, Richmond, L, et al.Primitive, quiescent, Philadelphia-positive stem cells from patients with chronic myeloid leukemiaare insensitive to STI571 in vitro. Blood. 2002; 99:319-325.344. Jorgensen, HG, Allan, EK, Jordanides, NE, Mountford, JC, Holyoake, TL. Nilotinib exertsequipotent antiproliferative effects to imatinib and does not induce apoptosis in CD34+ CML cells.Blood. 2007; 109:4016-4019.345. Copland, M, Hamilton, A, Elrick, LJ, Baird, JW, Allan, EK, Jordanides, N, et al. Dasatinib(BMS-354825) targets an earlier progenitor population than imatinib in primary CML but does noteliminate the quiescent fraction. Blood. 2006; 107:4532-4539.346. Cortes, J, O'Brien, S, Kantarjian, H. Discontinuation of imatinib therapy after achieving amolecular response. Blood. 2004; 104:2204-2205.347. Copland, M, Pellicano, F, Richmond, L, Allan, EK, Hamilton, A, Lee, FY, et al. BMS-214662 potently induces apoptosis of chronic myeloid leukemia stem and progenitor cells andsynergizes with tyrosine kinase inhibitors. Blood. 2008; 111:2843-2853.