MODIFIED NUCLEOTIDES AND NUCLEIC ACIDS AS MOLECULAR …gc497qr2572/Samantak Ghosh Ph.D... · Wang (for the RNA polymerase studies) and Dr. F. Samain (for the polyfluorophore project)

MODIFIED NUCLEOTIDES AND NUCLEIC ACIDS AS

MOLECULAR PROBES

A DISSERTATION

SUBMITTED TO THE DEPARTMENT OF CHEMISTRY

AND THE COMMITTEE ON GRADUATE STUDIES

OF STANFORD UNIVERSITY

IN PARTIAL FULFILMENT OF THE REQUIREMENTS

FOR THE DEGREE OF DOCTOR OF PHILOSPHY

SAMANTAK GHOSH

FEBRUARY 2010

http://creativecommons.org/licenses/by-nc/3.0/us/

This dissertation is online at: http://purl.stanford.edu/gc497qr2572

© 2010 by Samantak Ghosh. All Rights Reserved.

Re-distributed by Stanford University under license with the author.

This work is licensed under a Creative Commons Attribution-Noncommercial 3.0 United States License.

ii



http://purl.stanford.edu/gc497qr2572

I certify that I have read this dissertation and that, in my opinion, it is fully adequatein scope and quality as a dissertation for the degree of Doctor of Philosophy.

Eric Kool, Primary Adviser


James Chen


Wray Huestis

Approved for the Stanford University Committee on Graduate Studies.

Patricia J. Gumport, Vice Provost Graduate Education

This signature page was generated electronically upon submission of this dissertation in electronic format. An original signed hard copy of the signature page is on file inUniversity Archives.

iii

ii

Abstract

This thesis discusses a number of projects involving the use of modified nucleotides

and oligonucleotides in addressing some basic science questions and some clinical and

technological applications.

The first chapter details our efforts at using telomere-encoding circular DNA in

elongating zebrafish telomeres. Our lab had previously successfully lengthened

telomeres in vitro using these artificial oligonucleotides and advancing to the in vivo

studies is the next logical step towards making this technology more clinically relevant.

We microinjected our synthetic circular DNA into zebrafish embryos and studied their

telomere length 24 hrs later. Using Quantitative Fluorescence in situ Hybridization (Q-

FISH) as the analytical tool to determine telomere length, we observed no significant

difference in telomere length between the group injected with the synthetic DNA and

the control group.

In the second chapter we study the potential of a non-polar shape mimic of iodo-uracil

as an imager of tumors. I123/125

-labeled iodo-uracil has been shown to colocalize with

tumors and decrease their growth. However its usage is limited by some of its

unfavorable bio-pharmacokinetics. Compared to iodo-uracil the non-polar shape mimic

was expected to have much better stability and bio-availability. Hence radiolabeled 1-

(2-deoxy-β-d-ribofuranosyl)-2,4-dichloro-5-iodobenzene was injected into nude mice

containing tumor. However it was observed that the molecule was mostly taken up in

the thyroid and showed no significant deposition in the tumor cells.

iii

We continued working with non-polar nucleotide isosteres in investigating a novel

active site in polymerase from Pyrococcus furiosus (Pfu) in the third chapter. This

polymerase which is also used in PCR applications has been found to be inhibited by

deaminated bases like uracil and hypoxanthine. In order to study the importance of

shape and hydrogen bonding in base discrimination by this polymerase pocket we

employed non-polar shape mimics of uracil (F) and hypoxanthine (Fbim). We also

attempted to study the conformation (syn/anti) in which the bases were identified in this

pocket and employed oxidized nucleobases including oxo-guanosine and oxo-inosine

for our studies. It was discovered that F, the shape mimic of uracil was recognized by

this pocket moderately while Fbim, the shape mimic of hypoxanthine was not

recognized significantly. Neither of the oxidized bases was recognized by this binding

pocket. From these observations we concluded that although shape was an important

factor in distinguishing bases, this binding site also employed hydrogen bonding to

identify nucleoabases. The lack of any recognition of the syn-oxidized bases suggested

that the enzyme recognized bases in the anti conformation rather than syn.

In the fourth chapter we were interested in understanding the factors determining the

fidelity and selectivity observed in RNA Polymerase II mediated transcription. Once

again we used non-polar shape mimics of thymidine (dF) and adenine (dQ) to study the

importance of shape and hydrogen bonding. We observed that the thymidine mimic was

recognized better by the RNA Polymerase II active site than the mis-match bases. The

adenine isostere on the other hand, was poorly recognized. This preliminary study

demonstrates the importance of both shape and hydrogen bonding.

iv

The last chapter discusses our studies using polyfluorophores on a DNA backbone to

detect gases. Following a combinatorial method, a library of oligodeoxyfluorosides

(ODFs) were synthesized from which sensors of gases were selected. Using this method

we were able to select optical sensors for a diverse set of small molecules in the vapor

state.

v

Acknowledgements

I would like to express my sincere gratitude to my adviser Prof. Eric T. Kool for his guidance

and support during my graduate school. Eric is a great scientist and an excellent mentor. He

encourages his students to flourish in their own way and in that sense has a very modern

perspective on mentoring graduate students.

I also take this opportunity to thank Prof. James Chen. He had kindly allowed us to use his

zebrafish facility and taught me various techniques which were integral part of my work on

telomeres.

I would also like to thank both James and Prof W. Huestis for guiding me during graduate school

by being my Reading Committee Members.

I am indebted to all my collaborators: the Kassis Lab (for the tumor imaging project), the

Connolly Lab (for the project investigating uracil binding in archaeal polymerase), Dr. Dong

Wang (for the RNA polymerase studies) and Dr. F. Samain (for the polyfluorophore project).

Without their contribution this Doctoral thesis would not have come to fruition.

My thanks to my former colleague and friend Dr. Lucian Orbai who taught me how to take the

QFISH measurements for the telomere project.

Dr Greg Miller (who has been a like a bullying but caring elder brother), Dr Younjin Cho (or as I

call her Younjin didi) and Rabea Grisat (my cute little German sister) are some of the very close

friends that my graduate school had bestowed upon me, for which I would be eternally thankful.

I would also like to thank Rafael, Nan, Florent and Pete for making the life in 109 such a fun

experience.

vi

My thanks to all the past and present Kool group members with whom I have worked. I have

learned more than Chemistry from them.

My friends outside the lab provided me the social cushion to weather the ups and downs of

graduate school for which I am greatly thankful to them.

I thank Avi for helping me with indexing this thesis and also for his constant support and

encouragement.

Last but not the least, I thank my parents for their selfless love and unwavering support and my

sister for bringing so much joy and inspiration to my life.

vii

Table of Contents

Chapter 1 ................................................................................................................................................ 1

Introduction ............................................................................................................................................ 1

1.1 Modified oligonucleotides encoding telomeres .............................................................................. 1

1.2 Isosteres as shape mimics of nucleotides ....................................................................................... 3

1.3 Oligodeoxynucleosides in detection of gases.................................................................................. 4

Chapter 2 ................................................................................................................................................ 5

Elongating telomeres in zebrafish (a vertebrate model organism)............................................................ 5

2.1 Introduction ................................................................................................................................... 5

2.2 Telomere shortening and Cellular Senescence ............................................................................... 6

2.3 Telomeres are maintained by Telomerase ...................................................................................... 7

2.4 Structure of Telomerase ................................................................................................................ 7

2.5 Activation or reconstruction of Telomerase ................................................................................... 9

2.6 Alternative Lengthening of Telomeres (ALT) ................................................................................. 10

2.7 Rolling Circle Elongation of Telomeres ......................................................................................... 12

2.8 Factors affecting rolling circle replication ..................................................................................... 13

2.9 In vitro elongation of Telomeres using Rolling Circle Amplification ............................................... 14

2.10 Rolling circle elongation in vivo .................................................................................................. 16

2.11 Zebrafish (Danio reiro) as a model organism .............................................................................. 17

2.12 Developmental Stages of a Zebrafish ......................................................................................... 19

2.13 Microinjection into zebrafish embryos ....................................................................................... 20

2.14 Synthesis of the circular DNA ..................................................................................................... 21

2.15 Microinjection and Distribution of Fluorescein-labeled Circular DNA in the embryo ................... 25

2.16 Available Techniques for telomere measurement ...................................................................... 27

viii

2.17 Quantitative Fluorescence in situ Hybridization (Q-FISH) ............................................................ 30

2.18 Optimization of the metaphase preparation from zebrafish embryos ......................................... 32

2.19 Preparation of slides for Q-FISH analysis .................................................................................... 33

2.20 Dosage of circular DNA and mortality rate ................................................................................. 36

2.21 Q-FISH on zebrafish metaphase spreads..................................................................................... 37

2.22 Telomere length of 24hr old zebrafish ........................................................................................ 40

2.23 Telomere length after injection with telomere encoding circular DNA ........................................ 42

2.24 Discussion of telomere determination experiments ................................................................... 46

2.24 Summary ................................................................................................................................... 48

Chapter 3 .............................................................................................................................................. 49

Investigating the potential of radio-iodinated non-polar nucleoside analogs in tumor detection and

therapy ................................................................................................................................................. 49

3.1 Introduction ................................................................................................................................. 49

3.2 Therapeutically useful Auger emitters .......................................................................................... 50

3.3 Auger emitters targeting tumor ................................................................................................... 51

3.4 Radiolabeled 5-Iodo-2’-deoxyuridine (*IdU).................................................................................. 52

3.5 Non-polar nucleoside analogs ...................................................................................................... 55

3.6 Pharmacokinetics and metabolism of IdF (5-iodo-dF) ................................................................... 57

3.7 Effect of IdF on cancer cells .......................................................................................................... 57

3.8 Preparation radiolabeled ICl2PhdR ............................................................................................... 61

3.9 Synthesis of 1-(2-deoxy-β-d-ribofuranosyl)-2,4-dichloro-5-iodobenzene ...................................... 62

3.10 Stability and pharmacology of ICl2PhdR ...................................................................................... 64

3.11 Discussion of tumor-imaging experiments .................................................................................. 69

3.12 Summary ................................................................................................................................... 70

ix

Chapter 4 .............................................................................................................................................. 71

Investigating the steric and electronic discrimination of deaminated and oxidized bases by a novel

binding site of polymerase from Pyrococcus Furiosus (Pfu) .................................................................... 71

4.1 Introduction ................................................................................................................................. 71

4.2 Deamination of nucleobases ........................................................................................................ 71

4.3 Oxidation of bases ....................................................................................................................... 74

4.4 DNA repair ................................................................................................................................... 75

4.5 Base excision repair (BER) ............................................................................................................ 76

4.6 Stability and repair of DNA in hyperthermophilic archaea ............................................................ 76

4.7 Archaeal polymerases are inhibited by uracil ............................................................................... 78

4.8 Structure of archaeal polymerase bound to uracil containing DNA ............................................... 80

4.9 Role of hydrogen bonding and shape in base recognition ............................................................. 81

4.10 Non-polar analogs in investigating the importance of hydrogen-bonding ................................... 82

4.11 Dual recognition of both uracil and hypoxanthine ...................................................................... 83

4.12 Preparation of DNA sequences for polymerase extension assays................................................ 87

4. 13 Synthesis of F-phosphoramidite ................................................................................................ 88

4.14 Synthesis of oxoI-phosphoramidite ............................................................................................ 88

4.15 Primer extension assays with the polymerase enzyme ............................................................... 91

4.16 Results ....................................................................................................................................... 91

4.17 Discussion .................................................................................................................................. 98

4.18 Summary ................................................................................................................................... 99

Chapter 5 ............................................................................................................................................ 100

Investigating the importance of shape and hydrogen bonding in base recognition by DNA dependent

RNA polymerase II ............................................................................................................................... 100

5.1 Introduction ............................................................................................................................... 100

x

5.2 Hydrogen-bonding in RNA polymerases ..................................................................................... 100

5.3 RNA Polymerase II...................................................................................................................... 102

5.4 Hydrophobic analogs of adenine and thymine ........................................................................... 103

5.5 Synthesis of sequences for RNA polymerase studies .................................................................. 104

5.6 Synthesis of the dQ-phosphoramidite ........................................................................................ 105

5.7 Extension assays with Pol II enzyme ........................................................................................... 106

5.8 Results ....................................................................................................................................... 111

5.9 Discussion .................................................................................................................................. 111

5.10 Summary ................................................................................................................................. 112

Chapter 6 ............................................................................................................................................ 113

Development of polyfluorophores on a DNA backbone that could be used as sensors of small molecules

in the vapor phase ............................................................................................................................... 113

6.1 Introduction ............................................................................................................................... 113

6.2 Polychromophores of fluorescent nucleobases .......................................................................... 114

6.3 Using oligodeoxyfluorosides for gas detection ........................................................................... 114

6.4 Synthesis of the library and screening (Courtesy Dr. F. Samain) .................................................. 116

6.5 Re-synthesis and characterization of the selected sequences ..................................................... 117

6.6 Using the selected beads as sensors ........................................................................................... 117

6.7 The sensing of gases .................................................................................................................. 121

6.8 Discussion .................................................................................................................................. 123

6.9 Summary ................................................................................................................................... 124

Chapter 7 ............................................................................................................................................ 125

Material and Methods ......................................................................................................................... 125

7.1 Synthesis of 6-N-(l-(Dimethylamino)ethylene)-2’-deoxyadenosine (dma-dA) .............................. 125

xi

7.2 General procedure for the synthesis of non-polar thymidine/uracil analogs ............................... 126

7.3 Synthesis of 1-(2-deoxy-β-d-ribofuranosyl)-2,4-dichloro-5-iodobenzene and the corresponding

stannyl-analog ................................................................................................................................. 130

7.4 Synthesis of 7,8-dihydro-8-oxo-2’-deoxyinosine ......................................................................... 132

7.5 Synthesis of 1-[2-Deoxy-β-D-erythro-pentofuranosyl]-9-methyl-imidazo[(4,5)-b]pyridine (dQ)... 133

7.6 General Procedure for DMT protection and preparation of phosphoramidites ........................... 137

7.7 Primer extension assays with archaeal DNA polymerases enzymes ............................................ 138

7.8 Oligodeoxyfluoroside (ODF) library synthesis methods............................................................... 138

7.9 Image processing methods for screening ................................................................................... 140

References .......................................................................................................................................... 142

1

Chapter 1

Introduction

Since the identification of DNA as the basic genetic material, several attempts were

made early on to synthesize defined oligonucleotides169a-d

. However it was not until the

early 80s when the automation of oligonucleotide synthesis and the development of

versatile phosphoramidite170,171

reagents made efficient scale-up of oligonucleotides

possible, thereby expanding their application to diverse areas of fundamental and

applied biological research. Efficient solid-phase synthesis coupled with enzyme-

assisted synthetic methods and the availability of modified nucleotides increased the

utility of synthetic oligonucleotides172

. The last few decades has seen the wide use of

these synthetic biopolymers as molecular probes to understand the interaction between

proteins and nucleic acids at molecular level, and as therapeutic and diagnostic agents

and sensors173a,b,c

.

1.1 Modified oligonucleotides encoding telomeres

The Kool lab has been at the forefront of studies aimed at gaining basic understanding

of biological mechanisms by using modified nucleotides and applying this

understanding to the design and development of novel functionally useful molecular

probes174a-c

. A classic example of this approach is the group‟s work towards the

development of telomere encoding synthetic oligonucleotides. In order to study the

DNA binding properties of circular RNA involved in triple-helix formation, the group

2

had developed methods for efficient synthesis of circular oligonucleotides175

. Since

nucleic acids serve not only as recognition elements but also as encoders of genetic

information the group subsequently examined whether these circular oligonucleotides

could act as substrates of enzymes. They observed that some of these circular DNA

molecules could serve as efficient templates for transcription with RNA polymerase in

the absence of RNA primers or RNA promoter sequence176

. The group suggested that

RNA synthesis occurred by a “rolling circle” mechanism, in which after initiation the

polymerase produces many true repeating RNA copies of the DNA strand, progressing

around the circle multiple times. One year later they reported the same activity with

DNA polymerases resulting in the “rolling circle amplification” of circular DNA

sequences in the presence of complementary primers177

. The idea of rolling circle

elongation was then applied to the extension of telomeric ends of chromosomes. Using

telomeric 3‟-overhang as the primer for 54 nucleotide long complementary circular

DNA, the group was able to elongate telomeres on human chromosomes by several

thousand bases178

.

Since telomere length is the time clock that determines how long a cell can divide

before it dies10,11

, the artificial lengthening of telomeres has tremendous therapeutic

implications, as will be discussed in details in the second chapter of this thesis. Having

demonstrated the in vitro elongation of human chromosomes the Kool lab was eager to

pursue these studies in vivo. The second chapter discusses our efforts at elongating

telomeres in zebrafish (a model organism) using the principles of rolling circle

elongation.

3

1.2 Isosteres as shape mimics of nucleotides

Continuing with the theme of clinical and therapeutic significance of modified

nucleotides we discuss our studies in using artificial nucleosides as tumor tracers in the

third chapter. Almost a decade ago, the Kool lab had designed and developed non-polar

hydrophobic isosteres of nucleosides as close structural and steric mimics of natural

nucleosides99,100

. Although these bases were found to be destabilizing in DNA they

were surprisingly well accepted by DNA polymerases107

leading the group to

hypothesize the active-site tightness model which explained base pairing by steric

matching rather than hydrogen bonding. Furthermore, these nucleosides were expected

to have better metabolic stability and bio-availibility compared to natural nucleosides

because of their stable C-glycosidic bond and relative hydrophobicity, hence increasing

their therapeutic utility. In the third chapter of this thesis, we discuss the design and

application of one of these modified analogues in tumor detection and therapy.

Since these non-polar nucleoside mimics differ from their natural counterparts in the

absence of hydrogen-bonding groups they allow the investigation of the involvement

and importance of shape and hydrogen bonding in the interaction of nucleosides with

each other and within enzyme complexes. Transmission of the genetic information

from the parental DNA strand to the offspring is crucial for the survival of any living

species and is achieved by the replication machinery involving DNA polymerases. It

was recently observed that archaeal DNA polymerases have a novel way of maintaining

genomic integrity. They have a pocket which recognizes deaminated nucleobases and

stalls the DNA replication126

. It is of interest to understand how this pocket

4

discriminates the deaminated bases from structurally close natural bases. In the fourth

chapter we use nucleoside isosteres and some oxidized bases to probe the base

recognition mechanism of this pocket.

In the fifth chapter we extend the scope of our studies to RNA polymerases where we

once again use non-polar nucleoside isosteres to probe the active site of yeast RNA

polymerase II.

1.3 Oligodeoxynucleosides in detection of organic vapors

We finally end this thesis with a nifty application of artificial nucleobases in detection

of gases. The intrinsic fluorescent properties of natural nucleosides and nucleic acids

are limited179

but the DNA backbone does provide a convenient scaffold for attaching

fluorophores. Using fluorophores as substitutes for nucleobases the Kool lab had

developed a library of polyfluorophores called oligodeoxyfluorosides (ODFs)153

. It was

observed that the oligodeoxyfluorosides (ODFs) underwent multiple forms of electronic

interactions among the closely spaced chromophores, resulting in complex fluorescence

emission properties distinct from the component monomers153-157

. The last chapter

demonstrates the usefulness of such a library in sensing volatile compounds.

From basic science to biotechnological applications, this thesis provides the reader a

glimpse into a few of the numerous possible applications of modified nucleosides and

nucleic acids. Given the increased interest in this field one can only be certain that new

modifications and wider ranges of applications will be found of this class of compounds

in future.

5

Chapter 2

Elongating telomeres in zebrafish (a vertebrate model

organism)

2.1 Introduction

All eukaryotes, and a few prokaryotes, keep their genomes in the form of linear DNA

molecules. Eukaryotic telomeres end with 3′ protrusions at both chromosomal ends, as

demonstrated for ciliated protozoa, budding yeast, and human telomeres1,2,3,4

. The

physical ends of chromosomes, known as telomeres, cap the chromosome ends and

protect them from nucleolytic degradation and DNA repair activities. In most

organisms the telomeric DNA sequence is G-rich and is partially conserved, such as

„TTAGGG‟ in vertebrates or „TTGGGG‟ in ciliate Tetrahymena. The length of the

telomeric sequence can range from dozens to thousands of repeats5. It is generally

believed that this sequence is double-stranded except for the last few hundred bases of

the G-rich strand which are thought to be single stranded6,51

.

Fig 1. Telomeres cap the end of linear chromosomes [Ref 180]

6

2.2 Telomere shortening and Cellular Senescence

In the 1960s, Hayflick found that human diploid cells in culture divide a limited

number of times before undergoing a state called “cellular senescence”7. This state is

characterized by an irreversible stop of cellular proliferation and this limit has been

named "the Hayflick limit". A decade later, based on the mechanism of DNA

replication, James D. Watson described what he called "the end-replication problem".

Since conventional DNA-dependent polymerases replicate DNA only in the 5' to 3'

direction and cannot initiate synthesis of DNA chain de novo an 8- to 12- base stretch

of RNA is necessary to provide the 3'-OH end to prime DNA synthesis. Thus, during

DNA replication, the extreme 5' terminal end of the chromosome is not completely

copied, leaving a small region of telomere un-replicated8. This phenomenon leads to

shortening of chromosome ends with each successive division.

Finally in 1973, Olovnikov connected cellular senescence with the loss of telomeric

DNA. He proposed that telomere length acted like an intrinsic clock of aging that tracks

the number of cell divisions before cell growth arrest or replicative senescence sets in9.

Depending upon the type of cell the loss of telomere ranges from 25-

200bp/division10,11

. However, the correlation between telomere shortening and entry in

senescence is not absolute. It has been found that certain senescent cells have still rather

long telomeres (5-10 kb) and other cells with shorter telomeres keep their capacity to

divide. This discrepancy could be explained by the hypothesis that it is the shortest

telomere, and not the average size of telomeres that sets off senescence12

.

7

2.3 Telomeres are maintained by Telomerase

It was observed that in germ line or in tumor cells, loss of telomeric DNA due to

incomplete replication was balanced by telomere elongation, which may involve de

novo synthesis of additional repeats by a specific DNA polymerase13

. This enzyme

which was called Telomerase was discovered by Carol Greider and Elizabeth

Blackburn in 1984. This enzyme was found to be responsible for the maintenance and

elongation of telomeres, in a ciliate organism, Tetrahymena thermophilia14

. Further

investigation showed that this enzyme contains an RNA component and is thus a

ribonucleoprotein complex15

. This enzymatic activity was then detected in extracts of

human cell lines, where it synthesizes TTAGGG DNA repeats at chromosomal termini.

2.4 Structure of Telomerase

Telomerase is a ribonucleoprotein (RNP) whose catalytic function depends mainly on

two components: the TERT (telomerase reverse transcriptase) protein and telomerase

RNA (known as TR or TER). The telomerase RNA contains a short segment, which

encodes the telomere repeat, and serves as a template for reverse transcription by TERT

(Figure 2). The primer for reverse transcription is provided by the 3‟-overhang of the

telomeres. Although sharing many properties of “conventional” reverse transcriptases,

TERT also exhibits unique features; the primary ones are its utilization of a template

embedded in a large RNA and its ability to add multiple complements of the template

through repeated cycles of extension and “translocation” reactions10b

.

8

Fig 2. Telomere replication by reverse transcription of an RNA template in the

Telomerase [Ref 10(c): Mol. Biol. 2006; Reproduced with permission]

Since its discovery in 1980s, various applications of Telomerase have been proposed in

the field of diagnostics and therapeutics. Compared to most normal somatic cells where

telomerase is repressed, the expression of telomerase has been detected in most cancer

cells10a

. Hence the telomere/telomerase system offers ways to intervene in the

proliferative activity of the cell which could be beneficial for both cancer therapy as

well as treatment of degenerative diseases. Inhibition of telomere maintenance in tumor

cells by inhibiting telomerase could trigger their senescence. On the other hand,

increasing the telomere length by activating the residual telomerase or expressing

telomerase in normal somatic cells could alleviate their degeneracy.

9

2.5 Activation or reconstruction of Telomerase

Multiple lines of evidence suggest that telomere loss has a role to play in degenerative

diseases. Epidemiological studies show that individuals with short telomeres in their

blood cell DNA are statistically at higher risk for stroke (cerebrovascular dementia),

heart disease, and infections, compared to individuals with longer telomeres21,22

.

Genetic disorders like Dyskeratosis congenita, characterized by failure of proliferative

tissues like bone marrow, skin, hair and nails, are known to be caused by mutations in

the structure of telomerase leading to defective telomere maintenance23a

. So far efforts

to reduce telomerase loss have been focused on three main strategies23b

: (1) classical

gene therapy involving transfection with telomerase encoding sequences24

, (2)

telomerase promoter reprogramming in order to activate the repressed telomerase

gene25

, and (3) using telomerase activating molecules that interact directly with the

enzyme to enhance the low residual activity in some cells. However possible malignant

transformation in the presence of constitutively expressed telomerase is a concern in

ectopic expression of telomerase. On the other hand telomerase activators are limited in

their therapeutic effect because they can activate telomerase only in tissues with

residual telomerase activity. Although telomere or telomerase specific agents have been

rare, a number of activators have already shown promising results. TA-65, a telomerase

activator agent derived from the Chinese Astragalus plant, is licensed to Telomerase

Activation Sciences and Geron, has already been tested in a pivotal clinical study, and

showed to improve immune function, eye sight and skin characteristics by increasing

telomere length through hTERT gene activation26

. .

10

2.6 Alternative Lengthening of Telomeres (ALT)

In the late 90s, it was observed that some mammalian cells without any telomerase

activity are able to maintain the length of their telomeres for many population

doublings indicating the existence of non-telomerase mechanisms for telomere

maintenance27,36

. This has been called Alternative Lengthening of Telomeres (ALT).

Characteristics of human ALT cells include great heterogeneity of telomere size

(ranging from undetectable to abnormally long) within individual cells, and ALT-

associated PML bodies (APBs) that contain extra chromosomal telomeric DNA,

telomere-specific binding proteins, and proteins involved in DNA recombination and

replication28,29

. Telomeric dynamics in ALT is consistent with a recombinational

mechanism where elongation of telomere occurs by hybridization to a template and

extension by regular cellular polymerase. Four different types of recombinational

mechanism have been suggested to account for ALT36

: (1) Inter-telomeric

recombination event, where the single-stranded DNA at the end of one telomere

invades double-stranded DNA of another telomere and uses it as a copy template

resulting in a net increase in telomeric DNA within the cell30

. (2) Recombinant

dependent replication facilitated by strand invasion of the 3‟-overhang into the t-loops.

(3) Linear or circular extrachromosomal telomere repeat DNA acting as a template for

replication32,33

. Artificial circular DNA containing telomeric repeats has been shown to

be utilized by K. lactis to greatly extend its telomeres32

. Telomere repeat circles and

extra-chromosomal linear DNA have also been found in human tumors and in a human

immortal cell lines and in a human ALT lines34,35

. Hence there is a possibility that both

linear and circular DNA provide templates for telomere elongation in these cells.

11

Fig 3. Mechanisms suggested for Alternative Lengthening of Telomeres.[Ref 37 b :

Mechanisms of Aging and Development 2008; Reproduced with Permission ]

All immortalized cell lines studied to date either have telomerase activity or have the

telomere length phenotype characteristic of ALT37a

. Some cell lines like lymphocytic

cell line that may have both37b

. The situation, however, is more complex for tumors.

Approximately 85% of all human tumors have telomerase activity38

. Although an

extensive survey to determine the prevalence of ALT in human tumors has not yet been

done some suggest that the remaining 15% mainly maintain their telomeres by ALT.

12

2.7 Rolling Circle Elongation of Telomeres

In rolling circle replication model, the 3‟-overhang of telomere acts as a primer which

invades and hybridizes with the extra-chromosomal telomere repeat circles. In the

presence of cellular polymerase these primers are then elongated. The circular DNA

can roll along the telomere primer and several rounds of replication would result in

rapid telomere extension. Hence rolling circle amplification (RCA) has increasingly

becoming popular in nucleic acids amplification. It has found many applications in the

detection of nucleic acids, proteins and other biomarkers and has been used to improve

multiplexed genomic and proteomic profiling in micro-arrays39,40

. The isothermal

nature of the technology makes it far easier to adapt to clinical laboratory settings than

conventional amplification technologies.

Fig 4. Rolling circle replication of telomere [Ref 39a : Trends in Biochemical

Sciences 2006; Reproduced with Permission]

13

2.8 Factors affecting rolling circle replication

The extent to which circular telomeric repeat DNA contributes to telomere elongation,

even in cells that solely use recombination to maintain telomeres, may depend upon a

number of factors like their size, abundance and availability of alternative templates

(such as a long telomeric repeat tract at another chromosome end) that might permit a

recombination event to elongate a telomere. The other consideration is the potential of

cellular enzymes to access the telomere ends and process them. However most DNA

and RNA polymerases dissociate from the template after reaching certain length (i.e.

poor processivity), lack intrinsic displacement activity and display some 5‟-3‟

exonuclease activity41, 42

. The topology of the circular DNA as well as that of the

telomere ends might also influence the processivity of the enzymes. The ALT-

associated PML bodies (APBs) might contain proteins that play a significant role in the

process. In fact they have been found to contain telomere binding proteins like TRF1

and TRF2 other than a large range of proteins involved in DNA recombination and

replication like RAD51, RAD52, RPA, MRE11, RAD50, NBS1, BLM and WRN43-46

.

The presence of other proteins like RecQ helicases also concur with the notion of these

bodies facilitating the process of recombination-dependent replication either mediated

by extra-chromosomal DNA or intra-chromosomal homologues.

14

2.9 In vitro elongation of Telomeres using Rolling Circle

Amplification

The rolling circle mechanism was reconstituted in vitro by Kool and coworkers when

they demonstrated the ability of circular DNA to elongate human chromosomes in the

presence of polymerase47

. In this study 54nucleotide long circular DNA with sequences

complementary to human telomere were used to elongate primers representing the

telomere 3‟-overhang in the presence of polymerase. Using chimeric and completely

complementary sequences in the circular DNA the group was able to demonstrate

elongations from a few hundred to more than 12kb long. A sequence scrambled DNA

however didn‟t show any elongation confirming the necessity of sequence

complementarity between the primer and the template. Interestingly, most enzymes

tested showed telomerase-mimicking activity as determined by TRAP assay (Telomere

repeat amplification protocol) in the presence of the telomere repeat containing

nanocircle, with thermophilic DV, KF polymerase, and human pol β giving the longest

products. The group also studied the ability of polymerases to extend human telomeres

in fixed cells. Metaphase spreads of human embryonic kidney cells were incubated with

the telomere-encoding circle, nucleotide triphosphates including fluorescein-labeled

dUTP and thermophilic Taq polymerase. While controls lacking the nano-circles gave

no signals, green-fluorescein signals from the incorporated dUTP were clearly visible at

the ends of the human chromosomes. The results were replicated with another enzyme

pol β. However, as discussed earlier, the size and secondary structure of the circular

DNA could be important factors in determining its effectiveness. In order to study these

questions the group synthesized a series of circular DNA ranging from 36 nucleotides

15

to 60 nucleotides in size and tested them as templates for the synthesis of human

telomere repeats in vitro48

. They observed that despite forming secondary structures the

nano-circles were able elongate telomere primers. This was probably because these

secondary structures were formed at pH value lower than neutral pH. Even small circles

were found to be active although the optimum size varied from enzyme to enzyme. The

group also studied telomere elongation using human polymerase and mammalian

polymerases. Although these enzymes enabled significant elongation of the telomere

primer, they were not able to produce as long elongations as their prokaryotic

counterparts. Even nuclear extracts from HeLa cells with low telomerase activity was

shown to facilitate some elongation for the larger circles. This study illustrated a

telomerase-free approach of making long telomeres which could significantly enhance

our understanding of the structure of telomeres and the mechanism of telomere

elongation. The facile synthesis of circular DNA of varying sizes also encouraged the

possibility of using these molecules for telomere elongation in vivo. Being single

stranded, these circles wouldn‟t need to be denatured before they could anneal to the 3‟-

overhang of human telomeres. Regulation of telomeres in live human cells in the

absence of telomerase could have many applications in tissue engineering as well as

have a therapeutic potential in degenerative diseases. Such studies could provide a more

direct proof of the prevalence of rolling circle amplification as means of telomere

maintenance in telomerase negative ALT-positive human cancer cells and hence

provide new tumor biomarkers and pathways to target in such tumors.

16

2.10 Rolling circle elongation in vivo

Although the ability of circular DNA encoding telomere to act as template for rolling-

circle elongation of telomeres has been conclusively demonstrated in yeast49

the only

correlative data available in human beings is the existence of extra-chromosomal

telomeric circular DNA in ALT –positive cells50

. From their study of the origin of such

circles in non-ALT cells expressing a mutant TRF2, Wang et al inferred that these

circles arise by homologous recombination within an intrachromosomal t-loop,

producing an abruptly shortened telomere and the reciprocal recombination product, an

extrachromosomal t-circle50

. The in vitro studies in the Kool lab indicated that such

molecules could act as templates for rolling-circle telomere replication in human cells

as well. In order to study this, the group carried out studies on primary human cell

lines51

. DNA nano-circles were transfected into two primary cell lines, BJ fibroblasts

and Retinal pigmented epithelial cells and their telomere length monitored. However

within the error margin, no reproducible telomere extension was observed in the treated

cells compared to controls. One of the reasons could be that transfection of nucleic acid

is difficult to control and optimize and hence there is always a possibility that sufficient

circular DNA were not transported and localized in the nucleus. In order to overcome

some of these limitations, the group decided to study effect of microinjecting these

DNA nano-circles. The rest of the chapter will discuss our observations when the

telomere-encoding circular DNAs were microinjected into a model organism, zebrafish.

17

2.11 Zebrafish (Danio reiro) as a model organism

The zebrafish, a small (1–2 in.) fresh water tropical fish species native to India, has

recently emerged as an ideal model system for the study of development. What makes

zebrafish unique is its invertebrate-like advantages but vertebrate biology53

. These

characteristics also make it a great candidate for gerontological studies. The embryos

are transparent, thus, morphological differences can easily be detected via gross and

microscopic visual examination. Zebrafish embryos hatch to become free-swimming

larvae within 2-3 days after fertilization. They are physically large enough to isolate

specific tissues for experimental analysis, minimizing the disadvantages of pooled

whole organism approaches commonly used for invertebrate analyses. Thus, screens for

aging relevant phenotypes, such as alterations in growth, or responses to stress can be

readily determined.

Fig 5. (a) A 8 month old adult zebrafish, (b) A 48 hrs old embryo, (c) An embryo stained

with mitochondrial specific fluorescent dye Mitotracker Green [Ref 53: Experimental

Gerontology 2003; Reproduced with Permission]

18

Zebrafish has high fecundity. A single female can produce several hundreds of eggs per

week. This combined with economic husbandry requirements means thousands of

fishes can be quickly produced and cheaply maintained compared to rodents. This

facilitates large scale demographic studies not possible with other vertebrate models.

Although the average life-span of zebrafish(4 years)53

is 50% longer than that of

rodents its life span can be readily manipulated by calory intake, ambient temperature

and reproductive capacity. The true power of zebrafish as a model for aging comes

from the ability to manipulate it genetically. Well-developed in vitro-fertilization

techniques enable rapid breeding and mutant preservation. Since zebrafish spends 30-

40 minutes of its life as a single cell embryo which can be readily manipulated it can

act as a useful model for studies related to two well characterized unicellular models of

aging, budding yeast and the cellular senescence of cultured cells. The ease of genetic

manipulation has spurred a lot of efforts in developing dense genetic maps, genome

libraries and full genome sequences of zebrafish.

Molecular events that orchestrate a variety of morphogenesis and organ formation in

humans are conserved in zebrafish54a

, thus making it a good candidate for a wide range

of applications such as disease modeling and drug evaluation. Maintaining the

anatomical and physiological similarities zebrafish develop a wide spectrum of cancers

resembling human malignancies54b

. Last but not the least, like humans, zebrafish also

possess G-rich telomeric repeats (TTAGGG)n52

which make them amenable to

extension by circular DNA developed in the Kool lab.

19

2.12 Developmental Stages of a Zebrafish

Fig 6. Developmental Stages of a zebrafish (A) Single cell embryo (B) 4-cell stage (C) 8-cell

stage (D) Approximate 64-128 cell stage (E) 3 hr old blastula stage embryo (F) 24 hr old

embryo curled inside chorion (G) Free-swimming 48 hr old embryo [Ref 53:

Experimental Gerontology 2003; Reproduced with Permission]

Zebrafish takes 3-4 months to reach fertility. At its inception, the post-fertilization

embryo has one cell that appears like a half- bubble on the yolk which acts as a source

of nutrients(Fig 7 (A)). This period lasts for the first 45 minutes. The newly fertilized

egg is .7 mm in diameter and is enclosed in the chorion (egg shell). After the first

cleavage stage, the cells divide at around 15 minute intervals. This cleavage stage runs

from 45 minutes to 2 ¼ hours (Fig 7 (B),(C),(D))55

. The blastula stage lasts from 2 ¼ to

5 ¼ hours. During this period the blastoderm envelopes the yolk and the first

morphogenetic movement of the embryonic development called epiboly takes

place(Fig. 7 (E)). The pharyngula stage occurs between 24–48 hours (Fig. 7 (F)). This

is the time of development when one can compare the embryos of diverse vertebrates.

20

The heart begins to beat just at the onset of this period, the fins begin to form, the

pigmental cells differentiate and tactile sensitivity appears55

. Finally the embryo

hatches out of the chorion between the second and third day.

2.13 Microinjection into zebrafish embryos

Microinjection is a popular and reliable method of delivering nucleic acids, proteins and

small molecules into the zebrafish embryo. This method has been successfully used to

produce transgenic zebrafish expressing transgene for multiple generations56

. In this

method a microinjection pipette is filled with a solution of the sample to be injected and

attached to an apparatus that forces the solution out of the pipette with air pressure. Once

the sample is injected into the cytoplasm, the pipette is immediately withdrawn and the

injected embryos are incubated to develop further.

The basic setup includes a dissecting microscope, a pressure regulator, a micropipette

holder, and a micromanipulator. The holder for the injection pipette is mounted on a

micromanipulator and connected to the pressure regulator via a poly-ethylene tube. The

micromanipulator is used to precisely guide the location of the tip of the injection pipette

to the desired location in the embryo. An automatic system controls the pressure and the

discharges are activated with a foot paddle. The recommended injection volume is about

10–20% of that of the cytoplasmic volume since higher volumes can burst cells or

deform the embryos57

.

Agarose microinjection plates containing grooves are made by inserting a glass

microscope slide into warm agarose and letting it solidify. The day prior to

microinjection, male and female zebrafish are placed in a breeding trap separated by a

21

divider. The next morning the divider is removed. Once the eggs are laid, they are

immediately collected and positioned into the grooves so that they are supported when

penetrated by the microinjection needle. Embryos, the needle, and the microinjected

DNA are all visible under a stereomicroscope, allowing for precise control of the

microinjection process. The embryos are microinjected by first penetrating the cell wall

with the microinjection needle and then pushing gently on the syringe plunger. The

needle is immediately pulled out of the cytoplasm and moved to microinject the next

egg.

2.14 Synthesis of the circular DNA

Circular DNA containing repetitive sequences are in general difficult to synthesize.

This is because they are generally made by ligating the ends of a linear single stranded

DNA. However in order to bring the 5‟ and the 3‟ends of the DNA close to each other

templates or „splints‟ which hybridize across the broken ends need to be used. The

problem with repetitive sequences is that the template could hydrize at sites other than

the ligation site resulting in inefficient ligation. The rigidity of the splint-DNA duplex

also affects the circularization of the DNA. The Kool lab had developed a chemical

solution to this problem by using orthogonal protective groups58

. Dimethylacetamidine

(Dma) was used as protecting group for the exocyclic amine of Adenine. The modified

Adenine coupled efficiently on a standard solid-phase DNA synthesizer and remained

stable under ultra-mild deprotection conditions. Since it was recognized that the Dma

groups would inhibit duplex formation with the splint the linear DNAs were

synthesized containing Dma-protected Adenine at all adenine positions except those

22

close to the termini which had ultra-mild protecting groups on them. Upon the selective

deprotection of these groups the splint was encouraged to hybridize to the ends, thereby

preventing unwanted secondary structure.

For our studies, the N6-dimethylacetamidine-dA (Dma-dA) phosphoramidite was

prepared according to a published method59

. DNA oligonucleotides were synthesized

on an Applied Biosystems 394 synthesizer using β-cyanoethylphosphoramidite

chemistry. In order to enable enzymatic ligation the 5‟-end of the DNA was

phosphorylated using Chemical Phosphorylation Reagent I (Glen Research).

Deprotection of the ultra-mild protecting groups was done with 0.05 (M) K2CO3/MeOH

for 12 h at room temperature. The carbonate solution was neutralized by adding an

equal volume of 2(M) tetraethylammonium acetate. In order to facilitate ligation, a

typical reaction involved annealing the 54mer DNA (1µM) with 1.2µM of the 18mer

„splint‟ (5‟-GTTAGGGTTAGGGTTAGG-3‟) in 50Mm Tris-buffer (pH 7.5) and

10Mm MgCl2 at 900C for 20 min followed by slow cooling to room temperature.

Ligation was achieved using T4 DNA Ligase (New England Biolabs; 3.4 U/µL) in the

presence of DTT (final concentration 10mM) and ATP (final concentration 0.5µM) for

24 hrs. Followed by dialysis and evaporation the crude mixture was purified by

preparative 20% denaturing polyacrylamide gel electrophoresis (PAGE). The band

corresponding to the purified circle was cut out and extracted with 0.2 (M) NaCl. After

another step of dialysis followed by evaporation the Dma groups were cleaved from the

circular DNA by incubating it in NH4OH at 550C for 16hrs. Evapoartion of the NH4OH

23

gave pure circular DNA. Concentration was determined by UV absorbance at 260nm

and calculation of Molar Extinction Coefficients using the nearest neighbor method.

Using the above mentioned synthetic strategy we synthesized the following:

1. „HT54‟, a 54mer circular DNA which encodes 9 telomeric repeats (Fig. 7 A).

2. „SCR54‟, a 54mer circular DNA with same base composition as „HT54‟ but the

sequence is scrambled such that it cannot anneal to the telomeres. This molecule was

expected to serve as our control (Fig. 7 B).

3. „FL54‟, a 54mer circular DNA with the same sequence as „SCR54‟ but with a

fluorescein-labeled thymidine. This molecule was designed with the purpose of

detecting the distribution of circular DNA after microinjection (Fig. 7 C).

24

Fig 7. Single stranded circular DNA synthesized for the experiments (A) HT54, a telomere-encoding 54mer (B) SCR54, A 54 base long circular DNA with scrambled sequence (C) FL54, a circular DNA with the same sequence as SCR54 but with one fluorescein-T

25

2.15 Microinjection and Distribution of Fluorescein-labeled

Circular DNA in the embryo

Before the telomere encoding circular DNA was microinjected it was important to

make sure that it would be properly taken up and uniformly distributed at least amongst

the early group of dividing cells in the egg. Otherwise the telomere length elongation

could be localized and a sample homogenate may not accurately reflect the telomere

elongation in all the cells. Taking advantage of the transparency of the zebrafish

embryos the fluorescein labeled circular DNA (FL54) was microinjected into embryos

to see if they were uniformly distributed. Microinjections at different points on the

embryo and at different developmental stages were done to figure out the best method.

A solution of 4µM DNA in 0.25% phenol-red was found to be the optimum

concentration for fluorescence detection under the microscope once the circular DNA

was microinjected. The position of microinjection also seemed to have a strong bearing

on the distribution of DNA. While microinjection into the cell or any random position

in the yolk resulted in non-uniform distribution, it was found that microinjecting into

the yolk of the embryo right below the cell, in the single cell developmental stage was

the best method of getting uniform distribution of the circular DNA. Under these

conditions it was observed that on an average 90% of the embryos had uniform

distribution when they are 3 hrs old which is the blastula stage of the embryo, an

important developmental stage which is followed by epiboly (Fig 6 E). Beyond this

stage however the distribution of the circle as evinced by fluorescence becomes random

probably because of the morphogenetic movements that accompany it.

26

Fig 8. (A) Picture of a multi-cell embryo. The DNAs are microinjected right under the cell into

the yolk (B) A mixture of 3hr old embryos injected with fluorescein-labeled DNA (C) A

control embryo with no DNA injected (D) A 3hr old embryo with un-uniform distribution of

DNA and (E) A 3hr old embryo where the DNA is evenly distributed amongst the cells

27

2.16 Available Techniques for telomere measurement

Although microinjection may ensure the delivery of the DNA nanocircles into the cell

we still needed a suitable detection method to measure the telomere length. Since

evaluation of telomere length has diagnostic and prognostic value considerable efforts

have been focused to develop efficient method of telomere measurement. While

Southern Blot, the traditionally used technique for nucleic acid length determination

has been applied for telomeres a number of new hybridization based techniques have

also been introduced in the last decade which overcome some of its limitations. These

include hybridization protection assay, fluorescence in situ hybridization, flow

cytometry, primed in situ, quantitative-polymerase chain reaction and single telomere

length analysis60a

.

Southern Blot, where the DNA is fragmented by restriction enzymes, separated by gel

electrophoresis and labeled with sequence specific probes, still happens to be one of the

most widely used techniques for telomere length determination60b

. A densitometer is

used to quantitatively measure the size and abundance of the telomere/ telomere

restriction fragments. However the DNA extracted for Southern Blot analysis needs to

be un-fragmented and pure and this is not only technically difficult to obtain but is also

difficult to handle due to the high viscosity of un-fragmented DNA. Accuracy is also an

issue with Southern Blot since the telomeric restriction fragments could include

unknown amounts of the subtelomeric region as well. Also the relatively low sensitivity

of this technique means a large number of cells would be required to prepare samples

for analysis.

28

Hybridization Protection Assay (HPA) was used by the Nakamura lab to detect

telomeres61

. In this method genomic DNA from cell lysate are hybridized with

acridinium-ester labeled telomeric probe and detected by chemiluminiscence. HPA is

less time consuming, may not include subtelomeric sequences and requires fewer cells

for sample preparation. However HPA cannot give detailed information of the telomere

at the cell-level or chromosome level and cannot measure the telomere directly.

Fluorescence in situ Hybridization (FISH) involves labeling telomeric sequences

with oligonucleotide probes at individual cell level62

. DNA from metaphase

preparations of cells are denatured and hybridized with synthetic telomere-specific

probes containing fluorescein isothiocyante (FITC) or Cy3 and counterstaining the

DNA with 4', 6'-diamidino-2-phenylindole (DAPI) or propidium iodine (PI). This is

visualized by fluorescence microscopy or with a digital imaging system. Quantifying

the telomere length by FISH is called Q-FISH (quantitative FISH).

In Flow-FISH (flow cytometry-fluorescence in situ hybridization)63

the cell-sorting

by flow-cytometry is combined with fluorescence in situ hybridization. However the

cells don‟t need to be fixed in the metaphase stage and different cell populations can be

processed at the same time, making it more time-efficient than Q-FISH. But compared

to Q-FISH it requires a much larger number of cells and cell-permeability of the

telomere probes could be an issue.

29

Primed in situ (PRINS) is an effective method for detecting long repetitive sequences

like telomeres64

. In this method synthetic oligonucleotide primers with complementary

sequences are annealed and hybridized to metaphase of interphase spreads. In the

presence of thermostable DNA polymerase and fluorescence labeled nucleotides these

primers are elongated and fluorescence signals are analyzed by a fluorescence

microscope. However for short telomeres uneven primer annealing could lead to poor

telomere detection. In fact some of the modified probes used in FISH are also used in

PRINS detection.

Quantitative Polymerase Chain Reaction (Q-PCR) has also been used to determine

telomere length65

. The problem of amplification using complementary primers has been

overcome by using modified primers composed of repeated pattern of six bases

containing four consecutive paired bases followed by two mismatched bases. These

prevents the two primers from hybridizing with each other giving PCR amplified

products that are free of primer-derived products. One advantage of this method is that

it doesn‟t include the subtelomeric region.

Single Telomere Length Analysis (STELA)66

is another PCR based method which

involves annealing a linker called „telorette‟ containing repeats of TTAGGG followed

by a non-complementary tail to the G-rich telomere overhang which is ligated to the

5‟end C-rich strand of telomere. PCR amplification is performed by a primer identical

to the non-complementary telorette tail together with a chromosome specific upstream

30

primer in the subtelomeric region. Thus this method measures telomeres at individual

telomere level but can be used only when telomere adjacent sequences are known.

Besides these there are several methods available to determine the length of the

telomere 3‟-overhang. These include primer-extension/nick translation (PENT)67

,

telomeric-oligonucleotide ligation assay (T-OLA)68

, and electron microscopy69

.

2.17 Quantitative Fluorescence in situ Hybridization (Q-FISH)

Compared to Southern Blot, which provides an estimate of the average telomere length

only, Quantitative Fluorescence in situ Hybridization (Q-FISH) is a much more

sensitive method of telomere detection. Q-FISH provides an estimation of telomere

length in each chromosome to a resolution of 200bp. Unlike Southern Blot it could also

be used to measure telomere length in species containing interstitial telomeric site in

their genomes. In 1996 Lansdorp group replaced the oligonucleotide probes with

peptide nucleic acid (PNA) probes and showed that the fluorescence signals resulting

from the PNA/DNA hybridization could be effectively used in quantitative

measurement of telomere lengths62

. Although they produced higher background

compared to conventional oligonucleotide probes, the PNA probes exhibited more

intense staining of most telomeres and hence improved the sensitivity. Moreover, since

hybridization of the PNA probes to DNA was faster, the procedure was faster compared

to conventional FISH. In conventional FISH the hybridization of oligonucleotide

probes competes with the renaturation of complementary strands of the denatured

genomic DNA. Unfortunately the conditions that favor binding of small oligonucleotide

31

probes to repetitive telomeric DNA also result in efficient renaturing of genomic DNA.

This problem is overcome by using PNA probes. However Q-FISH is time consuming

procedure and the necessity of metaphase spreads means that only actively dividing

cells can be analyzed.

Q-FISH requires a fluorescence microscope equipped with a sensitive digital camera.

Samples are prepared by staining metaphase spreads of cells with Cy3/Fluorescein

labeled PNA probes specific for telomere sequences and the DNA dye DAPI51

. In a

typical Q-FISH experiment two separate images, one of the DAPI stained metaphase

chromosomes and the other of the telomere signals are acquired. They are then

processed with a dedicated computer program (TFL-TELO) which combines the

images and assigns telomeres to individual chromosomes. The program then provides

the user with the integrated fluorescence intensity value for each telomere, which is

proportional to the number of hybridized probes70

.

The study discussed in this chapter involved the measurement of telomere length in

zebrafish embryos by Q-FISH method to investigate the telomere elongating potential

of circular telomere encoding DNA.

32

2.18 Optimization of the metaphase preparation from zebrafish

embryos

In order to perform Q-FISH analysis metaphase spreads needed to be obtained from

zebrafishes. Zebrafish embryos which were 6hrs old, 1 day old, 2 days old and 3 days

old were used as sources of cellular DNA. While 6 hr old zebrafish embryos were

arrested in metaphase on treatment with 0.1% colchicine, a reagent which arrests

dividing cells in metaphase, direct treatment of the 1/2/3 days old zebrafish embryos

with colchicine, failed to provide any metaphase spreads. Hence the zebrafish embryos

were trypsinated with 0.25% Trypsin-EDTA solution to dechorionate them, loosen the

tissues and make them more permeable to colchicine. Following 5 minutes of

trypsination the zebrafish, the zebrafish were still seen to be alive as evinced by the

twitching of their tails. The trypsin was neutralized using a trypsin neutralizing medium

and then the embryos were incubated with 0.1% colchicine for 2.5 hrs. Although the

embryos were dead by this time, this period of colchicine treatment didn‟t generate

enough metaphases. The optimum time for colchicine incubation was found to be 4

hours. The embryos were then triturated to separate the cells from yolk and other extra-

cellular material. The cells which were lighter floated to the surface and were decanted

off. They were then incubated for 30 minutes at room temperature in 1mL of lysis

medium (60mM KCl). The solution was centrifuged and the cells resuspended in a

fixative solution made of 3:1 (methanol: acetic acid), gently mixed and incubated for 10

minutes. The cell suspensions were precipitated by centrifuging at 1000 rpm for 10

min, supernatant was removed and the cells were resuspended in 1mL fixative. This

step was repeated 3 times and finally the cells were suspended in appropriate amount of

33

fixative. At the end of this process all the intracellular and extra-cellular material

except for nuclear chromatin are removed from the solution. For the purpose of this

study 100µL was found to be the appropriate volume for having enough metaphases

(15-20) per slide when these fixed cells were dropped onto the slides for analysis. Since

the procedure of metaphase generation was found to be most efficient for 24hr old

embryos compared to 6hr old embryos or older embryos it was decided to determine

post-injection telomere length in 1 day old embryos.

2.19 Preparation of slides for Q-FISH analysis

Published methods of slide preparation were used for this study71

. Pre-cleaned glass

slides were washed with 0.5ml of fixative solution and 5-6 drops of cell suspensions

were dropped onto the slides. After another wash with fixative solution, the glass slides

were placed face-up on stacks of paper towel moistened with warm water to make the

rate of drying slow. Following complete drying, the glass slides were then aged

overnight in a fume hood. Best efforts were made to prepare slides of consistent quality

over different experiment sets. These slides were then subjected to further washing and

fixing and hybridized with PNA probes for Q-FISH analysis.

34

Figure 7. Steps involved in obtaining metaphase spreads from zebrafish for Q-FISH analysis

35

Fig 10. Metaphase spreads of zebrafish in Gray-scale format (A) The DAPI stained

chromosomes (B) The telomeres are seen as bright spots superimposed on the

chromosomes

36

2.20 Dosage of circular DNA and mortality rate

Although the zebrafish embryos are relatively large (approximately 1.2 mm including

the chorion) they are highly deformable and care needs to be taken during injection to

avoid damage. The post-injection survival rate depends upon a number of factors.

While a healthy embryo can survive the injection better, unhealthy or weak embryos

have much poorer chances of survival. Hence it is essential to maintain a healthy and

productive breeding stock of fish which are mated at least periodically. Fishes which

have not been mated for weeks often produce no eggs or eggs of poor quality. Post-

injection care and maintenance also plays a crucial role in affecting the survival rate.

Greater survival of the embryos post-injection was not only important for dosage and

toxicology studies but also necessary to get more living cells from which enough

metaphases could be harvested to produce statistically acceptable Q-FISH studies. In

order to compare toxicity profiles the zebrafish embryos were divided into three groups

and injected with HT54 (the telomere encoding circular DNA), SCR54 (the scrambled

DNA) and 0.25% phenol-red respectively. All together, approximately 250 embryos

were injected in each experimental set (all the three groups taken together). On an

average we observed slightly lower survival rate 24hr post-injection for the embryos

that were injected with DNA compared to the control group injected with phenol-red.

However there was no significant difference in survival rate between the groups

injected with telomere-encoding DNA and scrambled DNA. We also observed a

concentration dependence on the survival rate. Higher concentration of injected DNA

was found to lower the survival rate. Based on these studies we determined that 0.2µM

final concentration of DNA within the zebrafish was the maximum concentration of

37

DNA that could be injected without significantly affecting the survival and generation

of sufficient metaphases for subsequent Q-FISH studies

Final Concentration of

Circular DNA within the

embryo (µM)

Survival Percentage of

one day old embryos

post-injection

Average number of

metaphase spreads

obtained per slide

0.05 62 % 17

0.1 59% 15

0.2 58% 15

0.4 47% 8

0.5 30% 3

Table 1. Concentration dependent survival rate and success at generating

metaphases for subsequent Q-FISH analysis. The survival rates calculated here are

for 80 embryos for each set of experiments.

2.21 Q-FISH on zebrafish metaphase spreads

In order to determine telomere length using Q-FISH, the metaphase spreads fixed on

glass slides were hybridized with telomere specific PNA probes. Unbound probes were

washed away and the slides seen under microscope. Only slides that were washed and

hybridized on a single day under identical conditions were compared. In order to reduce

photo-bleaching of probes an antifade reagent was used. Since the image acquisition

time was kept constant over all the experiments any errors due to photo-bleaching were

38

not expected. The data from the images were processed by a software called TFL-Telo

provided by the Lansdorp lab.

The following steps were used for Q-FISH analysis of all the metaphase spreads

obtained from zebrafish. After the slides containing metaphases have been dried and

aged they were treated with 1(x) PBS for 5 min and then fixed with 4% formaldehyde

in PBS for 2min. They were then washed with 1(x) PBS again for two times over a

period of 5min each and then stored in a jar containing pepsin solution for 10 min at

370C. The slides were removed from the chamber and fixed again in 4% formaldehyde

and then dehydrated for 2min with cold (-200C) solutions of ethanol: water (75:25)

followed by ethanol: water (85:15) and finally with 100% ethanol. 200µL of probe

solutions were made by mixing 140µL deionized formamide, 37µL of water, 20µL of

Sigma Blocking Buffer (casein-based 10x), 1µL of Tris-HCl (pH 7.4) and 2µL of stock

PNA probe (300µg/mL). 15µL of the probe solution was applied to a cover slip and a

slide was placed over the hybridization solution and incubated at 860C for 4min. After

gradually cooling the slides to room temperature the cover slips were removed by

dipping the slides in a wash buffer I (50mL of 1M Tris-HCl, pH 7.4 + 50mL 1.5M

NaCl + 0.5mL Tween-20 + 400mL water) for 10min . This was repeated and then the

slides were washed twice for 10 min each in a wash buffer II (5mL 1M Tris-HCl, pH

7.4 + 350mL of deionized formamide + 5mL 10% BSA +140mL water). After they

were washed the slides were once again dehydrated with cold ethanol in the same way

as before. Once the slides were dry, 15µL of Vectashield Antifade/DAPI solution

(Molecular Probes) were added to each slide. The slides were then covered with thin

coverslips and seen under the microscope.

39

The Q-FISH analysis was performed following guidelines recommended by Lansdorp

lab70

. A Nikon fluorescence microscope was used to acquire images of the slides. FITC

filters were used to capture the green fluorescence of the telomere probes and DAPI

filters were used to capture the blue signal of DAPI. Since the telomere signals were

weak they were captured over a longer period of time (30s) compared to the DAPI

signals (2s). The captured images were saved in 8-bit grayscale TIF format and

processed by the TFL-Telo software provided by the Lansdorp lab.

DAPI signals that didn‟t co-localize with telomere signals were ignored as non-specific

binding events. It was assumed that the lengths of the telomeres were linearly related to

the integrated fluorescence intensity values70

. Since each slide contained 10 to 15

metaphases one would expect 2000 to 3000 telomere signals since zebrafish have 25

pairs of chromosomes. However we always observed lower number of telomere signals

because of irregular spreading of chromosomes wherein some telomere signals were

not accounted for. The median telomere lengths were used for comparison instead of

the mean lengths in order to avoid errors introduced by extreme values.

Previous studies as well as our own experience had revealed significant differences

between measurements of same metaphases performed on different days. To avoid the

day to day error that could have been introduced due to variations at different stages of

the protocol, only metaphase spreads fixed and incubated on the same day were

compared. In order to overcome inaccuracies introduced by variations in lamp

40

intensities the fluorescence signals could be calibrated against fluorescence of beads of

defined size or plasmids containing defined number of telomeric sequences. However

for our studies it was not necessary since we were comparing the telomere lengths and

not measuring their absolute values.

2.22 Telomere length of 24hr old zebrafish

In order to estimate the telomere length in 24 hour old zebrafish, they were compared

with cell-lines of known telomere lengths. Two mouse lymphoma cell lines, LY-R and

LY-S, with long and short telomeres respectively were used as standards of

comparison. It is known that LY-R cell lines have telomere lengths representative of

mouse chromosomes and estimated to be about 48kb long. LY-S cells on the other

hand, have much shorter telomeres in the range of 7kb. It has been found that telomere

lengths in these cell lines are quite stable over a period of many months72

. These cell

lines were obtained from cell cultures maintained in the lab (Lucian Orbai) and

subjected to Q-FISH analysis using the protocol mentioned earlier. Further validation

of the method was obtained by performing Southern Blot on these cell lines.

Both Q-FISH and Southern Blot showed that one day old zebrafishes have telomere

lengths in between the two cell lines. In other words the telomere length was

somewhere between 7kb and 48kb. This data was consistent with later reports on

zebrafish telomere lengths which determined the mean zebrafish telomere length to be

15-20kb long in embryos and larval fish as well as young adult fishes73

.

41

Fig. 11. Top: Q-FISH fluorescence distribution of murine lymphoma cells, LY-S (7Kb), LY-R

(48Kb) and 24 hr old zebrafish embryos. Bottom: Southern blot showing the telomeric

distribution of the same cell lines (courtesy Jie Liu)

42

2.23 Telomere length after injection with telomere encoding

circular DNA

Single cell embryos were injected with HT54, the telomere encoding DNA, and their

telomere length 24 hr post injection determined using the Q-FISH protocol described

earlier. The control groups were injected with scrambled circular DNA, SCR54, which

is not expected to elongate the telomeres. Although we did notice some increase in

telomere length in some studies, they were neither substantial nor reproducible. Indeed

in some studies we actually noticed a decrease in telomere length of the HT54 injected

group compared to the control group. More importantly the observed differences were

very small and within the statistical error for this technique, which according to

established literature is about 10%70

. Since we didn‟t notice any reliable dependence of

the telomere elongation on the concentration of injected DNA all subsequent studies

were conducted at a final concentration of 0.2µM, the maximum concentration with

significant survival rate. At higher concentration the increased mortality made the

generation of good metaphase spreads challenging probably because of lower number

of dividing cells to begin with.

43

Fig 12. Concentration dependence of telomere elongation. The red, blue and green

bars represent the difference between the median fluorescence intensities of HT54

injected embryos and those injected with the control SCR54, in 5 sets of

experiments conducted using 0.05, 0.1, 0.2µM concentrations of HT54

respectively. No clear concentration dependence was observed.

44

Fig 13. Q-FISH fluorescence distribution from two different experiments

conducted with 0.2µM circular DNA.

45

Fig 14. Q-FISH determination of median fluorescence intensity using 0.2µM

circular DNA. No clear trend is observable from 5 sets of data comparing the

telomere length of HT54 injected embryos with SCR54 injected embryos.

46

2.24 Discussion of telomere determination experiments

The absence of telomere elongation in the zebrafish embryos paralleled the finding of

similar studies on human cell lines performed in the lab50

. In these studies, telomere

encoding circular DNA transfected into primary human cell lines, were unable to

produce significant telomere elongation. Although compared to transfection,

microinjecting the DNA into the embryos reduces some of the cellular uptake issues,

the distribution and localization of the DNA could still be significant impeding factors

in the success of these molecules. There is a possibility that the molecules were not

localized in the nucleus in sufficient concentration to interact with the endogenous

telomeres and elongate them. Although the fluorescein-labeled circular DNA seemed to

be uniformly distributed amongst the cells, microscope use could resolve the

distribution in the cellular cytoplasm and nucleus. Such a resolution could be possible

using confocal microscopy which could enable one to determine the intra-nuclear

concentration of the molecules.

However the presence of these molecules in the nucleus does not ensure their telomere

elongation capability in vivo. They have to overcome the capping of telomere by

telomere binding proteins and the secondary structures of G-rich telomeres before they

could anneal to the free 3‟-overhang. Higher nuclear concentration is also desirable

because that would help in competing with alternative structures and complexes at the

telomere ends. It has also been observed that the accessibility of the telomeres to

telomerase mediated elongation is dependent upon the stage in the cell cycle. Late S

and G2 phases have been found to be the only phases when telomeres are elongated74

.

47

In other words the molecules have to be there not only at the right place but at the right

time in order to be able to interact with telomeres.

Even when the circular DNA anneal to the zebrafish telomere chromosome, they would

still need suitable polymerases to reach them and facilitate the elongation of the

telomeres. The availability of polymerases would be dependent among other factors on

the cell cycle stage.

Another important factor is the stability of the circular DNA inside the zebrafish

embryos. The Kool group had found that compared to linear DNAs which are degraded

within minutes in 100% human serum, the circular DNA were stable after 48hrs

(unpublished results). No stability studies have been done with zebrafish plasma but it

would not be surprising to find some endonuclease facilitated cleavage of the circular

DNA within the embryos. Both the stability and accessibility of the circular DNA could

be improved by using different circle sizes and by suitable chemical modifications.

Another complicating factor may be the constitutive expression of telomerase in

zebrafish. It has been reported that telomerase expression gradually increases post-

fertilization and although a 24 hr old zebrafish embryo has significantly lower

telomerase expression than a fully adult fish it is still higher than that observed in mice

and human somatic cells75

. Hence the DNA nano-circles have to not only compete

against endogenous telomerase for binding the telomeres but also had to produce

significant elongation in order to be observable over the telomerase expressed

48

elongation. However in-vitro elongation enabled by these DNA nano-circles had

extended telomeres by several kilo-bases. Hence if significant elongation is caused by

these molecules it should theoretically be possible to detect the difference. Smaller

differences on the other hand, may need much more sensitive techniques of

measurement. Since the DNA circles elongate the 3‟ overhang, a recent method for

quantitative measurement of telomere of the 3‟-overhang called primer/extension nick

translation (PENT)76

could be used to measure small telomere lengthening. This

method can measure telomere length with an error of about 10 bases and has been

shown to measure telomeres as short as 130 bases. Another method called telomeric-

oligonucleotide ligation assay (T-OLA)77

enables the detection of telomeres as short as

24 bases. These methods may prove useful in future studies on both cell cultures as

well as model organisms.

2.24 Summary

In this section, we described our studies on the effect of telomere-encoding circular

DNA on telomere lengths in zebrafish embryos. The circular DNA were microinjected

into single-cell embryos and their dosage and distribution were optimized. Methods for

generating metaphase spreads from 24hr old embryos were optimized and Q-FISH

(Quantitative Fluorescent in situ Hybridization) was used to analyze the telomere

lengths of the zebrafish embryos. Within the errors of margin for our technique, no

clear difference was observed between the treated zebrafish embryos and the untreated

controls.

49

Chapter 3

Investigating the potential of radio-iodinated non-polar

nucleoside analogs in tumor detection and therapy

3.1 Introduction

Radionuclides have been widely used in oncology for treatment and diagnosis. They

are not only useful for evaluating new therapy but also augment conventional

biological therapy when used in combination. While γ-emitters and positron emitters

have been largely employed to detect tumors through CT scan and PET scan

respectively, α and β-emitters have been mostly developed for therapy78a

. Positron

emission Tomography (PET) is particularly useful as most metabolic and tumor-

targeting molecules can easily be labeled with positron emitting isostopes78b

like C11

,

N13

, O15

and F18

. Current clinically useful therapeutic agents are mainly β-emitters.

Molecules containing radioisotopes of I131

, P32

, Sr89

, Y90

either by themselves or

conjugated to antibodies are used to target tumors for systemic therapy78c,f

.

While for large solid tumors the highly penetrating β-emissions would still be highly

preferable, they may not be ideal for targeting small clusters of tumor cells78b.d

. Auger

emitting radionuclides have recently emerged as an attractive alternative to β-

emitters. The auger effect arises when rearrangement of an inner-shell vacancy in

these nuclides results in a loss of orbital electrons and low energy X-rays. Auger

electrons provide high linear energy transfer (LET) of 4-26 keV within a very short

range of less than 1µm78e

. Hence, in contrast to α and β-emitters, auger emitters have

low toxicity but strong potency once they get in close proximity to the DNA or get

50

incorporated into the DNA of the target cells. Compared to β-rays the auger effect is

also less sensitive to hypoxic environment which is a major cause of radiotherapeutic

failure of β-rays. Since they introduce more double strand breaks in DNA, their

biological efficacy is higher than that of β-emission. Besides producing DNA double

strand breaks the auger energy also produces radicals. These freely diffusing

intracellular radicals could further damage the DNA.

Another advantage of using auger emitters is that increased mutation and decreased

survival rates in cells which are themselves not irradiated but have irradiated neighbors

have been observed in vivo with I125

treated cells. Such an effect is called the by-stander

effect and would be beneficial even if all the cancer cells are not treated with a

radiopharmaceutical.

Besides their potential in diagnosis and treatment of cancer, the auger electron emitters

have also been used to characterize molecular structures. I125

labeled oligonucleotides

of telomeric repeat sequences have been used to determine the structure of the G-

quadruplexes formed by them from the correlation between the double-strand breaks

and the distance from radionuclides80

. The study indicated that both parallel and

antiparallel conformations coexisted in solution, their relative abundance depending

upon the ionic concentration.

3.2 Therapeutically useful Auger emitters

While there are a large number of auger electron emitters, so far only I125

, I123

and Tl201

have been identified as therapeutically useful because of their pharmacologically

suitable half-lives and the amount of auger energy released by them. Auger emitters

51

like Fe55

, for example, have higher radiation energy but their half-life of 2.7 years make

them unsuitable for being used in therapy. On the other hand, In111

which has a half life

of 67 hrs releases only 8% of its energy in the form of auger energy, the rest being

released as photons. Since photons have low energy deposition per µm of penetration,

they are not as significant for therapy. Other than radionuclides, the auger process can

be induced artificially by external beams of ionizing radiation. Ultra-soft X-rays have

been used to create inner-shell vacancies of oxygen atoms in thin films of components

of DNA such deoxy-ribose, thymine, thymidine and thymidine 5‟-monophosphate and

it has been observed that the sugar is more sensitive to auger effect than the base

thymine79

.

3.3 Auger emitters targeting tumor

Since auger emitters are most effective when they are either covalently bound to DNA

or are in very close vicinity, various strategies have been used to target DNA with these

molecules. DNA intercalating agents labeled with I125

have been used to promote

cytotoxicity via the induction of double stranded breaks89

. Dosage and cytotoxicity

profiles of I125

-Hoechst 33258, a bis-benzimidazole which preferentially binds A+T

rich sequences in the minor groove of B-DNA have also been studied90

. Auger emitting

sequence specific triple helix forming oligonucleotides have been used to target MDR1,

a carcinogenic gene in purified DNA and intact nuclei91

. Studies with In111

/I125

-labeled

internalizing antibodies have established that with some carrier molecules internalized

in the nuclei of the tumor cells, incorporation into DNA is not necessary for an

effective therapy92

. Similarly radio-iodinated noradrenaline analog meta-

52

iodobenzylguanidine (MIBG) has been used for imaging and radiation therapy93

.

Although in case of MIBG the therapeutic efficacy of auger emitters is modest and beta

emitting I131

is still the radioisotope of choice.

Fig. 1. Some of the molecules iodinated with I125/ I123 for imaging and therapy. (A) Iodo-

Hoechst 33258 binds DNA in the minor groove (B) Meta-iodobenzylguanidine is used for

imaging and therapy

3.4 Radiolabeled 5-Iodo-2’-deoxyuridine (*IdU)

Auger emitting nucleoside analogs have been developed taking advantage of the fact

that nucleosides get incorporated into DNA during the synthesis phase of cell. Of these

I125

/I123

labeled iodo-deoxyuridine is probably the most widely studied. The compound

where the 5-methyl group is replaced by iodine, behaves remarkably similar to

thymidine and is efficiently incorporated into the nuclear DNA of synthesizing cell.

Early studies involving incubation of I123/125

dU with mammalian cells in vitro has

shown them to be highly cytotoxic when localized in cellular DNA84

. Compared to the

β-emitter I131

dU these molecules were found to be 6-fold more toxic. It has been

observed that mice injected with I125/123

dU containing intraperitonial ascites of ovarian

cancer show 5-log reduction in tumor growth81,82

. When injected intracerebrally into

mice bearing intraparenchymal gliosarcoma these molecules were able able to image

53

tumors very sensitively allowing the visualization of tumors as small as 0.5mm in

diameter85

. Furthermore the survival of the animals was significantly enhanced by

injection of these molecules. Formulations are available of the radiolabeled nucleoside

along with its stannyl-precursor which can be manipulated to maximize the tumor to

non-tumor uptake by up to 6-7fold83

. Methotrexate (MTX), a thymidylate synthase

inhibitor has also been found to substantially enhance the uptake of human cancer cells

in vitro (9-fold) and also improves the tumor to non-tumor ratio in tumor bearing

rats86,87

. Intra-arterial injection of I123

dU in patients with liver metastases from

colorectal cancer has resulted in rapid accumulation of radiolabeled IdU in tumor cells

and metastases being clearly visualized by scintigraphy. More importantly no

significant uptake was observed in bone marrows or other normal dividing tissues88

.

However the use of radiolabeled iodo-deoxyuridine in vivo is problematic for a number

of reasons. Rapid hepatic dehalogenation reduces their physiological half-life and

therapeutic distribution in cancer cells94

. There is also the possibility of uptake of the

radiolabeled nucleoside by actively dividing normal cell renewal systems like bone

marrow and gut resulting in unwanted cytotoxicity. The cell-cycle dependent

incorporation of the nucleoside means only tumor cells in the S-phase would

incorporate these molecules into their DNA, precluding the labeling of the entire tumor

cell population. This restriction is generally overcome by using osmotic pumps

delivering IdU continuously over several days covering at least two or three cell cycles.

Other than catabolism, the competition from endogenous thymidine could also reduce

the rate of DNA incorporation. Thymidine synthesis inhibitors have been used with the

aim of augmenting the DNA incorporation of radio IdU through salvage pathway.

54

Different thymidylate synthase inhibitors like 5-fluoro-2‟-deoxyuridine (FdU) and

methotrexate have been used to improve the incorporation rates of IdU up to five

fold95,96

.

Fig 2. The structures of (A) 5-Iodo-2’-deoxyuridine, IdU (B) 5-Fluoro-2’-deoxyuridine, FdU

Other than reducing competition from endogenous thymidine, the inhibition of

thymidylate synthase has been found to trigger an up-regulation of nucleoside

transporter proteins as well97

. This should further favor the uptake and incorporation of

exogenous nucleosides. This was observed when pre-treatment of patients with liver

metastases of colorectal cancer with FdU and folinic acid98

enhanced the uptake of IdU

by 72%. Some authors have suggested locoregional administration for overcoming the

stability and distribution issues but this approach is impractical for most clinical

settings.

55

3.5 Non-polar nucleoside analogs

C-aryl nucleoside mimics have been studied as potential therapeutic reagents as well.

Designed and developed by the Kool lab99,100

, non-polar hydrophobic isosteres of

nucleosides are close structural, steric and isoelectronic mimics with the natural

nucleosides. The nucleobases are replaced by benzene rings in these analogs, while the

hydrogen-bonding functionalities are replaced by non-hydrogen bonding groups like

halogens and methyl groups. For example, a thymidine mimic would have the carbonyl

groups at 2 and 4-position of the base replaced by halogens such that the shapes of the

bases are maintained. A number of C-nucleosides with a variety of 5-substituted

derivatives (H, I, F, CF3, CH=CHI, -C≡CH, -C≡C-I) of 1-(2-deoxy-β-D-ribofuranosyl)-

2,4-difluorobenzene have been synthesized since, for evaluation as thymidine

analogs101,102

. Such modifications of the pyridine nucleobases can bestow new

pharmacokinetic properties and alter the oral bioavailability and metabolic stability.

When incorporated into nucleic acids by enzymatic process these molecules could alter

their structure and function in a way which could be therapeutically beneficial.

Fig. 3. Structures of thymidine (2) and its non-polar nucleoside mimic 1-(2-deoxy-β-D-

ribofuranosyl)-2,4-difluoro-5-methylbenzene (1)

56

It was observed that despite being strongly destabilizing to DNA helices when paired

against natural bases, the triphosphates of the difluoro-analog of thymidine, dF (1) were

inserted into replicating DNA strands opposite adenine by the Klenow fragment (Kf

exo- mutant) of E. Coli DNA Polymerase I with nearly as high selectivity as natural

thymidine triphosphate and only 40-fold lower efficiency103

. It was therefore

anticipated that derivatives of 1 may be cytotoxic to highly proliferating cancer cells

and act as a radiopharmaceutical agent for both imaging and chemotherapy. The C-

nucleosides were also expected to be more stable to pyrimidine phosphorylases

compared to natural nucleosides since they lack the N-glycosidic bond. Compared to 5-

iodo-2‟-deoxyuridine (IdU) which underwent extensive catabolism under physiological

conditions these analogs were expected to be more resistant to deiodination. Moreover

the greater lipophilicity of these molecules could potentially facilitate their blood-brain

barrier penetration improving their bio-availability and distribution profile such that

unreachable targets like brain-tumors could be treated or imaged.

Fig. 4. The structures of (A) 5-iodouracil, IdU (B) 1-(2-deoxy-β-d-ribofuranosyl)-2,4-difluoro-

5-iodobenzene, IdF

57

3.6 Pharmacokinetics and metabolism of IdF (5-iodo-dF)

To assess the potential of 1-(2-deoxy-β-d-ribofuranosyl)-2,4-difluoro-5-iodobenzene

(IdF) as a potential alternative to IdU studies have been conducted to determine its

enzyme stability and physicochemical properties. As expected, compared to IdU (Log

P= -0.95) the C-nucleoside mimic is much more lipophilic (Log P= 2.8)104

. IdF did not

undergo deglycosidation in the presence of E.Coli thymidine phosphorylase compared

to thymidine which underwent 28% phosphorylsis and IdU which underwent 38%

phosphorylation under the same incubation conditions104

. Only 10% degradation was

observed when IdF was incubated in rat plasma at 370C for 24hrs. Thus compared to

IdF, the aryl mimic is stable to both deglycosidation and dehalogenation. IdF had a

short half-life of elimination of 9-12min after intravenous and oral administration to

rats compared to shorter half-life of IdU (7min). It has been shown to have a very high

oral bioavailability of 96%. In order to be incorporated into DNA the nucleoside analog

would have to be converted to triphosphates by cellular kinases first. Hence a study of

their phosphorylation by human kinases was also conducted. IdF underwent

phosphorylation by human cytosolic thymidine kinase (TK1) to about 5% and by

mitochondrial thymidine kinase (TK2) by about 45% relative to thymidine105

.

3.7 Effect of IdF on cancer cells

Since it was envisioned that IdF could replace IdU as a thymidine mimic which gets

incorporated and then destabilizes the DNA and inhibits polymerization, its potential

use in killing cancer cells was also studied. However initial in vitro studies against a

variety of cancer cell lines proved to be disappointing. It exhibited negligible

58

cytotoxicity in the MTT assay (CC50= 10-3

to 10-5

M) compared to thymidine (CC50=

10-3

to 10-4

M)101

. The authors suggested that the failure of the compound to undergo

phosphorylation to 5‟-monophosphate could be a reason for their lack of anti-cancer

activity. In order to bypass the kinase mediated mono-phosphorylation step they

designed 5‟-O-cycloSal-pronucleotides. This lipophilic uncharged inactive masked 5‟-

O-phosphate derivative of the nucleoside was expected to penetrate the cell and release

Fig. 5 The cyclosaligenyl-phosphotriester undergoes hydrolysis under physiological

pH conditions to produce the mono-phosphate of IdF

the bio-active mono-phosphate via a pH driven mechanism. However this compound

continued to exhibit weak cytotoxicity against cancer cells and showed marginal

improvement in potency (CC50= 10-5

to 10-6

M) compared to the reference compounds

IdF and IdU which exhibited CC50 in the range of 10-3

to 10-5

M106

.

59

There could be a couple of reasons why this kinase-bypass strategy failed to work. It is

possible that subsequent phosphorylations of the monophosphate to di- and

triphosphate is rate limiting. Alternatively, the triphosphates may not be incorporated

into the DNA efficiently enough to cause chain-termination and cytotoxicity. In this

respect a study conducted by the Kool lab about the size-dependence of the polymerase

facilitated incorporation of the non-polar thymidine mimics could explain the latter

hypothesis. Using a series of gradually expanding thymidine analogs (Fig. 6) by using

halogens of increasing size, F, Cl, Br, I instead of oxygen the Kool group was able to

probe the steric effects on efficiency and fidelity of polymerase107

.

Fig 6. The series of non-polar analogs of thymidine with increasing size from dF to dI [Ref

107: Proc. Natl Acad. Sci. 2005; Reproduced with Permission]

Conducting kinetic studies with DNA Polymerase I (Klenow fragement, exo-) the

group observed that the polymerase was very sensitive to even sub-angstrom difference

in sterics. The replication efficiency against adenine increased from dH to dF and

60

peaked at dL (the dichloro derivative) and then decreased as the size of the base

increased further. Interestingly both fidelity and efficiency showed the same trend with

maximum fidelity observed with the dichloro-analog.

Fig.7. Histogram of nucleotide insertion efficiencies vs. varied base pair size. Steady-state

efficiencies (as Vmax/KM) using DNA Pol I (exonuclease-deficient) are shown on a log

scale.[Ref 107: Proc Natl Acad Sci 2005; Reproduced with Permission]

Based on these observations one could postulate that a dichloro-analog would be a

better thymidine mimic to be incorporated into DNA by polymerase than the

corresponding difluoro-analog. Hence we decided to study the effectiveness of

radiolabeled 1-(2-deoxy-β-d-ribofuranosyl)-2,4-dichloro-5-iodobenzene (ICl2PhdR) in

cancer therapy and imaging.

61

3.8 Preparation radiolabeled ICl2PhdR

It is desirable to have a method of synthesis for any radiolabeled therapeutic compound

that is efficient and readily reproducible with minimum exposure to radioactive

reagents in the process of synthesis. Hence ideally the radiolabeling step should be the

last step of the synthesis and it should be rapid, quantitative and the desired product

easily separable. Facile preparation of radiolabeled IdU has been reported in the

literature and involves the demercuration of the corresponding chloromercury

compound ClHgdU108

or destannylation of the corresponding stannyl precursor109

.

However because of the toxicity of any trace mercury that might be contaminating the

product demetallation of the stannyl precursor is preferred.

Fig 8. Pathways of synthesizing radioiodinated nucleosides (PBS=phosphate buffered saline)

62

3.9 Synthesis of 1-(2-deoxy-β-d-ribofuranosyl)-2,4-dichloro-5-

iodobenzene

Following the Kool lab precedence of synthesizing a series of thymidine analogs110

, IdL

was synthesized by coupling the iodo-arene with syloxy-lactone. The 2-deoxy-D-ribose

was oxidized with bromine for 5 days to the corresponding lactone. After neutralization

with AgCO3 the crude oil was reacted with 1,3-dichloro-1,1,3,3-

tetraisopropyldisiloxane for 24 hours. Purification by flash-chromatography produced

3′,5′-O-((1,1,3,3-Tetraisopropyl)disiloxanediyl)-2′-deoxy-D-ribono-1′,4′-lactone as a

colorless oil. In order to couple the 2,4-dichloro-iodo-benzene to the siloxy-protected

lactone it was first lithiated with n-BuLi and then allowed to react with the lactone at -

780C for 3.5 hrs. Following quenching with NH4Cl, extraction with diethyl ether and

concentration in vacuo the crude oil was used used without further purification. It was

reduced with Triethylsilane in the presence of Lewis acid BF3.OEt2 at -780C for 6 hrs to

yield 11% of 1-(2-deoxy-β-d-ribofuranosyl)-2,4-dichlorobenzene after column

purification. The coupling reaction yielded the desired β-isomer as the major product

with about 10% of the α-isomer. The siloxane 3‟, 5‟- protecting group was removed

smoothly with tetrabutylammonium fluoride to provide the nucleoside analog.

Iodination of the free nucleoside to produce the 5-iodo-analog however, required very

forceful conditions. The dichloro-analog was treated with 10 equivalents of N-

iodosuccinimide in the presence of CF3CO2H to produce the 5-iodo-analog in 63%

yield after column purification. In order to convert this to the stannyl-precursor needed

for radioiodination, the iodo-analog was heated with tributyl-tin in the presence of

63

catalytic amount of Pd(PPh3)4 for 2 days. Column purification provided the stannyl-

compound in 78% yield. Radioiodination was done by the Kassis lab by treating the

stannyl-compound with radioactive NaI125

in the presence of Iodogen. (Synthetic

scheme is shown in the next page)

Fig 9. Synthetic scheme for the synthesis of radiolabeled 1-(2-deoxy-β-d-ribofuranosyl)-2,4-

dichloro-5-iodobenzene ( ICl2PhdR)

64

3.10 Stability and pharmacology of ICl2PhdR

The Kassis group studied the stability of the radiolabeled ICl2PhdR and found both the

labeled and the unlabeled iodo-compound quite stable in mouse and human serum (Fig

10, 11). Male nude mice (n = 10) were injected subcutaneously with 2 x 106 LS174T

cells. Once the tumors became ~0.5 cm in diameter (within ~10 days), each mouse

received an intravenous injection (tail vein) of 100 µl saline containing ~5 µCi of

125ICl2PhdR. The animals were killed 1 h (5 mice) or 24 h (5 mice) later. The tumours

and blood, as well as various organs and tissues (heart, lungs, liver, stomach, spleen,

small intestine + content, large intestine + content, kidneys, thyroid, skin, muscle, and

tail), were dissected, weighed, and their radioactive contents determined in a gamma

counter. The percentage injected dose per gram (%ID/g) of tissue was then calculated

and plotted. However as shown in Fig 12 and 13 on the basis of %ID/g it was observed

that the radiolabeled analog didn‟t localize preferentially into the tumor. Instead as is

observed for most iodinated compounds significant localization took place in the

thyroid gland.

65

Fig. 10 125ICl2PhdR(15 μL) was incubated in 100 μL of human serum at 370C (courtesy Kassis

lab)

66

Fig. 11 125ICl2PhdR(15 μL) was incubated in 100 μL of human serum at 370C (courtesy Kassis

lab)

67

Fig 12. Distribution of 125

ICl2PhdR in tumor-bearing nude mice 1hr after a single

intra-venous injection (courtesy Kassis lab)

68

Fig 13. Distribution of 125ICl2PhdR in tumor-bearing nude mice 1hr after a single intra-venous

injection (courtesy Kassis lab)

69

3.11 Discussion of tumor-imaging experiments

As indicated by the radioactivity measurement studies, the dichloro-analog failed to show

significant localization into the mouse tumor. The increase in radioactivity in thyroid

from 4% ID/g at 1hr to approximately 400% ID/g at the end of 24hrs could indicate

metabolic dehalogenation of the compound. However given the initial stability studies in

human and mouse serum where it was found to be 100% stable this would be unexpected.

In a recent study on the biodistribution of the difluoro-analog IdF persistent stomach and

thyroid radioactivity was observed in Balb/C mice111

. The authors suggested that the

actual amounts in thyroid and stomach were indicative of deiodination. Another

interesting observation made in this study was the time-dependence of tumor retention.

Although the retention of IdF in tumor was low, it peaked to 5% ID at 1-2hrs and then

dropped to half in 4 hrs and was negligible in 24 hrs. In comparison the tumor uptake of

IdU was steady at 5% ID for the entire study period. Dehalogenation of C-nucleosides

have been observed previously with 1-(2-deoxy-β-d-ribofuranosyl)-2,4-difloro-5-

[F18

]fluoromethyl-benzene which was rapidly and extensively defluorinated in vivo

yielding high radioactivity concentrations in bone112

. However the mechanism of

dehalogenation of C-nucleosides in vivo is still not clear. Compared to 5-iodo-uracil

which could facilitate dehalogenation by directing the uracil-ring electrons to the C-5

position, the 5-iodo-C-nucleosides are fully aromatic and therefore expected to be much

more resistant to C-I cleavage.

The low uptake of the dichloro-analog could also be a consequence of low

phosphorylation by cellular kinase in the proliferating tumor cells. In a recent study

70

conducted by the Kool lab113

it was observed that although TK1 doesn‟t efficiently

phosphorylate the C-nucleosides, the difluoro-analog of thymidine was much preferred

over the dichloro-analog as a substrate for the mitochondrial enzyme, TK2 and was

comparable in efficiency to natural thymidine. Hence a kinase-bypass strategy involving

prodrugs could be much more successful in case of the dichloro-analogs which are much

better substrates for DNA polymerase.

3.12 Summary

In this section we described our studies evaluating the potential of non-polar isostere of

thymidine 1-(2-deoxy-β-d-ribofuranosyl)-2,4-dichloro-5-iodobenzene as a tumor tracer.

Studies conducted in nude mice following intravenous injection showed that these

molecules are not selectively taken up by the tumor cells. Although these observations

appear to preclude the future of this molecule as a cellular proliferation imaging agent its

toxicity against proliferating cells and viruses should still be further ascertained. Targeted

prodrugs strategies involving this molecule might prove to be useful in tumor therapy.

71

Chapter 4

Investigating the steric and electronic discrimination of

deaminated and oxidized bases by a novel binding site of

polymerase from Pyrococcus Furiosus (Pfu)

4.1 Introduction

The stability and integrity of DNA is constantly threatened by environmental agents

like UV light or irradiation or by chemical oxidants or alkylating reagents. An accurate

read-out of DNA is necessary for the generation of mRNA and ultimately the proper

production of proteins. Hence DNA mutation is an important factor inducing

carcinogenesis and ageing. It is estimated that each day a human cell faces about 104

depurination events and hundreds of deamination events114

. However DNA is the

principle carrier of genetic information and hence the cellular machinery is constantly

at work to protect it from unwanted mutagenesis. The significant rates of hydrolysis,

oxidation and non-enzymatic alkylation are countered by specific DNA repair

processes.

4.2 Deamination of nucleobases

In addition to the inherent instability of the glycosidic bond, the DNA bases are also

vulnerable to hydrolytic deamination mostly targeting cytosine and 5-methyl-cytosine

bases114b,c

. The mechanism involves attack of hydroxide on the neutral base or by water

attacking the N3-protonated base115

(Fig 1). The resulting formation of uracil/thymine

upon replication, leads to the incorporation of adenine producing a G-C to A-T/U

72

transmutation in half the progeny. It has been revealed by using sensitive genetic assays

that cytosine deamination in double-stranded DNA has a half life of 35,000-80,000

years at a pH of 7.4 at 370C while a more solvent accessible base in single stranded

DNA is deaminated faster (t1/2=200 yrs)115

. At 700C the deamination occurs at a much

faster rate, making it very significant factor for hyperthermophilic archaea (t1/2=18yrs).

Interestingly, 5-methy-cytosine bases are deaminated 2-3 times faster than unmodified

cytosine115

. The effect is further magnified by the disparate rates of repair. In bacterial

and eukaryotic genomes the deaminated cytosine is rapidly excised by the abundant

uracil-DNA glycosylase to generate an abasic site which is efficiently corrected. This

enzyme however cannot act on thymine and the G-T mismatch is instead repaired by

the mismatch-correction process which is slower than the uracil correction process.

Thus methyl-cytosine residues end up becoming mutational hotspots. Sequencing of

tumor suppressor p53 gene illustrates this very well. It was observed that the cytosine

residues that were methylated had undergone mutation both in the normal and tumor

tissues, indicating that 5-methyl-cytosine may act as an endogenous mutagen and

carcinogen116

.

Fig 1. Mechanism of deamination of cytosine and 5-methyl-cytosine [Ref 115: Chemical

Research in Toxicology 2009; Reproduced with Permission]

73

Compared to cytosine, adenine is deaminated much slower at about 2-3% the rate of

cytosine deamination115

. The resulting hypoxanthine prefers to pair with cytosine rather

than thymine causing a mutagenic transition. The rate of deamination of guanine has

not been accurately determined yet but is assumed to be similar in rate or even slower

than adenine deamination. Xanthosine also encodes for cytosine although with reduced

specificity. In addition the xanthosine glycosyl bond with deoxyribose is particularly

susceptible to spontaneous hydrolysis116

.

Fig 2. The DNA nucleobases and their deaminated products

74

4.3 Oxidation of bases

Cells, particularly those growing aerobically are constantly exposed to endogenous

oxygen and free radical species. The hydrogen atoms on the deoxy-ribose sugar are

susceptible to abstraction by the hydroxide free radical based on their steric

accessibility117

which is H5‟ > H4‟ » H3‟ ~ H2‟ ~ H1‟. While the addition of hydroxide

radical to the C-5 of thymine produces various thymine derivatives like thymine glycol,

guanine is the major target of oxidative damage. The C-8 position is the primary

position of attack yielding a redox-ambivalent nucleobase radical that can undergo

either one electron reduction to produce formamidopyrimidine or one-electron

oxidation to produce 8-oxo-7,8-dihydroguanosine (Fig 3). 8-oxo-7,8-dihydroguanosine

base pairs with adenine preferentially over cytosine and hence is mutagenic. While 8-

oxo-7,8-dihydroguanosine and formamidopyrimidine are produced in equal quantities

by reaction with hydroxide radicals, the former is of greater interest because of its

direct mutagenic effect.

Fig 3. The mechanism of attack of guanosine by hydroxide radicals [Ref 115: Chemical

Research in Toxicology 2009; Reproduced with Permission]

75

4.4 DNA repair

Given the implications of DNA damage in metabolic disorders and carcinogenesis the

stability of the genome is under constant surveillance. To counter the continuous threat

posed to DNA by endogenous and environmental agents, cells have evolved several

systems that detect DNA damage, signal their presence and facilitate their repair.

Although the responses differ according to the lesion being remedied they do have a

common general program. While some lesions are fixed directly by a single protein

mediated repair most have to be remedied by a sequence of events catalyzed by

multiple proteins. In mis-match repair (MMR)118a

the mis-match base on the daughter

strand is recognized which is followed by its excision and repair by nuclease,

polymerase and ligase enzymes. Nucleotide excision repair (NER)118b

systems

recognize UV induced damages like thymine dimers and 6-4 photoadducts and work in

two sub-pathways that differ in the mechanism of lesion recognition: transcription

coupled pathways which specifically recognize lesions blocking transcription and

global-genome nucleotide excision repair. DNA double strand breaks are by-passed by

either homologous recombination or non-homologous end joining mechanisms118c,d

.

Base excision repair (BER) pathways, on the other hand, target bases recognized by

specific enzymes called DNA glycosylases115

. The lesions removed from DNA by BER

include uracil, N-alkylated purines, 8-oxo-7,8-dihydroguanine, thymine glycol and

many others. Besides repair pathways, the cells also protect their nuclear genome from

oxidative damages by maintaining poor oxygenation of the nucleus. The delegation of

oxygen metabolism to mitochondria has probably been evolved to protect the nuclear

DNA from damaging oxidative metabolism.

76

4.5 Base excision repair (BER)

Both modified bases and AP (apurinic/apyrimidinic) sites are removed by base excision

repair pathways which follow a general scheme shown in Fig. 4. AP sites can be

introduced into DNA by either non-enzymatic hydrolysis of sugar-base bond or by the

various DNA glycosylases which recognize different modified bases116

. For example,

excision of deaminated cytosine( uracil) by DNA glycosylase produces a base-free

deoxyribose-phosphate moiety. This is followed by an endonuclease mediated single-

strand break. After the generation of the 3‟-hydroxyl and 5‟-phosphate ends by the

phosphodiesterase DNA polymerase uses the opposite strand to template the insertion

of the proper base. Ligase then joins the two segments of the strand.

The inactivation of E. Coli fpg (Mut M) gene encoding the DNA glycosylase which

recognizes 8-oxo-7,8-dihydroguanine leads to a 10-fold increase in the spontaneous

mutation frequency118

. The same relative increase in mutation is observed in E. Coli

ung mutants which are unable to cleave uracil from DNA. It seems that hydrolytic

deamination of cytosine and oxidation of guanine to 8-oxo-guanosine are spontaneous

directly premutagenic events in the living cells and they occur at similar frequencies.

4.6 Stability and repair of DNA in hyperthermophilic archaea

The existence of microorganisms at high temperatures raises interesting questions about

the temperature limits of life sustaining metabolic processes. Since the intracellcular

contents of these microbes cannot be insulated from the environmental temperature

they must have adapted to function under these extreme conditions. In fact most of the

77

enzymes isolated from the hyperthermophiles have been found to be highly

thermostable. While enzymes that function at temperatures of 1300C are now well

established, some small proteins can even function at temperatures as high as 2000C

119.

Hence it appears that intrinsic enzyme stability may not be a limiting factor to the

survival of these hyperthermophiles. A more relevant question might be the capacity of

these organisms to cope with the extensive degradation of DNA primary structures that

could occur at such high temperatures. The rates of hydrolytic depurinations and

cytosine deaminations are significantly enhanced at higher temperatures. From in vitro

experiments it has been estimated that DNA above 1000C undergoes depurinations and

cytosine deaminations 3000-fold faster than DNA at 370C

114. In other words the

ordinary problems of DNA maintenance are magnified in hyperthermophiles. Hence in

order to maintain their genomic integrity hyperthermophiles need to have some passive

protective mechanisms against DNA damage or a highly efficient DNA-repair system.

Histones are known to provide some passive protection to the archaeal genome from

radiation induced DNA breaks but even at very high histone and salt concentration,

22Gy of irradiation, a relatively small dose, has been found to generate one single-

strand break per 4.36 kbp plasmid124

. It has also been hypothesized that reverse gyrase

enzymes maintain the DNA in positively supercoiled topological conformation

providing it some resistance to uncoiling at high temperature. But these factors by

themselves are not sufficient to maintain the genomic integrity of hyperthermophiles.

Thus evolutionary and physiological considerations argue that studying the

hyperthermophilic archaea would enable us to learn new molecular aspects of DNA

stabilization and repair. So far, the investigation of these prokaryotes has revealed a

78

number of genes and enzymes consistent with the known mechanisms of base excision

repair and trans-lesion repair. The enzymes related to the base excision repair include a

number of glycosylases including a uracil-glycosylase120

whereas trans-lesion synthesis

repair enzymes include a number of Y-family DNA polymerase enzymes121

. Unusual

and novel enzyme functions have also been observed. For example, type 1B DNA

Polymerase has been found to exhibit AP lyase activity122

. A new class of polymerase

was discovered when it was found that a single sub-unit polymerase from Sulfolobus

exhibited both ATPase and DNA primase activities123

. What is very surprising is that

all the genomes of the hyperthermophilic archaea that have so far been sequenced lack

key genes of both nucleotide excision repair and base mismatch repair pathways which

are otherwise highly conserved in biology.

4.7 Archaeal polymerases are inhibited by uracil

It was observed that when UTP was used instead of TTP to minimize carry-over

contamination in PCR, archaeal polymerases showed very poor performance.

Compared to the archaeal polymerases bacterial thermostable polymerases like the

enzymes from Thermus aquaticus were unaffected by UTP. It was later discovered that

archaeal polymerases are inhibited by DNA containing uracil which bound tightly to

such enzymes125

. It was recognized that archeal polymerases were unable to replicate

beyond the template strand uracil and were stalled 4 bases ahead of them126a

. Similarly

recognition of hypoxanthine, which is the deaminated product of adenine, was later

reported first with polymerase from Sulfolobus solfataricus126b

and then with

polymerase from Pyrococcus furiosus which was inhibited but to a lesser extent than by

79

uracil. There could be two ways of explaining this stalling. The „blocking model‟

envisages an actively extending polymerase molecule blocked by another polymerase

molecule bound tightly to the uracil in the template. Alternatively, the „read-ahead

model‟ entails a uracil binding site in the polymerase molecule upstream from the

primer-template junction which upon binding the uracil signals the stalling of the

polymerase. Given that DNA polymerases have a foot-print of at least 10-12 template

nucleotides and the stalling was observed only 4 bases ahead the latter model was

proposed by the Connolly lab to be likely occurring126c

. It was proposed that the N-

terminal domain typically found in archaeal polymerase contained a site responsible for

uracil binding. Using site directed mutagenesis of Pfu-Pol a binding pocket was

identified in the N-terminal domain127

. A Val93Q mutant of Pfu-Pol was found to have

completely lost the uracil recognition capacity while still maintaining the polymerase

activity128

. This mutant could be successfully used in PCR applications using UTP.

Fig. 4. Read-ahead uracil detector. (a) Blocking of a running polymerase actively extending a primer, by a second polymerase bound to deoxyuridine in the single-stranded segment of the template, would give a gap between the last incorporated nucleotide (arrowed) and thetemplate deoxyuridine (U), larger than the ‘‘footprint’’ of the polymerase. (b) In the read-ahead model, specific stalling of a running polymerase at a deoxyuridine upstream in the single-stranded segment of the template would give a gap between the last incorporated nucleotide (arrowed) and the template deoxyuridine (U), smaller than the ‘‘footprint’’ of the polymerase, as is observed (Ref 126a).

80

4.8 Structure of archaeal polymerase bound to uracil containing

DNA

The key question is how does the polymerase binding site discriminate uracil from the

four natural bases including thymidine which differs from it by just a methyl group.

Previously studied enzymes like uracil glycosylases and dUTPases serves as good

models of uracil recognition. Both these enzymes present a binding pocket with specific

hydrogen bonding to uracil and sterical exclusion of other bases. Although features of

the uracil binding pocket seemed to be similar to those of the glycosylases and the

dUTPases, a co-crystal structure of an archeal polymerase with uracil-containing DNA

further detailed the binding site structure and interactions. The crystal structure of

Fig 5. X-ray structural details of the interaction between Tgo-Pol and a primer–template

containing uracil at the +4 position in the template.

The DNA used has the sequence AAUGGAGACACGGCTTTTGCCGTGTC, which forms a snap-

back primer–template containing a (T)4 loop. The single-stranded template region is

underlined. (A) Overall structure with the polymerase domains colour-coded and the DNA

shown in red. Uracil is located in the N-terminal domain (yellow). (C) Amino acids lining the

uracil-binding pocket of Tgo-Pol. The amide nitrogens of Ile114 and Tyr37 form hydrogen

bonds (broken lines) with uracil O-2 and O-4 respectively. Val93 stacks over the heterocyclic

ring of uracil and Pro36, Pro90 and Phe116 are adjacent to the uracil C-5. [Ref 129: Connolly

B.A. Biochem Soc Trans (2009) 37, 1, 65-68. Reproduced with Permission]

81

polymerase from Thermococcus gorganarius with a primer-template containing uracil

at +4 position in the template shows the uracil bound to the predicted binding site in the

N-terminal domain128

. As in uracil glycosylases, the uracil was flipped into the binding

site. Strong interactions are seen with the 3‟ and 5‟-phosphates flanking the uracil and

there are putative hydrogen bonding groups for the O2 and O4 groups as well. Steric

blocking near the C-5 of uracil by Pro and Phe residues provide selectivity against

thymine. A Val93

residue was found to be placed in a position such that a stacking

interaction between its isopropyl side chain and the uracil heterocycle was possible.

This further substantiated the explanation provided by the site-directed mutagenesis

experiments where a V93Q mutant of Pfu-Pol was found to lack the uracil recognition

property. The uracil was found to be recognized in the anti-position.

4.9 Role of hydrogen bonding and shape in base recognition

As mentioned earlier, it is of interest to determine the structural and electronic features

which lead to uracil recognition and flipping. In this respect a comparison with other

well studied uracil recognizing enzymes like uracil DNA glycosylases (UDG) might be

insightful. Extensive structural and biophysical studies have determined that the

pathway of uracil recognition and flipping in UDG consist of three steps130a,b

. The first

step involves the formation of a quick encounter complex with the enzyme in which

uracil is still intrahelical which is followed by a metastable state in which the DNA is

bent but still largely stacked within the DNA. In the last step the base docks into the

enzyme active site and is clamped in place. Previous studies with UDG have shown that

82

the two factors which are important in determining whether an enzyme flips a base into

the active site are its shape and hydrogen bonding properties. To probe the role of these

factors the Stivers lab had studied the interaction of UDG with a synthetic DNA duplex

containing a single difluorophenyl nucleotide(F), which is an excellent isostere of uracil

but contains no hydrogen bonding functionality130c

. They observed that UDG was able

to partially unstack this base from the duplex but due to the lack of hydrogen-bonding

stabilization the enzyme couldn‟t undergo a conformational transition from open to

closed. While the F/A base pair showed just 5 fold lower affinity to the enzyme

compared to the U/A base pair, the T/A base pair showed 28 fold lower affinity. It was

proposed that the difluorophenyl nucleotide attained a metastable unstacked state that

mimicked a previously identified intermediate in the base-flipping pathway of uracil.

While the purine and thymine bases are sterically rejected cytosine is discriminated on

the basis of specific hydrogen bonding in these enzymes.

4.10 Non-polar analogs in investigating the importance of

hydrogen-bonding

In order to determine the role of hydrogen bonding and shape in base recognition by the

uracil/ hypoxanthine binding pocket of archaeal polymerase, non-polar analogs of these

nucleotides developed by the Kool lab were employed. The C-nucleoside, 1-(2-deoxy-

β-d-ribofuranosyl)-2,4-difluorobenzene (Fig 6B),which replaced the C=O bonds

83

Fig 6. Uracil analog difluorobenzene(F) and Hypoxanthine analog fluorobenzimidazole

(Fbim) were used as their shape mimics

of uracil with C-F bonds and the pyrimidine ring with benzene, was considered a very

good shape mimic of uracil. The non-polar mimic of hypoxanthine was designed by

similarly replacing the C=O bond with a C-F bond and the pyrimidine ring by

benzene(Fig 6D). The bond lengths of C-F (1.36 A0) are quite close to that of C=O(1.22

A0) in uracil and hence these analogs are expected to very well maintain the shape of

the nucleosides they are mimicking but lack the Watson-Crick hydrogen bonding

groups.

4.11 Dual recognition of both uracil and hypoxanthine

The fact that the archaeal polymerase recognizes both uracil and hypoxanthine

perplexed scientists because there were not many precedents of an enzyme which

bound hypoxanthine but rejected other purine bases like adenine, guanine and xanthine.

Also considering a tight pocket necessary to reject thymine it was difficult to

84

hypothesize a sterically larger base like hypoxanthine being accepted by the same

binding site. The best characterized enzyme which discriminates both a purine and a

pyrimidine is orotidine 5‟-monophosphate decarboxylase which recognized both 6-aza-

uridine monophosphate and xanthine monophosphate131b

. It accomplished this by

binding them in syn and anti conformations respectively. Hence the Connolly group

proposed that the archaeal polymerases might be using similar mechanism to identify

both uracil and hypoxanthine131a

. By overlapping molecular models of anti-uracil

monophosphate(dUMP) and syn-hypoxanthine monophosphate(dHMP) they showed

that the O4 and O

6 and C

5 and C

2 of dUMP and dHMP were each located within 0.1nm

of each other and could potentially be recognized by the same polymerase elements

(Fig. 7). The cystal structure128

later confirmed that uracil bound in the anti-

conformation in the binding pocket with appropriately located amino acids putatively

forming hydrogen-bonds with O2 and O

4 and providing steric exclusion at C

5.

Fig.7 Structures of anti-dUMP and syn-dHMP drawn with sugar and phosphate overlapped.

dUMP (yellow) dHMP (blue) [Ref 131a: J Mol Biol 2007; Reproduced with Permission]

85

The syn-anti hypothesis also brought up other interesting questions. It is well known

that oxidation of guanine to oxo-guanine occurs at a similar rate as the deamination of

cytosine to uracil and like deamination would be expected to be aggravated at higher

temperature. The translesional incorporation of adenine against oxo-guanine is based on

the rational that 8-substituted purines prefer to adopt syn-conformation over anti. The

steric repulsion between the 8-substituent and the 4‟-oxygen in the anti conformation

makes the syn conformation energetically favorable. Syn-oxoG forms a Hoogsteen base

pair with adenine without affecting the overall structure of duplex DNA132

. Hence it is

intuitive to wonder whether this unique hypoxanthine/uracil recognition pocket has

evolved to recognize more than just deaminated bases but can be also used by the

archaea to identify other mutagenic lesions like oxoguanosines.

In fact overlapping the energy-minimized molecular models (SPARTAN) of syn-

oxoguanosine with anti-uracil, along the C-N glycosidic bond, it is seen that the O6 and

O8 of oxo-guanosine are quite close to O

2 and O

4 of uracil so that they can potentially

hydrogen-bond with the same polymerase amino acids (Fig 8). However there is

additional steric bulk of the amino group at C2

position which could either hinder the

recognition of oxo-guanosine or could facilitate hydrogen bond formation with some

polymerase element. One way of probing the interaction of the 2-substituted amine in

oxoG is by studying a molecule which lacks it. 7,8-dihydro-8‟-oxo-2‟-oxoinosine

(oxoI) is a structural analog of oxoG which lacks the amino group at C2 position. It has

been used to study the interactions of damaged DNA and repair enzymes. These studies

have shown that the exocyclic amine at the C2 position is not essential for repair by

enzymes133,134

. 8-oxo-inosine, on the other hand overlaps very well with hypoxanthine

86

and even provides the additional hydrogen bonding group at O8 position which

hypoxanthine lacked. If hypoxanthine did bind in syn-conformation then syn-oxoI is

very likely to be recognized by the same polymerase elements which recognize uracil

and hypoxanthine. Hence in order to ascertain the validity of the syn-anti hypothesis

and also to determine whether the archaeal polymerase recognized more mutagenic

lesions than just uracil and hypoxanthine we decided to study the interaction of the

archaeal polymerases with oxo-guanosine and oxo-inosine.

Fig. 8 Overlap of molecular models (SPARTAN) of the molecules along the C-N glycosidic

bond (A) Overlap of anti-uridine and syn-inosine (B) Overlap of anti-uridine and syn-

oxoguanosine (C) Overlap of anti-insoine and anti-oxoinosine (D) Overlap of anti-uridine

with syn-oxoinosine

87

4.12 Preparation of DNA sequences for polymerase extension

assays

For primer extension assays, a 24 bases long primer and 44 bases long template

containing the base of interest either 6 or 10 bases upstream of the primer-template

junction were synthesized. Following are the sequences of the oligonucleotides

synthesized:

Primer (24mer): 5‟-GGGGATCCTCTAGAGTCGACCTGC-3‟

Template(44mer):5‟GGAGACAAGCTTGCXTGCCTGCAGGTCGACTCTAGAGGA

TCCCC-3‟ (where the underlined portion is the part of the template complementary to

the primer and X= F, Fbim)

5‟-GGAGACAAGCXTGCTTGCCTGCAGGTCGACTCTAGAGGATCCCC-3‟

(Where X= F, U, Fbim, oxoG, oxoI)

Oligonucleotides were synthesized on an Applied Biosystems Incorporated 394 DNA

synthesizer using standard protocols. Phosphoramidites for the incorporation of oxoG

were purchased from Glenn research while the phosphoramidites of the other modified

nucleotides (F, Fbim, oxoI) were synthesized in the Kool lab. The Fbim containing

sequences were provided by Samuel S. Tan. The oligonucleotides were purified by

polyacrylamide gel electrophoresis and quantitated by UV absorption. Molar extinction

coefficients were calculated by the nearest neighbor method. Values of the extinction

coefficients of the oligonucleotides containing unnatural residues were calculated by

adding the extinction coefficient of the unnatural nucleoside to that of the natural

sequence.

88

4. 13 Synthesis of F-phosphoramidite

Previously developed C-nucleoside synthesis for thymidine isosteres110

was used to

synthesize the difluorobenzene (F) nucleoside. Commercially available 2,4-difluoro-

bromobenzene was converted to its Grignard reagent by treating with Iodine/Mg and

then reacted with siloxy-protected ribonolactone. As in the previously discussed

reaction involving the coupling of aryl-lithiums, the aryl-grignards produced the β-

anomer with high selectivity and comparable yield. The siloxane was deprotected using

tetrabutylammonium fluoride and the free nucleoside was tritylated using standard

conditions. The phosphoramidite was produced by reacting the tritylated nucleoside

with 2-cyanoethyl-N,N,N‟N‟-tetraisopropylphosphoramidite in the presence of

tetrazole (Synthetic scheme shown in Fig 9)

4.14 Synthesis of oxoI-phosphoramidite

A facile one-pot synthesis of 8-oxo-7,8-dihydro-(2‟-deoxy)adenosine in water was

achieved using mercaptoethanol in the presence of triethylamine, following a published

procedure135

. The amino group of oxo-adenosine was then removed by an enzyme

called adenosine deaminase, an essential enzyme in purine metabolism which converts

adenosine to inosine132

. The oxo-inosine thus produced was tritylated at the 5‟-position

using standard tritylating conditions. As in the synthesis of F-phosphoramidite, the 2-

cyanoethyl-N,N,N‟N‟-tetraisopropylphosphoramidite was used to generate the oxo-I

phosphoramidite (Synthetic scheme shown in Fig. 10)

89

Fig. 9. Synthetic scheme for the synthesis of F-phosphoramidite

90

Fig.10. Synthetic Scheme for the synthesis of oxo-I phosphoramidite

91

4.15 Primer extension assays with the polymerase enzyme

The primer (10nM) and the template (20nM) were mixed with hot primers (0.5nM) in

the polymerase reaction buffers provided by the suppliers of each polymerase. They

were heated to 900C and then slowly allowed to cool down to room temperature in

order to facilitate annealing. 0.5 units of polymerase enzyme and dNTPs (1.25mM)

were then added to the reaction mixture to give a final volume of 20µL. The reaction

mixtures were incubated at 720C, the optimal temperature for archaeal polymerasee.

Aliquots of reaction mixtures were taken out at regular intervals and analyzed by

denaturing gel electrophoresis and detected by phosphorimaging.

For positive control, we compared the templates containing the modified bases with

templates containing uracil. If the templates containing modified nucleotides were

recognized then like uracil they should give rise to bands 4 nucleotides downstream of

the modified nucleotide. Negative control was provided by polymerase Thermus

aquaticus(Taq) an enzyme which doesn‟t have the type of read-ahead uracil recognition

property demonstrated by Pfu polymerase but is stalled at the site of incorporation of

the non-polar isostere136

. Both Taq and Pfu are however expected to give full length

products with thymidine and guanosine containing templates which are used as controls

showing full-length extension.

4.16 Results

Difluorobenzene analogs of uracil: When templates containing F at +10 and +6

positions from the primer-template junctions were compared with templates containing

92

uracil we did see some recognition of F by Pfu. Faint bands corresponding to stalled

products 4 bases downstream were evident particularly at shorter time points of the

polymerase reaction but the recognition was not as profound as for uracil (Fig 11).

Compared to thymidine however, Pfu recognizes F (the shape mimic of uracil) better

(Fig 13).

Fluorobenzimidazole analogs of hypoxanthine: When templates containing Fbim at +10

and +6 position from the primer-template junction were compared to templates

containing uracil we observed some stalling 4 nucleotides downstream but even lesser

than that observed with F and significantly lesser than uracil (Fig 12).

Oxo-inosine: Comparing oxo-I containing templates with U containing templates where

the concerned base is 10 nucleotides ahead of the primer-template junction we again

see some faint stalling 4 nucleotides downstream but again it is observed only at lower

time-points of polymerase reaction and is nowhere as profound as the recognition of

uracil by Pfu (Fig 14). As expected control sequences containing thymidine were

extended to full length products under the similar reaction conditions.

Oxo-guanosine: Templates containing oxo-guanosine also demonstrated slight read-

ahead recognition by Pfu polymerase(Fig 15).

93

Fig. 11. Primer-extension assays. Phosphorimaging of radiolabled primer on denaturing

polyacrylamide gel shows extension products on templates F(+10) and F(+6) containing F 10

bases and 6 bases upstream of the primer-template junction, respectively. U(+10) is used as

a control template containing uracil 10 bases upstream of the primer-template junction. As

expected Taq does not show any read-ahead recognition but is stalled by the uracil isosteres

at the site of incorporation. Pfu shows weak stalling as shown by faint bands 4 bases

downstream.

94

Fig 12. Primer-extension assays. Phosphorimaging of radiolabled primer on denaturing

polyacrylamide gel shows extension products on templates Fbim(+10) and Fbim(+6)

containing Fbim 10 bases and 6 bases upstream of the primer-template junction,

respectively. U(+10) is used as a control template containing uracil 10 bases upstream of the

primer-template junction. As expected Taq does not show any read-ahead recognition but is

stalled by the uracil isosteres at the site of incorporation. In fact we also see some full-

length extension products with Taq at longer time points. Pfu shows weak stalling as shown

by faint bands 4 bases downstream at shorter time points.

95

Fig 13. Primer-extension assays. Phosphorimaging of radiolabled primer on denaturing

polyacrylamide gel shows extension products on templates U(+10) ,F(+6), T(+10) containing

U, F and T 10 bases upstream of the primer-template junction, respectively. F, the shape

mimic of uracil is better recognized than T.

96

Fig 14. Primer-extension assays with Pfu. Phosphorimaging of radiolabeled

primer on denaturing polyacrylamide gel shows extension products. Oxo-I(+10),

U(+10) and T(+10) are templates containing oxo-inosine, uracil and thymidine 10

bases ahead of the primer-template junction respectively. While uracil is clearly 4

bases recognized ahead of the primer-template junction, thymine allows full-

length extension. Oxo-I containing template on the other hand shows some

pausing at initial time points but then is then elongated until it reaches the

modified base where it is inhibited strongly. Longer time points (not shown) show

some full-length extension of this template.

97

Fig 15. Primer-extension assays. Phosphorimaging of radiolabeled primers on

denaturing polyacrylamide gel shows the extension products with Pfu. U(+10),

oxo-G(+10), G (+10) are templates containing uracil, oxo-guanosine and guanosine

10 bases upstream of the primer-template junction, respectively. While guanosine

containing template shows rapid full-length extension the template containing

uracil shows profound read-ahead recognition. Oxo-guanosine containing

template doesn’t show significant read-ahead stalling.

98

4.17 Discussion

The weak recognition of the F analog by the uracil-binding pocket compared to the

recognition of uracil as well as the weaker recognition of fluorobenzimidazole analog

demonstrates that hydrogen-bonding is an important discriminating factor in the

recognition of bases by this binding site. Considering that hypoxanthine bound to the

enzyme 1.5-4.5 fold less than uracil131

, the weaker recognition of Fbim compared to F

was not surprising. However compared to the natural bases (T) we do see some stalling

4 bases ahead of the primer-template junction with the difluorobenzene analog (F)

which proves that shape recognition is important but not sufficient for discriminating

the nucleobases from each other (Fig 13)

What is more perplexing is the minimal recognition of oxo-inosine which is exactly the

same as hypoxanthine except for an additional an additional hydrogen bonding

functional group at the C8 position close to the C

2 oxygen of uracil. If uracil binds in

the anti-position as shown in the crystal structure then the syn-anti hypothesis

explaining the dual binding of uracil and hypoxanthine would require hypoxanthine to

bind in the syn-conformation. In such a scenario one would expect syn-oxoinosine to be

bound even better than syn-hypoxanthine since it is sterically almost identical and has

the additional hydrogen-bonding stabilization lacked by hypoxanthine. However if

contrary to the hypothesis hypoxanthine is recognized in the anti-conformation then

this would be thermodynamically unfavorable for oxo-inosine and oxo-guanosine both

of which prefer to be in their syn-conformations. The barrier involved in the syn to anti

transformation may be too high to be compensated by the putative hydrogen bonding

99

stabilization. In fact subsequent crystal structures (unpublished results Connolly lab)

confirmed that hypoxanthine bound in the anti-conformation rather than the proposed

syn-conformation. This clearly explains why we see no recognition of 8-oxo-bases by

this binding site.

4.18 Summary

In this section we studied the steric and electronic features which a novel binding site in

archaeal polymerase Pfu uses to distinguish deaminated bases from natural bases. We

used non-polar isosteric base analogs of uracil and hypoxanthine to determine the

importance of hydrogen-bonding in this binding site. The study shows that hydrogen-

bonding is an important factor in base identification by this binding site. We further

investigated whether the binding site could recognize oxidized bases as well. Using

oxo-guanosine and oxo-inosine we demonstrated that oxidized bases are not very well

recognized by this binding site since it appears to recognize both purines and

pyrimidines in anti-conformation. This makes it thermodynamically unfavorable for

oxidized purines with 8-oxo-groups to be bound in this pocket. It will be of interest to

determine what follows the stalling of replication by the capture of uracil and

hypoxanthine in these enzymes. More structural information and kinetic data is needed

to elucidate how the polymerase active site is switched off by this read-ahead

recognition.

100

Chapter 5

Investigating the importance of shape and hydrogen

bonding in base recognition by DNA dependent RNA

polymerase II

5.1 Introduction

While hydrogen-bonding is a significant contributor to the stability of DNA, its

importance in DNA replication was challenged about a decade ago when it was

observed by the Kool lab that non-hydrogen bonding shape mimics of nucleobases

were able to pair with complementary bases with significant fidelity and efficiency136

.

When thymine analog, difluorotoluene(dF) was used in DNA template, DNA Pol I

(Klenow fragment) was able to incorporate adenine base opposite to it with a specificity

similar to the natural base. dF-triphosphates were similarly inserted against adenine in

the DNA template with high selectivity and efficiency103

. Other high fidelity DNA

polymerases like Taq and T7 DNA polymerases also efficiently incorporated non-polar

bases. Based on these observations, it was proposed that steric-matching was a more

important factor in DNA replication than hydrogen-bonding137

.

5.2 Hydrogen-bonding in RNA polymerases

While the structural aspects underlying fidelity has been extensively investigated in

DNA polymerases, the RNA polymerase fidelity mechanisms remain poorly

understood. As with DNA polymerases it was originally thought that the primary

process ensuring fidelity of transcription was the Watson-Crick base pairing between

101

the incoming nucleotide triphosphate and the DNA base to be copied. However it was

observed that the stability provided by hydrogen-bonding was not sufficient to account

for the observed fidelity in RNA polymerases142

. Consequently it was realized that

there must be other factors which are critical to the fidelity of RNA polymerases.

In the recent past, studies involving hydrophobic base pairs have extended the paradigm

of shape complementariy to RNA Polymerases as well. The Hirao lab used unnatural

base pairs which neither hydrogen bond with natural bases nor with their synthetic

counterpart138

. They are however perfect shape complements of each other. The Ds-Pa

pair was designed to have shapes different from natural bases but have some proton

acceptor groups capable of interacting with the polymerases. In templates containing

these unnatural nucleotides the Ds-Pa complementarity mediated site specific

incorporation of Ds-triphosphates, Pa-triphosphates and modified Pa-triphosphates into

RNA by T7 RNA Polymerase.

Fig 1. The unnatural base pair Ds-Pa is a good shape complementary pair like natural

nucleobase pairs

The Romesberg group also developed base pairs which were selectively transcribed by

T7 RNA polymerase. These bases had complementary shape and packing rather than

complementary hydrogen-bonding140

. When present in a DNA template these unnatural

102

bases produced full-length extension products only in the presence of the cognate

nucleotide triphosphates. Although their fidelity of incorporation was comparable to

natural nucleobases, their efficiency was 20 times lower. Interestingly when dMMO2

and dNaM (Fig 2) were in the template they observed that extension was more efficient

than the synthesis of the unnatural base pairs. This was in contrast with the behavior

generally observed with DNA polymerases which appeared to depend upon the

presence of minor groove hydrogen bond acceptors for extension141

.

Preliminary studies in the Kool lab, also indicated that shape complementarity may play

an important role in base selectivity in RNA polymerases. It was found that

triphosphates of difluorobenzene ribonucleosides which are very good shape mimics of

uracil were incorporated against adenine by E. Coli RNA Polymerase139

.

5.3 RNA Polymerase II

RNA polymerase II is responsible for all mRNA precursor synthesis in eukaryotic cells

and hence is one of the most studied of all the DNA dependent RNA

polymerases145a,b,d

. As the enzyme controlling the first step of gene expression it

essentially regulates all activities of cellular differentiation and development. The

importance of understanding its structure and function was vindicated by the Nobel

prize recognition of Kornberg‟s seminal work in this field145c

. A recent crystal structure

published by the group145d

clearly shows the presence of a trigger-loop unit which

contains a network of NTP recognition elements including an asparagine residue which

helps discriminate deoxyribose triphosphates from ribose-triphosphates by at least

1000-fold. However it is still not very clear how individual bases are paired against the

103

corresponding bases in the template. We believe that structural and kinetic studies

involving modified bases would help in shedding some light on the electronic and

structural features which dictate fidelity and efficiency in RNA Polymerase II. To the

best of our knowledge, there have been no studies investigating RNA Polymerase II

activity using modified nucleobases. Hence we decided to study the importance of

shape and hydrogen bonding in base discrimination by RNA Polymerase II by using

non-polar isosteric mimics of nucleobases.

5.4 Hydrophobic analogs of adenine and thymine

9-methyl-1-H-imidazo[(4,5)-b]pyridine nucleoside analog (denoted as dQ) was

synthesized by the Kool lab as an isoelectronic and isosteric mimic of deoxyadenosine.

It lacked Watson-Crick hydrogen bonding groups but had a minor groove hydrogen

bonding acceptor N, analogous to N3 in adenine and was useful in demonstrating the

importance of minor groove hydrogen bond in extension of the 3‟-end of the primer by

DNA polymerase. While both Q and Z (4-methylbenzimidazole-deoxynucleoside,

which differed from Q by the absence of N3) were both inserted with similar efficiency

the extension rate of the former was significantly higher when placed at the 3‟-end of

the primer143

. In order to study the importance of shape and hydrogen bonding in RNA

Polymerase II we and our collaborator (Dong Wang) decided to study dQ as a non-

polar mimic of deoxy-adenosine. The analog difluorotoluene deoxyriboside (dF) which

is a non-hydrogen bonding isostere of thymidine was used as a thymidine mimic144

.

104

Fig 2. Non-polar nucleoside analogs (dF and dQ) used in this study. Natural nucleosides

shown above for comparison

5.5 Synthesis of sequences for RNA polymerase studies

The Kornberg lab had previously obtained the crystal structure of a transcribing

complex of yeast RNA polymerase II with a 29-residue DNA template, 10 residue

RNA and 14 residue DNA complementary to the template downstream to the RNA.

This structure showed the importance of a key polymerase element called trigger loop

in controlling nucleotide addition to the growing RNA145d

. A similar template

containing the modified base, 2 bases downstream of the RNA-DNA junction was

designed for the studies.

5‟- AU CGA GAG G -3‟ (RNA)

3‟- GTA GCT CTC CTX GCA GAC GAA TAG CCA TC- 5‟ (Template)

5‟-CTG CTT ATC GGT AG-3‟ (Complementary DNA)

Where X= dQ, dF

105

Oligonucleotides were synthesized on an Applied Biosystems Incorporated 394 DNA

synthesizer using standard protocols. Phosphoramidites for the incorporation of dF

were purchased from Glenn research while the phosphoramidite of the other modified

nucleotide, dQ was synthesized in the Kool lab. The oligonucleotides were purified by

polyacrylamide gel electrophoresis and quantitated by UV absorption. Molar extinction

coefficients were calculated by the nearest neighbor method. Values of the extinction

coefficients of the oligonucleotides containing unnatural residues were calculated by

adding the extinction coefficient of the unnatural nucleoside to that of the natural

sequence.

5.6 Synthesis of the dQ-phosphoramidite

Following a previously published method143

, 9-methyl-1-H-imidazo[(4,5)-b]pyridine was

obtained by treating 2,3-diamino-4-methyl pyridine with formic acid in HCl. The base thus

generated was reacted with sodium hydride and coupled to benzyl-protected chlorosugar of

deoxyribose . The major product Q bis-benzoyl-ester was not separated from a minor product

but carried on to the next step where the benzoyl groups were removed using sodium

methoxide/ methanol. Purification using column chromatography provided the desired product

which was characterized by HMBC and by the characteristic intramolecular hydrogen-bond

(which is only possible in this isomer) between the OH 5’ and the N6 of the base. The 5’-DMT

protected nucleoside was obtained using standard reagents and the phosphoramidite was

generated by reacting with 2-cyanoethyl N,N-diisopropylchlorophosphoramidite in the presence

of diisopropylethylamine.(Synthetic scheme in Fig 3).

106

5.7 Extension assays with Pol II enzyme

For addition of rNTPs, transcribing complexes were formed as described earlier with 10

pmol 10-subunit pol II, 120 pmol template, 240 pmol RNA, and 240 pmol downstream

nontemplate DNA, in transcription buffer (TB) . Complexes were incubated with 50

mCi α32

P-ATP (3000 Ci/mmol) to label active elongation complexes at room

temperature. The rNTP specified for incorporation at the subsequent template position

was then added at a final concentration of 25 µM or 500µM. The reaction products

were separated by 18% denaturing polyacrylamide gel and visualized using a

phosphorimager (Courtesy Dong Wang).

107

Fig 3. Synthetic scheme for the preparation of dQ-phosphoramidite

108

Fig. 4 RNA polymerase assays with adenine at the site of incorporation of modified

nucleobase (Courtesy Dong Wang). The reactions were carried out with different rNTP

concentrations of 25 µM and 500µM. The lanes correspond to different rNTP composition(

lane 0: no rNTP, lane 1: α32 P-ATP lane 2: α32 P-ATP, CTP, lane 3: α32 P-ATP, GTP, lane 4: α32

P-ATP, UTP, lane 5: α32 P-ATP, GTP, CTP, lane 6: α32 P-ATP, UTP, CTP, lane 7: α32 P-ATP, UTP,

CTP, GTP). Following are the sequences of the RNA and DNA template:

5’- AU CGA GAG G -3’

3’- GTA GCT CTC CTX GCA GAC GAA TAG CCA TC- 5’

5’-CTG CTT ATC GGT AG-3’

109

Fig. 5 RNA polymerase assays with dF at the site of incorporation of modified nucleobase

(Courtesy Dong Wang). The reactions were carried out with different rNTP concentrations of

25 µM and 500µM. The lanes correspond to different rNTP composition( lane 0: no rNTP,

lane 1: α32 P-ATP lane 2: α32 P-ATP, CTP, lane 3: α32 P-ATP, GTP, lane 4: α32 P-ATP, UTP, lane

5: α32 P-ATP, GTP, CTP, lane 6: α32 P-ATP, UTP, CTP, lane 7: α32 P-ATP, UTP, CTP, GTP).

Following are the sequences of the RNA and DNA template:




110

Fig. 6 RNA polymerase assays with dQ at the site of incorporation of modified

nucleobase(Courtesy Dong Wang). The reactions were carried out with different rNTP

concentrations of 25 µM and 500µM. The lanes correspond to different rNTP composition(

lane 0: no rNTP, lane 1: α32 P-ATP lane 2: α32 P-ATP, CTP, lane 3: α32 P-ATP, GTP, lane 4: α32

P-ATP, UTP, lane 5: α32 P-ATP, GTP, CTP, lane 6: α32 P-ATP, UTP, CTP, lane 7: α32 P-ATP, UTP,

CTP, GTP). Following are the sequences of the RNA and DNA template:




111

5.8 Results

When the non-polar analog of thymidine, dF was placed in the template strand of the

transcribing complex of yeast RNA polymerase II, we see that dA is incorporated

opposite it in the extending RNA (Fig 5). The efficiency of incorporation against the

unnatural base was lower than that against the natural base. The bands corresponding to

dF are visible strongly only at longer time points or higher concentration of rNTPs

(comparing the lanes in Fig 4 and 5). Under forcing conditions full-length extension

products were also visible. On the other hand, the isosteric analog of deoxyadenosine,

dQ was recognized to a much lesser extent. Some insertion and extension was observed

but only at higher concentrations and longer time points (Fig 6). However dF paired

significantly better with ATP than with GTP and CTP (lanes 2 and 3 Fig 4 & 5). This

clearly shows that shape of the nucleobase is an important factor in fidelity of RNA

Polymerase II.

5.9 Discussion

The observation that dF leads to the incorporation of dATP with moderate efficiency

suggests that shape is important but not sufficient to account for the efficiency of

transcription. The slow and inefficient incorporation against dQ in the template could

be explained on the basis that dQ is not a perfect shape mimic of dA. The steric bulk of

a C-H bond(1.1 A0) at the analogous N-1 position, lies in the base pair face of the

analog and may sterically clash with the N-3 of incoming thymidine base. Studies with

DNA polymerases have shown that sub-angstrom increase in the steric bulk at the base

pair face of the base could lead to significant drop in efficiency and selectivity107

.

112

Hence the lower efficiency with dQ could be due to steric effects. The observed

reduced efficiency with dQ is consistent with previous studies involving A-family

polymerases146

.

However these are preliminary studies and the efficiency inferences from them are at

best qualitative. More kinetic and structural information is needed. Studies need to be

performed to determine the efficiency of incorporation not only when the unnatural

base is in the template strand but also when it is an incoming nucleotide triphosphate.

Studies involving base discrimination need to be conducted to determine the

importance of shape and hydrogen bonding on the fidelity of RNA polymerases. Other

types of RNA polymerases including bacterial and human RNA Polymerases also need

to be studied to see if there is a generality in the observations. Indeed studies on T7

RNA polymerase and E. Coli RNA polymerases are currently going on in the Kool lab

and would be useful in furthering our understanding.

5.10 Summary

There are several factors which can affect the selectivity and efficiency of nucleotide

incorporation, including sterics, hydrogen boding and stacking interaction. In this

chapter we studied the importance of sterics and hydrogen bonding using two non-polar

analogs. We have demonstrated that yeast RNA pol II catalyzes the incorporation of

nucleotides against the thymidine analog, dF, with moderate efficiency and against the

adenine analog, dQ, with a much lower efficiency. From these preliminary studies we

conclude that although shape is an important factor, base-pair hydrogen bonding is also

a significant factor in transcription by RNA polymerases.

113

Chapter 6

Development of polyfluorophores on a DNA backbone that

could be used as sensors of small molecules in the vapor

phase

6.1 Introduction

There is an increasing need for convenient detection of gases and vapors. It is of

importance in environmental monitoring, industrial quality control, in medicine and at

security checkpoints161,162

. However conventional analytical techniques using optical

spectroscopy and gas chromatography are time-consuming, expensive and seldom used

for real-time detection163

. Although sensor molecules have been designed and studied

for decades for solution sensing, relatively few molecular approaches have been

developed for optical detection of small molecules in the vapor phase.

Conjugated polymers have emerged over the past decade as sensitive chemical and

biological sensors147-149

. Fluorescence quenching in conjugated polymers has been used

for the detection of nitro-aromatics150

. Dye-labeled DNA, a bio-polymer, has also been

used for solid phase detection of gases through the corresponding changes in

fluorescence properties upon interaction of the sensors with the analytes151

. At the same

time, colorimetric detection of vapors using arrays of cross-responsive nanoporous

pigments have also been demonstrated for the detection of ligating gases152

. One of the

main disadvantages of the currently available methods is the limited diversity of

sensing due to the use of only one type or a few types of sensor molecules. The

difficulty of synthesis, the lack of flexibility in attaching or conjugating molecules to

114

supports and potential difficulties in controlling the purity of polymer-based systems

also limit their usage.

6.2 Polychromophores of fluorescent nucleobases

Due to the ease of synthesis, water solubility and well defined backbone structure,

DNA is an attractive platform for assembling arrays of chromophores and fluorophores.

Using a small library of fluorophores as substitutes of natural nucleobases the Kool

group had constructed a library of fluorophores using the split and pool strategy on the

DNA synthesizer using phosphoramidite chemistry. The resulting library covered a

large spectrum of about 50 colors and hues from violet to orange153

. The large Stokes

shift and narrow excitation wavelength observed with these poly-fluorophores are

desirable characteristics for convenient detection systems using multiple sensors but

one excitation wavelength. The group further constructed a larger library of 14000

members consisting of tetramers made from 11 nucleosides157

. Some of these

oligodeoxyfluorosides demonstrated strong hypsochromic shift in their emission upon

UV excitation further enhancing their utility in detection154

.

6.3 Using oligodeoxyfluorosides for gas detection

When fluorophores are assembled on a DNA backbone, the DNA backbone arranges

them in a way that could facilitate multiple inter and intra-molecular interaction

between the assembled fluorophores as well as with other small molecules, thereby

significantly enhancing their optical profile. Fluorescent nucleobases have been used in

115

detecting DNA mismatches and hybridization using various modes of detection

including emission enhancement, quenching or changing of emission wavelength160a-c

.

We envisioned that such inter-molecular interactions would be greatly useful in the

detection of gases. Hence we constructed a library of 2401 polystyrene beads

containing ODF tetramers from seven monomers which included four fluorophores, a

potential quencher, a spacer and a spacer/hydrogen bonding unit (Fig 1).

Fig 1. a) Fluorescent and non-fluorescent monomers employed in the formation of the

library (b) Example of a typical bead coated with a tetrameric sequence 3’-DHT-DHT-E-I-5’

116

6.4 Synthesis of the library and screening (Courtesy Dr. F. Samain)

Synthesis of the four monomers Y, B, E, and K were carried out following previously

reported methods156,157

. The spacer phosphoramidite (S), the 5,6-Dihydro-dT-CE

phosphoramidite (DHT), the 5-nitroindole-CE phosphoramidite (I) were purchased

from Glen Research.

The previously mentioned split and pool synthetic strategy was used for the synthesis of

the tetramer library on the PEG-polystyrene beads157

. The assembly of the

oligodeoxyfluoroside was carried through an ABI 394 DNA synthesizer using the

phosphoramidite chemistry. The fluorophore sequences of each library member were

encoded by the binary encoding strategy with molecular tags. The tag synthesis,

tagging, and decoding procedure were done according to the published procedure by

Still 158

.

For screening of small molecules in the vapor phase, beads were placed on a small

microscope slide (1 mm X 3 mm X 4 mm) and one drop (0.004mL) of the selected

small molecule was placed beside the microscope slide and both were enclosed in a

sealed fluorescence QS cell. Fluorescence images were taken before, after 2 min, 7min,

and 30 min of exposure.

Screening of the library was carried out using an epifluorescence microscope (Nikon

Eclipse E800 equipped with a 4X objective, excitation 340 -380 nm; emission 400

nm). Fluorescence images were taken using a Spot RT digital camera and Spot

117

Advanced Imaging software. Beads which showed significant variation in optical

properties before and after exposure to the volatile material were selected with a flame-

pulled pipette and decoded. The changes included increase of fluorescence, quenching,

hypso-chromic and bathochromic shifts upon exposure to the small molecules. The

sequences were decoded by electron capture gas chromatographic analysis of tags

liberated from each individual bead that was selected in the screening.

6.5 Re-synthesis and characterization of the selected sequences

The selected tetramers were re-synthesized on an ABI 394 DNA/RNA synthesizer

using phosphoramidite chemistry. The synthesis was carried out on a 1µmol scale on

PEG-polystyrene beads and 3‟-Phosphate CPG. Cleavage from the 3‟-Phosphate CPG

support and final deprotection were done by treatment with 0.05 M potassium

carbonate in methanol. Beads were washed with a solution of EDTA. HPLC Analyses

of sequences were performed using a Shimadzu 10 Series HPLC machine with a C4

column and acetonitrile and water as eluents. The sequences were then characterized by

their masses.

6.6 Using the selected beads as sensors

The selected sensors on beads were once again exposed to the small molecules that they

were chosen to detect. As in the library screening method, the beads were placed on a

small glass slide and a drop of the volatile small molecule was added in a sealed

fluorescence QS cell. The vapors of the small molecule were expected to interact with

the ODFs on the beads and reproduce the fluorescence changes observed during the

118

screening process. The same fluorescence lamp that was used for the screening was

used and the excitation wavelength was maintained at 340-380nm and the emissions

below 400nm were filtered off. Images were taken before and after 2 min, 7 min, and

30 min of exposure. For display purposes, a grey color gradient was generated using

Photoshop. where the color changes are depicted by inverting color of the image taken

before exposure and merging it with the image taken after 30 min of exposure followed

by making it 50% transparent (Figure 2). The difference image provides us with an easy

color code for the detection of the small molecules with the ODFs.

119

120

Fig 2. Thirty sequences (FS 1-30) were selected from the library, characterized and re-

exposed to the analytes they were targeted to detect. The figure shows the beads before

and 30 min after exposure to the small molecules and the photoshop difference images

121

6.7 The sensing of gases

Except for the bead # FS-7 which was blue when selected from the library but red when

re-synthesized, all the other beads were of same color (with slight variations in intensity

or hue) as in the original screening. They also reproduced the expected trends when

exposed to the small molecules. For example, just as in the library, the bead # FS- 23

showed strong quenching upon exposure to nitrobenzene, while the bead#FS- 20

showed an increase in emission when exposed to propionic acid (Fig 2).

Encouraged by the positive correlation between the screening and the detection studies

we decided to explore the selectivity of these beads. Hence a cross-screening study of 8

beads against 4 small molecules having different structure and electronic properties was

then undertaken. In order to detect molecules of different structures and electronic

properties, nitrobenzene (electron deficient aromatic compound), acrolein (unsaturated

aldehyde), mesitylene (electron rich aromatic) and propionic acid (aliphatic carboxylic

acid) were chosen for this study. One could clearly see a color code emerging from this

study where each molecule produces a unique color foot-print on an array of 8 sensors

(Fig 3). Interestingly, sequences selected for their responses to individual analytes

demonstrated sensing of the other three analytes as well (eg sequences 2, 5 and 7). In

general we see a strong quenching of fluorescence with nitrobenzene and slight

quenching with mesitylene. Propionic acid, on the other hand, brought about blue-shift

with most of the sensors while acrolein showed some blue-shift and some quenching of

fluorescence. Also worth noting is that, sequences containing K display roughly no

color change except when exposed to nitrobenzene while sequences containing electron

122

rich aromatic fluorophores like Y and E, seemed to be more responsive and exhibited

strong quenching with NB, blue shift with propionic acid and acrolein and mild

quenching with mesitylene.

Fig 3. Cross-screening of some selected sequences against 4 different small molecules. The

photoshop image differences before and after exposure to the small molecules are shown

123

6.8 Discussion

Although some success has been achieved in detecting volatile materials using optical

methods, much of the power of fluorescence detection involving large signal and low

background still remains unharnessed. Fluorescent nucleobases have been used in the

recent past for the detection of DNA hybridization and single nucleotide

polymorphisms.160a,b,c

. To the best of our knowledge this is the first study reporting the

successful application of fluorescent nucleobases for the detection of gases. The library

of ODFs reported in this study greatly enhanced the repertoire of sensors which could

be used for detection of volatile material. Promising results are being shown by larger

cross-screening studies being currently carried out in the lab (Dr. F. Samain

unpublished results). One of the great advantages of this method is that the use of

narrow excitation wavelength range for the detection of multiple small molecules

enables parallel monitoring of a large number of analytes thus saving time and money.

This would be particularly useful in environmental monitoring of multi-component gas

samples. Moreover, solid-state detectors also come with the convenience of mobility

and ease of fabrication in micro-array. Being a fluorescence based detection method, it

would require just a source and detector to be incorporated into a handheld device for

field detection.

We hypothesize that the varied responses come from different electronic and/ steric

interactions between the analytes and the ODFs. However the mechanisms underlying

such interactions are not known and further studies need to be conducted in order to

investigate the mechanism behind the fluorescence changes. For example, a variety of

124

processes including excited state reactions, energy transfer, complex-formation and

collisional quenching could result in quenching of fluorescence. It has been postulated

that the fluorescence quenching of fluorophores generally observed with nitro-

aromatics involve the formation of excited state ion pair166

. Propionic acid on the other

hand could increase the flexibility of the DNA backbone167

by protonating the

phosphate groups which might enable the fluorophores to orient themselves into more

thermodynamically favorable conformers inducing hypsochromicity. Additionally,

acrolein and propionic acid also have the capacity of interacting with the ODFs via

hydrogen-bonding and inducing fluorescence changes.

6.9 Summary

We have demonstrated that a library of polyfluorophores on DNA backbone created by

a simple combinatorial strategy could be useful in developing gas sensors. Some of the

sensors selected from this library were able to detect small molecules of widely varied

molecular structure and electronic properties. This work is a “proof of concept” for

future rational modifications aimed at developing robust sensors for the reversible

detection of volatile materials.

125

Chapter 7

Material and Methods

7.1 Synthesis of 6-N-(l-(Dimethylamino)ethylene)-2’-

deoxyadenosine (dma-dA)

7.1

N6-dimethylacetamidine-dA (Dma-dA) phosphoramidite was prepared according to a

published method59

.

Synthesis of 6-N-(l-(Dimethylamino)ethylene)-2‟-deoxyadenosine (7.1)

2΄-deoxy-adenosine hydrate (1.6g, 6 mmol) was co-evaporated 3 times with pyridine.

N,N-Dimethylacetylamide (2.7mL, 18mmol) was added to it and the reaction was

stirred in 6mL of methanol at 400C for 18 hrs. The solution was then concentrated and

purified by column chromatography (silica: CH2Cl2/ MeOH: 1:0 to 20:1) to obtain the

pure compound in 70% yield.

126

A general procedure for 5‟-O-DMT protection and phoshoramidite synthesis is

described in section 7.6 of this chapter and is generally applicable to the

phosphoramidite synthesis of all the nucleosides made in this thesis.

7.2 General procedure for the synthesis of non-polar

thymidine/uracil analogs

The synthesis of pyrimidine analogs was performed by coupling the base analogs to

siloxy-protected ribonolactones following previously published methods110a,b

.

7.2

Synthesis of 3′,5′-O-((1,1,3,3-Tetraisopropyl)disiloxanediyl)-2′-deoxy-D-ribono-

1′,4′-lactone (7.2)

Bromine (9mL) was slowly added to a solution of 2-deoxy-D-riobse (4.50 g, 33.5

mmol) in water (30 mL). The flask was sealed, and the contents were stirred at room

temperature for 5 days. The excess bromine was blown away by a steady steam of air

and the solution was neutralized by adding Ag2CO3 until the pH of solution was 7.0.

The mixture was filtered through Celite 545 and the filtrate was concentrated under

reduced pressure to yield 2-deoxyribonolactone as yellow oil.

127

The crude oil was dissolved in anhydrous DMF (60 mL) without further purification

and imidazole (5.72 g, 84.0 mmol) was added. Then 1,3-dichloro-1,1,3,3-

tetraisopropyldisiloxane (15 g, 47.6 mmol) was slowly added to the solution via

dropping funnel for a period of 1 hour. The resulting solution was stirred at the room

temperature for 24 h, and extracted with ether. The organic layer was washed with

water, saturated aqueous NaHCO3, and brine, was dried over anhydrous Na2SO4, and

was concentrated under vacuum. Flash chromatography of the crude product (silica gel,

CH2Cl2) produced the desired product as a colorless oil (9.00 g, 24.0 mmol, 72 %).

7.2 (a) [X=F]

7.2 (b) [X=Cl]

Synthesis of 3′,5′-O-((1,1,3,3-tetraisopropyl)disiloxanediyl)-1′,2′-dideoxy-β-1-aryl-

D-ribofuranoses [7.2 (a),(b)]

The iodoarenes were coupled to the sugar either following their lithiation (as in the

dichloro analog dL) or as their Grignard reagents (in case of the difluoro analogs).

7.2 (a) Reaction of disiloxane-protected deoxyribonolactone with the Grignard

reagent of bromo-arene

Magnesium turnings (0.24 g, 9.9 mmol) and a few crystals of iodine were dissolved in

5mL of anhydrous THF. Bromo-arene (2.1 g, 10 mmol) was added dropwise to the

128

mixture. Slight heating was needed (40C) to drive the reaction to completion. After 1

hr, siloxy-lactone 7.2 (2.1 g, 5.6 mmol) dissolved in 2.5 mL THF was added dropwise

to the Grignard reagent. The solution was stirred at room temperature for 2 hours. The

reaction mixture was quenched with saturated aqueous NH4Cl and was then extracted

with diethyl ether. The combined ether phases were washed with saturated aqueous

NH4Cl, water, and brine, and were dried over anhydrous Na2SO4. The organic solvent

was evaporated to produce an oil that was used without further purification.

7.2 (b) Reaction of disiloxane-protected deoxyribononlactone with lithiated arenes

To a solution of the iodoarene (~4.2 mmol) in anhydrous THF (5 mL) under Ar and at –

78C was added n-BuLi (~1.6 M in hexanes, 1.0 equiv.) and the mixture was stirred at

–78C for 30 min. A solution of the disiloxane-protected deoxyribonolactone 7.2 (1.0 g,

2.7 mmol) in anhydrous THF (5 mL) was added slowly to this solution at -78C. After

2-3 h, the reaction mixture was quenched at –78C with sat. aqueous NH4Cl and was

then extracted with ether. The combined ether phases were washed with sat. aqueous

NH4Cl, water, and brine, and were dried over anhydrous Na2SO4. The extract was

concentrated under vacuum to give an oil which used without further purification.

Reduction with Triethylsilane

The crude oil from both the above steps were then dissolved in CH2Cl2 under Ar and at

–78 C and treated with Et3SiH (3 equiv.) and BF3OEt2 (3 equiv.). The resulting

solution was stirred at –78 C for 3 h, and then the reaction was quenched at –78 C by

the addition of satd. NaHCO3. The resulting mixture was extracted with diethyl ether.

The combined organic phases were washed with saturated NaHCO3, water, and brine.

129

This solution was dried over anhydrous Na2SO4 and was concentrated under vacuum.

The resulting oil was purified by column chromatography (silica gel, hexane/

dichloromethane; 10:1 to 1:1) to obtain the pure β-anomers from a mixture of β and α

anomers in yields around 10-11%

7.2 (a΄) [X=F]

7.2 (b΄) [X=Cl]

Removal of the disiloxane protecting group [7.2 (a΄), (b΄)]

Tetrabutyl ammonium fluoride (1 M in THF, 3.0 equiv.) was added to a solution of the

disiloxane-protected nuclecosides (~0.5 mmol) in 10mL of anhydrous THF. The

resulting mixture was stirred at the room temperature for 2 h, and then 5% aqueous

NH4HCO3 solution was added to quench the reaction. The mixture was extracted with

diethyl ether, and the combined organic extracts were washed with 5% aqueous

NH4HCO3, water, and brine. The organic portion was dried over anhydrous Na2SO4 and

concentrated in vacuo. The crude material was purified using column chromatography

(silica gel, CH2Cl2/MeOH 1:0 to 20:1).

130

7.3 Synthesis of 1-(2-deoxy-β-d-ribofuranosyl)-2,4-dichloro-5-

iodobenzene and the corresponding stannyl-analog

7.3 (a) 7.3 (b)

Synthesis of 7.3 (a)

1-(2-deoxy-β-d-ribofuranosyl)-2,4-dichlorobenzene (0.2 M)was iodinated by dissolving

in trifluoroacetic acid and adding 10 eqv of N-iodosuccinimide and allowing the

reaction to stir at room temperature for 11 days. At the end of 11 days the reaction was

quenched with ice-cold water, extracted with CH2Cl2 and washed with saturated

NaHCO3 and excess iodine neutralized with saturated Na2S2O3. After washing the

organic extract with brine it was dried over Na2SO4 and evaporated under vacuum. The

resultant mixture was column purified (silica, CH2Cl2/MeOH 1:0 to 20:1) to yield 63%

of the product.

H1 NMR (400MHz; CD3OD) ppm : 8.21 (s, 1H, Ar-H), 7.54 (s, 1H, Ar-H), 5.27 (dd,

1H, 10.1, 5.6 Hz, H-1΄ ), 4.26 (m, 1H, H-3΄ ), 3.98 (m, 1H, H-4΄ ), 3.77 (m, 2H, H-5΄),

2.42 (m, 1H, H-2΄α), 1.77 (m, 1H, H-2΄β) . C13

NMR (400 MHz; CD3OD) ppm: 44.2,

63.3, 73.4, 77.3, 87.2, 96.5, 129.7, 132.5, 137.6, 138.2, 139.9

HRMS m/z: Calculated for C11H12Cl2IO3 (M+H+) = 388. 91, found 388.7

131

Synthesis of 7.3 (b)

Following published procedure109

the 0.1g (0.257mmol) of the product obtained from

the previous step was dissolved in 4mL of dioxane at 500C. Once the entire product has

completely dissolved the temperature is cooled to room temperature and 0.13mL

Sn2Bu6 (1eqv) and 5 mg of Pd(PPh3)4 (catalytic) was added and the reaction was

heated to 1050C under argon and run for 12 hrs. The dioxane is evaporated and the

reaction mixture is purified using column chromatography (silica; CH2Cl2/MeOH 1:0 to

20:1) to yield 87% product.

H1 NMR (400 MHz; CD3OD) ppm : 7.52 (s, 1H, Ar-H), 7.33 (s, 1H, Ar-H), 5.42 (dd,

1H, 9.8, 5.9 Hz, H-1΄ ), 4.42 (m, 1H, H-3΄ ), 4.05 (m, 1H, H-4΄ ), 3.82 (m, 2H, H-5΄),

2.47 (m, 1H, H-2΄α), 1.83 (m, 1H, H-2΄β), 0.868-1.548 (m, 27H, 3 x C(CH3)3). C13

NMR (500 MHz; CD3OD) ppm: 10.9, 14.0, 27.7, 29.3, 42.9, 63.8, 74.1, 77.4, 87.2,

128.9, 133.1, 135.0, 137.1, 142.1

HRMS m/z: Calculated for C23H39Cl2O3Sn (M+H+) = 552.12, found 552.1

132

7.4 Synthesis of 7,8-dihydro-8-oxo-2’-deoxyinosine

Synthesis of oxo-inosine was achieved by converting 8-bromo-adenosine to 8-oxo-

adenosine (7.4 (a)) following a published procedure135

and oxidizing it further

following another published method132

.

Synthesis of 8-oxo-7,8-dihydro-2‟-deoxyadenosine [7.4 (a)]

To a 1.0 mM suspension of 8-Bromo-deoxyadenosine in water 3 M equiv of 2-

mercaptoethanol and 10 M equiv of triethylamine (TEA) were added. The resulting

solution was then heated at 1000C for 2 h. After evaporation of water under vacuum the

compound was column purified (silica gel; CH2Cl2: MeOH 1:0 to 10:1) to yield 95% of

the pure compound.

Synthesis of 8-oxo-7,8-dihydro-2‟-deoxyinosine [7.4 (b)]

A solution of 7,8-dihydro-8-oxo-2‟-deoxyadenosine 7.4 (a) (0.387 g, 1.45 mmol) and

adenosine deaminase (562.5 U) in water (5 ml) was stirred at room temperature for 10 h

and concentrated under reduced pressure. The residue was triturated with MeOH (3 ml)

under reflux and the resultant solid was collected by suction filtration and dried under

vacuum over P 2O5 to afford the compound as an off-white solid in a high yield of 94%.

133

H1 NMR (400MHz, DMSO-d6) ppm: 7.94 (s, 1H), 6.12 (dd, J = 8.0, 6.8 Hz, 1H), 4.36

(m, 1H), 3.78 (m, 1H), 3.58 (dd, J = 11.8, 4.6 Hz, 1H), 3.44 (dd, J = 11.8, 4.6 Hz, 1H),

2.94 (m, 1H), 1.99 (ddd, J = 12.9, 6.5, 2.8 Hz, 1H). C13

NMR (500MHz, DMSO-d6)

ppm: 152.5, 151.6, 145.8, 144.2, 108.4, 87.5, 81.5, 71.3, 62.4, 36.2.

HRMS (m/z) Calculated C10H13N4O5 (M+H+)= 269.08, found= 269.1

7.5 Synthesis of 1-[2-Deoxy-β-D-erythro-pentofuranosyl]-9-methyl-

imidazo[(4,5)-b]pyridine (dQ)

The synthesis of dQ was achieved following a previously published procedure143

where the

base is coupled to Hoffer‟s α-chlorosugar.

The base 9-methyl-1-H-imidazo[(4,5)-b]pyridine [7.5 (a)] was produced by dissolving

0.5g of 2,3-diamino-4-methyl pyridine in 15mL of 4(N) HCl and adding 1.6mL Formic

134

acid (10eqv; 41mmol) to the solution. The reaction was run for 18hrs at 100-1050C and

then cooled down to room temperature and neutralized with 2(N) NaOH. The mixture

was extracted with ethyl acetate 8 times and purified by column chromatography

(silica; CH2Cl2: MeOH 1:0 to 9:1) to produce the compound in 55% yield.

Hoffer‟s α-chlorosugar [7.5 (b)] was synthesized by adding acetyl chloride (0.3 mL) to

a solution of 2-deoxy-D-ribose (6.7 g, 0.05 mol) in MeOH (100 mL) and the resulting

solution was stirred at 250C for 45 min. Pyridine (10 mL) was added to this solution

and the solvents were removed in vacuo. The residue was dissolved in dry pyridine (30

mL), and the pyridine was removed in vacuo. The resulting syrup was dissolved in dry

pyridine (30 mL), and the solution was cooled in an ice-water bath. A catalytic amount

of 4-dimethylaminopyridine was added, and then 4-chlorobenzoyl chloride (14 mL,

0.11 mol) was added drop wise for 20 min. After stirring at 00C for 1 h, the reaction

was allowed to proceed at 250C overnight. The reaction was quenched with water (100

mL), and CH2Cl2 (120 mL) was added. The organic phase was separated, and the

aqueous fraction was extracted with CH2Cl2 (50 mL). The combined organic extracts

were washed with saturated aqueous NaHCO3 (2 × 100 mL), 15% aqueous H2SO4 (2 ×

100 mL), water and then brine, prior to drying (Na2SO4). Removal of the solvent in

vacuo gave a syrup that was dissolved in ether (100 mL), and the white crystalline solid

that formed was removed by suction filtration. filtrate was evaporated to dryness, and

toluene (50 mL) was added and evaporated repeatedly to remove moisture. The

resulting syrup was dissolved in ether (20 mL), cooled to 0C, and this solution was

added to a cold solution of a mixture of acetic acid and acetyl chloride (80:20:5) and

stirred in ice-bath for 15 min till a white precipitate appears. The precipitate is filtered

135

and washed with cold ether:hexane (1:1 v/v) and dried under vacuum in the presence of

P2O5 to obtain a white powder in 82% yield.

[2-Deoxy-3,5,-bis-O-(4-chlorobenzoyl)-β-D-erythro-pentofuranosyl]-9-methyl-1-H-

imidazo[(4,5)-b]pyridine. [7.5 (c)]

9-methyl-1-H-imidazo[(4,5)-b]pyridine 7.5 (a) (375 mg, 2.81 mmol), was dissolved in

dry acetonitrile (92 mL) and the solution was cooled to 0 °C under argon. Sodium

hydride 60% oil suspension (135 mg, 3.38 mmol) was added in one portion to the

solution and stirred for 30 min. Benzoyl-protected Hoffer‟s α-chlorosugar , 7.5 (b)

(1.78 g, 4.37 mmol) was added to the reaction mixture at 00C and 10 min later the

temperature was allowed to increase to room temperature. After 90 min the reaction

was quenched by addition of saturated sodium bicarbonate solution and the aqueous

layer was washed with ethyl acetate. The organic layers were washed with brine and

dried over anhydrous magnesium sulfate. The solution was filtered, concentrated, and

purified by silica column chromatography, eluting with hexanes-ethyl acetate (3:5 to

4:5) to obtain 685 mg (53%) of a mixture of the main product (Q bis-benzoyl ester) and

a minor product (these compounds were not separated at this step except for

characterization of Q bis-benzoyl ester.

1-[2-Deoxy-b-D-erythro-pentofuranosyl]-9-methyl-imidazo[(4,5)-b]pyridine [7.5 (d)]

The mixture of [2-Deoxy-3,5,-bis-O-(4-chlorobenzoyl)-b-D-erythro-pentofuranosyl]-9-

methyl-1-H-imidazo[(4,5)-b]pyridine, 7.5 (c) and the minor product (685 mg, 1.48

mmol) was suspended in dry methanol (14 mL) and a 0.5 M solution of sodium

136

methoxide in methanol (4 mL) was added. The reaction mixture was stirred at room

temperature for 2 h. Solid ammonium chloride (2.0 g) was added and stirring was

continued for 10 more min. The mixture was filtered, washed with methanol and

concentrated. The crude product was purified by silica column chromatography

(chloroform-methanol, 20:1) to obtain 65% of nucleoside Q. The desired isomer

(nucleoside Q) was confirmed by NOE experiments and by a characteristic intra-

molecular hydrogen bond (only possible for this isomer) between OH 5' and the N6 of

the base, observed in CDCl3.

H1-NMR (400 MHz, CDCl3 ) ppm: 8.20 (1H, d, J=5.5 Hz), 8.10 (1H, s), 7.12 (1H, d,

J=5.5 Hz), 6.96 (1H, d, J=12.2 Hz), 6.48-6.40 (1H, m), 4.28 (1H, s), 4.00 (1H, d, J=12.2

Hz), 3.82 (1H, t, J=12.2 Hz), 3.43 (1H, broad s), 3.24-3.14 (1H, m), 2.70 (3H, s), 2.34

(1H, dd, J=6.4 Hz, J=13.5 Hz); C13

-NMR (500 MHz, CDCl3) ppm: 146.38, 144.82,

144.35, 141.64, 136.78, 121.07, 89.84, 87.31, 73.11, 63.71, 41.39, 16.26;

HRMS (m/z) calculated d. for C13 H16O3N2 (M+H

+) 250.1192, found 250.12

137

7.6 General Procedure for DMT protection and preparation of

phosphoramidites

Standard procedure was used for 5‟-O- DMT protection of the nucleoside. The free

nucleosides were dissolved in CH2Cl2 (or pyridine in case of dQ) and 1.1 eqv of DMT-

Cl was added in the presence of an activating base. After 2hrs of stirring an additional

portion of DMT-Cl (0.2 eqv) was added to the reaction mixture. The reaction was

stirred at room temperature from 2 hrs to 12hrs (depending upon the substrate) after

which it was quenched with methanol, concentrated under vacuum and purified by

column chromatography (silica; CH2Cl2: MeOH 1:0 to 20:1). The 5‟-O-DMT-protected

nucleosides were obtained in 72-88% yields.

To a 0.1 (M) solution of the DMT-protected nucleoside in acetonitrile was added 1.1

eqv of tetrazole and 1.1 eqv of 2-cyanoethyl-N,N,N‟,N‟-tetraisopropylamino phosphine

and the reaction was stirred at room temperature for 1hr. Acetonitrile was evaporated

and the mixture purified by column chromatography (silica; CH2Cl2: MeOH 1:0 to

40:1) to obtain the pure phosphoramidites in 58-78% yields.

138

7.7 Primer extension assays with archaeal DNA polymerases

enzymes

Primers were labeled using [γ32

-P] ATP (Amersham Bioscience) and T4 Polynucleotide

kinase (Invitogen). 50pmoles of primers were reacted with 50µCi of [γ32

-P] ATP in the

presence of 10U of the enzyme. The reaction was allowed to run at 370C for 45min.

Labeled primers were purified by using Illustra microspin G-25 columns (GE). The

primer (10nM) and the template (20nM) were mixed with hot primers (0.5nM) in the

polymerase reaction buffers provided by the suppliers of each enzyme. They were

heated to 900C for 15 min and then allowed to slowly cool down to room temperature

to facilitate annealing of the primers to the template. dNTPs (1.25mM) and the

polymerase enzymes (0.5 U) were added to the reaction mixture to give a final volume

of 20.0µL. The reactions were allowed to run at 720C and aliquots of the reaction

mixture were taken out at regular interval and quenched with stop buffer (95%

formamide containing 10Nm EDTA, 0.05% xylene cyanol and 0.05% bromo-phenol

blue). The products were resolved by using 20% denaturing polyacrylamide gel

electrophoresis and detected by using a phosphorimager.

7.8 Oligodeoxyfluoroside (ODF) library synthesis methods

Syntheses of the four deoxyriboside monomers Y, B, E, and K (Fig. 1, main text) were

carried out as previously reported156,157

. The spacer phosphoramidite (S), the 5,6-

Dihydro-dT-CE phosphoramidite (H), and the 5-nitroindole-CE phosphoramidite (I)

were purchased from Glen Research.

139

The synthesis of the tetramer library was carried out using previously described

methods157

using a split-and-pool synthetic strategy on 60 mm amine-functionalized

PEG-polystyrene beads, NovaSyn TG amino resin (Nova biochem). The assembly of

the oligodeoxyfluorosides was performed on an ABI 394 DNA synthesizer using

standard phosphoramidite chemistry, but with extended coupling step times of 15 min.

The fluorophore sequences of each library member were recorded by the binary

encoding strategy with molecular tags. The tag synthesis, tagging, and decoding

procedures were done according to the published procedure of Still158

. The sequences

were decoded by electron capture gas chromatographic analysis of tags liberated from

each individual bead that was selected in the screening (see examples below).

For vapor phase screening of potential sensors, beads were laid down on a small

microscope slide (1 mm thick X 3 mm wide X 4 mm long). They were spaced sparsely

to allow for easier identification and picking. One drop (0.004 mL) of the selected

small molecule was placed beside the microscope slide and both were enclosed in a

sealed 3.5 mL quartz fluorescence QS 111 cell (Hellma Küvetten für

Fluoreszenzmessungen ). Fluorescence images were taken before, after 2 min, 7 min,

and 30 min of exposure in air at room temperature.

Screening of the library was carried out using an epifluorescence microscope (Nikon

Eclipse E800 equipped with a 4X objective, excitation 340 -380 nm; emission 400

nm). Fluorescence images were taken using a Spot RT digital camera and Spot

Advanced Imaging software. Beads whose responses were among the strongest were

picked up with a flame-pulled pipette and transferred into a capillary tube for decoding.

140

For further analysis, the selected ODF tetramers were prepared via automated

oligonucleotide synthesis by standard phosphoramidite synthetic procedures on an ABI

394 DNA/RNA synthesizer. The synthesis was carried out on a 1µmol scale in a

normal column containing both PEG-polystyrene beads and 3‟-Phosphate CPG (Glen

Research). In this way we could use the same synthesis to prepare new samples of the

ODF sensors on beads, and confirm full-length synthesis and identity of tetramers by

MS and spectra (see below). Cleavage from the 3‟-Phosphate CPG support and final

deprotection were done by treatment with 0.05 M potassium carbonate in methanol for

24 h at room temperature. Beads were washed with a solution of EDTA. Purification of

sequences was performed using a Shimadzu 10 Series HPLC with a C4 column (Altech

Platimun EPS) with acetonitrile and 0.05(M) tetraethylammonium acetate as eluents.

7.9 Image processing methods for screening

Fluorescence images taken during screening were analyzed using Adobe Photoshop

(version 10.01, Adobe Inc, CA). Raw color images (jpg format) were taken under

identical camera exposures before analyte exposure and (without moving the sample)

after 7 min of exposure to the analyte vapor. We used the “invert” function in

Photoshop to invert the r,g,b values of the image before exposure. This was copied and

overlaid onto the raw image after exposure, and adjusted to 50% transparency, giving a

50% blend of the two images. This is the final difference image. Since inverting the

original black background yields white, the final blended (difference) image yields 50%

gray for the background, and 50% gray for any beads that showed no change with the

analyte. The difference image highlights beads that changed by variations in

141

brightness/darkness (where darker than 50% gray shows quenching and lighter,

fluorescence enhancement) and in color (where the color of the difference image shows

color shifts that occurred upon exposure). Color changes can result from quenching of

selected parts of the combined emission bands or from shifts of emission peaks (Fig 1)

a) Blank (before exposure) b) after 7 min with NB

c) Difference image

Fig 1. Fluorescence images of library before and after exposure to nitrobenzene.

142

References:

1. Klobutcher LA, Swanton MT, Donini P, Prescott DM, (1981) All gene-sized DNA

molecules in four species of hypotrichs have the same terminal sequence and an

unusual 3′ terminus. Proc Natl Acad Sci USA 78:3015–3019

2. Makarov VL, Hirose Y, Langmore JP, (1997) Long G tails at both ends of human

chromosomes suggest a C strand degradation mechanism for telomere shortening.

Cell 88:657–666

3. Chai W, Du Q, Shay JW, Wright WE, (2006) Human telomeres have different

overhang sizes at leading versus lagging strands. Mol Cell 21:427–435

4. Wellinger RJ, Wolf AJ, Zakian VA, (1993) Saccharomyces telomeres acquire

single-strand TG1-3 tails late in S phase. Cell 72:51–60

5. Blackburn EH, Gall JG, (1978) A tandemly repeated sequence at the termini of the

extrachromosomal ribosomal RNA genes in Tetrahymena. J. Mol. Biol. 120, 33-53

6. Crabbe L, Karlseder J, (1931) In the end, Its all structure. Curr Mol. Med. 5, 135-

143

7. Olovnikov AM, (1971) Principle of marginotomy in template synthesis of

polynucleotides. Dokl, Akad. Nauk. SSSR 201, 1496-1499

8. Harley CB, Vaziri H, Counter CM, Allsopp RC, (1992) The telomere hypothesis of

cellular aging. Exp. Gerontol. 27 375-382

9. Forsyth NR, Evans AP, Shay JW, Wright WE, (2003) Developmental differences

in the immortalization of lung fibroblasts by telomerase. Aging Cell 2, 235-243

10. (a)Shay JW, Bacchetti S, (1997). A survey of telomerase activity in human cancer.

Eur. J. Cancer 33, 787–791 (b) Chantal Autexier and Neal F. Lue, (2006) Annu.

Rev. Biochem. 75, 493–517 (c) D. M. Shcherbakova, M. E. Zvereva, O. V.

Shpanchenko, and O. A. Dontsova (2006) Molecular Biology. 40, 4, 514-527

11. Lingner J, Hughes TR, Shevchenko A, Mann M, Lundlab V, Cech TR, (1997)

Reverse transcriptase motifs in the catalytic subunit of telomerase. Science 276 561-

567

143

12. Strahl C, Blackburn EH, (1996) Effects of reverse transcriptase inhibitors on

telomere length and telomerase activity in two immortalized human cell lines. Mol.

Cell. Biol. 16 53 -65

13. Damm K, Hemmann U, Garin-Chesa P, Hauel N, Kauffmann I, Priepke H, Niestroj

C, Daiber C, Enenkel B, Guilliard B, Lauritsch I, Mu¨ller E, Pascolo E, Sauter G,

Pantic M, Martens UM, Wenz C, Lingner J, Kraut N, Rettig WJ, Schnapp A, (2001)

A highly selective telomerase inhibitor limiting human cancer cell proliferation.

EMBO J. 20, 6958-6968

14. Rangarajan S, Friedman SH, (2007) Design, synthesis, and evaluation of

phenantridine derivatives targeting the telomerase RNA/DNA heteroduplex.

Bioorg. Med. Chem. Lett. 17, 2267-2273

15. Dikmen ZG, Gellert GC, Jackson S, Gryaznov S, Tressler R, Dogan P, Wright WE,

Shay JW, (2005) In vivo inhibition of lung cancer by GRN163L: a novel human

telomerase inhibitor. Cancer Res. 65, 7866-7873

16. Hochreiter AE, Xiao H, Goldblatt EM, Gryaznov SM, Miller KD, Badve S, Sledge

GW, Herbert BS, (2006) Telomerase template antagonist GRN163L Disrupts

telomere maintenance, tumor growth, and metastasis of breast cancer. Clin. Cancer

Res. 12, 3184-3192

17. Djojosubroto MW, Chin AC, Go N, Schaetzlein S, Manns MP, Gryaznov S, Harley

CB, Rudolph KL, (2005) Telomerase antagonists GRN163 and GRN163L inhibit

tumor growth and increase chemosensitivity of human hepatoma. Hepatology 42,

1127-1136

18. Falchetti ML, Fiorenzo P, Mongiardi MP, Petrucci G, Montano N, Maira G,

Pierconti F, Larocca LM, Levi A, Pallini R, (2006) Telomerase inhibition impairs

tumor growth in glioblastoma xenografts. Neurol. Res. 28, 532-537

19. Shammas MA, Kolev H, Batchu RB, Bertheau RC, Protopopov A, Munshi NC,

Goval RK, (2005) Telomerase inhibition by siRNA causes senescence and

apoptosis in Barett‟s adenocarcinoma cells: mechanism and therapeutic potential.

Mol. Cancer 4, 24

144

20. Li Y, Li H, Yao G, Li W, Wang F, Jiang Z, Li M, Inhibition of telomerase RNA

(hTR) in cervical cancer by adenovirus-delivered siRNA. Cancer Gene Ther., in

press

21. Zglinicki, Serra TV, Lorenz V, Saretzki M, Lenzen- GroBimlighaus G, Gebner R,

Risch R, Steinhagen- Thiessen AE, (2000) Lab. Invest., 80, 1-9

22. Cawthon RM., Smith KR., O'Brien E, Sivatchenko A, Kerber RA, (2003) Lancet,

361, 359-395

23. (a)Marrone A, Dokal I, (2004) Expert. Rev. Mol. Diagn., 6, 1-23 (b) I. Ta´rka´nyi, J.

Aradi (2008) Biochimie 90 , 156-172

24. Rowe-Rendleman C, Glickman RD, (2004) Possible therapy for age-related

macular degeneration using human telomerase. Brain Res. Bull, 62, 549-553

25. Serenicki N, Hoare SF, Kassem M, Atkinson SP, Keith WN, (2006) Telomerase

promoter reprogramming and interaction with general transcription factors in the

human mesenchymal stem cell. Regen. Med, 1, 125-131

26. http://www.tasciences.com/ta65molecule.html

27. Bryan TM, Reddel RR, (1997), Eur. J. Cancer, 33, 767-773

28. Bryan TM, Englezou A, Gupta J, Bacchetti S, Reddel RR, (1995) EMBO J., 14,

4240 - 4248

29. Hodges M, Tissot C, Howe K, Grimwade D, Freemont PS, (1998) Am. J. Hum.

Genet, 63, 297 - 304.

30. Dunham MA, Neumann AA, Fasching CL, Reddel RR, (2000) Nat. Genet., 26, 447

- 450

31. Murnane JP, Sabatier L, Marder BA, Morgan WF, (1994) EMBO J., 13, 4953 -

4962

32. McEachern MJ, (2001), Recombinational telomere elongation in the yeast K. lactis.

In Telomeres and telomerases: cancer and biology, Krupp G (ed). Landes

Bioscience: Georgetown, TX, USA (in press)

33. Yeager TR, Neumann AA, Englezou A, Huschtscha LI, Noble JR, Reddel RR,

(1999) Cancer Res., 59, 4175 - 4179

34. Regev A, Cohen S, Cohen E, Bar-Am I, Lavi S, (1998) Oncogene, 17, 3455 - 3461

http://www.tasciences.com/ta65molecule.html

145

35. Ogino H, Nakabayashi K, Suzuki M, Takahashi E-I, Fujii M, Suzuki T, Ayusawa

D, (1998) Biochem. Biophys. Res. Commun., 248, 223 - 227

36. Jeremy D Henson et al, (2002) Oncogene 21, 598 -610

37. (a) Colgin LM, Reddel RR, (1999) Curr. Opin. Genet. Dev., 9, 97-103 (b). Strahl C,

Blackburn EH, (1996) Mol. Cell. Biol., 16, 53 – 65 (b) Telomere uncapping and

alternative lengthening of telomeres (2008) Mechanisms of Aging and

Development. 129, 99-108

38. Shay JW, Bacchetti S, (1997) Eur. J. Cancer, 33, 787 - 791

39. (a) Mrinal K. Bhattacharyya and Arthur J. Lustig (2006) TRENDS in Biochemical

Sciences, 31, 2, 114-122. (b) Di Giusto DA, Wlassoff WA, Gooding JJ, Messerle

BA, King GC, (2005) Nucleic Acids Res., 33, 64/1

40. Zhang DY, Liu B, (2003) Detection of target nucleic acids and proteins by

amplification of circularizable probes. Expert Rev. Mol. Diag, 3, 237-248

41. Perler FB, Kumar S, Kong H, (1996) Thermostable DNA polymerases. In:

Advances in Protein Chemistry, 48, 377-435

42. Ausubel FM, Brent R, Kingstion RE et al, (1995) (Eds) Current Protocols in

Molecular Biology (Vol. 1), John Wiley & Sons, Hoboken, NJ, USA

43. Yeager TR, Neumann AA, Englezou A, Huschtscha LI, Noble JR, Reddel RR,

(1999), Cancer Res., 59, 4175 - 4179

44. Johnson FB, Marciniak RA, McVey M, Stewart SA, Hahn WC, Guarente L, (2001)

EMBO J., 20, 905 - 913

45. Wu G, Lee W-H, Chen P-L, (2000) J. Biol. Chem., 275, 30618 - 30622

46. Yankiwski V, Marciniak RA, Guarente L, Neff NF, (2000) Proc. Natl. Acad. Sci.,

USA, 97, 5214 - 5219

47. Lindstrom U.M. et al., (2002) Artificial human telomeres from DNA nanocircle

templates. Proc. Natl. Acad. Sci., U. S. A. 99, 15953–15958

48. Jörg Hartig, Eric Kool, (2004) Small circular DNAs for synthesis of the human

telomere repeat: varied sizes, structures and telomere-encoding activities, Nucleic

Acids Res., 32 (19):e152

49. Natarajan S, McEachern MJ, (2002) Mol. Cell. Biol., 22:4512–21

50. Wang RC, Smogorzewska A, de Lange T, (2004), Cell, 119:355–68

http://lib.bioinfo.pl/auth:Hartig,JS

http://lib.bioinfo.pl/auth:Kool,ET

http://lib.bioinfo.pl/pmid:15520461

http://lib.bioinfo.pl/pmid:15520461

146

51. Orbai L, (2007) Using Nucleic Acid chemistry to probe telomeric DNA function

and structure. Ph.D. Dissertation, Stanford University

52. Gornung E, Gabrielli I, Sola L, Genome, Vol. 41, 1998; 136-138

53. Experimental Gerontology 38 (2003) 1333–1341

54. (a) Thisse C, Zon LI, (2002) Science, 295, 457-62 (b) Amatruda, James F et al,

(2008) International Review of Cell and Molecular Biology, VOL 271, pg 1-34

55. Zebrafish model organism database (ZFIN) http://zfin.org/cgi-

bin/webdriver?MIval=aa-ZDB_home.apg

56. Culp P et al, (1991) High frequency germline transmission of plasmid DNA

sequences injected into fertilized zebrafish eggs. Proct. Natl. Acad. Sci U.SA. 88,

7953-7957

57. Qiling Xu, Microinjection into Zebrafish Embryos Methods in Molecular Biology,

Vol. 127: Molecular Methods in Developmental Biology: Xenopus and Zebrafish,

125-132

58. Lindstrom UM, Kool ET, An orthogonal oligonucleotide protecting group strategy

that enables assembly of repetitive or highly structured DNAs. Nucleic Acids

Research, 2002, Vol. 30 No. 19, 101

59. McBride LJ, Kierzek R, Beaucage SL, Caruthers MH, (1986) Amidine protecting

groups for oligonucleotide synthesis. J. Am. Chem. Soc., 108, 2040-2048

60. (a) Kah-Wai Lin, Ju Yan, (2005) The telomere length dynamic and method of its

assessment. J. Cell. Mol. Med. Vol 9, No 4, 977-989. (b) Southern EM, (1975)

Long range periodicities in mouse satellite DNA. J Mol Biol. 94: 51–69

61. Nakamura Y, Hirose M, Matsuo H, Tsuyama N, Kamisango K, Ide T, (1999)

Simple, rapid, quantitative, and sensitive detection of telomere repeats in cell lysate

by a hybridization protection assay. Clin Chem. 1999; 45: 1718–24

62. Lansdorp PM, Verwoerd NP, van de Rijke FM, Dragowska V, Little MT, Dirks

RW, Rapp AK, Tanke HJ, (1996) Heterogeneity in telomere length of human

chromosome. Hum Mol Genet., 5: 685–91

63. Rufer N, Dragowska W, Thornbury G, Roosnek E, Lansdorp PM, (1998) Telomere

length dynamics in human lymphocyte subpopulations measured by flow

cytometry. Nat Biotechnol., 16: 743–7

http://zfin.org/cgi-bin/webdriver?MIval=aa-ZDB_home.apg

http://zfin.org/cgi-bin/webdriver?MIval=aa-ZDB_home.apg

147

64. Therkelsen AJ, Nielsen A, Koch J, Hindkjaer J, Kolvraa S, (1995) Staining of

human telomeres with primed in situ labeling (PRINS). Cytogenet Cell Genet., 68:

115–8

65. Cawthon RM, (2002) Telomere measurement by quantitative PCR. Nucleic Acids

Res., 30: e47

66. Baird DM, Rowson J, Thomas DW, Kipling D, (2003) Extensive allelic variation

and ultrashort telomeres in senescent human cells. Nat Genet., 33: 203–7

67. Huffman KE, Levene SD, Tesmer VM, Shay JW, Wright WE (2000) Telomere

shortening is proportional to the size of the G-rich telomeric 3'-overhang. J Biol

Chem., 275: 19719–22

68. Cimino-Reale G, Pascale E, Battiloro E, Starace G, Verna R, D'Ambrosio E, (2001)

The length of telomeric G strand 3'-overhang measured by oligonucleotide ligation

assay. Nucleic Acids Res., 29: e35

69. Greider CW, (1999) Telomeres do d-loop-t-loop. Cell, 97: 419–22

70. Poon SS, Martens UM, Ward RK, Lansdorp PM, (1999) Telomere length

measurements using digital fluorescence microscopy. Cytometry, 36: 267–78

71. Bauman JG et al, (1980) A new method for Fluorescence microscopic localization

of specific DNA sequences by in situ hybridization of Fluorochromelabeled RNA,

Exp. Cell Res., 128, 485-490

72. Wong HP, Slijepcevic P, (2004) Cytogenet Genome Res 105:464–470

73. Shintaro Imamura et al, (2008) Plos, One October 2008, Volume 3, Issue 10, e3364

74. Frank CJ, Hyde M, Greider CW, (2006) Mol. Cell, 24, 423–432

75. Shuji Kishi et al, (2003) Experimental Gerontology 38, 777–786

76. Huffman KE, Levene SD, Tesmer VM, Shay JW, Wright WE, (2000) Telomere

shortening is proportional to the size of the G-rich telomeric 3'-overhang. J Biol

Chem., 275: 19719–22

77. Cimino-Reale G, Pascale E, Battiloro E, Starace G, Verna R, D'Ambrosio E, (2001)

The length of telomeric Gstrand 3'-overhang measured by oligonucleotide ligation

assay. Nucleic Acids Res., 29: e35

78. (a) Larson SM, Krenning EP, (2005) A pragmatic perspective on molecular targeted

radionuclide therapy. J Nucl Med, 46 Suppl 1:1S–3S (b) J Cancer Res Clin Oncol

148

(1993) 119:320-322 (c) Harbert JC (1987) Nuclear medicine therapy. Thieme, New

York (d) Juweid ME, (2002) Radioimmunotherapy of B-cell non-Hodgkin‟s

lymphoma: from clinical trials to clinical practice. J Nucl Med, 43:1507–1529 (e)

Kassis AI, Adelstein SJ, (2005) Radiobiologic principles in radionuclide therapy. J

Nucl Med, 46:4S–12S (f) Franz Buchegger et al, (2006) Auger radiation targeted

into DNA: a therapy perspective. European Journal of Nuclear Medicine and

Molecular Imaging Vol. 33, No. 11

79. Fujii K, Akamatsu K, Yokoya A, (2004) Ion desorption from DNA components

irradiated with 0.5 keV ultrasoft X-ray photons, Radiation Research, 161:435–441

80. He Y, Neumann RD, Panyutin IG, (2004) Intramolecular quadruplex conformation

of human telomeric DNA assessed with 125I-radioprobing. Nucleic Acids Research

32:5359–5367

81. Bloomer WD, Adelstein SJ, (1977) 5-125I-iododeoxyuridine as prototype for

radionuclide therapy with Auger emitters. Nature, 265:620–621

82. Baranowska-Kortylewicz J, Makrigiorgos GM, Van den Abbeele AD, BermanRM,

Adelstein SJ, Kassis AI, (1991) 5-[123I]iodo-2‟-deoxyuridine in the radiotherapy of

an early ascites tumor model. Int J Radiat Oncol Biol Phys., 21:1541–1551

83. Semnani ES, Wang K, Adelstein SJ, Kassis AI, (2005) 5-[123I/125I]iodo-2‟-

deoxyuridine in metastatic lung cancer: Radiopharmaceutical formulation affects

targeting. Journal of Nuclear Medicine, 46:800–806

84. Hofer KG, Prenkv W, and Hiiris. W. I., (1969) Death and metastatic distribution of

tumor cells in mice monitored with 'I-iododeoxy-uridine. Joumal of the National

Cancer Institute, 43, 763-773

85. Kassis AI, Adelstein SJ, (1993) Therapeutic potential of internally administered

radionuclides. Cintemporary issues in Neurorological Surgery: Diagnosis,

Treatment, and Biology, pp. 290-299

86. Kassis AI et al., (2003) In vivo therapy of neoplastic meningitis with methotrexate

and 5-[ I125

]-iodo-2'-deoxyuridine. Acta Oncologica, 39, 731 73

87. Kassis AI et al, (2004) Therapeutic potential of 5-[I125

]-iodo-2'-deoxyuridine and

methotrexate in the treatment of advanced neoplastic meningitis. Intemationai

Joumal of Radiation Biology, 80, 941 -941

149

88. Mariani. G et al (1993) Intra-arterial infusion of 5-[ I123

]iodo-2'-deoxyuridine in

patients with liver metastases from colon cancer. Journal of Nuclear Biology and

Medicine, 37, 157-158

89. Martin RF et al, (1979) Cytotoxicity of an I125

-Iabeled DNA-binding compound that

induces double-stranded DNA breaks. Cancer Research, 39, 3244 3247

90. Walicka MA et al, (1999) Cytotoxicity of [ I125

]- iodoHoechst 33342: contribution

of scavengeable effects. International Joumal of Radiation Biology, 75,1579-1587

91. Panyutin IG et al, (2000) Development of DNA-based radiophamaceuticals

carrying Auger-electron emitter for anti-gene radiotherapy. The Quarterly Journal

of NuclearMedicin., 44, 256-267

92. Ammin I. Kassis, (2004) Int. J. Rad. Biol., Vol 80, No 11-12, 789-803

93. Sisson JC, Shapiro B, Hutchinson RJ, Shulkin BL, Zempel S, (1996) Survival of

patients with neuroblastoma treated with 125-I MIBG. Am J Clin Oncol, 9:144–148

94. Calabresi P et al, (1961) Initial clinical studies with 5-iodo-2'-deoxyuridine. Cancer

Research 21, 550-559

95. Mester J, DeGoeij K, Sluyser M. Modulation of [5-I125

]iododeoxyuridine

incorporation into tumour and normal tissue DNA by methotrexate and thymidylate

synthase inhibitors. Eur J Cancer 1996;32A:1603–1608

96. Kassis AI, Guptill WE, Taube RA, Adelstein SJ. (1991) Radiotoxicity of 5-

[I125

]iodo-2′-deoxyuridine in mammalian cells following treatment with 5-fluoro-2′-

deoxyuridine. J Nucl Biol Med, 35. 167–173

97. Pressacco J, Mitrovski B, Erlichman C, Hedley DW. (1995) Effects of thymidylate

synthase inhibition on thymidine kinase activity and nucleoside transporter

expression. Cancer Res, 55, 1505–1508

98. Mariani G. et al (1996) Biochemical modulation by 5-fluorouracil and l-folinic acid

of tumor uptake of intra-arterial 5-[I123

]|iodo-2'-deoxyuridine in patients with liver

metastases from colorectal cancer. Acta Oncologica. 35, 941-945

99. Chaudhuri NC, Ren RX-F, Kool ET. (1997) C-Nucleosides derived from simple

aromatic hydrocarbons. Synlett, 4, 341–347.

100. Schweitzer BA, Kool ET. (1994) Aromatic nonpolar nucleosides as hydrophobic

isosteres of pyrimidine and purine nucleosides. J Org Chem, 59, 7238–7242.

150

101. Wang Z. X, Duan W, Wiebe LI, Balzarini J, De Clercq E, Knaus EE. (2001)

Synthesis of 1-(2-deoxy-b-D-ribofuranosyl)-2,4- difluoro-5-substituted-benzene

thymidine mimics, some related a-anomers, and their evaluation as antiviral and

anticancer agents. Nucleosides Nucleotides Nucleic Acids, 20, 11–40.

102. Wang Z. X, Duan W, Wiebe LI, Balzarini J, De Clercq E, Knaus EE. (2001)

Synthesis of 1-(2-deoxy-b-D-ribofuranosyl)-2,4-difluoro-5-substituted benzenes:

„thymine replacement‟ analogs of thymidine for evaluation as anticancer and

antiviral agents. Nucleosides Nucleotides Nucleic Acids, 20, 41–58

103. Moran S, Ren RX-F, Kool ET.(1997) A thymidine triphosphate shape analog

lacking Watson–Crick pairing ability is replicated with high sequence selectivity.

Proc Natl Acad Sci USA. 94, 10506–10511.

104. Panteha Khalili, Ebrahim Naimi, Edward E. Knaus and Leonard I. Wiebe (2002)

Biopharm. Drug Dispos. 23: 105–113

105. Wiebe L.I. et al (2004) Nucleosides, Nucleotides and Nucleic Acids. 23, 12, 1865–

1874

106. Wiebe L.I. et al (2003) Nucleosides, Nucleotides and Nucleic Acids. 22, 12, 2121–

2132

107. Kim, T. W.; Delaney, J. C.; Essigmann, J. M.; Kool, E. T. (2005) Proc. Natl.

Acad. Sci. U.S.A. 102, 15803-15808

108. Kassis, Amin I.; Foulon, Catherine F.; Adelstein, S. James. (1996) Rapid synthesis

of radiolabeled pyrimidine nucleosides or nucleotides. PCT Int. Appl. 43 pp.

109. Foulon CF, Zhang YZ, Adelstein SJ, Kassis AI.(1995) Instantaneous preparation

of radiolabeled 5-iodo-2‟-deoxyuridine. Appl Radiat Isot. 46, 1039 –1046.

110.(a) Kim, Tae Woo; Kool, Eric T.(2004) A Set of Nonpolar Thymidine Nucleoside

Analogues with Gradually Increasing Size. Organic Letters, 6(22), 3949-3952.(b)

Jacob S. Lai, Jin Qu, Dr., Eric T. Kool, (2003) Fluorinated DNA Bases as Probes of

Electrostatic Effects in DNA Base Stacking. Angewandte Chemie 42, 48, 5973

111. Stahlschmidt, Anke, Khalili, Panteha, Sun, William, Machulla, Hans-Jürgen,

Knaus, Edward E. and Wiebe, Leonard I.(2009) Biodistribution and Imaging of 1-

(2-Deoxy-β-D-Ribofuranosyl)-2,4-Difluoro-5-[123/125

I]Iodobenzene(RF[123/125

I]IB),

151

A Nonpolar Thymidine-Mimetic Nucleoside, in Rats and Tumor-Bearing Mice.

Nucleosides, Nucleotides and Nucleic Acids, 28: 5, 379 -393

112. Issa, W.; Tochon-Danguy, H.J.; Lambert, J.; Sachinidis, J.I.; Achermann, U.; et al.

(2004) Synthesis and evaluation of a thymidine analogue for positron emission

tomography study of tumor proliferation in vivo. Nucl. Med. Biol. 31, 839–849.

113. Jarchow-Choy, Sarah K.; Sjuvarsson, Elena; Sintim, Herman O.; Eriksson,

Staffan; Kool, Eric T.(2009) Nonpolar Nucleoside Mimics as Active Substrates for

Human Thymidine Kinases. Journal of the American Chemical Society, 131(15),

5488-5494.

114. (a) Lindahl, T. (1993) Instability and decay of the primary structure of DNA.

Nature 362, 709–715 (b) Shapiro, R., and Danzig, M. (1972) Acidic hydrolysis of

deoxycytidine and deoxyuridine derivatives. The general mechanism of

deoxyribonucleoside hydrolysis. Biochemistry 11, 23–29. (c) Shapiro, R., and

Klein, R. S. (1966) The deamination of cytidine and cytosine by acidic buffer

solutions. Mutagenic implications. Biochemistry 5, 2358–2362

115. Kent S. Gates (2009) Chem. Res. Toxicol. 22, 1747–1760

116. Lindahl, T. (1993) Nature (London) 362, 709–715

117. Balasubramanian, B., Pogozelski, W. K., and Tullius, T. D. (1998) DNA strand

breaking by the hydroxyl radical is governed by the accessible surface areas of the

hydrogen atoms of the DNA backbone. Proc. Natl. Acad. Sci. U.S.A. 95, 9738–

9743.

118 (a) Modrich, P., Lahue, R., (1996)Mismatch repair in replication fidelity, genetic

recombination, and cancer biology. Annu. Rev. Biochem. 65, 101–133 (b) Hanawalt,

P.C., (2001) Controlling the efficiency of excision repair. Mutat. Res. 485, 3–13. (c)

Johnson, R.D., Jasin, M., (2000) Sister chromatid gene conversion is a prominent

double-strand break repair pathway in mammalian cells. EMBO J. 19, 3398–3407

(d) Takata, M., Sasaki, M.S., Sonoda, E., Morrison, C., Hashimoto, M., Utsumi, H.,

Yamaguchi-Iwai, Y., Shinohara, A., Takeda, S., (1998) Homologous recombination

and non-homologous end-joining pathways of DNA double-strand break repair

have overlapping roles in the maintenance of chromosomal integrity in vertebrate

cells. EMBO J. 17, 5497–5508

152

118. Michaels, M.L., Cruz, C., Grollman, A.P. & Miller J.H. (1992) Proc. Natn. Acad.

Sci. USA. 89, 7022-7025

119. Hiller RZH, Zhou AMWW, Englender SW (1997) Stability and dynamics in a

hyperthermophilic protein with melting temperature close to 200°C. Proc Natl Acad

Sci USA. 94, 11329–11332

120. Yang, H., Fitz-Gibbon, S, Marcotte, E.M., Tai, J.H., Hyman, E.C., and Miller, J.H.

(2000) Characterization of a thermostable DNA glycosylase specific for U/G and

T/G mismatches from the hyperthermophilic archaeon Pyrobaculum aerophilum. J.

Bacteriol. 182, 1272-1279.

121. Grüz, P., Pisani, F.M., Shimizu, M., Yamada, M., Hayashi, I., Morikawa, K. and

Nohmi, T. (2001) Synthetic activity of Sso DNA polymerase Y1, an archaeal DinB-

like DNA polymerase, is stimulated by processivity factors Proliferating Nuclear

Antigen and Replication Factor C. J. Biol. Chem. 276, 47397-47401.

122. Belova, G.I., Prasad, R., Kozyavkin, S.A., Lake, J.A., Wilson, S.H. and Slesarev,

A.I. (2001) A type IB topoisomerase with DNA repair activities. Proc. Nat. Acad.

Sci. USA. 98, 6015-6020.

123. Lipps, G., Rother, S., Hart, C., and Strauss, G. (2003) A novel type of replicative

enzyme harbouring ATPase, primase, and DNA polymerase activity. EMBO J. 22,

2516-2525

124. Isabelle V, Franchet-Beuzit J, Sabattier R, Laine B, Spotheim-Maurizot M,

Charlier M (1993) Radioprotection of DNA by a DNA-binding protein: MC1

chromosomal protein from the archaebacterium Methanosarcina sp. CHTI55. Int J

Radiat Biol 63:749–758

125. Lasken, R.S., Schuster, D.M. and Rashtchian, A. (1996) Archaebacterial DNA

polymerases tightly bind uracil-containing DNA. J. Biol. Chem. 271, 17692–17696

126. (a) Greagg, M.A., Fogg, M.J., Panayotou, G., Evans, S.J., Connolly, B.A. and

Pearl, L.H. (1999) A read-ahead function in archaeal DNA polymerases detects pro-

mutagenic template-strand uracil. Proc. Natl. Acad. Sci. U.S.A. 96, 9045–9050 (b)

Savino, C., Federici, L., Johnson, K.A., Vallone, B., Nastopoulos, V., Rossi, M.,

Pisani, F.M. and Tsernoglou, D. (2004) Insights into DNA replication: the crystal

structure of DNA polymerase B1 from the archaeon Sulfolobus solfataricus.

153

Structure 12, 2001–2008 (c) Martin A. Greagg et al A read-ahead function in

archaeal DNA polymerases detects promutagenic template-strand uracil (1999)

Proc. Natl. Acad. Sci. USA. 96, 9045–9050

127. Fogg, M.J., Pearl, L.H. and Connolly, B.A. (2002) Structural basis for uracil

recognition by archaeal family B DNA polymerases. Nat. Struct. Biol. 9, 922–927

128. Firbank, S.J., Wardle, J., Heslop, P., Lewis, R.L. and Connolly, B.A. (2008) Uracil

recognition in archaeal DNA polymerases captured by X-ray crystallography. J.

Mol. Biol. 381, 529–539

129. Connolly B.A. (2009) Recognition of deaminated bases by archaeal family-B

DNA polymerases. Biochemical Society Transactions 37, 1, 65-68

130. (a) Jiang, Y. L., Song, F., and Stivers, J. T. (2002) Base flipping mutations of

uracil DNA glycosylase: substrate rescue using a pyrene nucleotide wedge.

Biochemistry 41, 11248-11254. (b) Jiang, Y. L., and Stivers, J. T. (2002) Mutational

analysis of the base flipping mechanism of uracil DNA glycosylase. Biochemistry

41, 11236-11247 (c) James T Stivers et al (2004) Biochemistry 43, 15429-15438

131(a) Sukhvinder Gill, Rory O‟Neill, Richard J. Lewis, Bernard A. Connolly (2007)

Interaction of the Family-B DNA Polymerase from the Archaeon Pyrococcus

furiosus with Deaminated Bases. J. Mol. Biol. 372, 855–863 (b) Wu, N. & Pai, E.

F. (2002). Crystal structure of inhibitor complexes reveal an alternate binding mode

in orotidine-5′-monophosphate decarboxylase. J. Biol. Chem. 277, 28080–28087

132. Natsuhisa Oka and Marc M. Greenberg (2005) The effect of the 2-amino group of

7,8-dihydro-8-oxo-2‟-deoxyguanosine on translesion synthesis and duplex stability.

Nucleic Acids Research, 33, 5, 1637–1643

133. Zharkov,D.O., Rosenquist,T.A., Gerchman,S.E. and Grollman,A.P. (2000)

Substrate specificity and reaction mechanism of murine 8-oxoguanine-DNA

glycosylase. J. Biol. Chem, 275, 28607–28617.

134. Tchou,J., Bodepudi,V., Shibutani,S., Antoshechkin,I., Miller,J., Grollman,A.P.

and Johnson,F. (1994) Substrate specificity of Fpg protein. Recognition and

cleavage of oxidatively damaged DNA. J. Biol. Chem. 269, 15318–15324

http://ezproxy.stanford.edu:2176/full_record.do?product=WOS&search_mode=AuthorFinder&qid=6&SID=2Bj7A6gi8@29ClNfeOh&page=1&doc=5&cacheurlFromRightClick=no

http://ezproxy.stanford.edu:2176/full_record.do?product=WOS&search_mode=AuthorFinder&qid=6&SID=2Bj7A6gi8@29ClNfeOh&page=1&doc=5&cacheurlFromRightClick=no

154

135. Chryssostomos Chatgilialoglu, Maria Luisa Navacchia, and Al Postigo (2006) A

facile one-pot synthesis of 8-oxo-7,8-dihydro-(20-deoxy)adenosine in water.

Tetrahedron Letters, 47, 711–714

136. Kool, Eric T.; Sintim, Herman O. (2006) The difluorotoluene debate-a decade

later. Chemical Communications (Cambridge, United Kingdom), 35, 3665-3675

137. Kool, E.T. Biopolymers (Nucleic Acid Sciences) 1998, 48, 3-18

138. Hirao I, Kimoto M, Mitsui T, et al. (2006) An unnatural hydrophobic base pair

system: site-specific incorporation of nucleotide analogs into DNA and RNA.

Nature Methods Volume: 3 , 9 ,729-735

139. Kevin. M. Guckian. Doctoral Dissertation, University of Rochester.

140. Seo YJ, Matsuda S, Romesberg FE. (2009) Transcription of an Expanded Genetic

Alphabet. JACS. 131, 14, 5046

141. Juan C. Morales‡ and Eric T. Kool.(2000) Functional Hydrogen-Bonding Map of

the Minor Groove Binding Tracks of Six DNA Polymerases. Biochemistry 39,

12979-12988

142. Gunther L. Eichhorn et al (1994) A structural model for fidelity in transcription.

Proc. Nati. Acad. Sci. USA. 91, 7613-7617

143. Juan C. Morales and Eric T. Kool (1999) Minor Groove Interactions between

Polymerase and DNA: More Essential to Replication than Watson-Crick Hydrogen

Bonds? J. Am. Chem. Soc. 121, 2323-2324

144. Schweitzer, B. A., and Kool, E. T. (1994) J. Org. Chem. 59, 7238–7242

145. (a) Kornberg R (1999). Eukaryotic transcriptional control. Trends in Cell Biology

9: M46 (b) Sims RJ 3rd, Mandal SS, Reinberg D (Jun 2004). Recent highlights of

RNA-polymerase-II-mediated transcription. Current opinion in cell biology 16 (3):

263–271. (c) Cell Death and Differentiation (2007) 14, 1989–1997 (d) Dong Wong

et al (2006) Structural Basis of Transcription: Role of the Trigger Loop in Substrate

Specificity and Catalysis. Cell 127, 941–954

146. Potapova, O., Chan, C., DeLucia, A. M., Helquist, S. A., Kool, E. T., Grindley, N.

D. F., and Joyce, C. M. (2006) Biochemistry 45, 890–898

147. Swager, T. M.(1998) Acc. Chem. Res. 31, 201.

148. Toal, S. J.; Trogler, W. C. (2006) J. Mater. Chem. 16, 2871.

https://scifinder.cas.org/scifinder/view/text/refList.jsf?nav=rO0ABXQAAWF0ACQyNTgwQ0MxNS04NkYzLTUwQjAtNjZENy1DNzczNjVFRTRFNEZ0AAFic3IAEWphdmEubGFuZy5JbnRlZ2VyEuKgpPeBhzgCAAFJAAV2YWx1ZXhyABBqYXZhLmxhbmcuTnVtYmVyhqyVHQuU4IsCAAB4cAAAAAR0AAFodAAbQVVUSE9SX0lOVkVOVE9SX05PX0dST1VQSU5HdAABcHNxAH4AAwAAAAF0AAJyb3NyABFqYXZhLmxhbmcuQm9vbGVhbs0gcoDVnPruAgABWgAFdmFsdWV4cAB0AAJzc3NyACtvcmcuY2FzLm9zY2FyLnNlcnZlci5kb21haW4uY29tbW9uLlNvcnRTcGVjPJCroB2X4MoCAAJMAAxteU9yZGluYWxLZXl0AChMb3JnL2Nhcy9vc2Nhci9zZXJ2ZXIvZG9tYWluL2NvbW1vbi9LZXk7TAAHbXlTb3J0c3QAGUxqYXZhL3V0aWwvTGlua2VkSGFzaFNldDt4cHBzcgAXamF2YS51dGlsLkxpbmtlZEhhc2hTZXTYbNdald0qHgIAAHhyABFqYXZhLnV0aWwuSGFzaFNldLpEhZWWuLc0AwAAeHB3DAAAABA_QAAAAAAAAHh0AANzc2FzcQB-AAsA

https://scifinder.cas.org/scifinder/view/text/refList.jsf?nav=rO0ABXQAAWF0ACQyNTgwQ0MxNS04NkYzLTUwQjAtNjZENy1DNzczNjVFRTRFNEZ0AAFic3IAEWphdmEubGFuZy5JbnRlZ2VyEuKgpPeBhzgCAAFJAAV2YWx1ZXhyABBqYXZhLmxhbmcuTnVtYmVyhqyVHQuU4IsCAAB4cAAAAAR0AAFodAAbQVVUSE9SX0lOVkVOVE9SX05PX0dST1VQSU5HdAABcHNxAH4AAwAAAAF0AAJyb3NyABFqYXZhLmxhbmcuQm9vbGVhbs0gcoDVnPruAgABWgAFdmFsdWV4cAB0AAJzc3NyACtvcmcuY2FzLm9zY2FyLnNlcnZlci5kb21haW4uY29tbW9uLlNvcnRTcGVjPJCroB2X4MoCAAJMAAxteU9yZGluYWxLZXl0AChMb3JnL2Nhcy9vc2Nhci9zZXJ2ZXIvZG9tYWluL2NvbW1vbi9LZXk7TAAHbXlTb3J0c3QAGUxqYXZhL3V0aWwvTGlua2VkSGFzaFNldDt4cHBzcgAXamF2YS51dGlsLkxpbmtlZEhhc2hTZXTYbNdald0qHgIAAHhyABFqYXZhLnV0aWwuSGFzaFNldLpEhZWWuLc0AwAAeHB3DAAAABA_QAAAAAAAAHh0AANzc2FzcQB-AAsA

http://ezproxy.stanford.edu:2176/full_record.do?product=WOS&search_mode=GeneralSearch&qid=1&SID=1CkOJ91d5gfCFno9h@p&page=3&doc=24&cacheurlFromRightClick=no

http://ezproxy.stanford.edu:2176/full_record.do?product=WOS&search_mode=GeneralSearch&qid=1&SID=1CkOJ91d5gfCFno9h@p&page=3&doc=24&cacheurlFromRightClick=no

http://ezproxy.stanford.edu:2176/full_record.do?product=WOS&search_mode=GeneralSearch&qid=1&SID=2EnIMCDg4pP6pA692aP&page=1&doc=3&cacheurlFromRightClick=no

http://ezproxy.stanford.edu:2176/full_record.do?product=WOS&search_mode=GeneralSearch&qid=1&SID=2EnIMCDg4pP6pA692aP&page=1&doc=3&cacheurlFromRightClick=no

155

149. Pinto, M. R.; Schanze, K. S.(2004) Proc. Natl. Acad. Sci. U.S.A. 101, 7505

150. Aditya Narayanan, Oleg P. Varnavski, Timothy M. Swager, and Theodore

Goodson (2008) Multiphoton Fluorescence Quenching of Conjugated Polymers for

TNT Detection. J. Phys. Chem. C, 112 (4), 881-884

151. Joel White et al (2008) Solid-State, DNA-Based Sensors for Volatiles. Plos Bio.

6, 1, 9

152. Sung H. Lim, Liang Feng, Jonathan W. Kemling, Christopher J. Musto and

Kenneth S. Suslick (2009) An optoelectronic nose for the detection of toxic gases.

Nature Chemistry, 1, 562

153 J. Gao, C. Str¨assler, D. Tahmassebi and E. T. Kool,(2002) J. Am. Chem. Soc.,

2002, 124, 11590–11591;

154. James N. Wilson and Eric T. Kool (2006) Fluorescent DNA base replacements:

reporters and sensors for biological systems. Org. Biomol. Chem., 4, 4265–4274

155. Teo, Y. N.; Kool, E. T.(2009) Bioconjugate. Chem. 20, 2371-2380.

156. Gao, J.; Watanabe, S.; Kool, E. T.(2004) J. Am. Chem. Soc. 126, 12748-12749.

157. Teo, Y. N.; Wilson, J. N., Kool, E. T.(2009) J. Am. Chem. Soc. 131, 3923-3933.

158 Ohlmeyer, M. H. J.; Swanson, M.; Dillard, L. W.; Reader, J. C.; Asouline, G.;

Kobayashi, R.; Wigler, M.; Still, W. C. (1993) Proc. Natl. Acad. Sci. U.S.A. 90,

10922-10926.

159. Teo, Y. N.; Wilson, J. N.; Kool, E. T. (2009) Chem. Eur. J. 15, 11551-11558

160. (a) K. Fujimoto, H. Shimizu and M. Inouye (2004) J. Org. Chem. 69, 3271–3275

(b) R. X.-F. Ren, N. C. Chaudhuri, P. L. Paris, S. Rumney, IV and E. T.

Kool,(1996) J. Am. Chem. Soc. 118, 7671–7678. (c) A. Okamoto, K. Tainaka, Y.

Ochi, K. Kanatani and I. Saito, (2006) Mol. BioSyst. 2, 122–127.

161. Chemical Sensors and Biosensors for Medical and Biological Applications (Ed.:

U. E. Spichiger-Keller), Wiley-VCH, Weinheim,1998

162. P. Simon, F. Kvanik in Optical Sensors for Industrial, Environmental and Clinical

Applications (Eds.: R. Narayanaswamy, O. S. Wolfbeis), Springer, Heidelberg,

2003, pp. 441 –465.

163. D.D. Lee, D.S. Lee, (2001) Environment Sensors, IEEE Sensors Journal 1, 214–

224.

156

164 (a) Thomas, S. W.; Joly, G. D.; Swager, T. M.(2007) Chem. Rev, 107, 1339–1386;

(b) Langhals, H.; Krotz, O.; Polborn, K.; Mayer, P. (2005) Angew. Chem., Int. Ed.

2, 16, 2427–2428; (c) Samuel, I. D. W.; Turnbull, G. A. (2007) Chem. Rev. 107,

1272–1295.

165. Shincheol Kang et al. (2009) Tetrahedron Letters 50, 2010–2012

166. J.V. Goodpaster, V.L. McGuffin (2001) Anal. Chem. 73, 2004.

167. H.A. Tajmir-Riahi et al. (1995) FEBS Letters 370, 105-108

169 (a) Michelson, A. M. and Todd A. R (1955) J. Am. Chem. Soc. 2632–2638 (b)

Khorana, H. G (1979) Science 203, 614–625 (c) Letsinger, R. L. and Mahadevan,

V.: (1965) J. Am. Chem. Soc. 80, 6212–6222 (d) Reese, C. B.(1978), Tetrahedron

34, 3143–3179

170. Beaucage, S. L. and Caruthers, M. H (1981) Tetrahedron Lett. 22, 1859–1862

171. Caruthers, M. H., Barone, A. D., Beaucage, S. L.et al.(1987) Methods Enzymol.

154, 287–313

172. Sandeep Verma and Fritz Eckstein (1998) Annu. Rev. Biochem. 67, 99–134

173. (a) Angew. Chem. Int. Ed. Engl. 30 (1991) 613-629 (b) Current Topics in

Medicinal Chemistry ( 2008) 8, 1379-1404 (c) Clinical Chemistry (2009) 55, 4,

670–683

174. (a) Kool E.T.(2002) Accounts of Chemical Research, 35 , 11, 936-943 (b) Kool

ET, Sintim H.O. (2006) Chemical Communications, 35, 3665-3675 (c) Krueger

AT, Kool ET (2007)Current Opinion in Chemical Biology, 11, 6, 588-594

175. Shaohui Wang and Eric T.Kool (1994) Nucleic Acids Research,Vol. 22, No. 12,

2326-2333

176. Daubendiek, S. L.; Ryan, K.; Kool, E. T.(1995) J. Am. Chem. Soc. 117, 7818-

7819

177. Dongyu Liu, Sarah L. Daubendiek, Martin A. Zillman, Kevin Ryan, and Eric T.

Kool (1996) J. Am. Chem. Soc. 118, 1587-1594

178. U. Lindstrvm, R. Chandrasekharan, L. Orbai, S. Helquist, G. Miller, S. Fernandez-

Lopez, E. Oroudjev, H. G. Hansma, Eric T. Kool. "Artificial Human Telomeres

from DNA Nanocircle Templates"(2002) Proc. Natl. Acad. Sci. USA. 99, 15953-

15958.

157

179. Larry J. Kricka, Paolo Fortina. (2009) Clinical Chemistry 55:4 670–683

180. http://openpit.wordpress.com/2009/10/12/immortality/

http://openpit.wordpress.com/2009/10/12/immortality/

Documents

MODIFIED NUCLEOTIDES AND NUCLEIC ACIDS AS MOLECULAR …gc497qr2572/Samantak Ghosh Ph.D... · Wang (for the RNA polymerase studies) and Dr. F. Samain (for the polyfluorophore project)