17
1 Catedra Biologie moleculară şi Genetică umană www.bimogeum.ucoz.com 2 Cursul Biologie moleculară Semestrul I Prelegeri 34 ore Lucrări practice – 51 ore două totalizări (lucrare scrisă + teste la calculator) teste evaluări curente pe compartimente Nota medie componentă a notei finale de la examen Examen Admiterea studenţilor cu două totalizări susţinute fără absenţe Consultaţii curente - tematice Cerc ştiinţific studenţesc 3 DORINŢĂ MUNCĂ SISTEMATICĂ INSISTENŢĂ ÎNDRĂZNEALĂ DISCIPLINĂ CREATIVITATE 4 ORGANISMELOR VII = SISTEMELOR BIOLOGICE funcţia dezvoltarea structura rel. cu mediul BIOLOGIA ŞTIINŢA DESPRE VIAŢĂ 5 BIOLOGIA Biologia moleculară Anatomia Citologia Histologia Genetica Biochimia Imunologia Ecologia Patologia Fiziologia 6 Revoluţia agricolă – sec. XVII-XVIII Revoluţia industrială – sec. XIX Revoluţia informaţională – sec. XX Revoluţia genetică – sec. XXI

Nota medie Biologie moleculară şi Genetică umanăbimogeum.ucoz.com/Biologie_moleculara/Rom/Prezentations/Introduce... · Examen Admiterea ... Conformaţia proteinelor ... Se replică

  • Upload
    haxuyen

  • View
    264

  • Download
    6

Embed Size (px)

Citation preview

Page 1: Nota medie Biologie moleculară şi Genetică umanăbimogeum.ucoz.com/Biologie_moleculara/Rom/Prezentations/Introduce... · Examen Admiterea ... Conformaţia proteinelor ... Se replică

1

1

Catedra Biologie moleculară şi

Genetică umană

www.bimogeum.ucoz.com

2

Cursul Biologie moleculară Semestrul I Prelegeri – 34 ore

Lucrări practice – 51 ore două totalizări (lucrare scrisă + teste la calculator)

teste – evaluări curente pe compartimente

Nota medie – componentă a notei finale de la examen

Examen Admiterea studenţilor

cu două totalizări susţinute

fără absenţe

Consultaţii curente - tematice

Cerc ştiinţific studenţesc

3

DORINŢĂ

MUNCĂ SISTEMATICĂ

INSISTENŢĂ

ÎNDRĂZNEALĂ

DISCIPLINĂ

CREATIVITATE

4

ORGANISMELOR VII = SISTEMELOR BIOLOGICE

funcţia dezvoltarea structura rel. cu mediul

BIOLOGIA

ŞTIINŢA DESPRE VIAŢĂ

5

BIOLOGIA

Biologia

moleculară

Anatomia

Citologia Histologia

Genetica

Biochimia

Imunologia Ecologia

Patologia

Fiziologia

6

Revoluţia agricolă – sec. XVII-XVIII

Revoluţia industrială – sec. XIX

Revoluţia informaţională – sec. XX

Revoluţia genetică – sec. XXI

Page 2: Nota medie Biologie moleculară şi Genetică umanăbimogeum.ucoz.com/Biologie_moleculara/Rom/Prezentations/Introduce... · Examen Admiterea ... Conformaţia proteinelor ... Se replică

2

7

Sisteme de

organe

Organe

Ţesuturi

Celule

Macromolecule

Micromolecule

Obiectul

BIOLOGIEI

MOLECULARE

23 mol

ADN

23

ADN

46 mol

ADN

46 mol

ADN

46 mol

ADN

46 mol

ADN 46 mol

ADN

Celule limfatice – 374

Celule endoteliale – 1031

Glande salivare – 17

Glanda tiroidă – 584

Glande paratiroide – 46

Muşchi netezi – 127

Glande mamare – 696

Pancreas – 1094

Splina – 1094

Suprarenale – 658

Vezica biliară – 788

Intestinul subţire – 297

Placenta – 1290

Muşchi striaţi – 735

Prostata – 1283

Leucocite – 2164

Creier – 3195 gene

Ochi – 547 gene

Oase – 904 gene

Ţesut adipos – 581 gene

Timus – 261 gene

Esofag – 76 gene

Plămâni – 1887 gene

Inima – 1195 gene

Ficatul – 2091 gene

Eritrocite – 8 gene

Trombocite – 22 gene

Intestinul gros – 874 gene

Rinichi – 712 gene

Testicul – 370 gene

Ovar – 504 gene

Uter – 1859 gene

Embrion – 1989 gene

Piele – 620 Tunica sinovială – 813 gene

Gene implicate în dezvoltarea şi

funcţionarea organelor şi

ţesuturilor la om

11

Unităţi de măsură în BM De lungime

1 mm = 10-3 m

1 μm = 10-6 m

1 nm = 10-9m

1 = Å 10-10 m

De greutate 1 Da = 1,66.. X10-24g (1uc)

kDa = 1000 Da

Dimensiuni AN 1 pb = 1pn

1 Kb = 1000 pn

1 Mb = 1 000 000 pn

Coeficient de sedimentare la centifugare S

Page 3: Nota medie Biologie moleculară şi Genetică umanăbimogeum.ucoz.com/Biologie_moleculara/Rom/Prezentations/Introduce... · Examen Admiterea ... Conformaţia proteinelor ... Se replică

3

13

Importanţa BM în medicină

Asigură înţelegerea organizării şi funcţionării tuturor organismelor

Stă la baza altor ştiinţe bio-medicale

Genetica

Biochimia

Fiziologia

Fiziopatologia

Farmacologia

Asigură înţelegerea mecanismelor de apariţie a maladiilor

Stă la baza metodelor contemporane de diagnostic

Stă la baza elaborării medicamentelor de generaţie nouă

14

Unitatea structurală, funcţională a viului - celula

15

ORGANISM VIU

Sistem deschis cu schimb permanent cu mediul de: substanţe;

energie;

informaţie.

Sistem caracterizat prin: autoreproducere

autoreglare

autoreînnoire

Sistem ce are un program: codificat în moleculele ADN

realizat prin sinteza ARN şi proteine

16

CELULA

Compoziţia chimică

Structura generală

Diversitatea

Proprietăţi

Funcţii

Integralitate

17

Compoziţie chimică

18

Setul de componente necesare: Organizarea generală a celulei

Membrana citoplasmatică

Citoplasma cu organite

Nucleul

Aparatul

metabolic

Sinteză SO

Scindare SO

Detoxifiere

Energetic

Semnalizare

Aparatul

genetic Material genetic

Aparat de

replicare

Aparat de

reparare

Aparat de

transcripţie

Aparatul

superficial

Barieră

Transport

Recepţie

Contacte cel.

Apărare

Page 4: Nota medie Biologie moleculară şi Genetică umanăbimogeum.ucoz.com/Biologie_moleculara/Rom/Prezentations/Introduce... · Examen Admiterea ... Conformaţia proteinelor ... Se replică

4

19

Celula procariotă

Celula eucariotă

Celula procatiotă

Fără nucleu

Membrana celulară glico-lipo-

proteică

Citoplasma

necompartimentalizată

Materilalul genetic:

Nucleoidul – molecula ADN

inelară, fixată de membrana

plasmatică

Plasmide – mol ADN mici

inelare

Expresia IG

Transcripţie

Translaţie

Transmiterea IG

Replicarea ADN

Diviziunea directă a cel

(amitoza)

Mod de organizare:

Organisme monocelulare

Celula eucatiotă Cu nucleu bine diferenţiat

Membrana celulară glico-lipo-proteică

Citoplasma compartimentalizată în mai multe organite membranare

Materilalul genetic:

mol ADN lineare compactizate sub formă de cromatina sau cromozomi

mol ADN mitocondrial, mici inelare

Expresia IG

Transcripţie

Processing ARN

Transfer ARN din nucleu în citoplasma

Translaţie

Conformaţia proteinelor

Transmiterea IG

Replicarea ADN

Diviziune indirectă a cel (mitoza, meioza)

Mod de organizare:

Organisme monocelulare

Organisme pluricelulare

21

Diversitatea celulelor organismului uman

•Organismul uman – alcătuit din ~200 tipuri celule

•Celulele conţin material genetic identic

•Celulele au structură asemănătoare, dar formă diferită

•Celulele au proprietăţi şi funcţii diferite, determinate de

expresia diferenţiată a informaţiei genetice

22

Diversitatea celulelor organismului uman

Diferite celule ale organismului au

genom identic + proteinom diferit

23

Tema 1 Macromoleculele = biopolimerii

Tipuri

Structură

Biogeneză

Proprietăţi

Funcţii

Localizare

Interacţiuni

24

STRUCTURA PROPRIETĂŢILE

FUNCŢIILE celulei

bazate pe un substrat molecular

ADN – conţine informaţia

ARN – asigură sinteza proteinelor

Proteinele – asigură vitalitatea

Page 5: Nota medie Biologie moleculară şi Genetică umanăbimogeum.ucoz.com/Biologie_moleculara/Rom/Prezentations/Introduce... · Examen Admiterea ... Conformaţia proteinelor ... Se replică

5

25 26

Relaţiile macromoleculelor în celulă

ADN ARN Proteine

Hidraţi de carbon

Lipide

Transcripţie Translaţie

Cataliză - sinteză

27

Funcţiile principale ale macromoleculelor

ADN ?

ARN ?

Proteine ?

Hidraţii de carbon (glucide) ?

Lipide ?

Complexe supramoleculare

ADN + proteine = DNP

(dezoxiribonucleooproteide)

ex.: cromosomii

ARN + proteine = RNP (ribonucleooproteide)

ex.: ribosomii

Lipide + proteine = lipoproteide

ex.: membrana plasmatică

Glucide + proteine = glicoproteide

ex.: acidul glucuronic

DNP RNP

Page 6: Nota medie Biologie moleculară şi Genetică umanăbimogeum.ucoz.com/Biologie_moleculara/Rom/Prezentations/Introduce... · Examen Admiterea ... Conformaţia proteinelor ... Se replică

6

Membrane Localizarea macromoleculelor în celulele umane

ADN

Localizat ….

Sintetizat ….

ARN

Localizat …..

Sintetizat ……

Proteine

Localizate …..

Sintetizate ……

Lipide

Localizate …..

Sintetizate …..

Glucide

Localizate …..

Sintetizate …..

33

Structura macromoleculelor Structura primară

lanţ de mai mulţi monomeri

uniţi prin legături covalente

Structura secundară

Plicaturarea lanţului polimeric

legături de hidrogen

Structura terţiară

Configuraţia tridimensională funcţională

legături de hidrogen, ionice, electrostatice

Structura cuaternară, supramoleculară

Combinaţia mai multor polimeri

legături de hidrogen, ionice, electrostatice

34

Monomer Dimer Trimer

Tetramer Pentamer

Polimer

dN

N

a.a.

dN dN dN

dN dN dN

N N N

N N N

a.a. a.a.

a.a. a.a. a.a. a.a.

dezoxiribonucleotid

ribonucleotid

aminoacid

MONOMER POLIMER

Catenă ADN

Catenă ARN

Catenă polipeptidică =

proteină

Structura macromoleculelor Monomeri ADN (acid dezoxiribonucleic):

4 tipuri de dezoxiribonucleotide (dNTP→dNMP)

dATP (deoxi-adenozin-trifosfat) → dAMP (deoxi-adenozin-monofosfat)

dGTP (deoxi-guanozin-trifosfat) → dGMP (deoxi-guanozin-monofosfat)

dCTP (deoxi-cimitidin-trifosfat) → dCMP (deoxi-cimitidin-monofosfat)

dTTP (deoxi-timitidin-trifosfat) → dTMP (deoxi-timitidin-monofosfat)

Monomeri ARN – acid ribonucleic:

4 tipuri de ribonucleotide (NTP→NMP)

ATP (adenozin-trifosfat) → AMP (adenozin-monofosfat)

GTP (guanozin-trifosfat) → GMP (guanozin-monofosfat)

CTP (cimitidin-trifosfat) → CMP (cimitidin-monofosfat)

UTP (uridin-trifosfat) → UMP (uridin-monofosfat)

Monomeri ai proteinelor:

20 tipuri de aminoacizi (bazici, acizi, neutri)

Ala

Val

Ser

His

Pro

....

Page 7: Nota medie Biologie moleculară şi Genetică umanăbimogeum.ucoz.com/Biologie_moleculara/Rom/Prezentations/Introduce... · Examen Admiterea ... Conformaţia proteinelor ... Se replică

7

37

Structura macromoleculelor

Structura primară ADN Catena polinucleotidică

nucleotidele polimerizează prin legături covalente fosfodiesterice;

ordinea nucleotidelor este aleatorie = codul genetic;

5' AGTGCATACGTACGGACATT ... 3‘

Structura primară ARN Catena polinucleotidică

nucleotidele polimerizează prin legături covalente fosfodiesterice;

ordinea nucleotidelor este copia ADNului;

5' AGUGCAUACGUACGGACAUU ... 3‘

Structura primară a proteinelor Lanţ polipeptidic

Aminoacizii polimerizează prin legături covalente peptidice

Ordinea aminoacizilor este determinată de ordinea codonilor în ARNm (copia unei secvenţe din ADN)

NH2.Ser-Ala-Tyr-Val-Arg-Thr...

Page 8: Nota medie Biologie moleculară şi Genetică umanăbimogeum.ucoz.com/Biologie_moleculara/Rom/Prezentations/Introduce... · Examen Admiterea ... Conformaţia proteinelor ... Se replică

8

Structura macromoleculelor Structura secundară ADN

Două catene unite prin punţi de H: Complementare – AT şi G C;

Antiparalele;

Dubluspiralate;

Structura secundară ARN Plierea catenei poliribonucleotidice:

bucle prin unirea (punţi de H) complementară a b.a. (AU şi G C)

Fiecare buclă = situs funcţional:

Conformaţia buclelor, numărul lor este specifică fiecărui ARN în parte.

Structura secundară a proteinelor Plierea catenei polipeptidice (punţi de H)

-spirale

-structuri

5' A T G C A T A C G T A C G A T 3‘

3‘ T A C G T A T G C A T G C T A 5'

Structura macromoleculelor

Structura terţiară a ADN

ADN+proteine histone+proteine non-histone

Cromatina

cromozomul

Structura terţiară a ARN

ARN+proteine

ARNr+proteine ribozomale ???

ARNt+proteine

ARNm+proteine

Structura terţiară a proteinelor

Plierea -spiralelor şi -structurilor prin punţi biS

Forma globulară

Structura macromoleculelor Structura cuaternară a proteinelor

Combinarea funcţională a mai multor polipeptide

Ex:

2 -globine + 2 -globine = Hb

2 -peptide + 2 -peptide = receptor insulinic

2 catene L (light) + 2 catene H (heavy) = Ig (Ac)

(-tubulia + -tubulina)n = microtubuli

…..

47

Acizii nucleici

ADN:

molecule bicatenare;

deţine informaţia genetică codificată

despre....

ARN – molecule monocatenare:

ARNm – copia IG, matriţa pentru sinteza proteinelor

ARNt – transportă aminoacizi, translatori ai codului genetic

ARNr – component al ribozomilor, controlul translaţiei

microARN – reglarea expresiei IG

48

Page 9: Nota medie Biologie moleculară şi Genetică umanăbimogeum.ucoz.com/Biologie_moleculara/Rom/Prezentations/Introduce... · Examen Admiterea ... Conformaţia proteinelor ... Se replică

9

49

ADN acid dezoxiribonucleic

Monomeri

Structura

Primară

Secundară

Terţiară

Localizare

Proprietăţi

Funcţii

Sinteză

Particularităţile ADN uman

Metode de studiu

Momomerul ADN

N

P P P

3’

C

C C

C

C

O

2’

4’

5’

1’

α β γ

dNTP – nucleotid – nucleozid trifosfat

nucleozid

N – baza azotată

-Pu – Adenina

Guanina

-Py – Timina

Citozina

51

dNMP = monomeri ADN

Monomer – nucleotidele (dNMP)

Structura primară:

catena polinucleotidică

Structura secundară:

bicatenară

54

Structura ADN

I – catena polinucleotidică

II – dublul helix = două catene spiralizate

unite prin legături de hidrogen

III – DNP = dezoxiribonucleoproteid

Page 10: Nota medie Biologie moleculară şi Genetică umanăbimogeum.ucoz.com/Biologie_moleculara/Rom/Prezentations/Introduce... · Examen Admiterea ... Conformaţia proteinelor ... Se replică

10

55

Structura primară a ADN

5' GCGT ... 3‘ 56

57

James Watson şi Francis Crick

alături de modelul structurii

secundare a ADN.

Rosalind Franklin Maurice Wilkins

58

Complementaritatea ADN asigură:

stabilitatea moleculei ADN;

mecanismul replicării;

mecanismul transcripţiei;

mecanismul recombinării;

mecanismul reparării leziunilor ADN

59

Conformaţia spaţială a moleculelor de ADN liniar Tip Lungimea spirei Baze/tur

Înclinarea faţă

de ax

A 24,6 Å ~11 +19°

B 33,2 Å ~10 -1,2°

Z 45,6 Å ~ 12 -9°

60

Structura terţiară ADN + proteine = DNP

ADN + proteine situs-specifice= complex funcţional

ADN nuclear + proteine histone = cromatina ↔ cromozomii

Page 11: Nota medie Biologie moleculară şi Genetică umanăbimogeum.ucoz.com/Biologie_moleculara/Rom/Prezentations/Introduce... · Examen Admiterea ... Conformaţia proteinelor ... Se replică

11

Proprietăţile ADN Replicare

dublarea IG Reparaţie

Identificarea, înlăturarea greşelilor Denaturare

ruperea legăturilor de H Renaturare

refacerea dublului helix Heterogenitate

varietatea secv. nucleotidice Flexibilitate

A↔B↔Z Fragilitate

sensibilitate la factori mutageni Migrare în câmpul electric (ADN are “—”)

Hibridizare

molecule de diferită origine formează noi molecule

62

Replicarea

= dublarea ADN = dublarea IG = transmiterea IG

63

Funcţiile ADN

Deţine IG codificată:

succesiunea b.a. în ADN determină succesiunea aminoacizilor în proteină

Păstrează IG:

de acţiunea nucleazelor

de citirea neautorizată

de mutaţii

Transmite IG prin dublare=replicare:

1ADN — replicare 2ADN

Realizează IG

ADN — transcripţie ARN — translaţie proteină

globina

globina

Insulina

actina

miozina

Imunoglobulina

Exemple

Hb

Reglează nivelul

glucozei

Apărare imună

Asigură

contracţiile

musculare

Concluzii:

ADN are secvenţe codante = gene: Gene p/u proteine ARNm ~ 30 000

Gene preARNr ~ 250

Gene ARNr 5S ~ 2000

Gene ARNt ~ 1300

Gene p/u microARN

ADN are secvenţe necodante Secv. reglatoare

Secv. spaţiatori

Secv. satelit (cen, t)

Secv. minisatelit (markeri crs)

Secv. microsatelit (markeri individuali)

66

Localizarea ADN

În nucleu 95 - 98%

molecule mari liniare de ADN

asociate cu proteine histone

sub formă de cromatină ↔ cromozomi

În mitocondrii 2-5%

molecule mici inelare

Page 12: Nota medie Biologie moleculară şi Genetică umanăbimogeum.ucoz.com/Biologie_moleculara/Rom/Prezentations/Introduce... · Examen Admiterea ... Conformaţia proteinelor ... Se replică

12

67

Particularităţile ADN uman ADN nuclear (nucleul celulei somatice, diploid)

cu o lungime de ~ 6,4x109p.n.; 7 picograme

fragmentat în 46 de molecule;

asociat cu proteine histone;

extrem de eterogen: secvenţe codificatoare şi necodificatoare;

secvenţe repetitive şi unice;

secvenţe active transcripţional şi inactive;

secvenţe stabile şi instabile mutaţional;

conţine ~ 30000 perechi de gene;

se replică numai în perioada S a ciclului celular;

50% este de origine maternă şi 50% de origine paternă.

68

69

Anemia cu hematii falciforme

A→T 17

70

Indivizii homozigoţi recesivi

Hemoglobină anomală

Hematii falciforme (în formă de seceră)

Distrugerea rapidă a

celulelor falciforme

Lipirea celulelor şi

blocarea circulaţiei

sanguine

Acumularea celulelor

falciforme în splină

Anemie Dereglări locale în alimentare sanguină

Supraactivitatea

măduvei osoase

Defecte

cardiace

Defecte în

activitatea

musculară

Defecte în

tractul

gastrointestinal

Creşterea cantităţii

măduvei osoase

Dilatarea

cordului Afectarea

plămânilor

Dereglări

cerebrale

Defecte

renale

Deformări

scheletice

Diminuarea

activităţii

mintale

Dereglări

cardiace

Pneumonie Paralizie

Dureri

nespecifice

Dereglări

renale

Fibroza

splinei

71

ADN mitocondrial

Are o lungime de 16,6 kb

Este inelar

Numărul moleculelor este variabil (2-10)

Conţine 37 de gene

Genele sunt dispuse compact

Se replică în dependenţă de metabolismul

celular

Este de origine maternă

Particularităţile ADN uman

72

Particularităţile genomului uman

Genomul nuclear

n=3,2 Gb / 2n=6,4 Gb

(~ 30000 gene/perechi)

Genomul mitocondrial

16,6 kb

37 de gene

ADN genic

25%

ADN extragenic

75%

ADN

codant

10%

ADN

necodant

90%

Secvenţe unice

sau în număr

mic de copii

60%

Secvenţe

moderat sau

înalt repetitive

40%

Page 13: Nota medie Biologie moleculară şi Genetică umanăbimogeum.ucoz.com/Biologie_moleculara/Rom/Prezentations/Introduce... · Examen Admiterea ... Conformaţia proteinelor ... Se replică

13

73

Genomul nuclear

SECVENŢE OBLIGATORII SECVENŢE FACULTATIVE

-Gene structurale

(codificatoare de proteine)

-Gene pentru ARNt, ARNr;

-Palindromi;

- ADN satelit (c,t…)

Elemente mobile

Pseudogene

ADN viral

74

Secvenţele necodificatoare ale genomului uman

SINEs – transpozoni; situsuri de iniţiere a replicării

LINEs – retrotranspozoni; situsuri de împerechere

corectă a crs în timpul meiozei I

ADN minisatelit – markeri genetici ai crs

ADN satelit – rol structural, formează regiunile de

heterocromatină constitutivă (c, t, h, s)

ADN microsatelit – markeri genetici individuali

SINEs (Short interspersed elements) – 11%

LINEs (Long interspersed elements) – 16%

75

Stabilirea structurii genelor normale şi

mutante

Depistarea mutaţiilor

Diagnosticul bolilor genice

Analiza polimorfismului individual

Studiul ADN pentru:

76

ARN – acid ribonucleic

Monomeri – NTP (ATP, GTP, CTP, UTP);

Structura primară – catena polinucleotidică;

Structura secundară – bucle;

Structura terţiară – RNP (ARN+proteine)

77 78

Monomeri ARN - NTP

Page 14: Nota medie Biologie moleculară şi Genetică umanăbimogeum.ucoz.com/Biologie_moleculara/Rom/Prezentations/Introduce... · Examen Admiterea ... Conformaţia proteinelor ... Se replică

14

ARNm ARNr ARNt ARNm

!!! Toate tipurile de ARN sunt transcrise de pe ADN

!!! ARN - este complementar unei catene de ADN

- este identic cu cealaltă catenă

Transcripţie

Processing

1 2 3 4

ARNm ARNr ARNt

Transcripţie

Processing

1 2 3

ADN

ARN precursor

ARNt ARNr ARNm

ARNr + proteine

ribozomale =

ribozomi

•Copia codului genetic

despre structura proteinei

•Matriţă pentru sinteza

proteinei în timpul

translaţiei

Sediul sintezei

proteinelor

•Transportă

aminoacizi spre

ribozomi

•Translează

codul genetic

din ARNm

transcripţie

processing

preARNm

preARNr

preARNt ARNhn

f

u

n

c

ţ

i

e

f

u

n

c

ţ

i

e

ARNm – ARN mesager (informaţional, matricial)

Molecule monocatenare, heterogene

Se obţin prin transcrierea catenei anticodogene a genei structurale şi processing-ului

pre-ARNm

Conţine informaţia despre un polipeptid şi serveşte ca matriţă p/u sinteza polipeptidului

• Molecule monocatenare; • Forma – 3 bucle funcţionale (anticodon, D, Ѱ);

• Se sintetizează prin transcripţia genelor ARNt, • Conţin nucleotide cu baze azotate obişnuite şi

minore (timina, pseudouracil, dihidrouridina) • Asigură transportarea aminoacizilor spre locul de sinteză a proteinelor • Reprezintă translatori ai codului genetic • În celulă se conţin 61 tipuri

ARNt

Structura secundară a ARNr

Page 15: Nota medie Biologie moleculară şi Genetică umanăbimogeum.ucoz.com/Biologie_moleculara/Rom/Prezentations/Introduce... · Examen Admiterea ... Conformaţia proteinelor ... Se replică

15

ARNr – ARN ribozomal

Molecule monocatenare

ARNr se sintetizează prin transcripţia genelor ARNr, în regiunea nucleolului

Intră în componenţa ribozomilor

18S + 33 proteine = 40S

5S + 5,8S + 28S + 49 proteine = 60S

Asigură interacţiunea dintre subunităţile ribozomale, ribozom-ARNm, ribozom-ARNt.

86

ARNr

Tipul celulelor Coeficientul de sedimentare

Procariote

5S

16S

23S

Eucariote,

nucleu

5S

5,8S

18S

28S

Eucariote, mitocondrii 12S

16S

87

microARN

ARNsn

ARN-primer

ARN-telomerazic

ARN din componenţa spliceosomei

ARNsc

Ribozime

ARN de interferenţă

Structura proteinelor

Monomeri – 20 tipuri de aminoacizi

Primară – lanţul polipeptidic de

aminoacizi (ordinea a-a controlată de codul genetic ADN)

Secundară – -spirale şi -structuri

Terţiară – globulară

Cuaternară - mai multe polipeptide formează o proteină complexă

!!! pot forma complexe cu alte proteine sau alte molecule (AN, glucide, lipide)

Formarea legăturilor peptidice Formarea polipeptidului

Page 16: Nota medie Biologie moleculară şi Genetică umanăbimogeum.ucoz.com/Biologie_moleculara/Rom/Prezentations/Introduce... · Examen Admiterea ... Conformaţia proteinelor ... Se replică

16

Structura proteinelor

Structura primară a ribonucleazei A (RNase A)

Structura secundară a ribonucleazei A (RNase A)

Arhitectura proteinelor

Tranzitii conformationale ale hexokinazei

•Domeniu: regiune compacta de 100-400 AA, specificata de un exon al genei, care determină o funcţie

Functii ale proteinelor

Clasa Functia Exemple

Proteine

dinamice

enzime Proteaze, lipaze,

nucleaze,

polimeraze....

transport Hb, transferina

contractia musculara actina, miozina

semnale, hormoni insulina, STH

protectie Ig, IFN

reglarea exprimarii

genelor

factori de

transcripţie

Proteine

structurale

matricea tisulara elastina,colagen

Page 17: Nota medie Biologie moleculară şi Genetică umanăbimogeum.ucoz.com/Biologie_moleculara/Rom/Prezentations/Introduce... · Examen Admiterea ... Conformaţia proteinelor ... Se replică

17

Proprietăţile majore ale proteinelor

Heterogenitate;

Pot fi bazice, acide sau neutre;

Interacţionează specific cu alte molecule;

Catalizatori eficienţi;

Adaptabilitate....

!!! Substratul moilecular al tuturor structurilor,

fucţiilor şi însuşirilor organisnului viu

Factorii de mediu – to, pH, P, h, cofactori, etc.

Structura chimică – primară

Configuraţia spaţială – Conformaţia (forma moleculei)

Proprietăţile moleculei

Funcţiile moleculei

Relaţia: structură – mediu – funcţie

99