Nataro J, 1998_142

7/30/2019 Nataro J, 1998_142

1/61

CLINICAL MICROBIOLOGY REVIEWS,0893-8512/98/$04.000

Jan. 1998, p. 142201 Vol. 11, No. 1

Copyright 1998, American Society for Microbiology

Diarrheagenic Escherichia coliJAMES P. NATARO* AND JAMES B. KAPER

Center for Vaccine Development, Departments of Medicine, Pediatrics, and Microbiology & Immunology,University of Maryland School of Medicine, Baltimore, Maryland 21201

INTRODUCTION .......................................................................................................................................................144ISOLATION AND IDENTIFICATION....................................................................................................................144

Biochemicals............................................................................................................................................................144Serotyping ................................................................................................................................................................144Phenotypic Assays Based on Virulence Characteristics....................................................................................144Molecular Detection Methods...............................................................................................................................145

Nucleic acid probes.............................................................................................................................................145PCR.......................................................................................................................................................................147

COMMON THEMES IN E. COLI VIRULENCE...................................................................................................147ENTEROTOXIGENIC E. COLI ...............................................................................................................................147

Pathogenesis ............................................................................................................................................................148Heat-labile toxins................................................................................................................................................148

(i) LT-I .............................................................................................................................................................148

(ii) LT-II...........................................................................................................................................................149Heat-stable toxins ...............................................................................................................................................149(i) STa ..............................................................................................................................................................149(ii) STb .............................................................................................................................................................151

Colonization factors............................................................................................................................................151Epidemiology ...........................................................................................................................................................152Clinical Considerations..........................................................................................................................................153Detection and Diagnosis ........................................................................................................................................154

ENTEROPATHOGENIC E. COLI............................................................................................................................155Pathogenesis ............................................................................................................................................................155

Attaching-and-effacing histopathology .............................................................................................................155Three-stage model of EPEC pathogenesis.......................................................................................................156

(i) Localized adherence..................................................................................................................................156(ii) Signal transduction..................................................................................................................................156(iii) Intimate adherence .................................................................................................................................158

Secreted proteins.................................................................................................................................................158Locus of enterocyte effacement .........................................................................................................................159EAF plasmids ......................................................................................................................................................159Regulation............................................................................................................................................................160Other potential virulence factors......................................................................................................................160

(i) Other fimbriae ...........................................................................................................................................160(ii) EAST1 ........................................................................................................................................................160(iii) Invasion....................................................................................................................................................160

Mechanism of diarrhea......................................................................................................................................161Epidemiology ...........................................................................................................................................................161

Age distribution...................................................................................................................................................161Transmission and reservoirs.............................................................................................................................161EPEC in developed countries............................................................................................................................161EPEC in developing countries ..........................................................................................................................162

Clinical Considerations..........................................................................................................................................162

Detection and Diagnosis ........................................................................................................................................162Definition of EPEC.............................................................................................................................................162Diagnostic tests ...................................................................................................................................................163

(i) Phenotypic tests.........................................................................................................................................163(ii) Genotypic tests .........................................................................................................................................163

* Corresponding author. Mailing address: Center for Vaccine De-velopment, Departments of Medicine and Pediatrics, University ofMaryland School of Medicine, Baltimore, MD 21201. Phone: (410)706-8442. Fax: (410) 706-6205. E-mail: [email protected].

142

7/30/2019 Nataro J, 1998_142

2/61

ENTEROHEMORRHAGIC E. COLI.......................................................................................................................164Origins......................................................................................................................................................................164Pathogenesis ............................................................................................................................................................165

Histopathology.....................................................................................................................................................165Shiga toxins .........................................................................................................................................................165

(i) Structure and genetics..............................................................................................................................165(ii) Stx in intestinal disease ..........................................................................................................................165(iii) Stx in HUS...............................................................................................................................................167

EAST1...................................................................................................................................................................167Enterohemolysin..................................................................................................................................................167Intestinal adherence factors ..............................................................................................................................167pO157 plasmid ....................................................................................................................................................168Iron transport......................................................................................................................................................168Other potential virulence factors......................................................................................................................168

Epidemiology ...........................................................................................................................................................169Incidence ..............................................................................................................................................................169Animal reservoir .................................................................................................................................................169Transmission .......................................................................................................................................................169Non-O157:H7 serotypes......................................................................................................................................170

Clinical Considerations..........................................................................................................................................171Clinical disease ...................................................................................................................................................171Treatment.............................................................................................................................................................171Vaccines................................................................................................................................................................172

Diagnosis and Detection ........................................................................................................................................172General considerations ......................................................................................................................................172(i) Why and when to culture .........................................................................................................................172(ii) Biosafety issues.........................................................................................................................................173(iii) Diagnostic methods.................................................................................................................................173

Culture techniques..............................................................................................................................................174Immunoassays .....................................................................................................................................................174

(i) O and H antigens......................................................................................................................................174(ii) Shiga toxins...............................................................................................................................................175(iii) Other antigens.........................................................................................................................................175(iv) Immunomagnetic separation .................................................................................................................175(v) Free fecal cytotoxic activity .....................................................................................................................175

DNA probes and PCR ........................................................................................................................................176(i) Detection of stx genes................................................................................................................................176(ii) Detection of eae genes..............................................................................................................................176(iii) Detection of the pO157 plasmid/hemolysin gene................................................................................176(iv) Detection of other genes .........................................................................................................................176

Strain subtyping..................................................................................................................................................177Serodiagnosis.......................................................................................................................................................177

ENTEROAGGREGATIVE E. COLI.........................................................................................................................178Pathogenesis ............................................................................................................................................................178

Histopathology.....................................................................................................................................................178Adherence.............................................................................................................................................................179EAST1...................................................................................................................................................................179Invasiveness .........................................................................................................................................................179Cytotoxins ............................................................................................................................................................179Model of EAEC pathogenesis............................................................................................................................179

Epidemiology ...........................................................................................................................................................180Clinical Features.....................................................................................................................................................181Detection and Diagnosis ........................................................................................................................................181

HEp-2 assay.........................................................................................................................................................181

DNA probe ...........................................................................................................................................................181Other tests for EAEC.........................................................................................................................................182

ENTEROINVASIVE E. COLI....................................................................................................................................182Pathogenesis ............................................................................................................................................................182

Invasiveness .........................................................................................................................................................182Enterotoxin production ......................................................................................................................................182

Epidemiology ...........................................................................................................................................................182Clinical Considerations..........................................................................................................................................183Detection and Diagnosis ........................................................................................................................................183

DIFFUSELY ADHERENT E. COLI.........................................................................................................................183Pathogenesis ............................................................................................................................................................184Epidemiology ...........................................................................................................................................................184

VOL. 11, 1998 DIARRHEAGENIC E. COLI 143

7/30/2019 Nataro J, 1998_142

3/61

Clinical Features.....................................................................................................................................................184Detection and Diagnosis ........................................................................................................................................184

OTHER CATEGORIES OF E. COLI WHICH ARE POTENTIALLY DIARRHEAGENIC.............................185CONCLUSIONS .........................................................................................................................................................185ACKNOWLEDGMENTS ...........................................................................................................................................185REFERENCES ............................................................................................................................................................186

INTRODUCTIONEscherichia coli is the predominant facultative anaerobe of

the human colonic flora. The organism typically colonizes theinfant gastrointestinal tract within hours of life, and, thereaf-ter, E. coli and the host derive mutual benefit (169). E. coliusually remains harmlessly confined to the intestinal lumen;however, in the debilitated or immunosuppressed host, or

when gastrointestinal barriers are violated, even normal non-pathogenic strains of E. coli can cause infection. Moreover,even the most robust members of our species may be suscep-tible to infection by one of several highly adapted E. coli clones

which together have evolved the ability to cause a broad spec-trum of human diseases. Infections due to pathogenic E. colimay be limited to the mucosal surfaces or can disseminatethroughout the body. Three general clinical syndromes result

from infection with inherently pathogenic E. coli strains: (i)urinary tract infection, (ii) sepsis/meningitis, and (iii) enteric/diarrheal disease. This article will review the diarrheagenic E.

coli strains, which include several emerging pathogens ofworldwide public health importance, and will specifically focuson pathogens afflicting humans. We will particularly concen-trate on the E. coli strains whose study has advanced most overthe last decade, i.e., enteropathogenic E. coli (EPEC), entero-hemorrhagic E. coli (EHEC), and enteroaggregative E. coli(EAEC). Since the categories of diarrheagenic E. coli are dif-ferentiated on the basis of pathogenic features, emphasis willbe placed on the mechanisms of disease and the developmentof diagnostic techniques based on virulence factors.

ISOLATION AND IDENTIFICATION

Although assays to identify all categories of diarrheagenic E.coli are available, in many situations it is not necessary toimplicate a specific E. coli pathogen in a particular patient.Patients with enterotoxigenic E. coli (ETEC) travelers diar-rhea, for example, generally resolve their diarrhea long beforethey come to medical attention for stool culture. Most entero-invasive E. coli (EIEC) isolates will be missed in the clinicallaboratory, yet diarrhea generally resolves and patients re-spond to empirical antibiotics, such as fluoroquinolones, givenfor other bacterial diarrheas. Culturing stools for most catego-ries of diarrheagenic E. coli should be performed in cases ofpersistent diarrhea, especially in travelers, children and theimmunocompromised, as well as in outbreak situations. E. colican be isolated from the stool and sent to a qualified reference

laboratory for definitive identification. The indications for cul-turing for EHEC differ from those for the rest of the diarrhea-genic E. coli categories; indications for culturing EHEC arediscussed below in greater detail in the EHEC section.

Biochemicals

E. coli is the type species of the genus Escherichia, whichcontains mostly motile gram-negative bacilli within the family

Enterobacteriaceae and the tribe Escherichia (55, 185).E. coli can be recovered easily from clinical specimens on

general or selective media at 37C under aerobic conditions. E.coli in stool are most often recovered on MacConkey or eosin

methylene-blue agar, which selectively grow members of theEnterobacteriaceae and permit differentiation of enteric organ-isms on the basis of morphology (32).

Enterobacteriaceae are usually identified via biochemical re-actions. These tests can be performed in individual culturetubes or by using test strips which are commercially avail-able. Either method produces satisfactory results.

For epidemiologic or clinical purposes, E. coli strains areoften selected from agar plates after presumptive visual iden-tification. However, this method should be used only withcaution, because only about 90% of E. coli strains are lactosepositive; some diarrheagenic E. coli strains, including many ofthe EIEC strains, are typically lactose negative. The indoletest, positive in 99% ofE. coli strains, is the single best test fordifferentiation from other members of the Enterobacteriaceae.

Serotyping

Serotyping ofE. coli occupies a central place in the history ofthese pathogens (reviewed in reference 394. Prior to the iden-tification of specific virulence factors in diarrheagenic E. colistrains, serotypic analysis was the predominant means by whichpathogenic strains were differentiated. In 1933, Adam showedby serologic typing that strains of dyspepsiekoli could beimplicated in outbreaks of pediatric diarrhea. In 1944, Kauff-man proposed a scheme for the serologic classification of E.

coli which is still used in modified form today.According to the modified Kauffman scheme, E. coli are

serotyped on the basis of their O (somatic), H (flagellar), andK (capsular) surface antigen profiles (185, 394). A total of 170different O antigens, each defining a serogroup, are recognized

currently. The presence of K antigens was determined origi-nally by means of bacterial agglutination tests: an E. coli strainthat was inagglutinable by O antiserum but became aggluti-nable when the culture was heated was considered to have a Kantigen. The discovery that several different molecular struc-tures, including fimbriae, conferred the K phenotype led ex-perts to suggest restructuring the K antigen designation toinclude only acidic polysaccharides (394). Proteinaceous fim-brial antigens have therefore been removed from the K seriesand have been given F designations (494).

A specific combination of O and H antigens defines theserotype of an isolate. E. coli of specific serogroups can beassociated reproducibly with certain clinical syndromes (Table1), but it is not in general the serologic antigens themselvesthat confer virulence. Rather, the serotypes and serogroups

serve as readily identifiable chromosomal markers that corre-late with specific virulent clones (690).

Phenotypic Assays Based on Virulence Characteristics

Identification of diarrheagenic E. coli strains requires thatthese organisms be differentiated from nonpathogenic mem-bers of the normal flora. Serotypic markers correlate, some-times very closely, with specific categories of diarrheagenic E.

coli; however, these markers are rarely sufficient in and ofthemselves to reliably identify a strain as diarrheagenic. (Anexception may be strains of serotype O157:H7, a serotype thatserves as a marker for virulent enterohemorrhagic E. coli

144 NATARO AND KAPER CLIN. MICROBIOL. REV.

7/30/2019 Nataro J, 1998_142

4/61

strains; nevertheless, EHEC of serotypes other than O157:H7are being identified with increasing frequency in sporadic andepidemic cases.) In addition to its limited sensitivity and spec-ificity, serotyping is tedious and expensive and is performedreliably only by a small number of reference laboratories. Thus,detection of diarrheagenic E. coli has focused increasingly onthe identification of characteristics which themselves deter-mine the virulence of these organisms. This may include in

vitro phenotypic assays which correlate with the presence ofspecific virulence traits or detection of the genes encodingthese traits.

One of the most useful phenotypic assays for the diagnosis of

diarrheagenic E. coli is the HEp-2 adherence assay. Themethod has recently been reviewed in detail (160). This assay

was first described in 1979 by Cravioto et al. (139) and remainsthe gold standard for the diagnosis of EAEC and diffuselyadherent E. coli (DAEC). The HEp-2 assay has been modifiedoften since its first description, including such variations asextending the incubation time to 6 h or changing the growthmedium during the incubation. However, collaborative studies

have shown that the assay performed essentially as first de-scribed provides the best ability to differentiate among all threeadherent diarrheagenic categories (EPEC, EAEC, andDAEC) (678). The HEp-2 adherence assay entails inoculatingthe test strain onto a semiconfluent HEp-2 monolayer andincubating it for 3 h at 37C under 5% CO2. After this incu-bation time, the monolayer is washed, fixed, stained, and ex-amined by oil immersion light microscopy. The three patternsof HEp-2 adherence (Fig. 1), localized adherence (LA), aggregative adherence (AA), and diffuse adherence (DA), can bedifferentiated reliably by an experienced technician. However,the authors have found some strains which yield equivocalresults reproducibly in the HEp-2 assay.

Molecular Detection Methods

Diarrheagenic E. coli strains were among the first pathogensfor which molecular diagnostic methods were developed. In-deed, molecular methods remain the most popular and mostreliable techniques for differentiating diarrheagenic strainsfrom nonpathogenic members of the stool flora and distin-guishing one category from another. Substantial progress hasbeen made both in the development of nucleic acid-basedprobe technologies as well as PCR methods.

Nucleic acid probes. The use of DNA probes for detectionof heat-labile (LT) and heat-stable (ST) enterotoxins in ETECrevolutionized the study of these organisms, replacing cumber-some and costly animal models of toxin detection (455). Sincethen, gene probes have been introduced for all diarrheageniccategories. Two general methods are commonly used for nu-cleic acid probe specimen preparation. The first entails theinoculation of purified cultures onto agar plates to producecolony blots, in which 30 to 50 such cultures are inoculatedper plate. After incubation, the bacterial growth is transferredto nitrocellulose or Whatman filter paper for hybridization(alternatively, the cultures can be grown directly on the nitro-cellulose overlying an agar plate). The bacterial growth on thepaper can be lysed, denatured, and hybridized with the probein situ, and then a radiographic image is generated by exposureto X-ray film. Substantial experience by ourselves and othershas demonstrated that the colony blot method is reliable andefficient. However, the use of this method requires that the E.

coli strain first be isolated from the patients stool, which in-troduces the possibility that any number of E. coli coloniespicked from a stool culture may fail to yield the offendingpathogenic strain. Over several years of study, we have found

that patients symptomatic with E. coli diarrhea generallypresent with the pathogenic strain as their predominant E. colistrain in the flora. Thus, studies in which three E. coli isolatesare tested per diarrheal stool specimen will have acceptablesensitivity. If increased sensitivity is desired or if the studyentails a large number of asymptomatic patients, isolating fiveisolates per specimen may be more appropriate.

An alternative to the use of colony blots is the stool blotmethod. In this technique, stool samples are spotted directlyonto nitrocellulose filters that have been overlaid onto an agarplate (373). After overnight incubation, the filter paper ispeeled off the plate, air dried, and treated as above for colony

TABLE 1. Serotypes characteristic of the diarrheagenicE. coli categories

Category Serogroup Associated H antigen(s)

ETEC O6 H16O8 H9O11 H27O15 H11

O20 NMO25 H42, NMO27 H7O78 H11, H12O128 H7O148 H28O149 H10O159 H20O173 NM

EPEC O55 H6, NMO86 H34, NMO111 H2, H12, NMO119 H6, NMO125ac H21O126 H27, NMO127 H6, NM

O128 H2, H12O142 H6

EHEC O26 H11, H32, NMO55 H7O111ab H8, NMO113 H21O117 H14O157 H7

EAEC O3 H2O15 H18O44 H18O86 NMO77 H18O111 H21O127 H2

O?

a

H10

EIEC O28ac NMO29 NMO112ac NMO124 H30, NMO136 NMO143 NMO144 NMO152 NMO159 H2, NMO164 NMO167 H4, H5, NM

a O antigen untypeable by conventional methods.


7/30/2019 Nataro J, 1998_142

5/61

146

7/30/2019 Nataro J, 1998_142

6/61

blots. The advantages of this technique include (i) that the E.coli colonies need not be isolated from the stool and (ii) thatthere may be increased sensitivity if the pathogenic strain rep-resents a minority member of the flora. However, the presenceof large numbers of other bacteria decreases the sensitivity ofthis test, and a threshold number (ca. 105 to 106 per g of stool[461]) of pathogenic organisms must be present to yield defin-itive results. In addition, the use of stool blots alone does not

result in a pure culture of the pathogen, which may be requiredfor verification of phenotypes.

Nucleic acid-based probes themselves can be of two types:oligonucleotide or polynucleotide (fragment probes). DNAfragment (polynucleotide) probes may be derived from genesthat encode a particular phenotype or may instead be empiricalprobes which, through extensive testing, are found to be linked

with the presence of a phenotype. Although empirical probeshave generated useful results (41, 701), probes which representthe virulence genes themselves are generally superior (241).

Oligonucleotide probes are derived from the DNA sequenceof a target gene. Annealing temperatures and other conditionsof hybridization and washing need to be determined muchmore precisely than for polynucleotide probes. Moreover, veryslight strain-to-strain differences among the virulence genes

may generate false-negative results with oligonucleotideprobes. Nevertheless, oligonucleotide probes have the advan-tage of faster and often cleaner results than those generated bypolynucleotide methods, a factor that comes into play espe-cially when screening for very small genes. Recommendedoligonucleotide probes are listed in Table 2.

Whereas the original probe techniques involved radionucle-otides to detect probe hybridization, nonisotopic methods arebecoming more popular. These include several methods fortagging oligonucleotide probes and a smaller number of effec-tive techniques for detection of polynucleotide probes. Thesenonisotopic techniques have facilitated the introduction ofprobe technology into areas where the use of radioisotopesis impractical.

PCR. PCR is a major advance in molecular diagnostics ofpathogenic microorganisms, including E. coli. PCR primershave been developed successfully for several of the categoriesof diarrheagenic E. coli (listed in Table 2). Advantages of PCRinclude great sensitivity in in situ detection of target templates.However, substances within stools have been shown to inter-fere with the PCR, thus decreasing its sensitivity (615); severalmethods have been used successfully to remove such inhibi-tors, including Sepharose spin column chromatography andadsorption of nucleic acids onto glass resin (397, 615). Scru-pulous attention to proper technique must be maintained toavoid carryover of PCR products from one reaction to the next.

COMMON THEMES IN E. COLI VIRULENCELike most mucosal pathogens, E. coli can be said to follow a

requisite strategy of infection: (i) colonization of a mucosal

site, (ii) evasion of host defenses, (iii) multiplication, and (iv)host damage. The most highly conserved feature of diarrhea-genic E. coli strains is their ability to colonize the intestinalmucosal surface despite peristalsis and competition for nutri-ents by the indigenous flora of the gut (including other E. colistrains). The presence of surface adherence fimbriae is a prop-erty of virtually all E. coli strains, including nonpathogenic

varieties. However, diarrheagenic E. coli strains possess spe-cific fimbrial antigens that enhance their intestinal colonizingability and allow adherence to the small bowel mucosa, a sitethat is not normally colonized (389, 679). The various mor-phologies ofE. coli fimbriae are illustrated in Fig. 2. The roleof fimbrial structures in adherence and colonization is ofteninferred rather than demonstrated, in part due to the hostspecificity of most fimbrial adhesins.

Once colonization is established, the pathogenetic strategiesof the diarrheagenic E. coli strains exhibit remarkable variety.Three general paradigms have been described by which E. colimay cause diarrhea; each is described in detail in the appro-priate section below: (i) enterotoxin production (ETEC andEAEC), (ii) invasion (EIEC), and/or (iii) intimate adherence

with membrane signalling (EPEC and EHEC). However, theinteraction of the organisms with the intestinal mucosa is spe-cific for each category. Schematized paradigms are illustratedin Fig. 3.

The versatility of the E. coli genome is conferred mainly bytwo genetic configurations: virulence-related plasmids andchromosomal pathogenicity islands. All six categories of diar-rheagenic E. coli described in this review have been shown tocarry at least one virulence-related property upon a plasmid.EIEC, EHEC, EAEC, and EPEC strains typically harborhighly conserved plasmid families, each encoding multiple vir-ulence factors (275, 467, 701). McDaniel and Kaper haveshown recently that the chromosomal virulence genes of EPECand EHEC are organized as a cluster referred to as a patho-genicity island (431, 432). Such islands have been described foruropathogenic E. coli strains (163) and systemic E. coli strains(75) as well and may represent a common way in which thegenomes of pathogenic and nonpathogenic E. coli strains di-

verge genetically. Plasmids and pathogenicity islands carryclusters of virulence traits, yet individual traits may be trans-poson encoded (such as ST) (607) or phage encoded (such asShiga toxin) (485).

In the sections that follow, we will review all aspects of

disease due to the different classes of diarrheagenic E. coli.Since diarrheagenic E. coli strains are distinguished and de-fined on the basis of pathogenetic mechanisms, much of thisreview will concern the latest advances in our knowledge of thepathogenesis of these organisms.

ENTEROTOXIGENIC E. COLI

ETEC is defined as containing the E. coli strains that elab-orate at least one member of two defined groups of enterotox-ins: ST and LT (381). ETEC strains were first recognized ascauses of diarrheal disease in piglets, where the disease con-tinues to cause lethal infection in newborn animals (reviewedin reference 15). Studies of ETEC in piglets first elucidated the

mechanisms of disease, including the existence of two plasmid-encoded enterotoxins. The first descriptions of ETEC in hu-mans reported that certain E. coli isolates from the stools ofchildren with diarrhea elicited fluid secretion in ligated rab-bit intestinal loops (642). DuPont et al. subsequently showedthat ETEC strains were able to cause diarrhea in adult

volunteers (175).

FIG. 1. The three HEp-2 adherence patterns manifested by diarrheagenic E. coli. (A) Localized adherence (LA), typical of EPEC. Bacteria form characteristicmicrocolonies on the surface of the HEp-2 cell. (B) Aggregative adherence (AA), which defines EAEC. Bacteria adhere to each other away from the cells as well asto the cell surface in a characteristic stacked-brick configuration. (C) Diffuse adherence (DA), which defines DAEC. Bacteria are dispersed over the surface of the cell.


7/30/2019 Nataro J, 1998_142

7/61

Pathogenesis

ETEC strains are generally considered to represent a patho-genic prototype: the organisms colonize the surface of thesmall bowel mucosa and elaborate their enterotoxins, givingrise to a net secretory state. Some investigators have reportedthat ETEC strains may exhibit limited invasiveness in cell cul-tures, but this has not been demonstrated in vivo (189, 190).ETEC strains cause diarrhea through the action of the en-terotoxins LT and ST. These strains may express an LT only,an ST only, or both an LT and an ST. These toxins haverecently been reviewed (291, 293, 295, 296, 480, 589), and thereader is referred to these sources for primary references.

Heat-labile toxins. The LTs ofE. coli are oligomeric toxinsthat are closely related in structure and function to the choleraenterotoxin (CT) expressed by Vibrio cholerae (596). LT andCT share many characteristics including holotoxin structure,protein sequence (ca. 80% identity), primary receptor identity,

enzymatic activity, and activity in animal and cell culture as-says; some differences are seen in toxin processing and secre-tion and in helper T-lymphocyte responses (153). There aretwo major serogroups of LT, LT-I and LT-II, which do notcross-react immunologically. LT-I is expressed by E. coli strainsthat are pathogenic for both humans and animals. LT-II isfound primarily in animal E. coli isolates and rarely in humanisolates, but in neither animals nor humans has it been asso-ciated with disease. Unless otherwise distinguished by Romannumerals, the term LT below refers to the LT-I form.

(i) LT-I. LT-I is an oligomeric toxin of ca. 86 kDa composedof one 28-kDa A subunit and five identical 11.5-kDa B subunits

(Fig. 4A) (622). The B subunits are arranged in a ring ordoughnut and bind strongly to the ganglioside GM

1 and

weakly to GD1b and some intestinal glycoproteins (643). TheA subunit is responsible for the enzymatic activity of the toxinand is proteolytically cleaved to yield A1 and A2 peptides

joined by a disulfide bond. Two closely related variants of LT-Iwhich exhibit partial antigenic cross-reactivity have been de-scribed. These variants are called LTp (LTp-I) and LTh(LTh-I) after their initial discovery in strains isolated from pigsor humans, respectively. The genes encoding LT (elt or etx)reside on plasmids that also may contain genes encoding STand/or colonization factor antigens (CFAs).

After binding to the host cell membranes, the toxin is endo-cytosed and translocated through the cell in a process involvingtrans-Golgi vesicular transport (378). The cellular target of LTis adenylate cyclase located on the basolateral membrane ofpolarized intestinal epithelial cells. The A1 peptide has an

ADP-ribosyltransferase activity and acts by transferring anADP-ribosyl moiety from NAD to the alpha subunit of theGTP-binding protein, GS, which stimulates adenylate cyclaseactivity. ADP-ribosylation of the GS subunit results in ade-nylate cyclase being permanently activated, leading to in-creased levels of intracellular cyclic AMP (cAMP). cAMP-dependent protein kinase (A kinase) is thereby activated,leading to supranormal phosphorylation of chloride channelslocated in the apical epithelial cell membranes. The majorchloride channel activated by LT and CT is CFTR (589), theion channel that is defective in cystic fibrosis. The net result isstimulation of Cl secretion from secretory crypt cells and

TABLE 2. Nucleotide sequences of PCR oligonucleotide primers and oligonucleotide probes for diarrheagenic E. coli strains

Category Factor PCR oligonucleotidesa Reference Oligonucleotide probe Reference

ETEC STI TTAATAGCACCCGGTACAAGCAGG 492 GCTGTGAATTGTGTTGTAATCC 457CTTGACTCTTCAAAAGAGAAAATTAC GCTGTGAACTTTGTTGTAATCC

LT GGCGACAGATTATACCGTGC 581 GCGAGAGGAACACAAACCGG 581CCGAATTCTGTTATATATGTC

EPEC eae b

EAF CAGGGTAAAAGAAAGATGATAA 214 TATGGGGACCATGTATTATCA 313TATGGGGACCATGTATTATCA

BFP AATGGTGCTTGCGCTTGCTGC 268 GCTACGGTGTTAATATCTCTGGCG 462GCCGCTTTATCCAACCTGGTA

EHEC eae CAGGTCGTCGTGTCTGCTAAA 234 ACTGAAAGCAAGCGGTGGTG 691TCAGCGTGGTTGGATCAACCT (O157:H7-specific)

SLTI TTTACGATAGACTTCTCGAC 223 GATGATCTCAGTGGGCGTTC 270CACATATAAATTATTTCGCTC (SLT-I AND II)

SLTII As above TCTGAAACTGCTCCTGTGTA 270Plasmid ACGATGTGGTTTATTCTGGA 223 CCGTATCTTATAATAAGACGGATGTTGG 223

CTTCACGTCACCATACATAT

EIEC ial CTGGATGGTATGGTGAGG 579 CCATCTATTAGAATACCTGTG 579GGAGGCCAACAATTATTTCC

EAEC Plasmid CTGGCGAAAGACTGTATCAT 576 NoneCAATGTATAGAAATCCGCTGTT

a Each primer is written 5-3. See the text for abbreviations and discussion.b No oligonucleotide primers have yet been described which will detect specifically all human EPEC strains. (See reference 234.)


7/30/2019 Nataro J, 1998_142

8/61

inhibition of NaCl absorption by villus tip cells. The increasedluminal ion content draws water passively through the para-cellular pathway, resulting in osmotic diarrhea.

Although the stimulation of Cl as a result of increasedintracellular levels of cAMP is the classical explanation for themechanism by which LT and CT cause diarrhea, there is in-creasing evidence, obtained mostly with CT, that the secretoryresponse to these toxins is considerably more complex (re-

viewed in reference 589). One alternative mechanism by whichthese toxins could act involves prostaglandins of the E series(PGE1 and PGE2) and platelet-activating factor. Synthesis andrelease of arachidonic acid metabolites such as prostaglandinsand leukotrienes can stimulate electrolyte transport and intes-tinal motility. A second alternative mechanism involves theenteric nervous system (ENS), which regulates intestinal mo-tility and ion secretion. Serotonin and vasoactive intestinalpolypeptide, both of which can stimulate intestinal epithelialcell secretion via the ENS, are released into the human smallbowel after treatment with CT (186). A third potential mech-anism could involve a mild intestinal inflammatory responsedue to CT and LT. CT has been reported to stimulate produc-tion of the proinflammatory cytokine interleukin-6 (IL-6),thereby activating the enteric immune system and potentially

generating arachidonic acid metabolites that stimulate secre-tion (433). These alternative secretory mechanisms are sup-ported by a variety of in vitro and in vivo data, and one or moreof them could act in concert with the classic mode of actioninvolving cAMP in causing diarrhea due to LT and CT. Thesimilarity of LT and CT is considered sufficiently high to ex-trapolate mechanistic similarities between the two toxins, andthe validity of these assumptions has proven largely correct,

with the exception of the failure of LT to release serotonin(660). However, observations made to date for secondary ef-fects of CT have not all been demonstrated for LT, nor has theclinical relevance of these secondary secretory effects beensubstantiated.

CT and LT have been shown as well to decrease the absorp-tion of fluid and electrolytes from the intestinal lumen (200).

Muller et al. have reported that both CT and LT inducecAMP-dependent inhibition of the H/peptide cotransporterin the human intestinal cell line Caco-2 (456). Interestingly,since the H/peptide cotransporter does not possess sites forphosphorylation by protein kinase A (PKA), the authors pro-pose that the effect is mediated through PKC. This hypothesis

would suggest another novel mechanism of CT and LT andrequires substantiation in other systems.

In addition to its enterotoxic properties, LT has the ability toserve as a mucosal adjuvant. Mutants of LT which retain ad-

juvanticity while eliminating the ADP-ribosyltransferase activ-ity have been constructed (153, 167, 460). Mice immunizedorally or intranasally with ovalbumin or fragment C of tetanustoxin together with the mutant LTs have developed higherlevels of serum and local antibodies to these antigens than

when the antigens are delivered without LT. This propertycould simplify vaccine development and administration for a

variety of pathogens by permitting oral or nasal, rather thanparenteral, administration of antigens.

(ii) LT-II. The LT-II serogroup of the LT family shows 55 to57% identity to LT-I and CT in the A subunit but essentially nohomology to LT-I or CT in the B subunits (229, 271, 518, 589,612). Two antigenic variants, LT-IIa and LT-IIb, which share71 and 66% identity in the predicted A and B subunits, respec-tively, have been described. LT-II increases intracellularcAMP levels by similar mechanisms to those involved withLT-I toxicity, but LT-II uses GD1 as its receptor rather than

GM1 (229). As noted above, there is no evidence that LT-II isassociated with human or animal disease.

Heat-stable toxins. In contrast to the large, oligomeric LTs,the STs are small, monomeric toxins that contain multiplecysteine residues, whose disulfide bonds account for the heatstability of these toxins. There are two unrelated classes of STsthat differ in structure and mechanism of action. Genes forboth classes are found predominantly on plasmids, and some

ST-encoding genes have been found on transposons. STa (alsocalled ST-I) toxins are produced by ETEC and several othergram-negative bacteria including Yersinia enterocolitica and V.

cholerae non-O1. STa has about 50% protein identity to theEAST1 ST of EAEC, which is described further below. It hasrecently been reported (564, 706) that some strains of ETECmay also express EAST1 in addition to STa. STb has beenfound only in ETEC.

(i) STa. The mature STa is an 18- or 19-amino-acid peptidewith a molecular mass of ca. 2 kDa. There are two variants,designated STp (ST porcine or STIa) and STh (ST human orSTIb), after their initial discovery in strains isolated from pigsor humans, respectively. Both variants can be found in humanETEC strains. These two variants are nearly identical in the 13residues that are necessary and sufficient for enterotoxic activ-

ity, and of these 13 residues, 6 are cysteines which form threeintramolecular disulfide bonds. STa is initially produced as a72-amino-acid precursor (pre-pro form) that is cleaved by sig-nal peptidase 1 to a 53-amino-acid peptide (533). This form istransported to the periplasm, where the disulfide bonds areformed by the chromosomally encoded DsbA protein (708).

An undefined protease processes the pro-STa to the final 18-or 19-residue mature toxin which is released by diffusion acrossthe outer membrane.

The major receptor for STa is a membrane-spanning enzymecalled guanylate cyclase C (GC-C), which belongs to a familyof receptor cyclases that includes the atrial natriuretic peptidereceptors GC-A and GC-B (152, 670). Additional receptors forSTa may exist (292, 410), but GC-C is the only receptor iden-tified definitively. GC-C is located in the apical membrane of

intestinal epithelial cells, and binding of ligands to the extra-cellular domain stimulates the intracellular enzymatic activity.

A mammalian hormone called guanylin is the endogenousagonist for GC-C (106). Guanylin is a 15-amino-acid peptide

which contains four cysteines and is less potent than STa inactivating GC-C. Guanylin is presumed to play a role in normalgut homeostasis, and GC-C is apparently used opportunisti-cally by STa to cause diarrhea.

Binding of STa to GC-C stimulates GC activity, leading toincreased intracellular cGMP levels (138, 446, 589) (Fig. 4B).This activity leads ultimately to stimulation of chloride secre-tion and/or inhibition of sodium chloride absorption, resultingin net intestinal fluid secretion. The intermediate steps in-

volved in this process are controversial, and roles for bothcGMP-dependent kinases and cAMP-dependent kinases have

been reported (589). Ultimately, the CFTR chloride channel isactivated, leading to secretion of Cl ions into the intestinallumen. In contrast to the 15- to 60-min lag time needed for LTto translocate to and activate the basolateral adenylate cyclasecomplex, STa acts much faster due to the apical location of itscyclase receptor. Alternative mechanisms of action for STainvolving prostaglandins, calcium, and the ENS have been pro-posed (477, 478), but the evidence for the involvement of thesefactors is inconsistent. The secretory response to STa may alsoinvolve phosphatidylinositol and diacylglycerol release, activa-tion of PKC, elevation of intracellular calcium levels, and mi-crofilament (F-actin) rearrangement (reviewed in reference 589).


7/30/2019 Nataro J, 1998_142

9/61

FIG. 2. Various morphologies of diarrheagenic E. coli fimbriae as seen by transmission electron microscopy. (A) Rigid fimbrial morphology illustrated by ETECfimbriae CS1 (labelled CFA/II in the figure). The diameter of individual fimbriae is ca. 7 nm. (B) Flexible fibrillar morphology exemplified by the CS3 component ofCFA/II (arrow). Note the typical narrow diameter, ca. 2 to 3 nm, and the coiled appearance. (C) Electron micrograph showing the EPEC bundle-forming pilus expressedby strain E2348/69. Bar, 0.35 m. Reprinted from reference 245 with permission of the publisher.


7/30/2019 Nataro J, 1998_142

10/61

(ii) STb. STb is associated primarily with ETEC strains iso-lated from pigs, although some human ETEC isolates express-ing STb have been reported. STb is initially synthesized as a71-amino-acid precursor protein, which is processed to a ma-ture 48-amino-acid protein with a molecular weight of 5.1 kDa(23, 171). The STb protein sequence has no homology to thatof STa, although it does contain four cysteine residues whichform disulfide bonds (23). Unlike STa, STb induces histologicdamage in the intestinal epithelium, consisting of loss of villusepithelial cells and partial villus atrophy. The receptor for STbis unknown, although it has been suggested recently that thetoxin may bind nonspecifically to the plasma membrane priorto endocytosis (115). Unlike the chloride ion secretion elicitedby STa, STb stimulates the secretion of bicarbonate from in-testinal cells (589). STb does not stimulate increases in intra-cellular cAMP or cGMP concentrations, although it does stim-ulate increases in intracellular calcium levels from extracellularsources (170). STb also stimulates the release of PGE

2and

serotonin, suggesting that the ENS may also be involved in thesecretory response to this toxin (228, 294).

Colonization factors. The mechanisms by which ETECstrains adhere to and colonize the intestinal mucosa have beenthe subject of intensive investigation (for recent reviews, seereferences 109, 149, 230, and 697). To cause diarrhea, ETECstrains must first adhere to small bowel enterocytes, an eventmediated by surface fimbriae (also called pili). Transmissionelectron microscopy of ETEC strains typically reveals manyfimbriae peritrichously arranged around the bacterium; often,multiple fimbrial morphologies can be visualized on the samebacterium (389) (Fig. 2B). A large number of ETEC fimbrial

antigens have been characterized (Table 3), although the fim-briae of some ETEC strains have yet to be identified and areonly presumed to exist. Clearly, the antigenic heterogeneityconferred by the existence of multiple fimbrial antigens is anobstacle to effective vaccine development.

ETEC fimbriae confer the species specificity of the patho-gen. For example, ETEC strains expressing K99 are patho-genic for calves, lambs and pigs, whereas K88-expressing or-ganisms are able to cause disease only in pigs (109). HumanETEC strains possess their own array of colonization fimbriae,the CFAs (150). The terminology of the CFAs is confusing andinconsistent. However, a uniform scheme has been proposed

which would number each putative CFA consecutively accord-ing to the year of its initial description (230); the number wouldbe preceded by the initials CS, for coli surface antigen. Wesupport this proposed scheme, and it has been included inTable 3.

The CFAs can be subdivided based on their morphologic

characteristics. Three major morphologic varieties exist: rigidrods, bundle-forming flexible rods, and thin flexible wiry struc-tures. CFA/I, the prototype rigid rod-shaped fimbria, is com-posed of a single protein assembled in a tight helical configu-ration (308). CFA/III is a bundle-forming pilus with homologyto the type 4 fimbrial family (633, 634). CFA/II and CFA/IVare in fact composed of multiple distinct fimbrial structures:CFA/II producers express the flexible CS3 structure eitheralone or in association with the rod-shaped CS1 or CS2 (389,597); CFA/IV producers express CS6 in conjunction with CS4or CS5 (109, 363). A large number of other, less commonadhesins have also been found in ETEC strains (150), yet

FIG. 2 Continued.


7/30/2019 Nataro J, 1998_142

11/61

epidemiologic studies suggest that CFA/I, CFA/II, or CFA/IVis expressed by approximately 75% of human ETEC strains

worldwide (697). A newly described ETEC fimbria, designatedLongus, has been found on a large proportion of human ETEC(244, 246).

The genetics of CFAs have been studied extensively, andthese studies have served to illuminate models for fimbrialexpression, protein secretion and translocation, and the assem-bly of bacterial organelles (Fig. 5). CFA genes are usuallyencoded on plasmids, which typically also encode the entero-toxins ST and/or LT (150). Typical fimbrial gene clusters con-sist of a series of genes encoding a primary fimbrial subunitprotein and accessory proteins which are required for process-

ing, secretion, and assembly of the fimbrial structure itself(150, 308, 319, 370). The pilin structural subunit is usually thepredominant immunogen and is thus subject to the greatestantigenic pressure. Pilin subunits accordingly exhibit the great-est sequence variation; however, the N termini of the subunitproteins, as well as the accessory proteins, are generally at leastpartially conserved. This phenomenon is believed to reflectstructure-function requirements (370). Although the actualprotein adhesin of some E. coli fimbriae (such as pap and type1 fimbriae) is a tip protein distinct from the structural proteincomprising the stalk, the adhesin of diarrheagenic E. coli fim-briae is generally the stalk protein itself.

Epidemiology

ETEC strains are associated with two major clinical syn-dromes: weanling diarrhea among children in the developing

world, and travelers diarrhea. The epidemiologic pattern ofETEC disease is determined in large part by a number offactors: (i) mucosal immunity to ETEC infection develops inexposed individuals; (ii) even immune asymptomatic individu-als may shed large numbers of virulent ETEC organisms in thestool; and (iii) the infection requires a relatively high infectiousdose (175). These three features create a situation in whichETEC contamination of the environment in areas of endemicinfection is extremely prevalent, and most infants in such areas

will encounter ETEC upon weaning. The percentage of cases

of sporadic endemic infant diarrhea which are due to ETECusually varies from 10 to 30% (12, 209, 298, 385, 406, 581, 654).School-age children and adults typically have a very low inci-dence of symptomatic ETEC infection. Characteristically, ST-producing ETEC strains cause the majority of endemic cases(12, 385).

Epidemiologic investigations have implicated contaminatedfood and water as the most common vehicles for ETEC infec-tion (71, 73, 395, 700). Sampling of both food and watersources from areas of endemic infection have demonstratedstrikingly high rates of ETEC contamination (550, 700); this isnot unexpected given that 108 CFU of ETEC with buffer must

FIG. 3. Pathogenic schemes of diarrheagenic E. coli. The six recognized categories of diarrheagenic E. coli each have unique features in their interaction witheukaryotic cells. Here, the interaction of each category with a typical target cell is schematically represented. It should be noted that these descriptions are largely theresult of in vitro studies and may not completely reflect the phenomena occurring in infected humans. See the text for details.


7/30/2019 Nataro J, 1998_142

12/61

be given to induce high attack rates in volunteers (175, 383).Thus, fecal contamination of water and food sources is theprincipal reason for the high incidence of ETEC infectionthroughout the developing world, and the institution of appro-priate sanitation is the cornerstone of preventive efforts againstthis infection.

ETEC infections in areas of endemic infection tend to beclustered in warm, wet months, when multiplication of ETEC

in food and water is most efficient (381). Person-to-persontransmission was not found to occur during a study of ETEC-infected volunteers housed side by side with volunteers en-rolled in an evaluation of influenza vaccine candidates (388).

Although ETEC infection occurs most frequently in infants,immunologically naive adults are susceptible (this stands incontrast to EPEC infection, as described below). Indeed,ETEC is the predominant etiologic agent causing travelersdiarrhea among adults from the developed world visiting areas

where ETEC infection is endemic (21, 70, 174, 422). Studiessuggest that 20 to 60% of such travelers experience diarrhea;typically, 20 to 40% of cases are due to ETEC. Predictably,

ETEC travelers diarrhea occurs most commonly in warm andwet months and among first-time travelers to the developingworld (21). Travelers diarrhea is usually contracted from con-taminated food and water (70, 422, 700).

Clinical Considerations

The clinical characteristics of ETEC disease are consistent

with the pathogenetic mechanisms described above. Similarfeatures of the illness have been demonstrated in both volun-teers and patients in areas of endemic infection. The illness istypically abrupt in onset with a short incubation period (14 to50 h) (175, 459). The diarrhea is watery, usually without blood,mucus, or pus; fever and vomiting are present in a minority ofpatients (175, 381). ETEC diarrhea may be mild, brief, andself-limiting or may result in severe purging similar to that seenin V. cholerae infection (383).

Most life-threatening cases of ETEC diarrhea occur inweanling infants in the developing world. Even though theadministration of antibiotics to which ETEC strains are sus-

FIG. 4. Classic mechanisms of action of ETEC toxins (see the text for details and additional proposed mechanisms). (A) LT-I. The LT holotoxin, consisting of oneA subunit and five B subunits, is internalized by epithelial cells of the small bowel mucosa via endocytosis. The A1, or catalytic, subunit translocates through the vacuolarmembrane and passes through the Golgi apparatus by retrograde transport. In the figure, the A subunit is shown passing through the B subunit ring, but this may notbe the case in vivo. A1 catalyzes the ADP-ribosylation of arginine 201 of the subunit of Gs-protein (which may be apically located); the ADP-ribosylated G-proteinactivates adenylate cyclase, which elicits supranormal levels of intracellular cAMP. cAMP is an intracellular messenger which regulates several intestinal epithelial cellmembrane transporters and other host cell enzymes, as well as having effects on the cytoskeleton. The activation of the cAMP-dependent A kinase results in

phosphorylation of apical membrane transporters (especially the cystic fibrosis transmembrane conductance regulator), resulting in secretion of anions (predominantlyCl by a direct effect, and HCO3

indirectly) by crypt cells and a decrease in absorption of Na and Cl by absorptive cells. cAMP may also have important effectson basolateral transporters and on intracellular calcium levels, both of which may increase the magnitude of the effects on fluid and ion transport. (B) STa. Less is knownabout the action of ST than of LT. ST is thought to act by binding the ST membrane receptor, GC-C. Activation of GC-C results in increased levels of intracellularcGMP. cGMP exerts its effects in increasing chloride secretion and decreasing NaCl absorption by activating the cGMP-dependent kinase (G-kinase) and/or the cAMPdependent kinase (A-kinase). Other effects of STa in inducing fluid secretion have also been postulated (see the text).


7/30/2019 Nataro J, 1998_142

13/61

7/30/2019 Nataro J, 1998_142

14/61

ture supernatants are added to Y1 cells and the cells areexamined for rounding (165). In the CHO cell assay, LT willcause elongation of the CHO cells (265). Immunologic assaysare easier to implement in clinical laboratories and include thetraditional Biken test (297) as well as newer immunologicmethods such as ELISA (709), latex agglutination (304), andtwo commercially available tests, the reversed passive latexagglutination test (582) and the staphylococcal coagglutination

test (116). Both of the commercially available tests are reliableand easy to perform (613).

ETEC strains were among the first pathogenic microorgan-isms for which molecular diagnostic techniques were devel-oped. As early as 1982 (455), DNA probes were found to beuseful in the detection of LT- and ST-encoding genes in stooland environmental samples. Since that time, several advancesin ETEC detection have been made, but genetic techniquescontinue to attract the most attention and use. It should bestressed that there is no perfect test for ETEC: detection ofcolonization factors is impractical because of their great num-ber and heterogeneity; detection of LT and ST defines anETEC isolate, yet many such isolates will express colonizationfactors specific for animals and thus lack human pathogenicity.

The LT polynucleotide probe provides good sensitivity and

specificity when labeled with radioisotopes (373, 455) or withenzymatic, nonisotopic detection systems (528). Several differ-ent protocols have been published in which nonisotopic label-ing methods have proven useful for LT detection (2, 117, 718);

we now use a highly reliable alkaline phosphatase-based de-tection system (Blue Gene; Gibco-BRL) for use in polynucle-otide probe colony blot hybridization.

ST polynucleotide probes have had problems of poor sensi-tivity and specificity, presumably because of the small size ofthe gene. For this reason, oligonucleotide probes which aregenerally more sensitive and specific for ST detection havebeen developed (581) (Table 2 lists the nucleotide sequencesof oligonucleotides used for probing and PCR of diarrheagenic

E. coli strains). An LT oligonucleotide has also been developed(581), but this reagent has relatively few advantages over an

enzymatically detected LT fragment probe. Recently, a triva-lent oligonucleotide probe has been proposed which may be ofuse in detecting the genes encoding LT, ST, and the EHECShiga toxin genes (see below); this probe shows promise in anearly report (44). ETEC strains are particularly amenable tostool blot hybridization because of the large number of organ-isms typically shed in the stools of infected individuals (615).

Several PCR assays for ETEC are quite sensitive and spe-cific (177, 374, 492, 581, 615, 654) when used directly on clinicalsamples or on isolated bacterial colonies. A useful adaptationof PCR is the multiplex PCR assay (374, 615), in whichseveral PCR primers are combined with the aim of detectingone of several different diarrheagenic E. coli pathotypes in asingle reaction. After multiplex PCR, various reaction prod-ucts can usually be differentiated by product size, but a sec-

ond detection step (e.g., nonisotopic probe hybridization)is generally performed to identify the respective PCRproducts definitively.

ENTEROPATHOGENIC E. COLI

EPEC is an important category of diarrheagenic E. coliwhich has been linked to infant diarrhea in the developingworld. Once defined solely on the basis of O and H serotypes,EPEC is now defined on the basis of pathogenetic character-istics, as described below.

Pathogenesis

Attaching-and-effacing histopathology. The hallmark of in-fections due to EPEC is the attaching-and-effacing (A/E) his-topathology, which can be observed in intestinal biopsy speci-mens from patients or infected animals and can be reproducedin cell culture (18, 314, 358, 453, 524, 547, 616, 640, 667, 669)(Fig. 6). This striking phenotype is characterized by effacement

of microvilli and intimate adherence between the bacte-rium and the epithelial cell membrane. Marked cytoskeletalchanges, including accumulation of polymerized actin, are seendirectly beneath the adherent bacteria; the bacteria sometimessit upon a pedestal-like structure. These pedestal structurescan extend up to 10 m out from the epithelial cell in pseu-dopod-like structures (453). This lesion is quite different fromthe histopathology seen with ETEC strains and V. cholerae, in

which the organisms adhere in a nonintimate fashion withoutcausing microvillous effacement or actin polymerization. Al-though earlier studies had also reported this histopathology, it

was not until the report by Moon et al. (453) that the pheno-type became widely associated with EPEC and the term at-taching and effacing was coined.

The initial observation by Knutton et al. (359) that the com-

position of the A/E lesion contained high concentrations ofpolymerized filamentous actin (F-actin) led to the develop-ment of the fluorescent-actin staining (FAS) test. In this test,fluorescein isothiocyanate (FITC)-labeled phalloidin bindsspecifically to filamentous actin in cultured epithelial cells di-rectly beneath the adherent bacteria. Prior to the developmentof this test, the A/E histopathology could be detected only bythe use of electron microscopy and intact animals or freshlyisolated intestinal epithelial cells. Besides providing a diagnos-tic test for EPEC strains and other organisms capable of caus-ing this histopathology, the FAS test enabled the screening ofclones and mutants, leading to the identification of the bacte-rial genes involved in producing this pathognomonic lesion.

In addition to F-actin, the composition of the A/E lesionincludes other cytoskeletal components such as -actinin, talin,ezrin, and myosin light chain (205). At the tip of the pedestalsbeneath the plasma membrane are located proteins that arephosphorylated on a tyrosine residue in response to EPECinfection (see below). The formation of the pedestal is a dy-namic process, and video microscopy shows that these EPECpedestals can bend and undulate, alternatively growing longerand shorter while remaining tethered in place on the cell sur-face (557). Some of the attached EPEC organisms can actuallymove along the surface of the cultured epithelial cell, reachingspeeds up to 0.07 m/s in a process driven by polymerization ofactin at the base of the pedestal. This motility resembles thatseen with Listeria spp. (650) inside eukaryotic cells, except thatthe motile EPEC organisms are located extracellularly. Thesignificance of this motility observed in vitro to the pathogen-esis of disease caused by EPEC is unknown. Similar A/E le-sions are seen in animal and cell culture models of EHEC (see

below) and Hafnia alvei isolated from children with diarrhea(9, 11). However, only a small, highly conserved subset of H.

alvei strains produce the A/E lesion (537, 538), and detailedtaxonomic studies suggest that the A/E-positive H. alvei strainsshould not be included in the same species as the A/E-negative

H. alvei strains (537). The A/E lesion is also produced bystrains of Citrobacter rodentium (formerly Citrobacter freundiibiotype 4280) that cause murine colonic hyperplasia (althoughdiarrhea is not seen in infection due to this species) (569). Inaddition to EPEC and EHEC, a variety of E. coli strains ca-pable of A/E have been isolated from rabbits (102), calves(206), pigs (717), and dogs (172). Thus, EPEC strains are the


7/30/2019 Nataro J, 1998_142

15/61

prototype of an entire family of enteric pathogens that produceA/E lesions on epithelial cells.

Three-stage model of EPEC pathogenesis. Multiple stepsare involved in producing the characteristic A/E histopathol-ogy. In 1992, Donnenberg and Kaper (158) proposed a three-stage model of EPEC pathogenesis consisting of (i) localizedadherence, (ii) signal transduction, and (iii) intimate adher-ence (Fig. 7). The temporal sequence of these stages is notcertain, and, indeed, the different stages may occur concur-rently. Nevertheless, this model has proven to be a robust onethat can readily accommodate advances in our understandingof EPEC pathogenesis that have been made since it was firstproposed. Additional details on this model can be found inrecent reviews (154, 159, 327).

(i) Localized adherence. As noted above, adherence toHEp-2 cells was first described by Cravioto et al. for EPEC(139). Baldini et al. (26) showed that the ability of EPEC strainE2348/69 (O127:H6) to adhere in a localized pattern was de-pendent on the presence of a 60-MDa plasmid. Loss of thisplasmid led to loss of the LA phenotype, and transfer of thisplasmid to nonadherent E. coli HB101 enabled this strain toadhere to HEp-2 cells. This plasmid was therefore designatedthe EPEC adherence factor (EAF) plasmid (see below), and a1-kb fragment from this region was developed as a diagnostic

DNA probe (the EAF probe) (27, 461). Although this probeproved to be extremely valuable in diagnosing EPEC (seebelow) and elucidating the epidemiology of EPEC infections,the exact nature of the adhesin mediating this adherence re-mained unknown for many years.

The identity of the factor mediating localized adherence wasreported in 1991 by Giron et al. (242), who described 7-nm-diameter fimbriae produced by EPEC strains which tended toaggregate and form bundles, thereby suggesting the namebundle-forming pilus (BFP). These fimbriae were producedonly under certain culture conditions, thereby accounting forthe failure of previous investigators to identify them (584).

Antiserum prepared against purified BFP significantly, al-though not completely, reduced the localized adherence ofEPEC strain B171 (O111:NM) to HEp-2 cells. BFP are defi-nitely involved in bacterium-to-bacterium adherence in thelocalized adherence pattern, but there is no definitive proofthat BFP mediates actual adherence to epithelial cells. TheN-terminal sequence of the purified fimbriae revealed similar-ity to the TCP pilus ofV. cholerae (242) and other members ofthe type IV fimbrial family. Donnenberg et al. (157) identifiedthe structural gene encoding BFP (bfpA) by using a TnphoAmutant of E2348/69 which no longer conferred localized ad-herence. Subsequent genetic studies have revealed that a clus-ter of 13 genes on the EAF plasmid is required for the expres-sion and assembly of BFP (609, 621). Many of these genesencode proteins with similarity to proteins required for type IVpilus biogenesis in other gram-negative pathogens such as V.

cholerae and Pseudomonas aeruginosa, but some BFP proteinshave no obvious homologs. In addition, expression and assem-bly of BFP require the global regulator element of EPECpathogenesis, Per (also called BfpTWV [see below]), and thechromosomal dsbA gene, encoding a periplasmic enzyme thatmediates disulfide bond formation (715).

(ii) Signal transduction. Adherence of EPEC to epithelialcells induces a variety of signal transduction pathways in the

eukaryotic cell. The bacterial genes responsible for this signaltransduction activity are encoded on a 35-kb pathogenicityisland called the locus of enterocyte effacement (LEE), whichencodes a type III secretion system, multiple secreted proteins,and a bacterial adhesin called intimin (see below). Mutation ofthe genes encoding the secreted proteins (espA, espB, and

espD) or the genes encoding the type III secretion system (sepand esc) abolishes these multiple signalling events. However,none of these signalling events has been reproduced by theaddition of EPEC culture supernatants to epithelial cells,thereby indicating that actual binding of the bacterium is nec-essary for these changes.

FIG. 6. Characteristic EPEC A/E lesion observed in the ileum after oral inoculation of gnotobiotic piglets. Note the intimate attachment of the bacteria to theenterocyte membrane with disruption of the apical cytoskeleton. The appearance of a bacterium sitting on a pedestal of cell membrane is quite characteristic.Reprinted from reference 26 with permission of the publisher.


7/30/2019 Nataro J, 1998_142

16/61

Infection with EPEC induces increases in the intracellularcalcium levels [Ca2

i] in cultured epithelial cells to which they

are attached (30, 31, 179, 514). The calcium originates fromintracellular stores rather than from an influx of extracellularcalcium, and buffering of intracellular calcium greatly reducesthe polymerization of actin and formation of the A/E lesion(30, 179). The increase in [Ca2i] has been hypothesized toproduce the cytoskeletal changes induced by EPEC via activa-tion of a calcium-dependent, actin-severing protein whichcould break down actin in the microvillus core (31). Further-more, since increases in intracellular calcium can inhibit Na

and Cl absorption and stimulate chloride secretion in entero-cytes (201, 202), these data also suggest that changes in [Ca2i]may mediate the intestinal secretory response to EPEC. Thereis evidence that calcium is released from 1,4,5-inositol trisphos-phate (IP3)-sensitive stores (31), and several investigators haveshown that binding of EPEC to cultured epithelial cells triggersthe release of inositol phosphates including IP

3and IP

4in

infected cells (179, 212, 360). The increase in the amount ofinositol phosphates is consistent with the recently reportedactivation of phospholipase C1 by EPEC attached to epithe-

lial cells (351).Adherence of EPEC to epithelial cells results in the phos-

phorylation of several epithelial cell proteins on serine andthreonine residues, the most prominent of which is myosinlight chain (407, 409). Activation of at least two kinases, PKCand myosin light chain kinase, has been shown (28, 137, 408,712). Activation of PKC induces rapid changes in intestinal

water and electrolyte secretion in vivo and in vitro (532) andphosphorylation of myosin light chain can lead to increasedpermeability of tight junctions (408), thereby suggesting addi-tional potential mechanisms of diarrhea due to EPEC.

Binding of EPEC to HeLa cells also induces protein phos-

phorylation on tyrosine residues (351, 544). The major ty-rosine-phosphorylated protein is a 90-kDa protein, calledHp90, inserted into the epithelial cell membrane protein (544).The tyrosine-phosphorylated proteins are part of the A/E le-sion, and the distribution of the phosphorylated proteins isrestricted to an area immediately beneath the adherent bacte-ria at the tip of the pedestals (545). Rosenshine et al. (545)have also shown that the tyrosine-phosphorylated Hp90 servesas a receptor for the intimin adhesin (see below). Thus, thesignal transduction induced in epithelial cells by EPEC acti-

vates receptor binding activity as well as subsequent cytoskel-etal rearrangements. The Hp90 protein has recently beenshown to be a bacterial protein called Tir (translocated intiminreceptor) (352a).

Experiments with polarized epithelial cells such as Caco-2 orT84 show that binding of EPEC results in a decrease in thetransepithelial resistance of the monolayers (101, 514, 614).

Although an initial report suggested that this drop in resistanceinvolved a transcellular pathway (101), subsequent reportshave demonstrated that the paracellular pathway with alter-ations in tight junctions is involved (514, 614). Buffering of

increases in the intracellular calcium concentration completelyabrogated the change in resistance (614).

In addition to the effects seen with intestinal epithelial cells,the signal transduction response to EPEC also includes migra-tion of polymorphonuclear leukocytes (PMNs). Using an in

vivo system in which polarized T84 intestinal epithelial cells arecocultured with PMNs, Savkovic et al. (565) showed that at-tachment of EPEC to the epithelial cells caused PMNs to crossthe epithelial monolayer. Stimulation of PMN transmigrationacross intestinal epithelial cells has been shown for invasiveorganisms such as Salmonella spp. (429) but is unusual for aprimarily noninvasive organism such as EPEC. Experimental

FIG. 7. Three-stage model of EPEC pathogenesis. (A) The first stage is characterized by initial, relatively distant interaction of bacteria with the enterocyte layer.This initial attachment is thought to be mediated by the bundle-forming pilus. (B) In the second stage, eae and other genes are activated, causing dissolution of thenormal microvillar structure. (C) In the third stage, the bacterium binds closely to the epithelial membrane via the protein intimin. Other bacterial gene productsmediate further disruption of the cytoskeleton and phosphorylation of cellular proteins. Modified from reference 158 with permission of the publisher.


7/30/2019 Nataro J, 1998_142

17/61

evidence supports a model in which the binding of EPEC toepithelial cells activates the eukaryotic transcription factor NF-B, which in turn upregulates the expression of the cytokineIL-8, which is a PMN chemoattractant (565, 566). Neutralizingantibodies to IL-8 ablated ca. 50% of the chemotactic activity,suggesting that other epithelium-derived chemotactic factorsare also stimulated by EPEC adherence.

(iii) Intimate adherence. Intimate adherence of EPEC to

epithelial cells is mediated by a 94- to 97-kDa outer membraneprotein called intimin. The gene encoding intimin (eae, for E.

coli attaching and effacing) was first reported by Jerse et al.(314), who screened TnphoA mutants of EPEC for loss of the

A/E phenotype by using the FAS test (the genes involved inEPEC pathogenesis are illustrated in Fig. 8). Although eaemutants cannot adhere intimately to epithelial cells, they canstill induce the signal transduction activities described above(212, 544, 565, 618). The eae gene is present in all EPEC,EHEC, C. rodentium, and H. alvei strains capable of producingthe A/E histopathology but is absent from E. coli strains in thenormal flora, ETEC strains, and other bacteria that do notproduce the A/E lesion.

The predicted intimin protein has 31% identity and 50%similarity to the invasin protein ofYersinia species (301). Com-

parison of the intimin proteins of EPEC strain E2348/69 andEHEC O157:H7 strain EDL933 reveals a striking pattern ofsequence conservation among intimin proteins (711). Al-though the overall protein identity is 83%, the sequence diver-gence is concentrated in the C-terminal region. The first 75%of the protein (i.e., the first 704 amino acid residues startingfrom the N terminus) has 94% identity, while the remaining25% of the residues has only 49% identity (711). The highlydivergent C-terminal region is the portion of the molecule thatbinds to receptors on the epithelial cell (217), and the differentintimin sequences can confer different colonization patterns

within the intestine (see the section on EHEC, below). Thereis a growing family of intimin proteins, and sequences havebeen determined for at least nine intimin proteins from EPEC(8, 314, 398, 687), EHEC (8, 43, 398, 711), C. rodentium (570),

H. alvei (217), and E. coli strains pathogenic for rabbits andswine (8). The intimin proteins from these different pathogensare referred to as Int

EPEC, Int

O26(from an O26 E. coli strain),

IntHA

(from Hafnia alvei), etc. The overall pattern for thesesequences shows high conservation in the N-terminal regionand variability in the C-terminal region.

The role of intimin in human disease was demonstrated bystudies in volunteers, who ingested an isogenic eae null mutantof E2348/69 (161). Diarrhea was seen in 11 of 11 volunteersingesting the wild-type E2348/69 compared to 4 of 11 volun-teers ingesting the isogenic mutant (P 0.002). These resultsindicate that the eae gene is essential for full virulence ofEPEC strain E2348/69 but that additional virulence factors areclearly required for disease. Prior to the discovery of the eaegene, Levine et al. (386) reported that a 94-kDa outer mem-brane protein (OMP) engendered a strong antibody response

in volunteers experimentally infected with EPEC. Subsequentstudies showed that this immunogenic 94-kDa OMP is intimin,the product of the eae gene (312). Interestingly, in the volun-teer studies conducted by Levine et al. (386) with 10 volun-teers, the 9 who became ill upon challenge had no preexistingantibodies to the 94-kDa OMP. In the other volunteer, who didnot become ill, antibodies to intimin were present in seracollected prior to challenge. This result hints that intimin mayplay a role in protective immunity to disease due to EPEC.Secretory immunoglobulin A (IgA) to a 94-kDa OMP ofE2348/69 was also found in breast milk from women in a ruralMexican village (143).

Expression of intimin in E. coli K-12 is not sufficient tomediate adherence to epithelial cells (314). However, E. coliK-12 expressing intimin from EPEC strains or E. coli O157:H7can adhere to epithelial cells when the cells are preinfected

with an eae mutant of EPEC (437). The eae mutant itselfcannot adhere intimately, but it can provide signals that triggerthe epithelial cell to form a functional receptor to which K-12expressing intimin can adhere. Rosenshine et al. (545) have

presented evidence that the EPEC receptor is a tyrosine-phos-phorylated 90-kDa membrane protein exposed on the surfaceof epithelial cells. As discussed above, one of the signal trans-duction events characteristic of EPEC adhering to epithelialcells is tyrosine phosphorylation of a 90-kDa protein (Tir).When this 90-kDa protein is not tyrosine-phosphorylated, itcannot serve as a receptor. These investigators also showedthat purified intimin protein fused to maltose binding proteincan bind to membranes extracted from cells preincubated withthe eae mutant but not to membranes extracted from cells thathave not been infected with this strain. In contrast to theseresults, Frankel et al. (217, 218) reported that purified intimin-maltose binding protein fusions can adhere to epithelial cellsthat have not been preincubated with EPEC. These investiga-tors further report that intimin binds to 1 integrins (220),

which also serve as receptors for the invasin protein fromYersinia species (379). The reason for these discrepant resultsis not clear, but it is possible that intimin can bind to more thanone receptor, and the question of which receptor is relevant foradherence to intestinal tissue remains to be answered.

Secreted proteins. A secreted enterotoxin that would explainthe mechanism of diarrhea due to EPEC has been unsuccess-fully sought for many years (542). It was recently discovered bythree independent groups that EPEC strains can secrete pro-teins into the culture supernatant if grown in cell culture media(273, 309, 350). These proteins, called Esps (for EPEC-se-creted proteins), are also produced during the course of dis-ease, since volunteers experimentally infected with EPEC pro-duce antibodies against a number of these proteins (309).However, in contrast to conventional enterotoxins, addition ofpurified preparations of these secreted proteins has no effecton epithelial cells; only when the proteins are presented to thetarget epithelial cell by an attached EPEC can they bring aboutthe various signal transduction changes in the epithelial celloutlined above.

At least four proteins are secreted extracellularly by EPEC,and three of these are essential for the A/E histopathology.The proteins that are essential for the A/E phenotype and theirapparent molecular masses on sodium dodecyl sulfate-polyac-rylamide gel electrophoresis are EspA (25 kDa) (352), EspB(38 kDa; formerly called EaeB) (164, 211, 273, 350), and EspD(40 kDa) (371). Mutation of the espA, espB, or espD geneabolishes the signal transduction in epithelial cells produced by

wild-type EPEC and the A/E histopathology. A fourth proteinof ca. 110 kDa, called EspC, is homologous to members of theautotransporter protein family, which includes IgA proteases

ofNeisseria gonorrhoeae and Haemophilus influenzae, Tsh pro-tein produced by avian pathogenic E. coli, SepA of Shigella

flexneri, and AIDA-I of DAEC (617). Mutation of the espCgene does not affect signal transduction, A/E histopathology,or any other obvious pathogenic phenotype of EPEC.

The EspA, EspB, and EspD proteins are translated withouta conventional N-terminal signal peptide (leader sequence).Jarvis et al. (309) showed that EPEC possesses a type IIIprotein secretion sys

Documents

Nataro J, 1998_142