KOCH Et Al - 2009 - Impacto HR Na RS

8/12/2019 KOCH Et Al - 2009 - Impacto HR Na RS

http://slidepdf.com/reader/full/koch-et-al-2009-impacto-hr-na-rs 1/8



cellular radiosensitivity as observed in lymphocytes or fibroblasts

when using the metaphase analysis may also result from differ-

ences in this further reduction of DSBs.

So far, the specific pathway by which this reduction occurs is

not known. It was tested here whether this reduction is performed

by HR, because HR is reported to be active especially in S/G2 phase

[23,24,33,42]. For this purpose, HR was inhibited by siRNA medi-

ated down-regulation of RAD51, which is the central protein of thisrepair pathway [1,50]. RAD51 was measured via western and foci

formation, DSBs by cH2AX foci formation, chromosomal damage

by PCC, G0 or G2-assay, and cell survival by colony forming assay.

Materials and methods

Cell culture

Experiments were performed with the rodent cell lines CHO K1,

CHO 10 B, AA8, V79, Rat1, and the radiosensitive mutants Xrs5 and

R7080. All cell cultures were maintained in a-MEM (Invitrogen)

containing 5% FBS (Invitrogen) in a humidified incubator at 37 C.

For experiments, cells were kept in a-MEM in RNase-free water

supplemented with 5% FBS. Cultures were routinely checked formycoplasma contamination.

The experiments with lymphocytes were carried out with blood

samples of 2 ml taken from volunteers. For stimulation, blood was

diluted in 4.5 ml RPMI (Gibco) medium supplemented with 15%

FCS and triggered to enter cell cycle with 2.5% PHA (Boehringer).

Irradiation

Irradiation was performed using a Philips therapeutic X-ray ma-

chine operating at 220 kVp, 15 mA with 0.5 Cu filter at a dose rate

of 1.0–2.0 Gy/min depending on the flask size.

Transfection of siRNA

HPLC purified siRNA was supplied by Dharmacon and Qiagen.

The siRNA was reconstituted according to manufacturer to yield

a 20 lM stock solution. Sequences were designed according to

the requirements published by [19] using the mRNA sequence

from GenBank gi155225; scrambled RNA (scrRNA) was used as

control. Two target sequences were used: AAGCUGGUUUC-

CAUACGGUGG and AAGUGGAUGGAGCAGCCAUGU; for scrRNA:

AAUGUGCGAGAGUUGCACGAG and AAUAGGCAUUGCGCGUGU-

GUC. Selected sequences were blasted against EST libraries. The

siRNA was transfected using TransIT-TKO. Briefly, siRNA (1:8.3)

and TransIT-TKO (1:12.5) were each diluted in a-MEM without

serum in separate tubes and incubated for 5 min. Diluted siRNA

and TransIT-TKO were gently mixed and incubated for 20 min to

allow the formation of complexes. Confluent cells were harvestedand stimulated by re-seeding. After 1 h of incubation, 200 ll siR-

NA–TransIT-TKO complexes were added to cells, resulting in a con-

centration of 200 nM siRNA and 6.7 ll/ml medium for TransIT-

TKO. After further incubation of 4 h, transfection reaction was di-

luted by adding 1 ml medium.

Western blotting

For extraction of proteins cell pellets were resuspended in

extraction buffer and the suspension was frozen in liquid nitrogen

and thawed at 37 C four times. After centrifugation at 11,000 rpm

for 10 min at 4 C supernatants were collected and protein quanti-

fied using the BCA method (Pierce). Boiled samples (20lg/ml)

were resolved by SDS–PAGE using a 12% gel. After transfer to aPVDF membrane, proteins were detected by anti-RAD51 IgG (onco-

gene, upstate) or anti-b-actin IgG (Sigma), horseradish peroxidase

conjugated anti-mouse IgG (Amersham) and enhanced chemo-

luminescence detection reagents (Amersham).

Immunofluorescence microscopy

RAD51 foci were detected according to [32]. Cells were fixed

with 2% formaldehyde in PBS for 15 min, permeabilized using0.1% Triton X-100 in PBS and blocked with 0.15% (w/v) glycine

and 0.5% (w/v) BSA in PBS overnight at 4 C followed by 30 min

at 37 C. Foci were detected using an anti-RAD51 antiserum (onco-

gene) and a Fluorescein-linked anti-rabbit Ig (Amersham). Slides

were mounted in DAPI/Antifade (0.1 lg/ml, Qbiogene). Cells were

analyzed by means of fluorescence microscopy.

Chromosomal damage

PCC

Premature chromosome condensation was performed as previ-

ously described by [39]. Briefly, CHO cells were used as mitotic in-

ducer of PCC. Mitotic cells were obtained by re-seeding confluent

cells into two 75 cm2 plastic flasks (Falcon) at half of their original

density and after 16 h cells were paused in metaphase by adding

0.2 lg/ml Colcemid (Gibco) for 4 h. The mitotic cells were collected

by selective detachment, stored on ice, with a routinely checked

mitotic index of about >95%.

An equal number (106) of mitotic and G1/G0 cells were resus-

pended and centrifugated at 150 g for 10 min at 4 C. The superna-

tant was discarded, and the pellet was carefully mixed with 100 ll

55% PEG (Boehringer) in order to initiate cell fusion. After 1 min,

the reaction was stopped by adding two times 500 ll PBS. Suspen-

sion was centrifugated with 150 g for 4 min, the supernatant was

discarded and the cells were resuspended in 1 ml a-MEM contain-

ing 106 M Colcemid followed by incubation in a humidified incu-

bator (5% CO2/95% air) at 37 C for 50 min which allowed the

condensation of the DNA. Thereafter, cells were treated in hypo-

tonic (0.075 M) KCl-solution and fixed several times in Carnoy’sfixative. Cells were dropped on pre-cleaned wet slides, stained

with 2% Giemsa (Sigma) for 7 min and embedded permanently

with Entellan (Merck).

Metaphase analysis

Irradiated cells were arrested in metaphase by adding Colcemid

(0.2 lg/ml, Gibco) for 6 h (G1-assay) or 1 h (G2-assay), respec-

tively. The metaphase chromosomes were prepared as described

previously [5–7]. Slides were coded and 25 metaphases were

scored per slide with a total number of about 100 cells per sample.

Lethal G1 aberrations scored included excess acentric fragments

and dicentric chromosomes. For G2 assay, all chromatid type aber-

rations including gaps, chromatid fragments, isochromatid frag-

ments, translocations and triradials were scored and calculatedas breaks per cell.

Clonogenic survival

Cell survival was determined by colony assay. After treatment

cells were plated in appropriate numbers in 100 cm2 petri dishes

and after 7 d cells were fixed and stained for colony assay. The sur-

vival of irradiated cells was normalized to the plating efficiency of

non-irradiated cells.

DSB repair

cH2AX foci were detected according to [41]. Cells grown on tis-

sue cultures slides were fixed in 2% paraformaldehyde for 15 min,washed three times in PBS for 10 min each, permeabilized on ice

266 Effect of HR on individual radiosensitivity



for 5 min with 0.2% Triton X-100 in 1% BSA/PBS, washed with 1%

BSA in PBS and blocked with 3% BSA in PBS for 1 h at room temper-

ature. The slides were then incubated with anti-c-H2AX antibody

(1:100 in 0.5% Tween 20/1% BSA in PBS, upstate) for 1 h, washed

three times with 0.5% Tween 20/1% BSA in PBS for 10 min each

time, and incubated with Alexa Fluor 594 goat anti-mouse IgG

(1:600 in 0.5% Tween 20/1% BSA in PBS, molecular probes) for

1 h at room temperature. Cells were washed four times in 0.5%Tween 20 in PBS for 10 min each time and mounted by using

mounting medium with 4,6-diamidino-2-phenlyindole (Vector

Laboratories). Fluorescence images were captured by using a Zeiss

Axioplan 2 epifluorescence microscope equipped with a charge-

coupled device camera and Optimas software. For quantitative

analysis, foci were counted by fluorescence microscopy using a

1000-fold magnification. One hundred cells per dose per slide

and experiment were evaluated blindly.

Data evaluation

Statistical analysis, curve fitting and graphs were performed by

means of the computer program Prism (GraphPad Software, San

Diego, USA). Data are given as means (±SEM) of replicate

experiments.

Results

Fig. 1 shows the DSB repair kinetics as measured for quiescent

CHO K1 irradiated with 6 Gy. DSBs were either detected via PCC

technique (Fig. 1B) or cH2AX foci measurement (Fig. 1C). The first

technique was used to unequivocally identify G1 cells via the pres-

ence of single condensed chromatin fibres, with S-phase cells dis-

playing pulverised chromatin and G2 phase cells doubled

chromatin fibres [25]. The repair kinetics, which started 30 min

after irradiation, showed a rapid decline with a plateau reached

4–6 h after irradiation. This level of about 7.5 fragments per cell re-

mained constant even up to 26 h after irradiation (Fig. 1D, h). Al-

most identical kinetics were observed (Fig. 1D, s) when DSBs

were detected via cH2AX foci formation (Fig. 1C).The number of fragments as well as DSBs was also measured for

cells kept in quiescence for only 6 h but then stimulated into cell

cycle by plating at lower density followed by a further repair incu-

bation for 20 h (Fig. 1D; stimulated, j, d). For fragment analysis

cells were arrested in metaphase by adding Colcemid (Fig. 1B). In

stimulated cells the number of both fragments and cH2AX foci

measured 26 h after irradiation was significantly less (fragm.,

p = 0.029; cH2AX, p = 0.03, Mann Whitney test) compared to qui-

escent cells. This result indicates that most of the DSBs, which re-

mained un-rejoined in quiescent G1 cells, can be removed when

cells are stimulated into cell cycle.

We also checked whether the further reduction of DSBs de-

scribed above for CHO cells occurs in other cell lines as well. For

this test, cell cultures which were grown to confluence or kept in

G0 (lymphocytes) were irradiated with 2 Gy and then incubated

at 37 C for either 6 or 26 h. In case of the short incubation cells

were stimulated into cell cycle by re-seeding at lower concentra-

tion or addition of PHA (lymphocytes) followed by a further incu-

bation at 37 C for 20 h. For non-stimulated cells, chromosomal

damage was detected by PCC and for stimulated cells by meta-

phase analysis and the respective data are listed in Table 1. For

all cell lines tested, the number of fragments measured after

0 6 12 18 241

10

5

50

quiescent

6Gy 37ºCCHO K1

chromosomal fragments

γ H2AX foci

s t i m u l a t e d

Time at 37ºC after X-irradiation, h

N u m b e r o f d s b

s p e r c e l l

A

D

B C

Fig. 1. Kinetics of DSB repair measured for X-irradiated CHO K1 cells (C). Confluent cells were irradiated with 6 Gy followed by incubation for either 26 h (quiescent) or only

6 h followed by stimulation into cell cycle by re-seeding at lower density and a further incubation for 20 h (stimulated). DSBs were scored either by PCC (A, h), metaphasetechnique (B, j) or cH2AX foci technique (C, s, d). Data were corrected for background values and error bars represent SEM.

K. Koch et al. / Radiotherapy and Oncology 90 (2009) 265–272 267





In order to confirm the data described above for quiescent and

proliferating CHO cells, effect of RAD51 knock-down on repair of

radiation-induced DSBs was also tested using the cH2AX foci

technique. For these experiments quiescent or exponentially

growing CHO K1 cells were both irradiated with 2 Gy followedby an incubation for 24 h before DSBs were detected via cH2AX

foci measurement. For RAD51 knock-down cells were treated

with siRNA starting 20 h prior to irradiation. It can be seen in

Fig. 5 that DSB repair capacity was not affected by this treatment

as long as CHO K1 cells were kept in confluence. Irrespective of

the treatment used, there are always about 2.1 un-rejoined DSBs

per cell in quiescent cells. This value agrees fairly well with the

level of 2.3 non-rejoined PCC fragments described above

(Fig. 3A). In proliferating cells, the number of un-rejoined DSBs

measured was clearly reduced with about one remaining DSB

per cell when HR was not suppressed. This reduction was com-

pletely abolished, when HR was suppressed ( p = 0.036, Mann

Whitney test). These data show that HR is not active in G1 as sug-

gested above but is involved in DSB repair when cells are prolif-

erating through S/G2.

Discussion

The aim of this study was to analyse the impact of homologous

recombination (HR) on individual cellular radiosensitivity. This

sensitivity is characterized by a substantial variation and wasshown to be a potential indicator for the individual risk of acute

or late tissue effects after radiotherapy [6,7,26].

In these studies individual radiosensitivity was measured with

lymphocytes using the metaphase analysis. For this purpose,

non-proliferating lymphocytes taken from blood samples were

irradiated in vitro and then stimulated into cell cycle by PHA fol-

lowed by incubation for 44–72 h, after which cells are arrested in

metaphase by the addition of Colcemid. This protocol implies that

for these lymphocytes the overall repair capacity is determined by

repair processes acting prior to and after stimulation into cell cycle.

It was previously shown for non-proliferating cells that DSB re-

pair is completed 4–6 h after irradiation with a substantial fraction

of un-rejoined DSBs still remainig, but that most of these DSBs are

removed when cells are stimulated into cell cycle [4,7]. This finding

was now confirmed for CHO K1 cells, whereby DSBs were detected

0 8 16 24 32 40 48

0.5

1.0

1.5

2.0

2.5

3.0 CHO K1

+siRNA+scrRNA

Time after restimulation, h

R e l a t i v e R A D 5 1 e x p r e s s i o n

0 G y

1 2 G y

1 2 G y + s

c r R N

A

1 2 G y +

s i R N

A0

20

40

60

80

100

C e l l s w i t h > 5 R A D 5 1 f o c i , %

50

40

kD

40

Rad51

ß-actin

Stimulation

siRNA

scrRNA

++

+

+ — —

—

—

—

— —

+

1 2 3 4

RAD51-Foci

DNA

12 Gy

siRNA

scrRNA

—

—

—

+

— —

— +

+

+

+

+

A

C D

B

Fig. 2. Knock-down of RAD51 in CHO K1 cells by siRNA. Confluent cells were stimulated by re-seeding at lower density and RAD51 was down-regulated by immediate

transfection with siRNA. (A) RAD51 proteins as detected by Western blotting 18 h after stimulation. (B) Kinetics of RAD51 expression after stimulation; RAD51 signals were

corrected by b-actin signals and normalised to data of mock-treated cells. Effect on radiation-induced RAD51 foci formation. Exponentially growing cells were irradiated with

12 Gy followed by incubation for 8 h. For RAD51 knock-down cells were transfected with siRNA 24 h prior to irradiation. (C) RAD51 foci detected by immunofluorescence

using a specific antibody and counterstaining of nuclei by DAPI. (D) Quantitative analysis of RAD51 foci formation expressed as percentage of cells with more than five foci per

cell. Error bars represent SEM.




using both chromosomal assays as well as cH2AX foci technique

(Fig. 1). This phenomenon was also observed in other cell lines

[9,18,43,47] but not in the human fibroblast line AG1522 [13].It could be demonstrated here by using different cell lines that

this phenomenon cannot simply be explained by selective apopto-

tic degradation or permanent G1-arrest (Table 1). We could also

exclude that this repair is performed by NHEJ, because the reduc-

tion of DSBs was also seen in cell lines deficient in this pathway

(Table 1).

Data presented by Durante et al. [18] suggested that this reduc-

tion of DSBs primarily occurs at the end of G2 phase. Since in late S

and G2 phase DSBs are known to be also processed by HR

[23,24,42], we tested whether this pathway might be responsible

for the decline of DSBs. For this purpose HR was depressed by RNAi

against RAD51, which is the central protein of the HR pathway

[1,13,50]. A transient approach was chosen because knockout of

RAD51 is lethal [49]. The siRNA treatment completely abolishedRAD51 induction normally seen during cell cycle [10,51] with a to-

tal reduction of RAD51 of about 70% (Fig. 2A and B). This extent is

similar to that achieved by Lio et al. [34] in HeLa cells. The siRNA

treatment also depressed the formation of RAD51 foci normallyoccurring after irradiation with 12 Gy (Fig. 2C and D), whereby

the extent of foci reduction was similar to that observed for ham-

ster cell lines deficient in HR [22,36]. Such a decreased formation of

RAD51 foci is generally considered to be a hallmark of impaired HR

[2,21,38,48].

The suppression of HR by knock-down of RAD51, however, did

not affect the further reduction of DSBs seen when quiescent CHO

K1 cells were stimulated into cell cycle (Fig. 3). A diminished re-

pair after siRNA treatment was only observed when CHO K1 cells

were irradiated in late S/G2 phase (Fig. 4). In line with this,

knock-down of RAD51 did not affect survival when cells were

irradiated in G0 but only when irradiated in late S/G2 (Figs. 3

and 4). A moderate increase in radiosensitivity in proliferating

cells was also observed by other authors when RAD51 wasdown-regulated [11,34,44].

0 2 4 6

0

2

4

6

8

quiescent

stimulated

X

X+siRNAX+scrRNA

X

X-ray dose, Gy

L e t h a l c h r o m o s o m e a b e r r a t i o n s p e r c e l l

0 3 6 9 1210-3

10-2

10-1

1

X

X+scrRNA

X+siRNA

X-ray dose, Gy

S u r v i v a l

A B

Fig. 3. Effect of RAD51 knock-down on chromosomal damage and survival of CHO K1 cells irradiated in confluence. (A) For chromosomal damage, cells irradiated in

confluence were incubated at 37 C for either 26 h (quiescent) or only 6 h; the latter followed by stimulation into cell cycle for another 20 h before arrested in metaphase

(stimulated). For quiescent cells chromosomal damage was determined by PCC technique and for stimulated cells by metaphase analysis. (B) Survival was measured for

quiescent cells irradiated with X-ray doses up to 12 Gy, but otherwise treated as described above for stimulated cells and cells were plated for colony assay 16 h after

stimulation. For RAD51 knock-down cells were always transfected with siRNA immediately after stimulation. Error bars represent SEM.

Chromatid aberrations

0.5 Gy 0.5 Gy 0.5 Gy +scrRNA +siRNA

0.0

0.5

1.0

1.5

2.0 Isochromatid fragments

0.5 Gy 0.5 Gy 0.5 Gy +scrRNA +siRNA

G 2 - A b e r r a t i o n s p e r c e l l

0.5 Gy 1.5 h at 37ºC

0 3 6 9 1210-3

10-2

10-1

1

X

X+scrRNA

X-ray dose, Gy

S u r v i v a l

X+siRNA

A B

Fig. 4. Effect of RAD51 knock-down on chromatid damage and survival of CHO K1 cells irradiated in S/G2. Cells grown to confluence were stimulated into cell cycle by re-

seeding at lower density with irradiation 20 h after stimulation. (A) For chromatid damage, cells were irradiated with 0.5 Gy followed by incubation for 0.5 h before cells were

collected in metaphase for 1 h by adding Colcemid. (B) For survival, cells were irradiated with doses up to 12 Gy followed by incubation for 16 h before cells were plated for

colony formation. For RAD51 knock-down cells were always transfected with siRNA immediately after re-seeding. Error bars represent SEM.




These data demonstrate that the repair of DSBs seen when CHO

K1 cells are stimulated into cell cycle is not performed by HR, how-

ever, HR is obviously involved in DSB repair when cells are irradi-

ated in late S/G2 (Fig. 1). It was already reported by others that HR

is especially active in S/G2 [23,24,33,42], but the data shown here

indicate that this activity is restricted to only those DSBs which are

actually induced in these two phases, whereas HR cannot process

DSBs that originate from G1. Detailed analysis of the chromosomal

damage measured for cells irradiated in late S/G2 revealed thatRAD51 knock-down affects DSB repair only for damage resulting

in chromatid but not isochromatid breaks (Fig. 4A). This observa-

tion implies that HR can only process DSBs in S/G2 when the

respective sister chromatids are still intact but not when both sis-

ter chromatids are damaged at identical sites. This finding also ex-

plains why DSBs which remained un-repaired in G1 cannot be

processed by HR, even when cells were triggered to proliferate

through S/G2 (Fig. 3A). Once passed through replication an un-re-

paired DSB will be converted into a chromosomal aberration with

two sister chromatids broken at identical site, which is – according

to the data described above – an inadequate substrate for RAD51-

dependent HR. These results are also in line with the recent data

reported by Saintigny et al. [46] showing that HR is not involved

in DSB repair when cells are arrested in G1, but only when cells

are stimulated into cell cycle immediately after irradiation at the

G1/S border. Probably the DSB repair seen when cells are stimu-

lated into cell cycle is performed by SSA, which is normally sup-

pressed by RAD51 [37].

The data presented here also imply that the variation of individ-

ual radiosensitivity seen when using metaphase analysis cannot be

ascribed to differences in HR. It was previously observed that this

variation, when measured with fibroblasts, cannot be attributed to

differences in the expression, localisation or activity of major NHEJ

proteins [29,31].Differences in DSB repair capacity, which are con-

sidered to the main cause for the variation of individual radiosen-

sitivity, do probably not result from changes of HR or NHEJ

complexes but are caused by other repair pathways such as SSA

[14,24,37,42,45] or are due to differences in factors such as chro-

matin structure [8,15].

In summary, it is shown here that the individual cellular radio-

sensitivity as measured by metaphase analysis does not depend on

HR.

Acknowledgements

The authors thank S. Bornkessel for excellent technical assis-

tance and Dr. J. Dahm-Daphi for critically reading the manuscript.This work was supported by Roggenbuck-Stiftung, Grant No. 0040/

102.

References

[1] Baumann P, West SC. The human Rad51 protein: polarity of strand transfer andstimulation by hRP-A. EMBO J 1997;16:5198–206.

[2] Bishop DK, Ear U, Bhattacharyya A, Calderone C, Beckett M, Weichselbaum RR,et al. Xrcc3 is required for assembly of Rad51 complexes in vivo. J Biol Chem1998;273:21482–8.

[3] Borgmann K, Dede M, Wrona A, Brammer I, Overgaard J, Dikomey E. For X-irradiated normal human fibroblasts only half of cell inactivation results fromchromosomal damage. Int J Radiat Oncol Biol Phys 2004;58:445–52.

[4] Borgmann K, Dikomey E. Relationship between PCC fragments and cell killingstudied in X-irradiated CHO cells and two radiosensitive mutants xrs1 andxrs5. Int J Radiat Biol 1997;72:667–74.

[5] Borgmann K, Haeberle D, Doerk T, Busjahn A, Stephan G, Dikomey E. Geneticdetermination of chromosomal radiosensitivities in G0- and G2-phase humanlymphocytes. Radiother Oncol 2007;83:196–202.

[6] Borgmann K, Hoeller U, Nowack S, Bernhard M, Röper B, Brackrock S, et al.Individual radiosensitivity measured with lymphocytes may predict the risk of acute reaction after radiotherapy. Int J Radiat Oncol Biol Phys 2008;71:256–64.

[7] Borgmann K, Roper B, El-Awady R, Brackrock S, Bigalke M, Dork T, et al.Indicators of late normal tissue response after radiotherapy for head and neckcancer: fibroblasts, lymphocytes, genetics, DNA repair, and chromosomeaberrations. Radiother Oncol 2002;64:141–52.

[8] Brammer I, Zoller M, Dikomey E. Relationship between cellular radiosensitivityand DNA damage measured by comet assay in human normal, NBS and ATfibroblasts. Int J Radiat Biol 2001;77:929–38.

[9] Brown JM, Evans J, Kovacs MS. The prediction of human tumor radiosensitivityin situ: an approach using chromosome aberrations detected by fluorescencein situ hybridization. Int J Radiat Oncol Biol Phys 1992;24:279–86.

[10] Chen F, Nastasi A, Shen Z, Brennemann M, Crissman H, Chen DJ. Cell cycle-dependent protein expression of mammalian homologs of yeast DNA double-strand break repair genes Rad51 and Rad52. Mutat Res 1997;384:205–11.

[11] Collis SJ, Tighe A, Scott SD, Roberts SA, Hendry JH, Margison GP. Ribozymeminigene-mediated RAD51 down-regulation increases radiosensitivity of human prostate cancer cells. Nucleic Acids Res 2001;29:1534–8.

[12] Convery E, Shin EK, Ding Q, Wang W, Douglas P, Davis LS, et al. Inhibition of homologous recombination by variants of the catalytic subunit of the DNA-dependent protein kinase (DNA-PKcs). Proc Natl Acad Sci USA2005;102:1345–50.

[13] Cornforth MN, Bedford JS. A quantitative comparison of potentially lethaldamage repair and the rejoining of interphase chromosome breaks in lowpassage normal human fibroblasts. Radiat Res 1987;111:385–405.

[14] Daboussi F, Dumay A, Delacôte F, Lopez BS. DNA double-strand break repairsignalling: the case of RAD51 post-translational regulation. Cell Signal2002;14:969–75.

[15] Dikomey E, Borgmann K, Brammer I, Kasten-Pisula U. Molecular mechanismsof individual radiosensitivity studied in normal diploid human fibroblasts.Toxicology 2003;193:125–35.

[16] Dikomey E, Borgmann K, Peacock J, Jung H. Why recent studies relating normaltissue response to individual radiosensitivity might have failed and how newstudies should be performed. Int J Radiat Oncol Biol Phys 2003;15:1194–200.

[17] Dikomey E, Brammer I, Johansen J, Bentzen SM, Overgaard J. Relationshipbetween DNA double-strand breaks, cell killing, and fibrosis studied inconfluent skin fibroblasts derived from breast cancer patients. Int J RadiatOncol Biol Phys 2000;46:481–90.

[18] Durante M, Furusawa Y, Majima H, Kawata T, Gotoh E. Association betweenG2-phase block and repair of radiation-induced chromosome fragments inhuman lymphocytes. Radiat Res 1999;151:670–6.

[19] Elbashir SM, Harborth J, Weber K, Tuschl T. Analysis of gene function insomatic mammalian cells using small interfering RNAs. Methods2002;26:199–213.

[20] Fei P, El-Deiry WS. P53 and radiation responses. Oncogene 2003;22:5774–83.[21] Godthelp BC, Artwert F, Joenje H, Zdzienicka MZ. Impaired DNA damage-

induced nuclear Rad51 foci formation uniquely characterizes Fanconi anemiagroup D1. Oncogene 2002;21:5002–5.

[22] Godthelp BC, Wiegant WW, van Duijn-Goedhart A, Scharer OD, van Buul PP,Kanaar R, et al. Mammalian Rad51C contributes to DNA cross-link resistance,sister chromatid cohesion and genomic stability. Nucleic Acids Res2002;30:2172–82.

[23] Golding SE, Rosenberg E, Khalil A, McEwen A, Holmes M, Neill S, et al. Doublestrand break repair by homologous recombination is regulated by cell cycle-

2 G y

s c r R N A + 2 G y

s i R N A + 2 G y

2 G y

s c r R N A + 2 G y

s i R N A + 2 G y

0.0

0.5

1.0

1.5

2.0

2.5

3.0

quiescent

2 Gy→24h at 37ºC

proliferating

N u m b e r o f

H 2

A X - f o c i p e r c e l l

Fig. 5. Effect of RAD51 knock-down on repair of radiation-induced DSBs in

quiescent or proliferating CHO K1 cells as measured by cH2AX foci technique.Confluent (left chart) or exponentially growing cells (right chart) were irradiated

with 2 Gy followed by repair incubation at 37 C for 24 h. For RAD51 knock-down

cells were transfected with siRNA 20 h prior to irradiation. Data were corrected for

background values and error bars represent SEM.




independent signaling via ATM in human glioma cells. J Biol Chem2004;279:15402–10.

[24] Hinz JM, Yamada NA, Salazar EP, Tebbs RS, Thompson LH. Influence of double-strand-break repair pathways on radiosensitivity throughout the cell cycle inCHO cells. DNA Repair 2005;4:782–92.

[25] Hittelman WN, Rao PN. Premature chromosome condensation. I. Visualizationof X-ray-induced chromosome damage in interphase cells. Mutat Res1974;23:251–8.

[26] Hoeller U, Borgmann K, Alberti W, Jung H, Dikomey E. Individualradiosensitivity measured with lymphocytes may be used to predict the risk

of fibrosis after radiotherapy for breast cancer. Radiother Oncol2003;69:137–44.

[27] Hu Q, Hill RP. Radiosensitivity, apoptosis and repair of DNA double-strandbreaks in radiation-sensitive Chinese hamster ovary cell mutants treated atdifferent dose rates. Radiat Res 1996;146:636–45.

[28] Iizuka D, Inanami O, Matsuda A, Kashiwakura I, Asanuma T, Kuwabara M. Xirradiation induces the proapoptotic state independent of the loss of clonogenic ability in Chinese hamster V79 cells. Radiat Res 2005;164:36–44.

[29] Kasten U, Plottner N, Johansen J, Overgaard J, Dikomey E. Ku70/80 geneexpression and DNA-dependent protein kinase (DNA-PK) activity do notcorrelate with double-strand break (dsb) repair capacity and cellularradiosensitivity in normal human fibroblasts. Br J Cancer 1999;79:1037–41.

[30] Kasten-Pisula U, Tastan H, Dikomey E. Huge differences in cellularradiosensitivity are due to only very small variations in double-strand breakrepair capacity. Int J Radiat Biol 2005;81:409–19.

[31] Kasten-Pisula U, Vronskaja S, Overgaard J, Dikomey E. In normal humanfibroblasts variation in DSB repair capacity cannot be ascribed to radiation-induced changes in the localisation, expression or activity of major NHEJproteins. Radiother Oncol 2008;86:321–8.

[32] Kraakman-van der Zwet M, Overkamp WJ, van Lange RE, Essers J, van Duijn-Goedhart A, Wiggers I, et al. Brca2 (XRCC11) deficiency results inradioresistant DNA synthesis and a higher frequency of spontaneousdeletions. Mol Cell Biol 2002;22:669–79.

[33] Limbo O, Chahwan C, Yamada Y, de Bruin RA, Wittenberg C, Russell P. Ctp1 is acell-cycle-regulated protein that functions with Mre11 complex to controldouble-strand break repair by homologous recombination. Mol Cell2007;28:134–46.

[34] Lio YC, Schild D, Brennemann MA, Redpath JL, Chen DJ. Human Rad51Cdeficiency destabilizes XRCC3, impairs recombination and radiosensitizes S/G2-phase cells. J Biol Chem 2004;279:43313–40.

[35] Little JB, Nagasawa H. Effect of confluent holding on potentially lethal damagerepair, cell cycle progression, and chromosomal aberrations in human normaland ataxia-telangiectasia fibroblasts. Radiat Res 1985;101:81–93.

[36] Liu N. XRCC2 is required for the formation of Rad51 foci induced by ionizingradiation and DNA cross-linking agent Mitomycin C. J Biomed Biotechnol2002;2:106–13.

[37] Mansour WY, Schumacher S, Rosskopf R, Rhein T, Schmidt-Petersen F,Gatzemeier F, et al. Hierarchy of nonhomologous end-joining, single-strandannealing and gene conversion at site-directed DNA double-strand breaks.Nucleic Acids Res 2008 [epub ahead of print].

[38] O’Regan P, Wilson C, Townsend S, Thacker J. XRCC2 is a nuclear RAD51-likeprotein required for damage-dependent RAD51 focus formation without theneed for ATP binding. J Biol Chem 2001;276:22148–53.

[39] Pantelias PE, Maillie HD. Direct analysis of radiation-induced chromosomefragments and rings in unstimulated human peripheral blood lymphocytes bymeans of the premature chromosome condensation technique. Mutat Res

1985;149:67–72.[40] Peacock J, Ashton A, Bliss J, Bush C, Eady J, Jackson C, et al. Cellular

radiosensitivity and complication risk after curative radiotherapy. RadiotherOncol 2000;55:173–8.

[41] Rogakou EP, Boon C, Redon C, Bonner WM. Megabase chromatin domainsinvolved in DNA double-strand breaks in vivo. J Cell Biol 1999;146:905–16.

[42] Rothkamm K, Kruger I, Thompson LH, Lobrich M. Pathways of DNA double-strand break repair during the mammalian cell cycle. Mol Cell Biol2003;23:5706–15.

[43] Rothkamm K, Lobrich M. Evidence for a lack of DNA double-strand break repairin human cells exposed to very low X-ray doses. Proc Natl Acad Sci USA2003;100:5057–62.

[44] Russell JS, Brady K, Burgan WE, Cerra MA, Oswald KA, Camphausen K, et al.Gleevec-mediated inhibition of Rad51 expression and enhancement of tumorcell radiosensitivity. Cancer Res 2003;63:7377–83.

[45] Saleh-Gohari N, Helleday T. Conservative homologous recombinationpreferentially repairs DNA double-strand breaks in the S phase of the cellcycle in human cells. Nucleic Acids Res 2004;32:3683–8.

[46] Saintigny Y, Delacôte F, Boucher D, Averbeck D, Lopez BS. XRCC4 in G1suppresses homologous recombination in S/G2, in G1 checkpoint-defectivecells. Oncogene 2007;26:2769–80.

[47] Sasai K, Evans JW, Kovacs MS, Brown JM. Prediction of human cellradiosensitivity: comparison of clonogenic assay with chromosomeaberrations scored using premature chromosome condensation withfluorescence insitu hybridization.Int J RadiatOncol BiolPhys1994;30:1127–32.

[48] Takata M, Sasaki MS, Tachiiri S, Fukushima T, Sonoda E, Schild D, et al.Chromosome instability and defective recombinational repair in knockoutmutants of the five Rad51 paralogs. Mol Cell Biol 2001;21:2858–66.

[49] Tsuzuki T, Fujii Y, Sakumi K, Tominaga Y, Nakao K, Sekiguchi M, et al. Targeteddisruption of the Rad51 gene leads to lethality in embryonic mice. Proc NatlAcad Sci USA 1996;93:6236–40.

[50] West SC. Molecular views of recombination proteins and their control. Nat RevMol Cell Biol 2003;4:435–45.

[51] Yamamoto A, Taki T, Yagi H, Habu T, Yoshida K, Yoshimura Y, et al. Cell cycle-dependent expression of the mouse Rad51 gene in proliferating cells. Mol GenGenet 1996;251:1–12.


Documents

KOCH Et Al - 2009 - Impacto HR Na RS