Upload
others
View
2
Download
0
Embed Size (px)
Citation preview
FALL FINAL REVIEWName:________________________
Date:_______________Hour:_____
Short Answer.
Answer the following questions by providing the correct answer in the space provided.
1. Is this cell division process Mitosis or Meiosis (circle)? Number the phases 1-10 in the order that they occur.
(1) (2) (7) (5) (6) (4) (3) (9) (8)
_______ _______ _______ _______ _______ _______ _______ _______ _______
2. Is this cell division process Mitosis or Meiosis (circle)? Number the phases 1-5 in the order that they occur.
(1) (4) (5) (2) (3)
______ ______ ______ ______ ______
3 . List the similarities and the differences between mitosis and meiosis in the Venn diagram provided
(Meiosis) (Mitosis)
(Both)
(~produces diploid cells~cells are identical to parent cells) (~produces sperm & eggs~produces haploid cells~division happens twice)
(~DNA is replicated~cell division~begin diploid)
4. List some advantages and disadvantages of both sexual reproduction and asexual reproduction.
(~SEXUAL = +genetic variation –takes effort –takes a long time~ASEXUAL = +fast reproduction + little effort –all genetically identical)
(temp, pH, changing the shape of the enzyme) (substrate)5. The substance that an enzyme reacts with which fits exactly into the active site is called a _________________.
(ase)6. The function of an enzyme can be lowered or altered by _________________.
7. This suffix is always found in the name of an enzyme _________________.
(endothermic)8. This term describes a chemical reaction which absorbs energy IN during the breakdown of an organic compound _________________.
(ATP)9. This molecule is able to store potential energy in phosphate bonds that can be broken thereby releasing energy to cells for metabolism purposes _________________.
(eukaryotic)
10. If a cell contains a nucleus, it must be a(n) ________________ cell.
(bacteria)
11. Name an organism that is not composed of Eukaryotic cells __________________.
(ribosomes, cytoplasm)
12. Name two organelles that are found in both prokaryotic and eukaryotic cells__________________.
Multiple Choice.
(A)Answer the following questions by choosing the most correct answer from the choices provided.
_________13. Which of the following statements about enzymes is true?
a. Enzymes speed the reactions which occur during food digestion.
b. Enzymes always slow the rate at which a chemical reaction occurs.
c. Enzymes change the amount of product created during a chemical reaction.
d. Only a small number of the body’s metabolic processes involve enzymes.
(B)
_________14. Look at the graph to the right. Which one of these lines is employing the use of an enzyme?
a. Line A
( A)b. Line B
c. Neither line
d. Both lines are employing the use of an enzyme
( B)
Matching.
Match the following definitions on the left to the words on the right.
(D) (a. Golgi Bodyb. Nucleolusc. Nucleusd. Ribosomese. Rough ERf. Smooth ER)
_________15. Tiny dots or spheres that act like protein production factories
(F)
_________16. Network of narrow round tubes that detoxify poisons and
(A)produce lipids
_________17. "Packages" the cell materials for transport within or out of the
cell like the Post Office, UPS, etc.
(C)
_________18. The command center of the cell where all cellular activities are
(E)coordinated.
_________19. Network of tubes that serve as a highway system for transporting
proteins
Multiple Choice.
(C)Answer the following questions by choosing the most correct answer from the choices provided.
________20. What symptoms would you expect for a living organism which had major damage to all of its Lysosomes?
a. Limited growth because of the cell’s inability to catch sunlight and make sugars
b. Limited growth because altered genetic instructions cause the production of nonfunctional proteins
c. Limited growth because large biomolecules are not broken down into small molecules needed by the cell
(B)d. Lack of energy because the cell cannot process sugars into ATP
________21. What symptoms would you expect for a living organism which had major damage to all of its DNA?
a. Limited growth because of the cell’s inability to catch sunlight and make sugars
b. Limited growth because altered genetic instructions cause the production of nonfunctional proteins
c. Limited growth because large biomolecules are not broken down into small molecules needed by the cell
d. Lack of energy because the cell cannot process sugars into ATP
(D)
_________22. What symptoms would you expect for a living organism which had major damage to all of its mitochondria?
a. Limited growth because of the cell’s inability to catch sunlight and make sugars
b. Limited growth because altered genetic instructions cause the production of nonfunctional proteins
c. Limited growth because large biomolecules are not broken down into small molecules needed by the cell
(B)d. Lack of energy because the cell cannot process sugars into ATP
__________23. Suppose a certain poison kills cells by blocking the pores in the nuclear membrane. Which of the following types of cells would NOT be affected by this type of poison?
a. plant cells b. bacteria cells c. human cells d. all types of cells would be affected
(D)
__________24. Identify the main function of the nucleolus?
a. the command center that directs all cell activities
b. manufactures the spindle used to help the cell divide into 2 cells
c. provides a storage location for digestive enzymes used by the cell
d. manufactures new ribosomes that are then used by the cell
(A)
___________ 25. A contagious disease causes the breakdown in a cell’s Rough ER function. As a result, which of the following biomolecules would be in a limited supply in the cell?
a. proteinsb. ATPc. carbohydratesd. lipids
(A)
___________26. An inherited disease causes a person’s cells to make broken Smooth ER. As a result, which of the following cell consequences would be expected?
a. toxic byproducts will build up and there will be a shortage of new lipid molecules
b. there will be a shortage of digestive enzymes and new proteins
c. the cell will run out of ATP energy
d. the cell will not be able to copy its genetic instructions
(D)
__________27. Ribosomes, the endoplasmic reticulum, and the Golgi apparatus work together to:
a. convert solar energy to chemical energy
b. pass on genetic information
c. break down and recycle materials
d. make and deliver proteins
Matching.For questions 28-38, tell whether the description or cell diagram best applies to Mitosis or Meiosis , BOTH or Neither
(B)A = MitosisB = MeiosisC = BOTH Mitosis & Meiosis D = Neither Mitosis & Meiosis
(A)______ 28) allows for new gene combinations as paired chromosomes trade genes through “crossing over”
(C) (DNA Replication)______ 29) functions in growth, repairing injuries, and replacing old body cells
(B)______ 30) involves ripping “double” chromosomes into “single” chromosomes
(C) (12)______ 31) produces haploid sperm or eggs
(A)______ 32) begins with a Diploid cell
(C)______ 33) produces diploid daughter cells
(B)______ 34) produces daughter cells with “single” chromosomes
(C)_____ 35) produces daughter cells with “double” chromosomes
(B) (13) ((2n)) ((n))_____ 36) see diagram #12
(A) ((2n))_____ 37) see diagram #13
(A)_____ 38) see diagram #14
_____ 39) see diagram #16
(16) (15) (14)
Use the NUMBERS of the terms below to answer questions #39-51 based off the cell pictures provided.
1. NUCLEUS2. NUCLEOLUS3. GOLGI BODY4. SMOOTH ER
5. ROUGH ER6. RIBOSOMES7. VACUOLE8. CELL MEMBRANE
9. CELL WALL10. CENTRIOLES11. LYSOSOME12. CHLOROPLASTS
13. CYTOPLASM14. VESICLES15. MITOCHONDRIA
(40)
(39) (41)
(42)
( 44 (whole structure)) (45) (46) (47) ( 43 (little dots)) (48)
(40) (45) (43) (44) (47) (48) (49) (41) (42) (50) (51) (46)
(6) (1) (2) (13) (10)
39. ___________40. ___________41. ___________42. ___________43. ___________
(15) (4) (8) (12) (5)
(9) (7) (12)44. ___________45. ___________46. ___________47. ___________48. ___________
49. ___________50. ___________51. ____________
Short Answer.
Answer the following questions by providing the correct answer in the space provided.
(hydrophillic)
52. The term which describes a "water-loving" substance like the head end of a phospholipid molecule is ______________________.
(fatty acid tails)
53. This plasma membrane component is chemically "hydrophobic"________________________.
(cell membrane)
54. The term "selectively permeable" BEST describes this cell structure ______________________.
(osmosis) (facilitated diffusion)55. The process of moving a particle from high concentration to low concentration ([H][L]) through a membrane transport protein is called ______________________.
56. The diffusion of WATER across a selectively permeable membrane is ______________________.
(active transport)57. When energy (ATP) is needed by the cell to move particles across a membrane it is called this type of transport ______________________.
58. What would happen to a soft-bodied slug if you placed it into a glass of pure water?
(it would swell because there is more salt inside the slugs body)_______________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________
Short Answer.
Study the cups of lemonade below to answer 59-61. Each glass of lemonade contains a chicken egg with the shell removed.
A B C
90 % H2O 55 % H2O 70 % H2O
10 % Solutes 45 % Solutes 30 % Solutes
75 % H2O 65 % H2O 30 % H2O
25 % Solutes 35 % Solutes70 % Solutes
(B)
59. This cup/s of lemonade is a hypotonic solution relative to the chicken egg _______________
(B)
(NONE)60. This cup/s of lemonade would result in a NET flow of water IN to the egg _______________
61. This cup of lemonade is currently in a state of Equilibrium _______________
Multiple Choice.
Answer the following questions by choosing the most correct answer from the choices provided.
(B)
_________62. Identify the missing reactant for a Photosynthesis Chemical Reaction? H2O + ____ sugar + O2
a. Oxygen (O2)b. Carbon Dioxide (CO2)c. Nitrogen (N2)d. Ammonia (NH3)
(A)
_________63. Identify the missing reactant for a Cellular Respiration Chemical Reaction? Sugar + ____ CO2 + H2O
(D)a. Oxygen (O2)b. Carbon Dioxide (CO2)c. Nitrogen (N2)d. Ammonia (NH3)
_________64. When given CO2, determine which of the following is necessary for plants to complete photosynthesis?
a. Oxygen (O2)b. Ammonia (NH3)c. Glucose (C6H12O6)d. Water (H2O)
(D)
_________65. Identify which of the following is a necessary product of cellular respiration:
(B) a. Oxygen (O2)b. Ammonia (NH3)c. Glucose (C6H12O6)d. Water (H2O)
_________66. Which of these best explains the difference between the way animals and plants exchange gases with their
environments?
a. Animals use only photosynthesis, while plants use both photosynthesis and respiration.
b. Animals use only respiration, while plants use both photosynthesis and respiration.
c. Animals use both photosynthesis and respiration, while plants use only respiration.
d. (D)Animals use both photosynthesis and respiration, while plants use only photosynthesis.
________67. Biology students are studying photosynthesis…which will cause the greatest increase in photosynthesis rate?
a. increase water and oxygenc. increase carbon dioxide and sugar
(C)b. increase sugar and oxygend. increase carbon dioxide and water
________68. Which of the following do the processes of Photosynthesis and Cellular Respiration NOT have in common?
a. both involve the exchange of gases in a cellc. both require the input of energy from light
(B)b. both use ATP molecules for temporary energy storaged. both occur in Eukaryotic cells
_________69. A student is collecting the gas given off from a plant in bright sunlight at a temperature of 27°C. The gas being collected is probably ______________________.
a. carbon dioxideb. oxygenc. hydrogend. carbon monoxide
(D)
_________70. Photosynthesis uses sunlight to convert water and carbon dioxide into:
a. oxygenb. glucosec. ATP and oxygend. oxygen and glucose
(B)
________71. Energy is released from ATP when:
a. a phosphate group is addedc. ATP is exposed to sunlight
(C)b. bonds between phosphate groups are brokend. adenine binds to ribose
_________72. Identify the molecule below which is broken down by cellular respiration to form water and carbon dioxide and release energy for the cell?
a. DNAb. oxygenc. glucosed. enzyme
(C)
________73. Photosynthesis is to chloroplasts as cellular respiration is to…
a. chloroplastsb. cytoplasmc. mitochondriad. nucleus
(A)
________74. What is the correct equation for cellular respiration?
a. 6O2 + C6H12O6 6CO2 + 6H2O c. 6O2 + C6H12O6 CO2 + 6H2O
b. 6CO2 + 6H2O 6O2 + C6H12O6 d. 6CO2 + 6H2O O2 + C6H12O6
(D)
________75. Which of the following is something that SPEEDS up the rate of photosynthesis?
a. low waterb. low temperaturesc. excessive heatd. increased heat
(C)
________76. Which of the following SLOWS DOWN the rate of photosynthesis?
(A)a. increased waterb. decreased glucosec. decreased lightd. increased oxygen
________77. Which of the following is something that SPEEDS up the rate of cellular respiration?
a. increased glucoseb. decreased glucosec. extreme temperaturesd. low water
(D)
________78. Which of the following SLOWS DOWN the rate of cellular respiration?
a. increased waterb. increased glucosec. increased lightd. decreased oxygen
Short Answer.
Answer the following questions by providing the correct answer in the space provided.
79. These two scientists proposed the double helix model of DNA ___________________ and ______________________.
80. Describe what happens in the final step in transcription:
________________________________________________________________________________________________________________________________________________________________________________________________________________________
(PO45-C SugarNitrogen base)81. What is the diagram of?
82. List three ways that RNA and DNA differ.
1. ___________________________________
2. ___________________________________
3. ___________________________________
Multiple Choice.
(B)Answer the following questions by choosing the most correct answer from the choices provided.
________83. Which of the following would NOT likely result in a mutation or change of DNA letter codes?
a. replication of the DNA blueprintc. exposure to X-ray energy
b listening to a loud stereo system d. exposure to strong chemicals in cigarette smoke
(C)
_________84. How many Nitrogen base letters are grouped in a CODON and an ANTICODON?
a. 2b. 20c. 3d. 64
(#85#86)
(C)
_________85. The process of making an mRNA copy of a DNA gene code is called? (see diagram above #85)
a. translationb. replicationc. transcriptiond. cloning
(A)
________86. The process of converting a mRNA code into a specific protein chain? (see diagram above #86)
a. translationb. replicationc. transcriptiond. cloning
(C)
________87. What is the correct complementary DNA strand for: ACCAGTTAG?
(B)a) TGGTGATAGb) CGGCAGGTCc) TGGTCAATCd) TGGTCTTTC
________88. What is the correct complementary RNA strand for ACCAGTTAG?
a) UGGUCUUUGb) UGGUCAAUCc) TGGTCAATCd) TGGTCUUTC
(D)
_________89. Which of the following is NOT part of an RNA nucleotide?
a) riboseb) nitrogen bases c) phosphate groupd) deoxyribose
(B)
_________90. When does DNA replication occur?
a) after cell divisionb) before cell divisionc) anytimed) never
(B)
________91. Only DNA mutations in ___________ cells can be inherited by the next generation?
(A)a. brainb. spermc. skind. liver
________92. Which of the following is a nucleotide found in DNA?
a. ribose + phosphate group + uracilb. deoxyribose + phosphate group + cytosine
c. ribose + phosphate group + thymined. deoxyribose + phosphate group + uracil
(C)
________93. What happens during the process of translation?
a. transfer RNA is made from messenger RNA b. copies of DNA molecules are made
c. the cell uses information from messenger RNA to make proteinsd. Messenger RNA is made from DNA
Short Answer.
Given the following DNA strand, answer questions 94-96: GGTACGGAGAACCTTTTACT
(CCA-TGC-CTC-TTG-GAA-AAT-GA)
94. What would the complementary DNA strand be formed during replication? __________________________________________
95. What would the mRNA strand be that formed during transcription? CCAGUCCUCUUGGAAAAUGA
96. What amino acid sequence would tRNA translate the mRNA into? (HINT: Don’t forget you have to find the codon that codes for “start” to begin and the codon that codes for “stop” to end) START-PRO-LEU-GLY-LYS-STOP
(24)
97. A cell with 24 chromosomes undergoes Mitosis twice. Each daughter cell will contain ______chromosomes.
(40)
98. Two gametes, each containing 20 chromosomes, fuse during fertilization. The zygote will contain _____chromosomes.
(Diploid)
99. A body or somatic cell (such as a skin cell) is said to be ________.