Multipotential Nestin-Positive Stem Cells Isolated From

Multipotential Nestin-Positive Stem Cells Isolated FromAdult Pancreatic Islets Differentiate Ex Vivo IntoPancreatic Endocrine, Exocrine, and HepaticPhenotypesHenryk Zulewski,

1Elizabeth J. Abraham,

2Melissa J. Gerlach,

2Philip B. Daniel,

2Wolfgang Moritz,

3

Beat Muller,4

Mario Vallejo,5

Melissa K. Thomas,2

and Joel F. Habener2

The endocrine cells of the rat pancreatic islets of Lang-erhans, including insulin-producing b-cells, turn overevery 40–50 days by processes of apoptosis and theproliferation and differentiation of new islet cells (neo-genesis) from progenitor epithelial cells located in thepancreatic ducts. However, the administration to rats ofislet trophic factors such as glucose or glucagon-likepeptide 1 for 48 h results in a doubling of islet cell mass,suggesting that islet progenitor cells may reside withinthe islets themselves. Here we show that rat and humanpancreatic islets contain a heretofore unrecognized dis-tinct population of cells that express the neural stemcell–specific marker nestin. Nestin-positive cells withinpancreatic islets express neither the hormones insulin,glucagon, somatostatin, or pancreatic polypeptide northe markers of vascular endothelium or neurons, suchas collagen IV and galanin. Focal regions of nestin-positive cells are also identified in large, small, andcentrolobular ducts of the rat pancreas. Nestin-positivecells in the islets and in pancreatic ducts are distinctfrom ductal epithelium because they do not express theductal marker cytokeratin 19 (CK19). After their isola-tion, these nestin-positive cells have an unusually ex-tended proliferative capacity when cultured in vitro (;8months), can be cloned repeatedly, and appear to bemultipotential. Upon confluence, they are able to differ-entiate into cells that express liver and exocrine pan-creas markers, such as a-fetoprotein and pancreaticamylase, and display a ductal/endocrine phenotype withexpression of CK19, neural-specific cell adhesion mole-cule, insulin, glucagon, and the pancreas/duodenum spe-

cific homeodomain transcription factor, IDX-1. Wepropose that these nestin-positive islet-derived progen-itor (NIP) cells are a distinct population of cells thatreside within pancreatic islets and may participate inthe neogenesis of islet endocrine cells. The NIP cellsthat also reside in the pancreatic ducts may be contrib-utors to the established location of islet progenitorcells. The identification of NIP cells within the pancre-atic islets themselves suggest possibilities for treat-ment of diabetes, whereby NIP cells isolated frompancreas biopsies could be expanded ex vivo and trans-planted into the donor/recipient. Diabetes 50:521–533,2001

The mammalian pancreas consists of three dis-tinct tissue types: the ductal tree, the exocrineacini that produce digestive enzymes, and theendocrine islets of Langerhans. Embedded in the

exocrine tissue are the islets (which contain a-, b-, d-, andPP-cells that produce the hormones glucagon, insulin,somatostatin, and pancreatic polypeptide, respectively)involved in the regulation of physiological nutrient ho-meostasis (1). Ductal cells of the adult pancreas includelatent progenitor cells of the islet endocrine cells that canbe induced to differentiate into islet endocrine cells giventhe appropriate morphogen stimuli—a process referred toas neogenesis (2–6). The differentiation of duct cells of thepancreas into endocrine hormone-producing cells is be-lieved to recapitulate the embryonic development (ontog-eny) of the pancreas, whereby the exocrine and endocrinepancreases arise from the differentiation and proliferationof patterned endodermal cells in the early embryonicforegut that first form a ductal tree by branching morpho-genesis (1). During early embryonic development, neuraland islet cells share many phenotypic properties. Devel-oping islet cells express several neuronal-specific markerssuch as synaptophysins, nerve-specific enolase, the cate-chol-synthesizing enzymes tyrosine hydroxylase, dopaminedecarboxylase, phenylethylnolamine methyl transferase(7), and the transcription factors Isl-1, Brain-4, Pax 6, Pax4, Beta2/NeuroD, and IDX-1 (8–13).

Recently, pluripotential stem cells have been identifiedin the brain that are capable of differentiating into eitherneuronal or glial tissues (4,12). A special characteristic ofneural stem cells is that they express the protein nestin, an

From the 1Division of Endocrinology and Diabetes, University Hospital ofGeneva, Geneva, Switzerland; the 2Laboratory of Molecular Endocrinology,Massachusetts General Hospital, Howard Hughes Medical Institute, HarvardMedical School, Boston, Massachusetts; the 3Department of Surgery, Univer-sity Hospital of Zurich, Zurich; the 4Division of Endocrinology, Diabetologyand Metabolism, Department of Internal Medicine, University Hospitals,Basel, Switzerland; and the 5Institute for Biomedical Research, SuperiorCouncil of Scientific Research, Madrid, Spain.

Address correspondence and reprint requests to Joel F. Habener, Labora-tory of Molecular Endocrinology, Massachusetts General Hospital, 55 FruitSt., WEL320, Boston, MA 02114. E-mail: [email protected].

Received for publication 25 January 2000 and accepted in revised form 15November 2000.

H.Z. and E.J.A. contributed equally to this work.bFGF, basic fibroblast growth factor; CHIB, cultured human islet bud; CK19,

cytokeratin 19; ConA, concanavalin A; EGF, epidermal growth factor; GLP-1,glucagon-like peptide 1; HGF, hepatocyte growth factor; IPSC, islet progenitorstem cell; NCAM, neural cell adhesion molecule; NIP, nestin-positive islet-derived progenitor cell; PBS, phosphate-buffered saline; PCR, polymerasechain reaction; RIA, radioimmunoassay; RT, reverse transcription; SC, spher-ical cluster; SSC, sodium chloride–sodium citrate.

DIABETES, VOL. 50, MARCH 2001 521

Dow

nloaded from http://diabetesjournals.org/diabetes/article-pdf/50/3/521/366946/521.pdf by guest on 28 D

ecember 2021

intermediate filament protein (14,15). Nestin is expressedin the neural tube of the developing rat embryo at embry-onic day 11 (E11), reaches maximum levels of expressionin the cerebral cortex at E16, and decreases in expressionin the adult cortex, becoming restricted to a population ofependymal cells (14). Because of phenotypic similaritiesbetween developing neural and islet cells, we examinedrat pancreatic islets for the presence of nestin-expressingcells. Here we demonstrate the existence of a distinctpopulation of cells within islets and in focal regions of thepancreatic ducts and exocrine pancreas that express nes-tin and have an extended capacity for proliferation invitro. These cells derived from islets have properties ofstem cells and can differentiate in culture into cells withliver, pancreatic exocrine/ductal, and endocrine pheno-types. The differentiated cells express several liver andexocrine pancreatic markers, such as a-fetoprotein, trans-thyretin, carboxypeptidase, the ductal marker cytokeratin19 (CK19), and neural cell adhesion molecule. They alsosecrete detectable levels of islet hormones, such as insu-lin, glucagon, and glucagon-like peptide 1 (GLP-1), as wellas express the transcription factor IDX-1 (also known asPDX-1, IPF-1, and STF-1) (16–19). Our observations de-scribed herein provide evidence that pancreatic isletsthemselves, apart from the ducts, also contain multipoten-tial progenitor cells. These findings may have implicationsfor enhancing engraftment of isolated islets in diabeticindividuals by providing new insights into modifications ofislet preparations used in ongoing clinical islet transplan-tation studies.

RESEARCH DESIGN AND METHODS

Animals. Male Sprague-Dawley rats, 8–9 weeks old and weighing ;200 g(Taconics, Germantown, NY), were obtained for preparation of pancreatictissue sections for immunocytochemistry and for the isolation of pancreaticislets for tissue culture. Timed pregnant female Sprague-Dawley rats (CharlesRiver, Wilmington, MA) were obtained for isolation of fetal pancreases at E16.Isolation and culture of pancreatic islets. Rat pancreases were removed(postmortem) and dissected into 2- to 3-mm segments, and islets were isolatedby the collagenase digestion method of Lacy and Kostianovsky (20). Humanislet tissue was obtained from the islet distribution program of the CellTransplant Center, Diabetes Research Institute, University of Miami School ofMedicine (Miami, FL), and the Juvenile Diabetes Foundation Center for IsletTransplantation, Harvard Medical School (Boston, MA). Thoroughly washedislets were handpicked, suspended in modified RPMI 1640 media (11.1 mmol/lglucose) supplemented with 10% fetal bovine serum, 10 mmol/l HEPES buffer,1 mmol/l sodium pyruvate, antibiotic-antimycotic (Gibco Life Technologies,Gaithersburg, MD), and 71.5 mmol/l b-mercaptoethanol (Sigma, St. Louis,MO), and added to 12-well tissue culture plates (Falcon 3043; BectonDickinson, Lincoln Park, NJ) that had been coated with concanavalin A(ConA). The islet preparation was incubated for 96 h at 37°C with 95% air and5% CO2. In these conditions, most of the islets remained in suspension(floated), whereas fibroblasts and other non-islet cells attached to thesubstratum. After 96 h of incubation, the media containing the suspendedislets were carefully removed, and the islets were manually picked andresuspended in the modified RPMI 1640 media, now further supplementedwith 20 ng/ml each of basic fibroblast growth factor (bFGF) and epidermalgrowth factor (EGF). The islet suspension (containing 20–30 islets per well)was added to 12-well plastic tissue culture plates not coated with ConA. Theislets immediately adhered to the surfaces of the plates. Within several days,a monolayer of cells was observed growing out and away from the islets. Cellsin the monolayers—nestin-positive islet-derived progenitor (NIP) cells—wererepeatedly recloned and expanded: 10 times over 8.5 months (rat) and 7 timesover 8 months (human). In certain instances, human NIP cells were culturedin modified RPMI media containing 2.5 mmol/l glucose and in several growthfactor combinations that include activin-A (2 nmol/l), hepatocyte growthfactor (HGF) (100 pmol/l), or betacellulin (500 pmol/l). In other instances, NIPcells were challenged with nicotinamide (10 mmol/l), exendin-4 (10 nmol/l),activin-A, and HGF in media (11.1 mmol/l glucose) containing no serum.

Dexamethasone (10 mmol/l) treatments were also administered in modifiedRPMI media containing no serum.Antisera. We used mouse monoclonal antibodies to human CK19 (cloneK4.627; Sigma). The rabbit polyclonal antisera to rat nestin and to IDX-1 wereprepared by immunizations of rabbits with a purified GST rat nestin fusionprotein or the last 12 amino acids of rat IDX-1, respectively (21). Theanti-human nestin antiserum was a generous gift from Dr. C.A. Messam(National Institute of Neurological Disorders and Stroke [NINDS], NationalInstitutes of Health, Bethesda, MD). Guinea pig anti-insulin and anti-pancre-atic polypeptide antisera were obtained from Linco (St. Charles, MO). Mouseantiglucagon and rabbit antisomatostatin antisera were purchased from Sigmaand DAKO (Carpinteria, CA), respectively. The mouse anti-human galanin andcollagen IV antisera were purchased from Peninsula Laboratories (Belmont,CA) and Caltag Laboratories (San Francisco, CA).Immunocytochemistry. Cryosections (6 mm) prepared from E16 and adult(60-day) rat pancreases and cells were fixed with 4% paraformaldehyde inphosphate buffer. Cells were first blocked with 3% normal donkey serum for30 min at room temperature and incubated with primary antisera overnight at4°C. Sections and cells were rinsed off with phosphate-buffered saline (PBS)and incubated with the respective Cy3 and Cy2 labeled secondary donkeyantisera for 1 h at room temperature. Slides were then washed with PBS andcoverslipped with fluorescent mounting medium (Kirkegaard and PerryLaboratories, Gaithersburg, MD). Tissue sections were incubated overnight at4°C with primary antisera. Primary antisera were then rinsed with PBS, andslides were blocked with 3% normal donkey serum for 10 min at roomtemperature before incubation with donkey anti-Cy3 (indocarbocyanine) orCy2 and either anti–guinea pig (insulin), anti-mouse (glucagon), or anti-sheep(somatostatin) sera DTAF (Jackson ImmunoResearch Laboratories, WestGrove, PA) for 30 min at room temperature. Slides were then rinsed with PBSand coverslipped with fluorescent mounting medium (Kirkegaard and PerryLaboratories). Fluorescence images were obtained using a Zeiss Epifluores-cence microscope equipped with an Optronics TEC-470 CCD camera (Optron-ics Engineering, Goleta, CA) interfaced with a PowerMac 7100 installed withIP Lab Spectrum analysis software (Signal Analytics, Vienna, VA).Reverse transcription and polymerase chain reaction. Total cellular RNAprepared from rat or human islets and cell cultures was reverse transcribedand amplified by polymerase chain reaction (PCR) for 35 cycles as describedpreviously (22). Oligonucleotides used as amplimers for the PCR and forsubsequent Southern blot hybridization were as follows. Rat nestin: forward,59gcggggcggtgcgtgactac 39; reverse, 59aggcaagggggaagagaaggatgt 39; hybridiza-tion, 59aagctgaagccgaatttccttgggataccagagga 39. Rat keratin 19: forward,59acagccagtacttcaagacc 39; reverse, 59ctgtgtcagcacgcacgtta 39; hybridization,59tggattccacaccaggcattgaccatgcca 39. Rat neural cell adhesion molecule(NCAM): forward, 59cagcgttggagagtccaaat 39; reverse, 59ttaaactcctgtggggttgg39; hybridization, 59aaaccagcagcggatctcagtggtgtggaacgatgat 39. Rat IDX-1: for-ward, 59atcactggagcagggaagt 39; reverse, 59gctactacgtttcttatct 39; hybridiza-tion, 59gcgtggaaaagccagtggg 39. Human nestin: forward, 59agaggggaattcctggag39; reverse, 59ctgaggaccaggactctcta 39; hybridization, 59tatgaacgggctggag-cagtctgaggaaagt 39. Human keratin: forward, 59cttttcgcgcgcccagcatt 39; re-verse, 59gatcttcctgtccctcgagc 39; hybridization, 59aaccatgaggaggaaatcagtacgctgagg 39. Human glucagon: forward, 59atctggactccaggcgtgcc 39; reverse,59agcaatgaattccttggcag 39; hybridization, 59cacgatgaatttgagagacatgctgaaggg 39.Human E-cadherin: forward, 59 agaacagcacgtacacagcc 39; reverse, 59cctccgaa-gaaacagcaaga 39; hybridization, 59 tctcccttcacagcagaactaacacacggg 39. Humantransthyretin: forward, 59 gcagtcctgccatcaatgtg 39; reverse, 59 gttggctgtgaatac-cacct 39; hybridization, 59 ctggagagctgcatgggctcacaactgagg 39. Human pancre-atic amylase: forward, 59gactttccagcagtcccata 39; reverse, 59 gtttacttcctgcagggaac 39; hybridization, 59 ttgcactggagaaggattacgtggcgttcta 39. Human pro-carboxypeptidase: forward, 59 tgaaggcgagaaggtgttcc 39; reverse, 59 ttcgagata-caggcagatat 39; hybridization, 59 agttagacttttatgtcctgcctgtgctca 39. Humansynaptophysin: forward, 59 cttcaggctgcaccaagtgt 39; reverse, 59 gttgaccatagt-caggctgg 39; hybridization, 59 gtcagatgtgaagatggccacagacccaga 39. HumanHGF: forward, 59 gcatcaaatgtcagccctgg 39; reverse, 59 caacgctgacatggaattcc 39;hybridization, 59 tcgaggtctcatggatcatacagaatcagg 39. Human cMET (HGF re-ceptor): forward, 59 caatgtgagatgtctccagc 39; reverse, 59 ccttgtagattgcaggcaga39; hybridization, 59 ggactcccatccagtgtctccagaagtgat 39. Human XBP-1: for-ward, 59gagtagcagctcagactgcc 39; reverse, 59 gtagacctctgggagctcct 39; hybrid-ization, 59 cgcagcactcagactacgtgcacctctgca 39. Human GLUT2: forward, 59gcagctgctcaactaatcac 39; reverse, 59 tcagcagcacaagtcccact 39; hybridization, 59acgggcattcttattagtcagattattggt 39. Human insulin: forward, 59 aggcttcttcta-caca 39; reverse, 59 caggctgcctgcacca 39; hybridization, 59 aggcagaggacctgca 39.

Primers were selected from two different exons and encompassed at leastone intronic sequence. In addition, a reverse transcription (RT) minus controlwas run for most samples. PCR cycling was at 94°C for 1 min followed by 94°Cfor 10 s, 58/56/54°C for 10 s, 72°C for 1 min (35 cycles), and 72°C for 2 min. The

NESTIN-POSITIVE STEM CELLS FROM ADULT ISLETS

522 DIABETES, VOL. 50, MARCH 2001

Dow


ecember 2021

annealing temperature was 58°C for rat nestin, 45°C for human insulin, and56/54°C for the remaining primer pairs.

For Southern hybridization, oligonucleotide probes were labeled with T4polynucleotide kinase and [g-32P]ATP. Radiolabeled probes were hybridizedto PCR products that had been transferred to nylon membranes at 37°C for1 h, then washed in 1 3 sodium chloride–sodium citrate (SSC) 1 0.5% SDS at55°C for 10–20 min or 0.5 3 SSC 1 0.5% SDS at 42°C for the human PCRproducts.

Radioimmunoassays. Insulin and glucagon concentrations in culture mediawere determined by ultrasensitive radioimmunoassay (RIA) kits purchasedfrom Linco Research and Diagnostics Products, respectively. The antiserasupplied in the respective kits are guinea pig anti-human insulin and rabbitanti-human glucagon. GLP-1 secretion was measured with an anti-humanGLP-1(7-36) amide rabbit polyclonal antiserum raised by immunization of arabbit with a synthetic peptide CFIAWLVKGR amide conjugated to keyholelimpet hemocyanin. The antiserum is highly specific for the detection of

FIG. 1. Expression of the neural stem cell–specific marker nestin in a distinct cell population within pancreatic islets. Dual fluorescenceimmunocytochemical staining of (A) an islet cluster in an E16 rat pancreas and (B) a pancreatic islet in the pancreas of an adult 60-day-old (P60)rat. Immunostaining of nestin and insulin were developed with the fluorophores Cy3 (red) and Cy2 (green), respectively. Note that there is nocoexpression of nestin and insulin in the cells, which, if present, would be seen as yellow cells. Typical representative islets are shown. C: Nestin(red) and collagen IV (green), a marker of vascular endothelium, are expressed in separate cell populations in a rat pancreatic islet. D:Nestin-positive (yellow in pseudocolor) cells have a distinct nucleus (blue stain with Hoechst). E: RT-PCR of RNA prepared from islets isolatedfrom a P60 adult rat (left) or human islet tissue (right). RT-PCR was performed using oligonucleotide amplimers to rat and human nestin mRNAgiving the predicted 326- or 495-bp product of the correct size (upper panels) and confirmed by Southern blot analysis hybridized with a32P-labeled nestin probe (lower panels) (see RESEARCH DESIGN AND METHODS). Original magnification 3200.

H. ZULEWSKI AND ASSOCIATES


Dow


ecember 2021

FIG. 2. Isolation and proliferation of NIP cells. A: Isolation of NIP cells. Panel 1: A rat islet cultured for 8 days in modified RPMI 1640 mediacontaining 20 ng/ml bFGF and EGF showing outgrowth of the monolayer of cells. Original magnification 3100. Panel 2: Dual fluorescenceimmunostaining of the cell monolayer outgrowing from rat islets using antisera to nestin (Cy3) and insulin (Cy2). B: Proliferation and formationof SCs in rat cultures. Five to ten cells were picked from the monolayer shown in A and subcloned by cylindrical cloning. Two-day cultures showthat the cells have attached. Then, cells proliferate and reach confluence by day 12. They then migrate (15 days) and form SCs by day 18. The last



Dow


ecember 2021

GLP-1(7-36) amide and only weakly detects proglucagon. The sensitivity levelsfor the insulin, glucagon, and GLP-1 assays are 8, 13, and 10 pg/ml, respec-tively. The interassay variability for the insulin RIAs was 15%.

RESULTS

Stem cell marker nestin expression within pancreatic

islets. Nestin expression was observed by immunocyto-chemical staining of a distinct population of cells withindeveloping islet clusters of E16 rat pancreas (Fig. 1A) andin islets of the adult rat pancreas (60 days postnatally)(Fig. 1B). The nestin-positive cells are distinct from b-, a-,d-, and PP-cells because they do not costain with antiserato the hormones insulin (Fig. 1A and B), glucagon, soma-tostatin, or pancreatic polypeptide (data not shown). Thenestin-positive cells also do not costain with antisera tocollagen IV, a marker for vascular endothelial cells (Fig.1C); with an antiserum to galanin, a marker for nerve cells(data not shown); or with a monoclonal antibody to CK19,a specific marker for ductal cells (Fig. 6A and B). Nestin-positive staining is associated with distinct cells within theislets clearly observed by nuclear costaining (Fig. 1D). Toconfirm the immunocytochemical identification of nestinexpression in pancreatic islets, we performed an RT-PCRof the nestin mRNA using total RNA prepared from freshlyisolated rat islets and human islet tissue. The RT-PCRgenerated products of the correctly predicted size (Fig. 1E,upper panels) that were confirmed by Southern blotting(Fig. 1E, lower panels) and by DNA sequencing of theproducts (data not shown). Thus, we identified a new celltype in pancreatic islets that expresses nestin and mayrepresent an islet pluripotential or multipotential stem cellsimilar to the nestin-positive stem cells in the centralnervous system.Isolation and proliferation of NIP cells in vitro

Having established the presence of nestin-expressing cellswithin islets, we next sought to determine whether thesecells have the potential to proliferate in vitro, anothercharacteristic feature of stem cells. To pursue this notion,islets prepared from 60-day-old rats or obtained from anormal adult human were first plated on ConA-coateddishes and cultured in modified RPMI 1640 medium con-taining 10% fetal bovine serum for 4 days to purge the isletpreparation of fibroblasts and other non-islet cells thatadhered to the ConA-coated plates. The islets that did notadhere to the plates under these culture conditions werecollected and transferred to 12-well plates (without ConAcoating) containing the same modified RPMI 1640 mediumnow additionally supplemented with bFGF and EGF (20ng/ml each). The growth factors bFGF and EGF togetherwere selected because they are known to stimulate theproliferation of neural stem cells derived from ependymaof the brain (13). The islets attached to the plates and cellsslowly grew out of the islet as a monolayer. The outgrow-ing monolayer of cells (Fig. 2A, panel 1) expressed nestin(Fig. 2A, panel 2). Rat cells were picked from the mono-layer (batches of at least 5–10 cells), subcloned into12-well plates, and incubated with the modified RPMI 1640medium (11.1 mmol/l glucose) containing bFGF and EGF.

Figure 2B shows a time lapse series of representativeimages of the same field of rat NIP cells taken every 24 hfor 18 days. Only days 2, 5, 12, 15, and 18 are shown forsake of brevity. The subcloned cells were attached at 2days, grew slowly up to 5 days, and then rapidly prolifer-ated, dividing every 12–15 h, as determined by countingthe cells in the wells, and became confluent by 10–11 days.After attaining confluence, the cells migrated to formwave-like structures, and after 15–18 days of culture, thecells formed spherical clusters (SCs) (Fig. 2B, bottom rightpanel). This proliferation behavior of the NIP cells isreminiscent of that of marrow stromal cells (describedrecently by Colter et al. [23]), which are pluripotentialstem cells.

Similar cells were cloned from human islets. The sub-cloned human cells expressed nestin (Fig. 2C) but notinsulin (data not shown). By immunostaining, a smallsubpopulation of subcloned cells expressed the homeodo-main protein IDX-1, possibly reflecting early stages of thedifferentiation process; however, the majority of the cellsdid not stain for IDX-1 (not shown). Upon reachingconfluence (Fig. 2D, panel 1), the human cells migrated toform large vacuolated structures in the dish (Fig. 2D,panels 2 and 3). Then the cells lining the large spaceschanged morphology, rounded, and aggregated togetherforming three-dimensional SCs (Fig. 2D, panels 4–6). It isimportant to note that monolayers of both rat and humanNIP cells were cloned and recloned and expanded for 10and 7 consecutive cycles, respectively.Differentiation of NIP cells toward endocrine or duc-

tal/exocrine pancreatic phenotypes. We characterizedindicators of differentiation of NIP cells that formed theSCs by RT-PCR and Southern blot and found that theyexpress the endocrine marker NCAM (24) (Fig. 3A, rightpanel) and the ductal cell marker CK19 (25–27) (Fig. 3A,left panels). At this stage of study, we concluded that whenthe NIP cells became confluent and aggregated into SCs,they began to express pancreatic genes (NCAM and CK19)but may have been limited in expression of islet genesbecause of the absence of growth factors essential fortheir differentiation to endocrine cells. We also recognizedthat the differentiation of a progenitor cell populationtypically requires first a proliferative phase and thenquiescence of proliferation in the presence of differentia-tion-specific morphogen growth factors. Therefore, wemodified the culture conditions in some instances byreplacing the media containing 11.1 mmol/l glucose, bFGF,and EGF, with media containing lower glucose (2.5 mmol/l),HGF/scatter factor, betacellulin, activin-A, exendin-4, or nic-otinamide. It is important to appreciate that glucose is aknown proliferative factor for pancreatic islet b-cells (28,29)and that HGF/scatter factor, activin-A, and exendin-4 havebeen shown to differentiate the pancreatic ductal cell lineAR42J into an endocrine phenotype that produces insulin,glucagon, and other pancreatic endocrine cell proteins (30–32).

We found that human NIP cultures containing SCs also

panel (bottom right) is a magnified image of an SC. C: NIP cells subcloned (passage 1; day 5) from human islets and immunostained with antiserato nestin (Cy3). D: Sequence of events leading to the formation of SCs in human NIP cell cultures. Cells were picked from the outgrowthsurrounding a human islet and subcloned. The cells become confluent (panel 1), migrate (panel 2), and form vacuolated structures (panel 3).Next, cells around these spaces become round, forming dense bodies (panel 4), which become larger (panel 5), and eventually form SCs (panel6).



Dow


ecember 2021

expressed the pancreas-specific homeodomain proteinIDX-1 by immunocytochemistry (Fig. 3B), RT-PCR, andSouthern blot (Fig. 3C), and by Western immunoblot (Fig.3D). The expression of IDX-1 is of particular importancebecause it is recognized to be a master regulator ofpancreas development and to be required for the matura-

tion and functions of the pancreatic islet b-cells thatproduce insulin (33).

Some cultures of NIP cells containing SCs also ex-pressed the mRNA encoding proglucagon and insulin, asseen by RT-PCR (Fig. 4A and B), and secreted smallamounts of immunoreactive glucagon, GLP-1, and insulin

FIG. 3. Differentiation of rat and human NIP cells toward an endocrine or duct phenotype. A: The DNA products (upper panels) of the correctpredicted sizes generated by RT-PCR of NIP RNA using amplimers to rat (690 bp) or human (1 kb) CK19 and rat NCAM (326 bp). The authenticityof the DNA products was verified by Southern blot hybridization using 32P-labeled CK19 and NCAM, respectively (lower panels). B: Expressionof homeodomain protein IDX-1 in human SCs derived from NIP cells. Immunocytochemistry (Cy3 immunofluorescence) in SCs (after treatmentwith bFGF plus EGF for 17 days, then incubation with Activin-A plus HGF for 2 weeks) using an antiserum to IDX-1. Bright punctate structuresare immunopositive nuclei throughout the SCs (inset; original magnification 3400). Preimmune serum control staining of human SCs werenegative (not shown). C: RT-PCR of mRNA prepared from SCs. DNA product (553 bp) obtained by RT-PCR (top panel) was confirmed by Southernblot hybridization (bottom panel). D: Western immunoblot of protein extract (positive control) prepared from human SCs derived from NIP cells(left) compared with extract prepared from a rat clonal b-cell line (INS1) (right) using an antiserum to IDX-1 (upper panels) or preimmuneserum (lower panels). The exposure was longer for the Western blot prepared for human NIP cells.



Dow


ecember 2021

FIG. 4. Expression of pancreatic endocrine hormones in NIP cultures containing SCs. A: RT-PCR of RNA prepared from human NIP cultures(bFGF plus EGF for 17 days, then incubated with activin-A plus HGF for 14 days) containing islet-like aggregates or freshly isolated islets wasperformed using oligonucleotide primers for human proglucagon (179 bp, top panels). The identity of bands were confirmed by Southern blottingwith a 32P-labeled proglucagon oligonucleotide probe (lower panels; see RESEARCH DESIGN AND METHODS.) B: RT-PCR product of RNA prepared fromhuman NIP cultures (bFGF plus EGF for 9 days, then incubated with activin-A, HGF, nicotinamide, and exendin-4 for 3 days) or islets usingoligonucleotide primers for human insulin (;100 bp, top panels). The authenticity of the bands were confirmed by Southern blotting with a32P-labeled probe (lower panel). C: Insulin secretion values from NIP cultures that were subjected to the same treatment protocol as in B, or controlmedia that contained no growth factors (n 5 1). Note that the data in Table 1 and Fig. 4 are obtained from different clonal lines of human NIP cultures.



Dow


ecember 2021

(Table 1). Moreover, incubation of the cell clusters for 6days in nicotinamide, as described by Ramiya et al. (34), or3 days with a combination of growth factors containingactivin-A, HGF, nicotinamide, and exendin-4 increasedinsulin secretion by two- to fivefold (Table 1 and Fig. 4C).Several additional pancreatic markers were expressed indifferentiated NIP cells, such as GLUT2 (35), synaptophy-sin, and HGF (36), as shown in Fig. 5. To determinewhether the differentiating NIP cells may have propertiesof pancreatic exocrine tissue, we used RT-PCR and de-tected the expression of amylase and procarboxypepti-dase (Fig. 5).Differentiation of NIP cells toward hepatic pheno-

types. Because of the reported apparent commonaltiesbetween hepatic stem cells (oval cells), hepatic stellatecells, and progenitor cells in the pancreas, and the obser-vations that after some injuries, the regenerating pancreasundergoes liver metaplasia (1,37–39), we performed RT-PCR to detect liver-expressed genes in the SCs. PCRproducts were obtained for XBP-1, a transcription factorrequired for hepatocyte development (40), and transthyre-tin, a liver acute-phase protein. Several other liver markerswere also expressed, such as a-fetoprotein (41), E-cad-herin (42), c-MET (43), HGF (44), and synaptophysin (35)(Fig. 5) The expression of proteins shared by the pancreasand liver, such as HGF and synaptophysin, may reflecttheir common origin from the embryonic foregutendoderm and represent differentiation toward either pan-creatic or hepatic phenotypes.Nestin expression is also localized within limited

focal regions of pancreatic ducts. Because the neogen-esis of new islets is also known to occur by differentiationof cells in pancreatic ducts, particularly during the neona-tal period (rats and mice) but to some extent throughoutadult life (3–6), we looked for nestin expression in thepancreatic ducts of adult rats. By dual fluorescence immu-nocytochemistry with antisera to nestin and to CK19, amarker of ductal epithelium, nestin is strongly expressedin cells in localized regions of both the large and smallducts as well as in some centrolobular ducts within theexocrine acinar tissue (Fig. 6A–C). Remarkably, the local-ized regions of nestin expression in the ducts are mostlydevoid of staining for CK19. Further, the nestin-positivecells in the ducts appear to have a morphology that is

distinct from that of the epithelial cells. The epithelial cellsconsist of a homogenous population of cuboid roundedcells, whereas the nestin-positive cells are nucleated,serpiginous, and appear to reside in the interstices amongor around epithelial cells (Fig. 6C).

Thus, CK19 is not expressed in the majority of ductalcells that express nestin, suggesting that these nestin-expressing cells located within the pancreatic ducts are apassenger population of cells distinct from the ductalepithelial cells and may represent stem cells that have notyet differentiated into a ductal or endocrine phenotype.The finding of localized populations of nestin-expressingcells within the pancreatic ducts (and islets) of the adultrat pancreas further supports the idea that rat pancreaticducts contain cells that are progenitors of islet cells(neogenesis), but these progenitors may not be a subpopu-lation of ductal epithelial cells per se.

DISCUSSION

Here we demonstrate the presence of a distinct cell typethat expresses the neural stem cell–specific marker nestinwithin rat and human pancreatic islets and ducts with anextended capacity to proliferate in vitro. These nestin-positive cells, when isolated from islets, can differentiatein vitro to cells that express pancreatic endocrine mark-ers, such as GLUT2, insulin, glucagon, and the homeodo-main transcription factor IDX-1 as well as a number ofpancreatic exocrine and hepatic genes. These stem cell–like pluripotential cells may be similar to the islet progen-itor stem cells (IPSCs) described by Pour (45), Corneliuset al. (46), and Ramiya et al. (34) and possibly related tothe cultured human islet buds (CHIBs) described byBonner-Weir et al. (47), all of which were derived fromducts. However, the cells that we identified in the ductsand islets in the pancreas and describe herein do not yetappear to have a ductal phenotype. Although nestin isexpressed in some cells in the pancreatic ducts, the ductalmarker CK19 is not expressed in the majority of these cellsand also is not expressed in any of the nestin-positive cellslocated within the islets. These findings imply that thesenestin-expressing cells located within the pancreatic ductsare undifferentiated cells that are distinct from ductalepithelial cells. We suggest that the nestin-positive cellsmay be distinct multipotential stem or progenitor cells thathave not yet differentiated into either a ductal or anendocrine pancreatic or hepatic phenotype.

We speculatively propose two possibilities for the origin(neogenesis) of endocrine cells from the pancreatic ducts(Fig. 7). One is that regionalized populations of ductalepithelial cells can become endocrine cells given theappropriate morphogenic stimuli. The other possibility isthat the progenitors of endocrine cells consist, at least inpart, of distinct stem cells apart from the ductal epithelialcells that reside within the interstices of the ductal epithe-lial cells and within the surrounding periductal lamina. Wefavor the concept that the stem/progenitor cells that canbecome islet endocrine cells are not a specialized form ofductal epithelial cells but rather are a distinct populationof cells that reside within the interstices of the ductalepithelium and within the islets themselves. Notably, anow recognized property of stem cells is that they arehighly motile (48). They move rapidly within tissues, in

TABLE 1Secretion of pancreatic endocrine hormones from differentiatinghuman NIP cells

Days inculture

Hormone concentrations in mediaInsulin (pg/ml) Glucagon (pg/ml) GLP-1 (pg/ml)

60–64 28.2 13 4182–84 106 110 —85–87 68.5 34 —88–90 235.5 — —

Media were collected for RIAs after 4-day intervals of culture. Day 1is the day of initial subcloning. Insulin and GLP-1 values representthe average of measurements from two to three wells at each timeinterval in culture. Insulin levels varied from 13.3 to 56.4, 79 to 133,66 to 71, and 150 to 321 pg/ml for days 60–64, 82–84, 85–87, and88–90, respectively. GLP-1 levels varied from 15 to 67 pg/ml. NIPcells were pretreated with activin-A and HGF or betacellulin. Valuesobtained from 85- to 90-day cultures were derived from NIP cellstreated with nicotinamide in the absence of serum.



Dow


ecember 2021

FIG. 5. Expression of neuroendocrine, exocrine pancreatic, and hepatic markers in human NIP cultures containing SCs. RT-PCR of RNA preparedfrom human NIP cultures (cultured in the absence of serum for 9–12 days) was performed using oligonucleotides (see RESEARCH DESIGN AND

METHODS) for human synaptophysin (SYN), HGF receptor (HGFR) or c-MET, GLUT-2, pancreatic amylase (AMY), procarboxypeptidase (CARB),transthyretin (TTR) (induced when cultures were treated with 10 mmol/l dexamethasone), HGF, E-cadherin (E-CAD), XBP-1, and a-fetoprotein(AFP). The identities of each band was confirmed by Southern blotting with 32P-labeled oligonucleotides (data not shown).



Dow


ecember 2021

some aspects similar to macrophages. We propose that thepancreatic stem cells may likewise migrate within theislets and ducts and when they reach a specific mesenchy-mal niche and sense appropriate paracrine morphogensignals, are induced to differentiate into endocrine cells.Our bias is based on the observations of the distinctserpiginous morphology of the nestin-positive cells that isso unlike the cuboid morphology of the ductal epithelialcells or the rounded morphology of mature endocrine cellsof the islets.

It is possible that the stem cell–like multipotential cellsreportedly derived from pancreatic ducts are actually thesubpopulation of nestin-positive cells in the ducts (28,39).

The conditions of ex vivo growth used by these investiga-tors may have resulted in a more rapid differentiation to aductal phenotype than we have found. Nonetheless, thefinding of localized populations of nestin-expressing cellswithin the pancreatic ducts of the adult rat pancreasfurther supports the idea that cells located within pancre-atic ducts and islets are progenitors of islet cells (neogen-esis).

An important property of stem cells is their ability forself-renewal and differentiation into specific cell lineages.We subcloned rat and human NIP cells, maintained themin culture for over 8 months (in the presence of bFGF andEGF and 11.1 mmol/l glucose), and found that many (a

FIG. 6. Nestin-positive cells are expressed in localized regions of the ducts in the rat pancreas. A: Phase contrast (panel 1) and dualimmunofluorescence immunostaining (panel 2) using antisera to CK19 (green) and nestin (red) of a section of a pancreas from a 60-day-old rat(P60). (Original magnification 3100.) The arrows in panel 2 point to localized regions of the ducts that express nestin (red) or coexpress nestinand CK19 (yellow). Note that the islet contains cells are immunostained for cytokeratin (green) or nestin (red) but not both. Also note that thereare nestin-positive cells scattered about in the exocrine parenchyma, probably consisting of cells in centroacinar ductules. B: Section of ratpancreas showing islets and ducts stained with antisera to nestin (red) and CK19 (green). Original magnification 3200. C: High magnification ofa large duct in a section of a rat pancreas. The top panel shows immunostaining with antisera to nestin (yellow in pseudocolor), and the lowerpanel shows coimmunostaining for nestin (yellow in pseudocolor) and nuclei stained with Hoechst (blue).



Dow


ecember 2021

subpopulation) of these cells continued to express nestin.When the cells were allowed to become confluent and toform clusters (a process that was apparently acceleratedby the removal of bFGF and EGF and adding the differen-tiation factors such as HGF, activin-A, exendin-4, andnicotinamide), we observed expression of NCAM, theductal marker CK19, and the IDX-1 transcription factor. Infact, we are uncertain whether the HGF, activin-A, andnicotinamide per se are responsible for initiating theexpression of pancreatic islet markers because in some ofthe culture wells, confluence alone appeared to initiate theproduction of these markers. A notable exception wastransthyretin, a liver acute-phase protein (34) that wasexpressed only in NIP cell cultures treated with dexameth-asone. In some cultures, we detected low levels of se-creted islet hormones, such as insulin, glucagon, andGLP-1. In this regard, our cells are similar to the rat IPSCsdescribed by Ramiya et al. (34), which also secrete smallquantities of insulin in vitro (140 pg/300 islets) but arenevertheless able to reverse hyperglycemia in streptozo-tocin-induced diabetic mice when transplanted in vivo.

Although it seems clear that the combination of bFGFand EGF is pro-proliferative for both neural stem cells andour nestin-positive islet progenitor cells (12–14), it is lessclear which factors are essential for the differentiation ofNIP cells to an endocrine phenotype. We used HGF,activin-A, and exendin-4 because they have been shown todifferentiate AR42J cells, derived from a rat ductal carci-noma, to glucagon- and insulin-producing endocrine cells.Moreover, exposure of the AR42J pancreatic ductal cellline to high doses of dexamethasone converts them tohepatocytes (49). However, the duct-derived IPSCs (34)and CHIBs (47) differentiated in response to the applica-tion of HGF/EGF/nicotinamide and keratinocyte growthfactor/Matrigel, respectively. Further studies are war-ranted to optimize the in vitro conditions required tocomplete the pancreatic endocrine differentiation processand enhance hormone secretion from our NIP cell cul-tures.

It remains unclear whether the NIP cells described in

our studies are pluripotential stem cells, akin to bonemarrow hematopoietic stem cells and neural ependymalstem cells, or are multipotential cells that can differentiateto more restricted cell lineages. Our speculation is thatthese intraislet cells are multipotential stem cells with thepotential to differentiate into several pancreatic cell lin-eages (endocrine, exocrine, and ductal) or hepatic celllineages (37–39) given exposure to appropriate environ-mental growth factor stimuli.

Our findings of IDX-1 expression in localized regions ofhuman islet-like clusters suggest that these cells may becapable of differentiating into any pancreatic lineage.Similar to the CHIBs of Bonner-Weir et al. (47), we foundweak cytoplasmic and nuclear IDX-1 staining in the NIPcells and strong nuclear staining in the SCs of cells. IDX-1is a homeodomain protein expressed early in pancreasdevelopment (E8–9 in the mouse) (50) and the regenerat-ing pancreas after partial pancreatectomy (51), which isrequired for the development of the pancreas (10,16).IDX-1 is thought of as a “master regulator” of pancreasdevelopment and an essential transactivator of islet cell–specific genes such as the insulin gene expressed in b-cells(33). The ectopic expression of IDX-1 in a-cell lines that donot normally express IDX-1 in vitro (52,53) and in hepaticcells in vivo (54) converts them into a b-cell phenotype.Remarkably, the administration to mice of an adenovirus-based vector expressing IDX-1 is sufficient in and by itselfto convert a subpopulation of hepatic cells into insulin-producing b-cells that can also restore glucose homeosta-sis to streptozotocin-induced diabetic mice (54).

It is also worth noting that pancreatic cells have thecapacity to transdifferentiate into hepatic cells. During theregenerative phase of the rat pancreas after metabolicinjury (37), portions of the reforming pancreas undergoliver metaplasia. It has also been reported that the pan-creas contains hepatic oval stem cells (37). All of theselines of evidence suggest that a close relationship mayexist between pancreatic stem cells, NIP cells, and hepatic/oval stem cells. Therefore, we speculate that transplanta-tion of pancreatic stem cells to the liver may provide afavorable environment for successful engraftment, partic-ularly if the cells are programmed to express the transcrip-tion factor IDX-1. It is also tempting to speculate that therecent success of islet transplantation in individuals withtype 1 diabetes in which a much larger than usual numberof islets were transplanted (55) may be attributable to thedelivery of a suprathreshold number of stem cells con-tained within the islets.

Further investigations of the properties of the pancre-atic NIP cells may provide a means for successful islet celltransplantation without immunosuppression in patientswith diabetes owing to an absolute or relative loss of b-cellmass. Pancreatic biopsies obtained from the diabeticindividual could be used to prepare islets that could beused as a source for culture and expansion of intraisletprogenitor cells ex vitro. These cells then could be genet-ically engineered to preclude autoimmunity reactions andtransplanted back into the recipient host donor of theislets, thereby avoiding both immune intolerance (host vs.graft) and autoimmunity reactions. In this regard, success-ful transplantation of nonallogenic duct-derived pancre-atic stem cells has already been accomplished in mice

FIG. 7. Alternative models for the origin of pancreatic duct cells thatare progenitors of islet endocrine cells. Model 1: Ductal epithelial cellscontain specialized regions of prepatterned cells upon exposure toappropriate morphogens in the environment. Model 2: Stem cellsdistinct from epithelial cells reside in and around the ductal epithe-lium, are highly motile, and migrate until they find a mesenchymalniche that produces morphogens appropriate for their differentiationto endocrine cells. Our studies favor model 2 (Fig. 4C).



Dow


ecember 2021

(34). Stem cells isolated from pancreatic ducts, expandedex vivo, and implanted into nonobese diabetic mice cureddiabetes. It is intriguing that in this study (34), the stemcell graft was allogeneic and there was neither immuneintolerance nor autoimmunity, suggesting that the stemcells are immunologically blind and may be reprogrammedby the allogeneic host to be recognized as self. If thesefindings are substantiated by further studies, efforts toachieve successful transplantation of freshly isolatedwhole islets without immunosuppression in individualswith type 1 diabetes should be reconsidered and refocusedon the transplantation of pancreatic stem cells or islets inwhich the population of stem cells has been expanded byex vivo culturing.

ACKNOWLEDGMENTS

This work was supported in part by U.S. Public HealthService Grants DK 30457, DK 30834, and DK 55365 (toJ.F.H.) and DK 02476 (to M.K.T.). H.Z. was supported inpart by Deutsche Diabetes Stiftung. J.F.H. is an Investiga-tor with the Howard Hughes Medical Institute.

We thank H. Hermann, K. McManus, and S. McNamarafor expert experimental assistance and T. Budde and R.Larraga for preparation of the manuscript. We thank Dr. C.Messam (NINDS, NIH, Bethesda, MD) for sharing theantibody against human nestin with us.

REFERENCES

1. Slack JMW: Developmental biology of the pancreas. Development 121:1569–1580, 1995

2. Dudek RW, Lawrence IE Jr, Hill RS, Johnson RC: Induction of isletcytodifferentiation by fetal mesenchyme in adult pancreatic ductal epithe-lium. Diabetes 40:1041–1048, 1991

3. Bonner-Weir S, Baxter LA, Schuppin GT, Smith FE: A second pathway forregeneration of adult exocrine and endocrine pancreas: a possible reca-pitulation of embryonic development. Diabetes 42:1715–1720, 1993

4. Rosenberg L: In vivo cell transformation: neogenesis of beta cells frompancreatic ductal cells. Cell Transplant 4:371–383, 1995

5. Bouwens L, Kloppel G: Islet cell neogenesis in the pancreas. Virchows

Arch 427:553–560, 19966. Vinik A, Rafaeloff R, Pittenger G, Rosenberg L, Duguid W: Induction of

pancreatic islet neogenesis. Horm Metab Res 29:278–293, 19977. Alpert S, Hanahan D, Teitelman G: Hybrid insulin genes reveal a develop-

mental lineage for pancreatic endocrine cells and imply a relationship withneurons. Cell 53:295–308, 1988

8. Madsen OD, Jensen J, Petersen HV, Pedersen EE, Oster A, Andersen FG,Jorgensen MC, Jensen PB: Transcription factors contributing to thepancreatic beta-cell phenotype. Horm Metab Res 29:265–270, 1997

9. Sander M, German MS: The beta cell transcription factors and develop-ment of the pancreas. J Mol Med 75:327–340, 1997

10. Habener JF, Stoffers DA: A newly discovered role of transcription factorsinvolved in pancreas development and the pathogenesis of diabetesmellitus. Proc Assoc Am Physicians 110:12–21, 1998

11. St.-Onge L, Wehr R, Gruss P: Pancreas development and diabetes. Curr

Opin Genet Dev 9:295–300, 199912. Morshead CM, Reynolds BA, Craig CG, McBurney MW, Stains WA,

Morassutti D, Weiss S, van der Kooy D: Neural stem cells in the adultmammalian forebrain: a relatively quiescent subpopulation of subependy-mal cells. Neuron 13:1071–1082, 1994

13. Reynolds BA, Weiss S: Clonal and population analyses demonstrate that anEGF-responsive mammalian embryonic CNS precursor is a stem cell. Dev

Biol 175:1–13, 199614. Lendahl U, Zimmerman LB, McKay RD: CNS stem cells express a new class

of intermediate filament protein. Cell 60:585–595, 199015. Dahlstrand J, Zimmerman LB, McKay RD, Lendahl U: Characterization of

the human nestin gene reveals a close evolutionary relationship toneurofilaments. J Cell Sci 103:589–597, 1992

16. Jonsson J, Carisson L, Edlund T, Edlund H: Insulin-promoter-factor 1 isrequired for pancreas development in mice. Nature 371:606–609, 1994

17. Leonard J, Peers B, Johnson T, Ferreri K, Lee S, Montminy MR: Charac-

terization of somatostatin transactivating factor-1, a novel homeoboxfactor that stimulates somatostatin expression in pancreatic islet cells. Mol

Endocrinol 7:1275–1283, 199318. Miller CP, McGehee RE Jr, Habener JF: IDX-1: a new homeodomain

transcription factor expressed in rat pancreatic islets and duodenum thattransactivates the somatostatin gene. EMBO J 13:1145–1156, 1994

19. Offield MF, Jetton TL, Labosky PA, Ray M, Stein RW, Magnuson MA, HoganBL, Wright CV: PDX-1 is required for pancreatic outgrowth and differen-tiation of the rostral duodenum. Development 122:983–995, 1996

20. Lacy PE, Kostianovsky M: Method for the isolation of intact islets ofLangerhans from the rat pancreas. Diabetes 16:35–39, 1967

21. McManus MF, Chen LC, Vallejo M: Astroglial differentiation of corticalprecursor cells triggered by activation of the cAMP-dependent signalingpathway. J Neurosci 19:9004–9015, 1999

22. Daniel PB, Habener JF: Cyclical alternative exon splicing of transcriptionfactor cyclic adenosine monophosphate response element-binding protein(CREB) messenger ribonucleic acid during rat spermatogenesis. Endocri-

nology 139:3721–3729, 199823. Colter DC, Class R, DiGirolamo CM, Prockop DJ: Rapid expansion of

recycling stem cells in cultures of plastic-adherent cells from human bonemarrow. Proc Natl Acad Sci U S A 97:3213–3218, 2000

24. Cirulli V, Baetens D, Rutishauser U, Halban PA, Orci L, Rouiller DG:Expression of neural cell adhesion molecule (N-CAM) in rat islets and itsrole in islet cell type segregation. J Cell Sci 107:1429–1436, 1994

25. Bouwens L: Cytokeratins and cell differentiation in the pancreas. J Pathol

184:234–239, 199826. Bouwens L, Braet F, Heimberg H: Identification of rat pancreatic duct cells

by their expression of cytokeratins 7, 19, and 20 in vivo and after isolationand culture. J Histochem Cytochem 43:245–253, 1995

27. Bouwens L, Wang RN, De Blay E, Pipeleers DG, Kloppel G: Cytokeratins asmarkers of ductal cell differentiation and islet neogenesis in the neonatalrat pancreas. Diabetes 43:1279–1283, 1994

28. Swenne I: Pancreatic beta-cell growth and diabetes mellitus. Diabetologia

35:193–201, 199229. Bonner-Weir S, Deery D, Leahy JL, Weir GC: Compensatory growth of

pancreatic beta-cells in adult rats after short-term glucose infusion.Diabetes 38:49–53, 1989

30. Mashima H, Shibata H, Mine T, Kojima I: Formation of insulin-producingcells from pancreatic acinar AR42J cells by hepatocyte growth factor.Endocrinology 137:3969–3976, 1996

31. Mashima H, Ohnishi H, Wakabayashi K, Mine T, Miyagawa J, Hanafusa T,Seno M, Yamada H, Kojima I: Betacellulin and activin A coordinatelyconvert amylase-secreting pancreatic AR42J cells into insulin-secretingcells. J Clin Invest 97:1647–1654, 1996

32. Zhou J, Wang X, Pineyro MA, Egan JM: Glucagon-like peptide 1 andexendin-4 convert pancreatic AR42J cells into glucagon- and insulin-producing cells. Diabetes 48:2358–2366, 1999

33. Stoffers DA, Thomas MK, Habener JF: Homeodomain protein IDX-1: amaster regulator of pancreas development and insulin gene expression.Trends Endocrinol Metab 8:145–151, 1997

34. Ramiya VK, Maraist M, Arfors KE, Schatz DA, Peck AB, Cornelius JG:Reversal of insulin-dependent diabetes using islets generated in vitro frompancreatic stem cells. Nat Med 6:278–282, 2000

35. Wang Z, Gleichmann H: GLUT2 in pancreatic islets: crucial target moleculein diabetes induced with multiple low doses of streptozotocin in mice.Diabetes 47:50–56, 1998

36. Menke A, Yamaguchi H, Giehl K, Adler G: Hepatocyte growth factor andfibroblast growth factor 2 are overexpressed after cerulein-induced acutepancreatitis. Pancreas 18:28–33, 1999

37. Reddy JK, Rao MS, Yeldandi AV, Tan XD, Dwivedi RS: Pancreatichepatocytes: an in vivo model for cell lineage in pancreas of adult rat. Dig

Dis Sci 36:502–509, 199138. Bisgaard HC, Thorgeirsson SS: Evidence for a common cell of origin for

primitive epithelial cells isolated from rat liver and pancreas. J Cell Physiol

147:333–343, 199139. Rao MS, Yukawa M, Omori M, Thorgeirsson SS, Reddy JK: Expression of

transcription factors and stem cell factor precedes hepatocyte differenti-ation in rat pancreas. Gene Expr 6:15–22, 1996

40. Reimold AM, Etkin A, Clauss I, Perkins A, Friend DS, Zhang J, Horton HF,Scott A, Orkin SH, Byrne MC, Grusby MJ, Glimcher LH: An essential rolein liver development for transcription factor XBP-1. Genes Dev 14:152–157,2000

41. Dabeva MD, Petkov PM, Sandhu J, Oren R, Laconi E, Hurston E, ShafritzDA: Proliferation and differentiation of fetal liver epithelial progenitor cellsafter transplantation into adult rat liver. Am J Pathol 156:2017–2031, 2000

42. Stamatoglou SC, Enrich C, Manson MM, Hughes RC: Temporal changes in



Dow


ecember 2021

the expression and distribution of adhesion molecules during liver devel-opment and regeneration. J Cell Biol 116:1507–1515, 1992

43. Ikeda H, Nagoshi S, Ohno A, Yanase M, Maekawa H, Fujiwara K: Activatedrat stellate cells express c-met and respond to hepatocyte growth factor toenhance transforming growth factor beta1 expression and DNA synthesis.Biochem Biophys Res Commun 250:769–775, 1998

44. Skrtic S, Wallenius V, Ekberg S, Brenzel A, Gressner AM, Jansson JO:Hepatocyte-stimulated expression of hepatocyte growth factor (HGF) incultured rat hepatic stellate cells. J Hepatol 30:115–124, 1999

45. Pour P: Islet cells as a component of pancreatic ductal neoplasms. I.Experimental study: ductular cells, including islet cell precursors, asprimary progenitor cells of tumors. Am J Pathol 90:295–316, 1978

46. Cornelius JG, Tchernev V, Kao KJ, Peck AB: In vitro-generation of islets inlong-term cultures of pluripotent stem cells from adult mouse pancreas.Horm Metab Res 29:271–277, 1997

47. Bonner-Weir S, Taneja M, Weir GC, Tatarkiewicz K, Song KH, Sharma A,O’Neil JJ: In vitro cultivation of human islets from expanded ductal tissue.Proc Natl Acad Sci U S A 97:7999–8004, 2000

48. Weissman IL: Stem cells: units of development, units of regeneration, andunits in evolution. Cell 100:157–168, 2000

49. Slack JMW, Shen C-N, Tosh D: Molecular mechanism of pancreas to livermetaplasia (Abstract). In Abstract Presented at the Stem Cells and

Pancreatic Development Meeting. Bethesda, MD, NIH, 2000, p. 35

50. Edlund H: Transcribing pancreas. Diabetes 47:1817–1823, 199851. Sharma A, Zangen DH, Reitz P, Taneja M, Lissauer ME, Miller CP, Weir GC,

Habener JF, Bonner-Weir S: The homeodomain protein IDX-1 increasesafter an early burst of proliferation during pancreatic regeneration. Dia-

betes 48:507–513, 199952. Serup P, Jensen J, Andersen FG, Jorgensen MC, Blume N, Holst JJ, Madsen

OD: Induction of insulin and islet amyloid polypeptide production inpancreatic islet glucagonoma cells by insulin promoter factor 1. Proc Natl

Acad Sci U S A 93:9015–9020, 199653. Watada H, Kajimoto Y, Miyagawa J, Hanafusa T, Hamaguchi K, Matsuoka

T, Yamamoto K, Matsuzawa Y, Kawamori R, Yamasaki Y: PDX-1 inducesinsulin and glucokinase gene expressions in alpha TC1 clone 6 cells in thepresence of betacellulin. Diabetes 45:1826–1831, 1996

54. Ferber S, Halkin A, Cohen H, Ber I, Einav Y, Goldberg I, Barshack I,Seijffers R, Kopolovic J, Kaiser N, Karasik A: Pancreatic and duodenalhomeobox gene 1 induces expression of insulin genes in liver andameliorates streptozotocin-induced hyperglycemia. Nature Med 6:568–572, 2000

55. Shapiro AM, Lakey JR, Ryan EA, Korbutt GS, Toth E, Warnock GL,Kneteman NM, Rajotte RV: Islet transplantation in seven patients with type1 diabetes mellitus using a glucocorticoid-free immunosuppressive regi-men. N Engl J Med 343:230–230, 2000



Dow


ecember 2021

Documents

Multipotential Nestin-Positive Stem Cells Isolated From