JOURNAL OF BIOSCIENCE AND BIOENGINEERING Vol. 93, NO. 4, 388-394. 2002

Molecular Characterization and Regulatory Analysis of dnaK Operon of Halophilic Lactic Acid

Bacterium Tetragenococcus halophila DA1SUKE FUKUDA, 1 MAKI WATANABE, 1 SH1NO SONEZAKI, 1 SHINYA SUGIMOTO, ~

KENJI SONOMOTO, l* AND AYAAKI ISHIZAKI l

Laboratory of Microbial Technology, Division of Microbial Science and Technology, Department of Bioscience and Biotechnology, Faculty of Agriculture, Graduate School, Kyushu University,

6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581, Japan I

Received 6 November 2001/Accepted 16 January 2002

We have cloned and characterized the dnaK operon of Tetragenococcus halophila JCM5888. Nucleotide sequence analysis of cloned fragments showed that the dnaK operon consists of four open reading frames with the organization hrcA-grpE-dnaK-dnaJ. Two regulatory CIRCE (Con- trolling Inverted Repeat of Chaperone Expression) elements were identified in the region up- stream of hrcA. The T. halophila dnaK encoded a protein of 618 amino acids with a calculated mo- lecular mass of 67 kDa. The dednced amino acid sequence of T. halophila DnaK showed high sim- ilarities with those of the corresponding DnaK homologues of Lactococcus lactis, Lactobacillus sakei and Bacillus subtilis. Using a pET expression system, the T. halophila DnaK was overex- pressed in Escherichia coli and the purified DnaK was found to exhibit ATPase and refolding ac- tivities. Northern hybridization analysis revealed that the transcription of the dnaK gene was in- duced by heat shock, and several transcripts were detected including a tetra-cistronic mRNA with a maximum size of 4.9-kb which corresponds to the transcript of the complete dnaK operon. The amount ofdnaKtranscripts increased about 3.5-fold at high NaCI concentration of 3-4 M, but not at the same KCI concentrations. These resuits suggest that the cloned DnaK acts as a functional molecular chaperone and plays an important role in salinity adaptation.

[Key words: heat shock protein, dnaK operon, molecular chaperone, CIRCE, halophile, Tetragenococcus, refolding]

Heat shock proteins (HSPs) are temporarily overex- pressed when cells are exposed to high temperature, high salinity and other various environmental stresses (1). HSPs, including members of the Hsp60 (GroES/EL) and Hsp70 (DnaK/DnaJ/GrpE) families, are known to be highly con- served. DnaK, the Hsp70 molecular chaperone system in Escherichia coli, has been intensively characterized with regard to its many functions such as preventing protein ag- gregation and acting as a protein stabilization factor for adaptation to stress conditions (2). Two other HSPs, DnaJ and GrpE, have been found to stimulate the chaperone ac- tivity of DnaK. In the presence of both DnaJ and GrpE, the ATPase activity of DnaK increases up to 50 times (3).

In Gram-negative bacterium E. coli, the expression of most heat shock genes is mediated by the rpoH-encoded alternative sigma factor cy n (4). In contrast, Gram-positive bacterium Bacillus subtilis contains three different classes ofheat shock genes (5). Class I heat shock genes, including DnaK/DnaJ/GrpE and GroES/GroEL systems, are regulated by the HrcA protein and the CIRCE (Controlling Inverted Repeat of Chaperone Expression) element (6). Class II heat

* Corresponding author, e-mail: sonomoto@agr.kyushu-u.ac.jp phone/fax: +81 -(0)92-642-3019

shock genes possess cyB-dependent promoters and are expressed under various environmental stress conditions. Little is known about the regulatory mechanism of class III heat shock genes.

The relationship between DnaK functions and injury effects of high temperature has been studied in detail (7). Recently, it has been reported that the dnaK mutant strain ofE. coli failed to deplasmolyze and adapt to high salinity; moreover, the mutant strain could not maintain appropri- ate intracellular K + concentration (8, 9). Therefore, DnaK seemed to be a factor indispensable to the adaptation of E. coli to high osmolarity. However, little information is avail- able about the function of the DnaK homologue in the adap- tation of halophilic eubacteria to high-salinity condition.

Tetragenococcus halophila (formerly known as Pedio- coccus halophilus) is a moderately halophilic Gram-posi- tive lactic acid bacterium (LAß) used for brewing of Japa- nese soy sauce (10). Based on 16S rDNA sequence studies, this bacterium shows a close phylogenetic relationship to enterococci and lactobacilli. Unlike these genera of LAß, T. halophila can tolerate high salt concentrations (up to 4 M NaC1) and grows optimally in media containing 0.5 to 3.0 M NaC1. When cultivated in a high-salt-concentration me- dium, T. halophila is known to intracellularly accumulate

388

VOL. 93, 2002 CHARACTERIZATION OF dnaK OPERON OF Z HALOPHILA 389

not only Na + but also large amounts of K + and several or- ganic substances as compatible solutes (11). We have much interest in the functions and the expression of T. halophila DnaK under the conditions of high intracellular osmotic pressure and increased hydrophobic interactions in the pro- tein structure. In this paper, we describe the cloning, expres- sion and transcriptional analysis of dnaK of T. halophila. Data on the characteristics of T. halophila DnaK contribute to bettet understanding of its mechanism of adaptation to high salinity.

M A T E R I A L S A N D M E T H O D S

Bacterial strains and growth conditions T. halophila JCM5888 (ATCC33315 T) used in this study was grown at 30°C in MRS medium (Oxoid, Hampshire, UK) containing 1 M NaCl. The medium was adjusted to pH 7.5 before sterilization. E. coli JM109 (Toyobo, Osaka) and BL21 (DE3) were grown at 37°C with shaking in Luria-Bertani (LB) broth. When the growth was appropriate for clonal selection, X-gal (5-bromo-4-isopropyl-[3-D- 4-chloro-3-indol-J3-D-galactopyranoside), IPTG (isopropyl 1-thio- B-D-galactoside) and ampicillin were added to the culture at con- centrations of 50, 40, 20 mg/l, respectively.

DNA isolation and manipulation T. halophila chromosomal DNA was isolated by a combination of the two methods, as de- scribed previously (12, 13). pUC18, the plasmid DNA used for cloning of T. halophila dnaK operon, was purified from E. coli with a Mag extractor plasmid extraction kit (Toyobo). Restriction endonuclease digestion, analyses and ligation were performed ac- cording to the methods of Sambrook et al. (14). E. coli competent cells for electroporation were prepared according to the protocol recommended for the Gene Pulser apparatus (Bio-Rad, Hercules, CA, USA). Southern hybridization with nucleotide probes was performed using the AlkPhos labeling system (Amersham Pharma- cia Biotech, Uppsala, Sweden) according to the manufacturer's protocol.

Cloning of T. halophila dnaK operon Two degenerated oligo- nucleotides (dnaK-TS l and dnaK-TA 1) used as PCR primers were designed from the DnaK-conserved region of other Gram-positive bacteria (Table 1). PCR was performed a 100-/al reaction mixture containing l gg of genomic DNA, 50 mM KC1, l0 mM Tris-HCl (pH9.0), 0.1% Triton X-100, 1.5mM MgCl 2, 0.2mM of each dNTP, 100 pmol of each primer and 5 U of Taq polymerase. Am- plification was carried out for 28 cycles (denaturation at 95°C for 1 min, annealing at 48°C for 20 s, and polymerization at 72°C for 1 min). The amplified fragment with an expected size of 0.9 kb was labeled with an AlkPhos Direct system (Amersham Pharmacia Biotech) and used as a probe to screen the 77 halophila genomic library. The 3.5-kb (pTX-H3) and 2.0-kb (pTXE-AI) fragments, which generated a strong hybridization signal with the probe, were sequenced with an ALF express automated DNA sequencer (Amersham PhalTnacia Biotech) and the sequences obtained were

analyzed with the DNASIS program (Hitachi Software Engineer- ing, Tokyo) and GENETYX-W1N (Software Development, Tokyo). The free energy of the stem-loop structure was also calculated with GENETYX-W1N (Software Development).

The region immediately upstream of the partial hrcA gene which was cloned into pTXE-A1 was characterized by inverse PCR reactions (15). T. halophila chromosomal DNA was digested completely with HindIII and religated for use as the template. Inverse PCR reaction, using the divergent primers hrcA-IA1 and hrcA-IS1 (Table 1), was performed with KOD DNA polymerase (Toyobo), which increased polymerization fidelity. The generated fragment was cloned into pUC 18 and named pTIH-B 1.

Comparison of deduced amino aeid sequenee and phylo- genetic analysis of T. halophila DnaK Multiple aligrmaents of the DnaK arnino acid sequences were performed by the ClustalW program (16) and were adjusted manually. The phylogenetic tree based on the NJ (Neighbor-joining) method was constructed by Treeview (ver. 1.6) (17). Accession numbers of other sequences used in the analysis are as follows: Bacillus stearothermophilus dnaK, X90709 (18); B. subtilis dnaK, X85182 (19); Clostridium acetobutylicum dnaK, M74561 (20); E. coli dnaK, K10420 (21); Lactobacillus sakei dnaK, AJ006274 (22); Lactococcus lactis dnaK, X76642 (23); Nitrosomonas europae dnaK, AB018706 (24); Listeria monocytogenes dnaK, AB023064 (25); Pseudomo- nas syringae dnaK, AF135163 (26); Rhodobacter capsulatus dnaK, U57637 (27); Staphylococcus aureus hsp70, D30690 (28); Streptococcus mutans dnaK, U78296 (29); Therrnus thermophilus dnaK, L57504 (30); ~brio chorelae dnaK, VCY14237 (31).

Nucleotide sequence accession number The nucleotide se- quence of the dnaK operon from 77 halophila JCM5888 which was determined in this study has been registered in the EMBL, Gen- Bank, DDBJ databases under accession number AB070346.

Construction of the fusion plasmid and expression of T. halophila dnaK in E. coli A 1.9-kb fragment encoding the T. halophila DnaK protein was amplified by PCR with two oligo- nucleotide primers, 5'- GGG GrA GAG ATG ACT TTA AGA AAG C-3' and 5-CAA CTT CAA TTG CTA CAG CAC GTT C-3', followed by digestion with XhoI and NdeI. The resultant fragment was ligated into the Xho[-NdeI site of pET-14b (Takara Shuzo, Tokyo). The resulting plasmid, named pTDnaK-His, was trans- formed into E. coli BL21 (DE3). The expression of the DnaK-poly His fusion was induced by the addition of IPTG to a final concen- tration of 0.3 mM. The 77 halophila DnaK-poly His fusion protein was purified using the Mag Extracter-His tag kit (Toyobo). Protein samples were separated by SDS-PAGE using 10% (w/v) SDS- polyacrylamide gels and then stained with Coomassie brilliant blue.

Measurement of ATPase activity ATPase activity was as- sayed in a reaction mixture (100 ~tl) containing 25 mM Tris-HCl (pH 7.5), 5 mM MgC12, 150 mM KC1, 1 mM ATP and 0.6 p.g of purified DnaK protein. After a 1-h incubation at 37°C, the reaction was terminated by adding 25 ~tl of 20% perchloric acid. The re- action mixtures were centrifuged at 15,000 rpm for 5 min at 4°C, and the amount of released inorganic phosphate was measured

TABLE 1. Oligonucleotide primers used in this study

Name Sequence Note

dnaK-TS1

dnaK-TA 1

hrcA-IS 1

hrcA-IA1

5 '-ATCAC(A/T)GT(A/T)CCTGC TTA CTT-3'

5 '-ATATC(C/T)AATTGGAAACGACC-3'

5 '-CGGCGCTATCGATTGGACCTGATGTAAG-3'

5'-CGATAACCCTTTAGC GAAGGGATACGACC-3'

The degenerative oligonucleotide primer corresponding to 339 to 358 of the L. lactis dnaK gene.

The degenerative oligonucleotide primer corresponding to 1262 to 1281 of the L. lactis dnaKgene.

The oligonucleotide primer corresponding to 362 to 389 of the T. halophila hrcA gene.

The oligonucleotide primer corresponding to 187 to 215 of the T. halophila hrcA gene.

390 FUKUDA ET AL. J. BlOSCI. BIOENG.,

using KHzPO 4 as a standard (32). Data are expressed as means_+ S.E.M. (n=5).

Measurement of the refolding activity of denatured lactate dehydrogenase Lactate dehydrogenase (LDH) was denatured with 8 M urea in 5 mM 2-mercaptoethanol and 50 mM triethanol- amine hydrochloride (TAE-HCI, pH 7.0) for 30 min. Refolding re- action was performed using 20 nM of denatured LDH in 1 ml of reacfion buffer containing 200nM DnaK, 0.1 mM ATP, 10 mM pyruvate, 5 mM 2-mercaptoethanol and 50mM TAE-HCI (pH 7.0). After incubation at 30°C for 24 h, NADH was added (0.2 mM), and the decrease in absorbance at 340 nm due to the oxida- tion of NADH was measured (33). The activity of native LDH was also measured as a control experiment (100% activity).

Northern blot hybridization Total RNA was isolated from T. halophila cells using an RNeasy Total RNA kit (Qiagen, Chats- worth, CA, USA). RNA sarnples (5 gg) were denatured with form- aldehyde and electrophoresed on a 1.5% agarose gel in 20 mM MOPS (morpholine propane sulfonic acid) buffer (pH 8.0) and 2.2 M formaldehyde. After electrophoresis, capillary transfer to a nylon membrane (Hybond-N +, Amersham Pharmacia Biotech) was carried out in 20×SSC (I ×SSC: 0.15 M NaC1, 15 mM trisodium citrate, pH 7.0). The PCR-generated probe, used in the cloning of the T. halophila dnaK operon described above, was labeled with 32p-dCTE Northern blot hybridization was carried out at 42°C for 12 h. The detection of dnaK transcripts was performed by auto- radiograph densitometry with a BAS 2000 Bio-Imaging Analyzer system (Fuji Photo Film, Tokyo).

Slot-blot hybridization Slot-blot hybridization is less prone to pipetting errors compared to Northern blot hybridization, thus is more effective in terms ofexact quantification. Five micrograms of alkaline-denatured total RNA were transferred to Zeta Probe Not- fing membranes (Bio-Rad) with a Bio-Dot SF microfiltration appa- ratus (Bio-Rad) as specified by the manufacturer, and subjected to UV cross linking. Prehybridization and hybridization were carried out by the same methods as those used in Northern hybridization. The relative concentration of dnaK transcripts was also estimated by autoradiograph densitometry.

RESULTS

Cioning and nucleotide sequence analysis of the dnaK operon from T. halophila JCM5888 Two oligonucleo- tide primers for degenerative PCR, dnaK-TS1 and dnaK- TAl (Table 1), were designed based on results of the amino acid sequence alignment o f highly conserved regions o f DnaK proteins from Lactococcus lactis, B. subtilis and Clostridium acetobutylicum. The amplified fragment with the expected size of 900 bp was cloned into E. coli JM109

using pUC 18 and sequenced. The nucleotide sequence of the cloned PCR fragment showed high similarities to those of other bacterial dnaK homologues. This PCR fragment was labeled and used as a probe for Southern hybridiza- tion with the chromosomal DNA of T. halophila JCM5888. The 3.5-kb XbaI and 2.0-kb XbaI-EcoRV-digested frag- ments that hybridized with the probe were purified from the agarose gel and cloned into pUC 18, resulting in plas- mids pTX-H3 and pTXE-A1. The nucleotide sequences ob- tained revealed that these clones cover several open read- ing frames (ORFs). Cloning of the gene at a region further upstream of hrcA was achieved by an inverse PCR tech- nique as described in Materials and Methods. A 4.0-kb am- plified fragment was generated from the HindIIi-digested T halophila chromosomal DNA. This fragment was cloned in E. coli JM109 using pUC18 and named pTIH-B 1. The com- plete nucleotide sequence o f the fragments revealed the presence o f six ORFs. Four ORFs showed high degrees of similarity to L. lactis HrcA, GrpE, DnaK and DnaJ. ORF 1, upstream of hrcA, was found; it showed considerable simi- larity to the B. subtilis oxygen-independent coproporphyri- nogen III oxidase HemN (50% identity) (34). ORFó, down- stream of DnaJ, showed high similarity with the C-terminal end of the B. subtilus ABC (ATP-binding cassette) trans- porter (48% identity) (accession no. AF084104). The ge- netic organization o f the dnaK operon of T. halophila is shown in Fig. 1.

Upstream of hrcA, two inverted repeats were identified which correspond to the consensus sequence o f the CIRCE element (35). A putative promoter region similar to the con- sensus Gram-positive vegetative promoter region was found between two CIRCE elements (with a -35 sequence, 5'- TTAACA-3', and -10 sequence, 5'-TATATT-3') (Fig. 2). A stem-loop structure with a free energy o f - 2 0 . 2 kcal-mol 1 was found immediately downstream of dnaK indicating a rho-independent transcriptional terminator (Tl). A rho-in- dependent terminator was also found downstream of dnaJ (T2) which had a free energy o f - 2 1 . 0 kcal-mok j.

Analysis of the dedueed amino aeid sequenee of T. halophila DnaK The dnaK gene encoded a 618-amino- acid protein with a predicted molecular mass of 66,783 Da. The similarities in amino acid sequences between T. halo- phila DnaK and the other bacterial DnaKs were 79% (L. lactis), 76% (L. sakei), 76% (B. subtilis), and 53% (E. coli). The degree of similarity was consistently higher at the N-

P1 P2 T1 T2

[ o r f l ~ h r « A ~ß--~-grpE~.~ dnaK ~.~ dnaJ ] ~ ~ ß - - ]

I

I. [ ~~ pvx-ù3 (3.» kb~ " " ~ pTXE-A1 (2.0 kb)

y

pTIH-B1 (4.0 kb)

FIG. 1. Genetics and organization of the T. halophila dnaK operon. P indicates the putative promoter region, and the potential stem-loop struc- ture is indicated by T. The open reading frames, orfl located upstream of hrcA and orf6 located immediately downstream of dna J, are transcribed in an opposite direction to the dnaK operon.

VOL. 93, 2002 CHARACTERIZATION OF dnaK OPERON OF T. HALOPH1LA 391

1351 TGCTCCTTTAGCAAAGC•TGTTTTGTCATTAGTTTACCATAGTTATTTATAAACTTAGACGAATTTCTAGCT•TTTCTCCAG•ATTAG•• 1440 » » » »

1441 CTCTAACATAAAGAGTG•TAATTTTTTG•G•ATTTCCTCTTAA•ATT•TTGTGATTTG•GGTATATTAATAATCGTGTTAG•A•TTAGAT 1530

» » CIRCE « < < < « « « < - 3 5 - 1 0 » » » » CIR

1531 ATAAGG~GTGCTAAT~G~TAAATTTGTTG~CGCAA~G~CA~GATAATATTTTGCATC~AATTATTC~TAATTATACA~ATTTA 1620 GE « « « « S.D. M L T Q R Q D N I L H Q I I H N Y T N L

hrcA

FIG. 2. Promoter region of the Z halophila hrcA gene. The CIRCE elements are indicated by arrowheads and typical Shine-Dalgarno sequence (S.D.) is boxed. The putative promoter sequenees, -35 and -10, are underlined. The alternative start codon (TTG) for hrcA is indieated in boldface.

terminus and declined substantially toward the C-terminus. This particular feature was shown by all the members of Hsp70. DnaJ also exhibited high similarity with DnaJ of L. lactis (67%), and the highly conserved region at the N-ter- minus.

The phylogenetic tree of 14 bacterial DnaK homologues clearly showed that two distinct clusters, the clusters of Gram-negative and Gram-positive bacteria, existed (Fig. 3). The DnaK homologues of LAß including T. halophila were characterized as an independent subcluster in the Gram-pos- itive bacterium cluster. Different from the result of homol- ogy search described above, T. halophila DnaK showed a closer relationship with L. sakei DnaK than with L. lactis DnaK.

Purification of the recombinant T. halophila DnaK To confirm whether the cloned T. halophila dnaK gene encodes a functional DnaK/Hsp70 homologue protein, the T. halophila dnaK gene expression plasmid pTDnaK-His was constructed (as described in Materials and Methods). After induction by the addition of IPTG, SDS-PAGE re- vealed that a 75-kDa polypeptide was highly expressed in E. coli (Fig. 4, lane 4). The purified recombinant T. halo- phila DnaK protein exhibited an ATPase activity (12.5 nmol

Pi. m i n 1. mg -~) and a refolding activity (29.7%) of the urea- denatured LDH. This indicates that the cloned dnaK gene from T. halophila chromosomal DNA encodes the protein which could act as a functional molecular chaperone. After cleavage of the 75-kDa protein with thrombin, a 65-kDa protein was generated (Fig. 4, lane 5), which was similar to T. halophila DnaK in terms of its predicted molecular mass.

Transcript ional analysis o f T. halophila dnaK by heat shock To clarify the expression of the cloned T. halophila dnaK and to confirm the function of DnaK as a heat shock protein, we performed Northem blot hybridization and ana- lyzed the effect of heat shock on the expression of T. halo- phila dnaK. Total RNA was purified from T. halophila cells and subjected to Northern blot hybridization using specific probes for dnaK. The autoradiograph using the dnaK probe revealed several bands of large transcripts of 4.9, 3.8, 2.6 and 1.8 kb sizes (Fig. 5), which may correspond to hrcA- grpE-dnaK-dnaJ, hrcA-grpE-dnaK, grpE-dnaK and dnaK, respectively (see Fig. 1). To determine the level of induction of dnaK by heat shock more precisely, quantitative slot-blot hybridization was also performed. When cells were trans- ferred from 30°C to 45°C, the dnaK mRNA level increased about 10-fold after 30min (Fig. 6A). These data suggest

LAß cluster

Streptococcus mutans I ~ Listeria monocytogenes

Lactococcus lactis [ [ I Bacillus subtilis Lactobacillussakei ~ i i l ~ ß a c i l l u s s t e a r ° t h e r m ° p h i l u s

~ - - Staphylococcus aureus

~e~ra~~~ococcu~~lo, h i ~ . ~ i : . i ~ ~,~8 ~1~~ Clostridium acetobutylicum

Escherichia coli_

Vibrio chore 997

~.~ I \ . . . . "~hermus,hermo,~~l~~

Pseudomonas syringae I Nttrosomonas europae Rhodobacter capsulatus

0.1

FIG. 3. Phylogenetic analysis o f Z halophila DnaK and other bacterial DnaK (Hsp70) homologues. A phylogenetic tree was constructed based on the NJ method as described in Materials and Methods.

392 FUKUDA ET AL.

1 2 3 4 5 1 2 3

J. BIOSCI. BIOENG.,

FIG. 4. SDS-PAGE of His-tagged T halophila DnaK. Lane 1, Moleeular weight markers (kDa); lane 2, before induetion of the His- tagged DnaK; lane 3, after overexpression of His-tagged DnaK; lane 4, His-tagged DnaK purified using a nickel affinity column; lane 5, DnaK after treatment of His-tagged fusion protein with thrombin.

that cloned T halophila dnaK is definitely a component o f a system for heat shock response.

Transcriptional induction of T. halophila dnaK by sal t s t ress In addition to heat shock, we analyzed the effect o f high salinity on the induction o f T. halophila dnaK by slot- blot hybridization. The cells grown in the presence of 1.0 M NaC1 for 24 h were transferred to the same fresh medium containing the indicated NaC1 concentrations, and further incubated for 2 h. Figure 6B indicates that the amount o f dnaK m R N A increased almost 3.5-fold with 3 M NaC1; thus, this salt concentration may be critical for cell growth. On the other hand, KC1 did not induce dnaK even at high concentrations (data not shown). These suggest that the salt induction o f T. halophila dnaK is regulated at the transcrip- tional level, and is specific to sodium ion but not to high osmolarit ies with salts.

DISCUSSION

In this paper, we describe the cloning and nucleotide se-

4.9 kb

-~ 3.8

2.6

1.8

23S r R N A

16S r R N A

FIG. 5. Northern blot analysis ofdnaK gene expression in T halo- phila. Total RNA was isolated from the cells grown at 30°C for 24 h in MRS medium containing 1 M NaCI (lane 1) and further incubated for 5 and 10 min after shifting to 45°C (lanes 2 and 3). Ethidium bromide staining of the gel shows that equal amounts of RNA were loaded.

quence analysis o f the dnaK operon o f the halophilic L A ß T. halophila JCM5888, as well as expression analysis of the dnaK. To our knowledge, this is the first report about the genetic characterization o f the dnaK operon from halophilie Gram-posi t ive and -negative bacteria. The dnaK operon of T. halophila consists o f at least four ORFs in the order of hrcA-grpE-dnaK-dnaJ. Since Northern blot hybridization analysis revealed that orfl and orf6 were not induced by heat shock at the transcription level (data not shown), orfl and orfó are not part o f the heat shock operon. This kind o f genetic organization was also found in several other low- G + C Gram-posi t ive bacteria. In the case of L. lactis, the dnaJ gene is not part o f the dnaK operon, although the pre- dicted amino acid sequence o f T. halophila DnaK showed

"~ I0

8

< 6 Z

E

"~ 2

(A)

0 5 10 30

Time (min)

(B)

5

4

3

2

o 1 2 3 4

NaCI concentration (M)

FIG. 6. Quantitative analysis of T. halophila dnaK gene expression induced by heat shock (A) and NaC1 stress (B). Transcript levels were quantified using the dnaK probe by slot-blot analysis. (A) Total RNA was isolated from the cells grown at 30°C for 24 h in MRS medium contain- ing 1 M NaC1 and further incubated for 5, 10 and 30 min after shifting to 45°C. The signal intensity before heat shoek was defined as 1.0. (B) The cells were grown at 30°C for 24 h in MRS medium eontaining 1 M NaCI. Total RNA was obtained from cells after their transfer to a fresh MRS medium containing the indicated concentrations of NaC1 and 2 h of incubation. The signal intensity for 1 M NaCI was defined as 1.0.

VOL: 93, 2002 CHARACTERIZATION OF dnaK OPERON OF T HALOPHILA 393

high similarity with that of L. lactis DnaK. A highly con- served inverted repeat sequence, termed the CIRCE ele- ment, was found at two sites, that is, 101-bp and 17-bp up- stream of the hrcA start codon. This element is extensively studied in B. subtilis (35) and S. aureus (36). It has recently been shown that the HrcA interacts with the CIRCE element and regulates the expression of the dnaK operon in these bacteria. It can be presumed that in T. halophila the CIRCE element and HrcA protein also represent an important sys- tem for regulating the expression of class I heat shock genes. Except for the groESL operon of Laetobacillus hel- veticus and L. johnsonii, most of the class I heat shock genes existing on the Genbank database possess a single set of CIRCE elements. Two CIRCE elements in the promoter region of the T. halophila dnaK operon might contribute to an elaborate transcriptional regulation for developing an ad- aptation system against environmental stress.

In recent years, DnaK homologues have been used for determining evolutional relationships because of their high degree of sequence conservation (37). Although the amino acid sequence of T. halophila DnaK showed higher simi- larity with that of L. lactis DnaK than with that of L. sakei, phylogenetic analysis based on the NJ method showed a closer relationship between T. halophila DnaK and L. sakei DnaK compared with that between T. halophila DnaK and L. laetis DnaK (Fig. 3). This result corresponded to that of a previous taxonomic analysis (10) based on 16S rDNA se- quences.

The cloned T. halophila dnaK gene was overexpressed in E. coli using the pET system and the resulting DnaK-poly His fusion protein was purified. The SDS-PAGE profile of this protein revealed that its molecular mass is 75 kDa, which was higher than the calculated mass of the T. halo- phila dnaK gene product. This discrepancy might be due to the specific protein structure and the molecular mass of the hexahistidine-tagged derivative. The purified recombinant T. halophila DnaK exhibited apparent ATPase and LDH- refolding activities. Thus, the purified protein corresponds to the functional molecular chaperone DnaK.

Northern blot hybridization revealed a polycistronic tran- scription product with a maximum length of 4.9 kb. This confirms that the dnaK operon of T. halophila is tetracis- tronic, and the 4.9-kb transcript may encompass the com- plete dnaK operon. A greater amount of the 2.6-kb bicis- tronic transcript (grpE-dnaK) was detected than that of the 4.9-kb transcript (Fig. 5). This suggests that a certain level of transcription controlled by the P2 promoter might occur (Fig. 1). In B. subtilis, specific cleavage between grpE and dnaK was reported previously (36, 38). The 1.8-kb tran- script, which may encompass the dnaK gene, may have arisen for the same reason.

Slot-blot analysis of total RNA from T halophila con- firmed the heat shock induction of the T. halophila dnaK. In addition to the heat shock induction, transcription of T. halophila dnaK was induced by 3 M NaCI. The increased expression level of dnaK under high NaC1 concentration in- dicates that DnaK plays an important role in adaptation to high-salinity condition in the environment. Recently, sev- eral attempts to elucidate the role of DnaK upon osmotic adaptation have been performed with E. coli. Most micro-

organisms take up or synthesize compatible solutes such as potassium ions, glycine-betaine and choline in response to osmotic adaptation (39). T. halophila was also reported to take up and accumulate glycine-betaine under high-salinity eondition, and accumulated compatible solutes that regulate the intracellular Na + concentration (11). Thus, compatible solutes and DnaK may play complementary roles in the maintenance of cell structures by stabilizing proteins and preventing their denaturation. Interestingly, similar induc- tion behavior of T. halophila DnaK was not observed at high KC1 concentration. In the adaptation to hyperosmotic condition, accumulation of intracellular K + is a primary event for many bacteria (40). Since T. halophila is also known to accumulate large amount of K + intracellularly as a compatible solute in the high-NaCl-concentration media (11), excess potassium ions from the environment may be aliowed.

DnaK1 from the halotolerant cyanobacterium Aphano- theee halophytica showed a chaperone activity at 1.0 M NaC1 (40). T. halophila can grow under higher external sa- linity condition than A. halophytica (41, 42), thus the func- tional chaperone activity of T. halophila DnaK is of great interest. We are now investigating the ATPase and refolding activities of the DnaK protein of T. halophila under high-sa- linity condition. A halotolerant molecular chaperone, which exhibits a strong folding activity of denatured protein under high-salinity condition might be useful for molecular bio- logical applications.

ACKNOWLEDGMENT

This work was partly supported by the Sasakawa Scientific Re- search Grant from The Japan Science Society.

REFERENCES

1. Lindquist, S. and Craig, E.A.: The heat-shock proteins. Annu. Rev. Genet., 22, 631-677 (1988).

2. Gross, C. A., Strauss, D. B., Erickson, J. W., and Yura, T.: The function and regulation of heat shock proteins in Esch- erichia coli, p. 167-189. In Morimoto, R.I., Tissieres, A., Georgopoulos, C. (ed.), Stress proteins in biology and medi- eine. Cold Spring Harbor Laboratory Press, Cold Spring Har- bor, NY (1990).

3. Liberek, K., Marszalek, J., Ang, D., Georgopoulos, C., and Zylicz, M.: Escherichia coli DnaJ and GrpE heat shock proteins interact both in vivo and in vitro. J. Bacteriol., 171, 1590-1596 (1991).

4. Yura, T., Nagai, H., and Mori, H.: Regulation of the heat- shock response in bacteria. Annu. Rev. Microbiol., 47, 321- 350 (1993).

5. Hecker, M., Schumann, W., and Völker, U.: Heat-shock and general stress response in Bacil[us subtilis. Mol. Micro- biol., 19, 417-428 (1996).

6. Schulz, A. and Schumann, W.: hrcA, the first gene of the Bacillus subtilis dnaK operon encodes a negative regulator of class I heat shock genes. J. Bacteriol., 178, 1088-1093 (1996).

7. Hartl, F.U.: Molecular chaperones in cellular protein fold- ing. Nature, 381,571-586 (1996).

8. Meury, J. and Kohiyama, M.: Role of heat shock protein DnaK in osmotic adaptation of Escherichia coli. J. Bacteriol., 173, 4404-4410 (1991).

9. Yaagoubi, A.E., Kohiyama, M., and Richarme, G.: Lo-

394 FUKUDA ET AL. J. Biosci. BIOENG.,

calization of DnaK (chaperone 70) from Escherichia coli in an osmotic-shock-sensitive compartment of the cytoplasm. J. Bacteriol., 176, 7074-7078 (1994).

10. CoHins, M.D., Williams, A.M., and Wallbanks, S.: The phylogeny of Aerococcus and Pediococcus as determined by 16S rRNA sequence analysis; description of Tetragenooccus gen. nov. FEMS Microbiol. Lett., 70, 255-262 (1990).

11. Robert, H., Marrec, C.L., Branco, C., and Jebbar, M.: Glycine betaine, carnitine, and choline enhance salinity toler- ance and prevent the accumulation of sodium to a level in- hibiting growth of Tetragnococcus halophila. Appl. Environ. Microbiol., 66, 509-517 (2000).

12. Marmur, J.: A procedure for the isolation of deoxyribo- nucleic acid from microorganisms. J. Mol. Biol., 3, 208-218 (1961).

13. Berns, K.I . and Thomas, C.A., Jr.: Isolation of high mo- lecular weight DNA from Haemophilus influenzae. J. Mol. Biol., 11,476-490 (1965).

14. Sambrook, J., Fritsch, E.F., and Maniatis, T.: Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989).

15. Innis, M.A., Gelfand, D.H., Sninsky, J.J., and White, T.W.: PCR protocols. Academic Press Inc., San Diego, CA (1990).

16. Thompson, J.D., Higgins, D.G., and Gibson, T.J.: CLUSTALW: improving the sensitivity of progressive mul- tiple sequenee alignment through sequence weighting, posi- tions-specific gap penalties and weight matrix choice. Nucl. Acids Res., 22, 4673-4680 (1990).

17. Saitou, N. and Nei, M.: The neighbor-joining method, a new method for reconstructing phylogenetic trees. Mol. Biol. Evol., 4, 406-425 (1985).

18. Herbort, M., Schoen, U., Lang, J., and Schnmann, W.: Cloning and sequencing of the dnaK operon of Bacillus stearothermophilus. Gene, 170, 81-84 (1996).

19. Wetzstein, M., Voelker, U., Dedio, J., Loebau, S., Zuber, U., Schiesswohl, M., Herget, C., Hecker, M., and Schumann, W.: Cloning, sequencing, and molecular analysis of the dnaK locus from Bacillus subtilis. J. Bacteriol., 174, 3300-3310 (1992).

20. Narberhaus, F., Giebeler, K., and Bahl, H.: Molecular char- acterization of the dnaK gene region of Clostridium aceto- butylicum, including grpE, dna J, and a new heat shock gene. J. Bacteriol., 174, 3290-3299 (1992).

21. Cowing, D. W., Bardwell, J. C. A., Craig, E. A., Woolford, C., Hendrix, R. W., and Gross, C.A.: Consensus sequence for Escherichia coli heat shock gene promoters. Proc. Natl. Acad. Sci. USA, 82, 2679-2683 (1985).

22. Schmidt, G., Hertel, C., and Hammes, W.P.: Molecular characterisation of the dnaK operon of Lactobacillus sakei LTH681. Syst. Appl. Microbiol., 22, 321-328 (1999).

23. Eaton, T.J., Shearman, C. A., and Gasson, M. J.: Cloning and sequence analysis of the dnaK gene region of Lacto- coccus lactis subsp, lactis. J. Gen. Microbiol., 139, 3253- 3263 (1993).

24. Iizumi, T. and Nakamura, K.: Cloning, nucleotide sequence, and regulatory analysis of the Nitrosomonas europaea dnaK gene. Appl. Environ. Microbiol., 63, 1777-1784 (1997).

25. Hanawa, T., Kai, M., Kamiya, S., and Yamamoto, T.: Cloning, sequencing, and transcriptional analysis of the dnaK heat shock operon of Listeria monocytogenes. Cell Stress Chaperones, 5, 21-29 (2000).

26. Keith, L. M., Partridge, J. E., and Bender, C. L.: dnaK and the heat stress response of Pseudomonas syringae pv. gly-

cinea. Mol. Plant Microbe Interact., 12, 563-574 (1999). 27. Nickel, C. M., Vandekerckhove, J., Beyer, P., and Tadros,

M.H.: Molecular analysis of the Rhodobacter capsulatus chaperone dnaKJ operon: purification and characterization of DnaK. Gene, 192, 251-259 (1997).

28. Ohta, T., Saito, K., Kuroda, M., Honda, K., Hirata, H., and Hayashi, H.: Molecular cloning of two new heat shock genes related to the hsp70 genes in Staphylococcus aureus. J. Bacteriol., 176, 4779-4783 (1994).

29. Jayaraman, G. C., Penders, J. E., and Burne, R.A.: Tran- scriptional analysis of the Streptococcus mutans hrcA, grpE and dnaK genes and regulation of expression in rcsponse to heat shock and environmental acidification. Mol. Microbiol., 25, 329-341 (1997).

30. Motohashi, K., Watanabe, Y., Yohda, M., and Yoshida, M.: Heat-inactivated proteins are rescued by the DnaK/J- GrpE set and ClpB chaperones. Proc. Natl. Acad. Sci. USA, 96, 7184-7189 (1999).

31. Chakrabarti, S., Sengupta, N., and Chowdbury, R.: Role of DnaK in in vitro and in vivo expression ofvirulence factors of Vibrio cholerae. Infect. Immun., 67, 1025-1033 (1999).

32. Lill, R., Dowhan, W., and Wickner, W.: The ATPase ac- tivity of SecA is regulated by acidic phospholipids, SecY, and the leader and mature domains of precursor proteins. Cell, 60, 271-280 (1990).

33. Badcoe, I. G., Smith, C.J., Halsall, D.J., Holbrook, J.J., Lund, P., and Clark, A. R.: Binding of a chaperonin to the folding intermediates of lactate dehydrogenase. Biochemistry, 30, 9195-9200 (1991).

34. Homuth, G., Heinemann, M., Zuber, U., and Schumann, W.: The genes lepA and hemN form a bicistronic operon in Bacillus subtilis. Microbiology, 142, 1641-1649 (1996).

35. Zuber, U. and Schumann, W.: CIRCE, a novel heat shock element involved in regulation of heat shock operon dnaK of Bacillus subtilis. J. Bacteriol., 176, 1359-1363 (1994).

36. Ohta, T., Nettikadan, S., Tokumasu, F., Ideno, H., Abe, Y., Kuroda, M., Hayashi, H., and Takeyasu, K.: Atomic force microscopy proposes a novel model for stem-loop structure that binds a heat shock protein in the Staphylococcus aureus HSP70 operon. Biochem. Biophys. Res. Commun., 226, 730- 734 (1996).

37. Boorstein, W. R., Ziegelhoffer, T., and Craig, E. A.: Molec- ular evolution of the HSP70 multigene family. J. Mol. Evol., 38, 1-17 (1994).

38. Homuth, G., Mogk, A., and Schumann, W.: Post-transcrip- tional regulation of the Bacillus subtilis dnaK operon. Mol. Microbiol., 32, 1183-1197 (1999).

39. Kempf, B. and Bremer, E.: Uptake and synthesis ofcompat- ible solutes as microbial stress responses to high-osmolarity environments. Arch. Microbiol., 170, 380-386 (1998).

40. Palleros, D. R., Reid, K. L., Shi, L., Welch, W. J., and Fink, A.L.: ATP-induced protein-Hsp70 complex dissociation re- quires K + but not ATP hydrolysis. Nature, 365, 664466 (1993).

41. Hibino, T., Kakn, N., Yoshikawa, H., Takabe, T., and Takabe, To: Molecular characterization of DnaK from the halotolerant cyanobacterium Aphanothece halophytica for ATPase, protein folding, and copper binding under various salinity conditions. Plant Mol. Biol., 40, 409-418 (1999).

42. Röling, W. E and ran Verserveld, H.W.: Characterization of Tetragenococcus halophila populations in Indonesian soy mash (kecap) fermentation. Appl. Environ. Microbiol., 62, 1203-1207 (1996).