International Student Biotechnology Congress

Embed Size (px)

DESCRIPTION

International Student Biotechnology Congress

Citation preview

  • 3rd

    International Student Biotechnology Congress

    In the name of God

  • 3rd

    International Student Biotechnology Congress

    rd

    International Student Biotechnology

    Congress

    May 6-8th

    2013, Allameh-Amini Hall,

    University of Tehran

    3isbc.ir

    3

  • 3rd

    International Student Biotechnology Congress

    Organizers:

    University of Tehran, Student Scientific Society of Biotechnology

    Alzahra University, Student Scientific Society of Biotechnology

    Committee Members:

    Chair: Prof. Parviz Norouzi

    Director: Ramin Fazel

    Executive Chair: Fatemeh Gheidari

    Scientific Chair: Dr. Mahdi Rahaie

    Financial Manager: Pejman Shirazian

    Public Relations Manager: Amir Banaei Esfahani

  • 3rd

    International Student Biotechnology Congress

    Sponsors:

    University of Tehran

    Alzahra University

    Cinnagen Company

    Ministry of Science, Research and Technology

    National Institute of Genetic Engineering and Biotechnology

    Aryogen Biopharma

    Institute for Research in Fundamental Sciences (IPM)

    Sinaclon Company

    Faculty of New Sciences and Technologies, University of Tehran

    Stem Cell Technology Research Center

    Biotechnology Development Council

  • 3rd

    International Student Biotechnology Congress

    Conference Welcome Note

    Research and investigation is one of the most important criteria of a society's

    scientific development. An academic development is followed by an appropriate

    training, actuating academic achievements, maintaining the youth capability,

    sharpness and eagerness to aim a goal in research which makes modern societies

    have young acumen involved in research fields. Most of worthwhile discoveries

    and inventions are the fruit of youth age or have its roots in it.

    I am honored to welcome you all to the "The 3rd

    International Student

    Biotechnology Congress" which is held by Student Scientific Society of

    Biotechnology at University of Tehran and Alzahra University. This conference

    is a worthy action which can encourages students and researchers to enter

    researching fields. To meet all the conditions and facilities needed for this

    academic investigative conference, the responsible panel particularly the director

    Mr.Ramin Fazel, executive chair Ms.Fatemeh Gheidari, scientific chair Dr.Mahdi

    Rahaie and public relations manager Mr.Amir Banaei Esfahani did lots of efforts

    and I would like to appreciate them due to their feasible attempts.

    Best regards,

    Parviz Norouzi

    Chairman of the 3rd

    International Student Biotechnology Congress.

  • 3rd

    International Student Biotechnology Congress

    Director Remarks

    Reaching welfare, wealth and manufacturing is the main goal of all countries in

    today's world. In this area, third world countries have sufficed with using natural

    and nether resources. These countries are endeavoring to aim the target by

    extracting these resources. On the other hand, circumspect countries have imitated

    using developed technology instead of prospecting exhaustible resources. Using

    these High-Tech fields such as Biotechnology, Nanotechnology and IT is the most

    important device to actualize the concept of Earning money from science .

    Unfortunately in our country, the first have been dominated up to now and have

    been sustained from this point of view; therefore its the duty of scientists and

    researchers to actuate the second view and propel people and government toward

    it. Considering this point the Scientific Student Society of Biotechnology at

    Univarsity of Tehran and Alzahra University are on the verge of holding

    The 3rd

    International Student Biotechnology Congress and are going to step

    forward in making a progress in national level hoping it could gain such an aim.

    Best Regards,

    Ramin Fazel

    Director of the 3rd

    International Student Biotechnology Congress

  • 3rd

    International Student Biotechnology Congress

    Scientific Committee Members:

    Dr. Mehdi Alavi

    Dr. Sedigheh Asad

    Dr. Kayhan Azadmanesh

    Dr. Valiollah Babaeipour

    Dr. Behnaz Bakhshandeh

    Dr. Mohammad Barshan Tashnizi

    Dr. Shahin Bonakdar

    Dr. Mehdi Dastgheib

    Dr. Elahe Elahi

    Dr. Jamshid Fouladi

    Dr. Naser Ghaemi

    Dr. Zahra Hajihassan

    Dr. Monir Hosseinzadeh

    Dr. Hamidreza Javadi

    Dr. Mahbube Kabiri

    Dr. Vahid Khalaj

    Dr. Ali Mohammad Latifi

    Dr. Sayed-Amir Marashi

    Dr. Faramarz Mehrnejad

    Dr. Mohammad MirDerikvand

    Dr. Javad Mohammadnejad

    Dr. Vahid Niknam

    Dr. Ali Hossein Rezayan

    Dr. Mehdi Sadeghi

    Dr. Gholam reza Salehi

    Dr. Sorush Sardari

    Dr. Ehsan Seyedjafari

    Dr. Zarvan Shahrzad

    Dr. Meisam Tabatabaei

    Dr. Ladan Teimoori-Toolabi

    Dr. Masoud Tohidfar

    Dr. Bagher Yakhchali

    Dr. Mahboubeh Zarabi

  • 3rd

    International Student Biotechnology Congress

    Executive Committee:

    Hamideh Abbasi

    Motahareh Agha Molaei

    Hossein Akhoondi

    Khadijeh Alishah

    Mosab Asadi

    Saba Asili

    Saba Aslani

    Farnoosh Azarian

    Amin Azimi

    Parizad Babaei

    Soraya Bahari

    Behnaz Bakhshandeh

    Zeinab Bakhshi

    Niloofar Dadkhah

    Mohsen Dehghani

    Ali Delavari

    Samaneh Farajzadeh

    Sudeh Farani

    Sadaf Farsinejad

    Armin Fazel

    Hamideh Fouladiha

    Tahereh Ghasemi

    Zohreh Gheisary

    Azadeh Hadadian Pour

    Mahdieh Hadi

    Samereh Hamedani

    Raheleh Hamrahi

    Sahar Hedayati Khah

    Mahshid Heidary

    Zhaleh Hosseini

    Saeedeh Hosseinian

    Mohadeseh Jamal Khan

    Ali Karimi

    Negin Katal

    Narjes Kazemi

    Arash Keshavarzi

    Afrooz Khalili

    Alireza Majd

  • 3rd

    International Student Biotechnology Congress

    Yasaman Mian Mahaleh

    Reihaneh Mir Hasani

    Pouria Mirzavand

    Azam Moosavi

    Fatemeh Motamedi

    Negin Motamedi

    Mohammad Motealehi

    Atena Mozafari

    Narjes Nakhaei

    Maryam Navaeian

    Paria Pirasteh

    Mohebat Pour Majidian

    Amir Hossein Saadati

    Zeinab Sadri

    Mohammad Reza Sadrzadeh

    Marzieh Sahebi

    Mohammad Hasan Samiee Aref

    Mohammad Reza Sarshar

    Sajad Sarvari

    Pejman Shirazian

    Fatemeh Siahvashi

    Salma Sohrabi

    Sana Pour Tabatabaei

    Andisheh Talaei

    Meisam Yousefi

    Roya Yousefi

    Rafooneh Zafari

    Mohammad Zim

  • 3rd

    International Student Biotechnology Congress

    Responsibility for materials published in this collection is

    solely with the authors. Be in printed in this series does

    not indicate that the content where approved by the

    scientific committee of the congress.

  • 3rd International Student Biotechnology Congress

    1

    Contents Oral Presentation Abstracts ............................................................................................................. 12

    Medical Biotechnology ................................................................................................................ 12

    Human Papillomavirus Type 16- E7 DNA Vaccine: Mutation in the RB binding site of E7 gene

    Enhances Specic Cytotoxic T-Lymphocyte Induction and Antitumor Activity........................... 12

    Recombinant 36kDa outer membrane protein (Omp2b) of Brucella abortus Elicited Strong

    Cytokine Responses in BALB/c mice ......................................................................................... 13

    DHPLC-mutation scanning of the breast cancer predisposing gene BRCA2 in breast cancer

    patients from the south of Iran ................................................................................................ 14

    Expression of the TrkC gene and a novel long non-coding RNA located in the gene in different

    cancerous cell lines .................................................................................................................. 15

    Cautiously view point on the effect of essential oils as therapeutic materials for

    neurodegenerative diseases .................................................................................................... 16

    Preparation of EGF Receptor-Targeted Polyplexes for breast cancer therapy ........................... 17

    Relationship between TNF-a(-308) and LT-a(+252) polymorphisms and acute lymphoblastic

    leukemia in Northwest of Iran.................................................................................................. 18

    Inhibition of oncogenic activity of WWP1 on breast cancer cell line with synthetic microRNA .. 19

    Transcription-mediated Isothermal Amplification for Rapid Identification of Lishmania major

    using Sequence-based Primers................................................................................................. 20

    The Differentiation of Mesenchymal Stem Cells into lnsulin-producing Cells through

    Transduction of a Lentivirus Containing IPF-1 Gene.................................................................. 22

    Crocetin attenuates spatial learning dysfunction and brain damage after chronic cerebral

    hypoperfusion in rats ............................................................................................................... 23

    Cytotoxic and Apoptotic Activity of Scrophularia amplexicaulis in MCF-7 Human Breast Cancer

    Cells ......................................................................................................................................... 24

    RNA-binding protein Rbm47 binds to Nanog in mouse embryonic stem cells ........................... 25

    Codon optimization, cloning and expression of single-chain variable fragment (scFv) antibody

    against CD22 in PichiaPastoris and optimization of Expression conditions ................................ 26

    Agricultural Biotechnology ........................................................................................................... 27

    dabb1 ........................................................... 27

    Transgenic expression and recovery of biologically active recombinant human insulin from

    Arabidopsis thaliana seeds ....................................................................................................... 28

  • 3rd International Student Biotechnology Congress

    2

    Evaluation Molecular, Physical and Mechanical Procedures for Determinate Grain Hardness in

    Bread Wheat ........................................................................................................................... 30

    Evaluation Molecular, Physical and Mechanical Procedures for Determinate Grain Hardness in

    Bread Wheat ........................................................................................................................... 31

    ...................................... 32

    Subcellular targeting of transiently expressed GFP using a plant virus based expression system

    in planta .................................................................................................................................. 33

    Genetic diversity of dwarfing Apples (Malusdomestica) of Iran AFLP markers .......................... 34

    Molecular and phenotypic tracking of Stb4, a gene conferring resistance to septoria tritici

    blotch of wheat ....................................................................................................................... 35

    SUF4 CLF ...................................................... 37

    cDNA PR10 (zea mays) ................................................................. 38

    Microbial and Industrial Biotechnology ........................................................................................ 39

    Nitrate reductase purification from a moderately halophilic microorganism, Salinicoccus

    iraniensis ................................................................................................................................. 39

    Comparison and Optimization of Expression of a Chimeric-Truncated t-PA by Pichia pastoris

    Strains: GS115 and KM71 ......................................................................................................... 40

    Isothermal-based Amplification Technology for Rapid Molecular Diagnosis of Pseudomonas

    syringae pv. syringae using Loop and Bumper Primers ............................................................. 42

    .............................. 43

    Design and construction of the expression cassette for producing the Epithermal growth factor

    with the ability of connecting to the collagen ........................................................................... 44

    Wastewater Algae: A Potential Candidate for Biodiesel Production .......................................... 45

    Effects of agitation on enhancement of bacterial cellulose production..................................... 46

    Effect of Different Carbon Sources on Activity of Biocatalyst in Biocathode Microbial Fuel Cells

    (BMFCs) ................................................................................................................................... 47

    A novel method for optimization of biomass lipid extraction.................................................... 48

    Molecular Biotechnology ............................................................................................................. 49

    In-cell western analysis, a new method of evaluating cellular protein expression and cell toxicity

    assays ...................................................................................................................................... 49

    Preparation of recombinant single domain antibody against epidermal growth factor receptor

    ................................................................................................................................................ 50

    ADSCs/ESCs Co-culture: a novel approach to increase the proliferation of ADSCs ..................... 51

    A novel cold-inducible expression system for Bacillus subtilis 1A772 ........................................ 52

  • 3rd International Student Biotechnology Congress

    3

    Isothermal-based Amplification Technology for Rapid Molecular Diagnosis of Pseudomonas

    syringae pv. syringae using Loop and Bumper Primers ............................................................. 53

    Probing the binding sites of Fediamsar and bovine serum albumin ........................................ 54

    The benefits of lanthanide cofactors for the characterization and application of RNA-ligating

    deoxyribozymes ....................................................................................................................... 55

    Investigating the Effects of Interactions between Histidin and Other Amino acids on

    Thermostability of Methylglyoxal synthase from Thermus sp.GH5 ........................................... 56

    Cell-Mediated Responses Elicited by Immunization of BALB/c Mice with Recombinant

    Eukaryotic Vector, pVAX1 Harboring omp28 of Brucella abortus, and Recombinant Omp28 as

    booster .................................................................................................................................... 57

    Nono-Biotechnology .................................................................................................................... 59

    phage Nanobioparticle expressing Apoptin suppress only human breast carcinoma tumor

    growth in vivo .......................................................................................................................... 59

    Synthesis of Nanobody- Dendrimer Conjugates for Targeted Breast Cancer therapy ................ 60

    Dendrosome-based delivery of siRNA against GFP gene in CHO-cell ......................................... 61

    PLGA Nanoparticles Containing a Combination of Recombinant 31kda Surface Protein and

    Detoxified Lipopolysaccharide of Brucella abortus Significantly Stimulated a Protective

    Response in BALB/C Mice ........................................................................................................ 62

    Design a hydrogen peroxide biosensor by use of catalase and modified electrode with

    magnesium oxide nanoparticles ............................................................................................... 64

    An assessment of CH50 activity in mice (Mus msuculus ) treated with silver nanoparticles during

    skin wound healing .................................................................................................................. 65

    Cell supports of GNP-chitosan nanocomposite/hyaluronic acid and chondroitin sulphate

    systems. cell adhesion and proliferation study ......................................................................... 66

    Blood Lead level measurement using two biosensors pGL3-luc/pbr and pGL3-luc/cad ............. 68

    Evaluation of ESAT-6 and CFP-10 proteins expression of Mycobacterium bovis at RNA level and

    evokes cellular immunity in mice with proliferation lymphocyte method ................................. 69

    Bioinformatics ............................................................................................................................. 71

    Modeling and Molecular Dynamics Simulation of Survivin and Effect of T34A Mutation on its

    Structure ................................................................................................................................. 71

    From microarray data to gene expression pattern, network and protein analysis in Mus

    musculus under Helicobacter pylori infection .......................................................................... 72

    Preparing Draft Genome-Scale Metabolic Network of Bacillus licheniformis based on the

    Reconstructed Metabolic Network of Bacillus subtilis .............................................................. 73

    Poster Presentation Abstracts ......................................................................................................... 74

  • 3rd International Student Biotechnology Congress

    4

    Medical Biotechnology ................................................................................................................ 74

    Investigation of mouse embryonic stem cells proliferation on surface modified of aligned and

    random nanofibrous PCL scaffolds ........................................................................................... 74

    Stem Cells and Gene Therapy for Cartilage and Bone Repair .................................................... 76

    Immunogenicity Prediction of the Chimeric Protein Consists of Shiga and Cholera Toxins B-

    Subunits Using Bioinformatics approaches ............................................................................... 77

    Immune Response to Combination of Recombinant Ag85B and Ag85C of Mycobacterium

    tuberculosis in C57BL/6 Mice ................................................................................................... 79

    Enhanced production of recombinant human Growth Hormone in Chinese Hamster Ovary cells

    in presence of Dimethyl sulfoxide ............................................................................................ 80

    Homozygosity mapping in an Iranian pedigree affected with muscular dystrophy limb girdle

    (LGMD) reveals linkage to 2p12-14 and 10q25-26 chromosomes ............................................. 81

    Targeting of the signal transducer Smo links microRNA-326 to the oncogenic Hedgehog

    pathway in drug resistant CD34+ CML stem/progenitor cells ................................................... 82

    ..................................................................................... 83

    The suitable purification method for investigation on Alpha-synuclein involved in Parkinson

    disease .................................................................................................................................... 84

    MicroRNA Profiling as a New Approachfor Early Detection of Breast Cancer ............................ 85

    Investigating the different combinations of five monoclonal antibodies in ELISA development to

    detect 26kDa antigen of H. Pylori ............................................................................................. 86

    Inhibition of survivin restores the sensitivity of breast cancer cells to docetaxel and vinblastine

    ................................................................................................................................................ 87

    Approaches to detect matrix metalloproteinases (MMPs) as disease biomarkers ..................... 88

    mRNA and microRNA Transferring by Microvesicles ................................................................. 89

    EGFR expressing tumor model establishment to evaluate the efficacy of mimotope vaccine .... 90

    Genotype Analysis of CCR5-59353-C/T Using PCR Allele Specific Amplification in Iranian normal

    population ............................................................................................................................... 91

    Recombinant Omp19 combined with detoxified LPS Elicited Protective Immunity against

    Brucella melitensis infection in BALB/c Mice ............................................................................ 92

    Linkage of a locus for autosomal recessive familial spastic paraplegia to chromosome 8q24 .... 93

    Comparing specific genes expression in differentiated and undifferentiated cells derived BMSCs

    during BMP-4 and 4mT SMF treatments .................................................................................. 94

    Generation of a pLEX-lamp-darpins chimeric lentiviral vector for expression of DARPins in

    exosomes surface for breast cancer gene therapy.................................................................... 95

    In vitro anti HIV-1 testing of (2, 3-diaryl-1, 3-thiazolidin-4-one) derivatives against HIV-1 ......... 96

  • 3rd International Student Biotechnology Congress

    5

    The response of human breast cancer cells to the non-thermal atmospheric pressure plasma . 97

    .......................................................... 98

    The role of p-glycoprotein in resistance of lung cancer............................................................. 99

    Phylogenetic Analysis of HLA-B27 Various Alleles based on Coding Sequence Using in silico AFLP

    Technique .............................................................................................................................. 101

    2- ....................................... 103

    Enzybiotics and their applications in medicine ....................................................................... 104

    ......................................... 105

    Adapting SyberGold and Loop-mediated Isothermal Amplification for Rapid Molecular

    Detection of Human Influenza Virus ....................................................................................... 105

    MicroRNA mediated knockdown of STAT3 reduces breast cancer stem cells viability ............. 106

    -2 " "

    .............................................................................................................................................. 108

    Recombinant TraQ of Brucella melitensis Elicited Potent IFN- and IL-12 Response in BALB/c

    Mice ...................................................................................................................................... 109

    Tri-block copolymer: An efficient membrane sealant recovers sever spinal cord injury .......... 111

    The cytotoxic effects of the organophosphates chlorpyrifos on human lymphoid cells in vitro113

    Induction of cardiac differentiation through overexpression of microRNA-1 in human-induced

    pluripotent stem cells ............................................................................................................ 114

    Diagnosis of Breast cancer with saliva samples: A review ....................................................... 115

    RNAi-based fusion oncogene knockdown; a plausible strategy for cancer therapy ................. 116

    CagA EPIYA-C ................................... 117

    Cyclin D1 expression in brain tissue of a murine model of alzheimers disease ....................... 118

    .................................................................. 119

    Cloning and Molecular Characterization of an Immunogenic LipL41 Protein of Leptospira

    interrogans Serovar Icterohaemorrhagia ............................................................................... 120

    Detection of Borna Disease Virus p24 RNA in peripheral blood cells of obese patients in Iran 121

    Designing specific ARMS tetra-primers of C/T polymorphism in promoter region of F8 gene.. 122

    Effect and mechanism of Sphingosin 1-Phosphate in malignant behavior of lymphocytic

    leukemia and non-smallcell lung cancer cells ....................................................................... 123

    Spermicidal activity of Arum maculatum L. on human sperm ................................................. 124

    Investigation of genes expression in differentiated cells derived BMSCs during BMP-4

    treatments with FTIR ............................................................................................................. 125

    16141 rs NPY ......... 126

  • 3rd International Student Biotechnology Congress

    6

    Pluripotency features in adipose tissue-derived stem cells ..................................................... 127

    Agricultural Biotechnology ......................................................................................................... 128

    Agrobacterium rhizogenes Mediated Induction of Recombinant Tobacco Hairy Roots Expressing

    the Chimeric stxB-ctxB Gene .................................................................................................. 128

    ............................................................................... 130

    (Iris spp.) ISSR ........................... 131

    Iris .................................................................................. 132

    Plantlet regeneration from hairy root cultures of Atropa belladonna Hamadan sp ................. 133

    MTLD ................................................... 134

    ................................ 135

    Molecular characterization and assessment inter and intra diversity of some prunus species In

    Iran by AFLP marker ............................................................................................................... 136

    (Solanum tuberosum L.)

    ................................................................................................................... 137

    ....................... 138

    Tissue culture and somaclonal variation in M7 rootstock ..................................................... 139

    Optimization of Cronobacteriocin DGH2 a bacteriocin inhibiting Xanthomonas axonopodis pv.

    Citri ....................................................................................................................................... 140

    Characterization of cronobacteriocin DGH2 an anticitrus canker disease bacteriocin ............. 141

    Contamination of cattle slaughtered in the city KazerounE.coli O157: H7 in 2012 .................. 142

    Construction of a genetic linkage map with SSR, AFLP and morphological markers to locate QTLs

    controlling pathotype-specific powdery mildew resistance in diploid roses ............................ 143

    Assessment Of Regeneration Of Stevia Rebaudiana By Seed .................................................. 144

    Marker Assisted Selection for Overexpressed Bx7 Gene (Bx7OE) Effective in Bread Wheat

    Quality ................................................................................................................................... 145

    Validation and Identification GPC-B1 Gene Effective in High-Grain Protein Content in the Wheat

    Cultivars and Advance lines.................................................................................................... 146

    Identification and Distribution of the Photoperiod Insensitive Allele in Ppd-D1 locus in Wheat

    .............................................................................................................................................. 147

    Application of Allele-Specific Markers for Identification of Different Sources of 1AL/1RS and

    1BL/1RS WheatRye Translocations in Wheat ........................................................................ 148

    Allelic Variation at the Vernalization Genes Vrn-A1, Vrn-B1, Vrn-D1, and Vrn-B3 in Iranian

    Wheat Cultivars and Their Association with Growth Habit ..................................................... 149

    ................................................ 150

  • 3rd International Student Biotechnology Congress

    7

    Analysis of molecular methods for producing glyphosate resistance .................................... 151

    Evaluation of allelic variation and assessment of quality of storage proteins in Iranian durum

    wheats ................................................................................................................................... 152

    PROLIFRATION OF MOHREKHOSH (ZHUMERIA MAJDAE Resh. f. & Wendelbo) BY SEED

    GERMINATION AND CALLUS INDUCTION ............................................................................... 153

    Proliferation of Mouhrekhosh(Zhumeria Majde Resh.f.& wendelbo) by seed germination and

    callus induction ...................................................................................................................... 155

    Molecular and phenotypic tracking of Stb4, a gene conferring resistance to septoria tritici

    blotch of wheat ..................................................................................................................... 156

    Identification of single nucleotide polymorphism in exon 26 of apoB gene in khazak breed

    chickens ................................................................................................................................. 157

    Prevalence of foot and mouth disease virus (FMDV) in carrier cow reffered to Khorasan Razavi

    industrial abattoir by Realtime quantitative PCR (q-PCR) ........................................................ 158

    ............................... 159

    (Glycyrhiza glabra) ................................................................................................................. 159

    New techniques in development of transgenic animal technology ......................................... 160

    Morphological investigation of hairy roots induced in Datura metel ...................................... 161

    Application of vermicompost as a carrier of phosphate solubilizing bacteria (Pseudomonas

    fluorescens) in increase growth parameters of maize ............................................................ 162

    Divesity of iranian genotypes for seed storage proteins and storage proteins and

    two_dimensional protein pattern in genotypes with high and low oleic acid .......................... 163

    Transcripts pattern in bread wheat under drought stress ....................................................... 164

    ................................ 165

    .......................................................................................................... 166

    Investigation of callus induction, regeneration and BYMV virus elimination by meristem tip

    culture in three cultivars of Gladiolus ..................................................................................... 167

    Microbial and Industrial Biotechnology ...................................................................................... 168

    Optimization of algal lipid extraction for biodiesel production (hexane) ................................. 168

    ............................................................................ 169

    Cloning, Expression, Purification and in Silico Analysis of the Brucella Urease ........................ 170

    Enhanced production of recombinant human Growth Hormone in Chinese Hamster Ovary cells

    in presence of Dimethyl sulfoxide .......................................................................................... 171

    PCR ....................................................... 172

  • 3rd International Student Biotechnology Congress

    8

    Optimization of amylase and protease co-produced by Bacillus licheniformis using economical

    medium ................................................................................................................................. 173

    Molecular detection of TEM-derived ESBLs and CTX-M gene in E. coli from fecal of canaries,

    lovebirds and pigeons in regions of Iran ................................................................................. 174

    Survey Pathogenicity of Listeria monocytogenes and Listeria Ivanovii isolated from silage in

    mice ...................................................................................................................................... 175

    Microbial bio-degradation of polyethylene ............................................................................ 177

    Stable immobilization of Aspergillus niger phytase on perlite; activity and stability ................ 178

    Multi Drug Resistance of Genomic Islands in Haemophilus influenza Isolated from Clinical

    Isolates of Iran ....................................................................................................................... 179

    Aspergillus Niger

    Aspergillus Niger .......................................................................................... 180

    ......................................................................... 181

    In vitro proteome analysis of an Iranian strain (NIGEB-088) of Xanthomonas citri subsp. Citri 182

    Using microarray data to construct network and its analysis for kidney transplantation rejection

    .............................................................................................................................................. 184

    ........................................................ 185

    Isolation of a Native Bacillus cereus Amylase Producer from Hot spring of sabalan mountain 186

    Comparison of expression of single chain variable fragment of anti human CD4 receptor

    antibody fused to green fluorescent protein in two strains of Escherichia coli using flow

    cytomerty .............................................................................................................................. 187

    In vitro evaluation of co-aggregation effect of probiotic lactobacilli on mutans streptococci .. 188

    Microbial diversity of culturable halophilic and halotolerant bacteria from Urmia Salt lake .... 190

    ........................................... 191

    The Assessment of Substrate Preference of Microbial Biocatalysts in Biodesulfurization ........ 192

    Suitable strategies for heterologous expression and purification of membrane proteins ........ 193

    Effects of phosphate limitation on Saccharomyces cerevisiae gene expression pattern and its

    expression network analysis .................................................................................................. 194

    Antibacterial activity of methanol extract of the leaves and fruit of Chenopodium foliosum

    (Moench) Asch against four strains of Gram-negative pathogenic bacteria ............................ 195

    Molecular cloning of Fusion of GP96gene and Kinetoplastid membrane protein-11(KMP-11) of

    Leishmania infantum in pET28a vector as a candidate for vaccine preparation against visceral

    leishmaniasis ......................................................................................................................... 196

    Design of a gene construct by Intein self-splicing properties in order to EGF protein expression

    in E.coli .................................................................................................................................. 197

  • 3rd International Student Biotechnology Congress

    9

    Antibacterial activity of Echium amoenum aqueous and ethanolic extracts............................ 198

    Evaluation of Molecular Farming Industry in the Production of Recombinant ........................ 199

    ................... 200

    : ........................................................... 201

    Quantitative competitive PCR assay for detection of Lactobacillus acidophilus in probiotic

    yogurts .................................................................................................................................. 202

    Application of vermicompost as a carrier of phosphate solubilizing bacteria (Pseudomonas

    fluorescens) in increase growth parameters of maize ............................................................ 203

    Design and Construction of Rotary Biological Contactor (RBC) for enhancement of microbial

    cellulose Production .............................................................................................................. 204

    Production of truncated recombinant nmp22 protein reactive towards commercial antibody

    and inducing immune system for polyclonal response ........................................................... 205

    The effectiveness and enzyme potential of honey for inhinition of growth on Pseudomonas

    aeruginosa, Staphylococcus aureus, Escherichia coli .............................................................. 206

    Identification of GABA production by Lactobacillus casei and Lactobacillus parcasei and

    characterization of their glutamate decarboxylase gene ........................................................ 207

    Construction of an Eukaryotic Plasmid Encoding ESAT-6 gene of Mycobacterium Bovis as a

    Candidate for DNA Vaccine .................................................................................................... 208

    Developing of effective enzyme based biofuel cells ................................................................ 209

    Molecular Biotechnology ........................................................................................................... 210

    ................................. 210

    GFP M13 ................ 211

    Analysis of intratype E6 variants of Human papillomavirus type 31, 52 and 58 in Indian HIV-

    positive women with different cervical disease status: a pilot study ....................................... 212

    Using a combination of mutations in photoprotein aequorin to application study .................. 213

    Modification of Collagen- Chitosan Scaffold by PVA for Skin Tissue Engineering Application .. 214

    Cloning and overexpression of miR-939 in HUH7 cell line ....................................................... 215

    Efficient expression of laccase gene from Bacillus pumilus ..................................................... 216

    The study of interaction between -Lactoglobulin with retinol at monomer and dimmer

    conditions by circular dichroism ............................................................................................. 217

    ...................... 218

    ............................................................................. 219

    Translational targeting of breast cancer cells using construct containing 5UTR of bFGF......... 221

    BRCA1 ................ 222

  • 3rd International Student Biotechnology Congress

    10

    Molecular aspects on the interaction of isatin-3-isonicotinylhydrazone to deoxyribonucleic acid

    .............................................................................................................................................. 223

    .............................................................................................................................................. 224

    Isolation, Cloning and Expression Verification of the Mycobacterium Bovis CFP-10 Gene in

    BALB/c mice........................................................................................................................... 225

    Protein engineering of bacterial -xylosidase by Site-directed mutagenesis and expression in

    Pichia pastoris........................................................................................................................ 226

    Optimization of Genomic DNA Extraction of Mistletoe (Viscum album) .................................. 227

    Pluripotency features in adipose tissue-derived stem cells ..................................................... 228

    ND3 mitochondrial genes, a good candidate for DNA Barcoding ............................................ 229

    Nono-Biotechnology .................................................................................................................. 230

    Experimental Study of Nanoarchaeosomal Carrier for Paclitaxel on MCF-7 Cell Line............... 230

    Application of siRNA nanoparticles in stem cells differentiation ............................................. 231

    The investigation of Electron transfer mechanism of glucose oxidase at graphene and graphene

    oxide electrode ...................................................................................................................... 232

    The use of chitosan nanoparticles as new anticancer drug carrier system .............................. 233

    Viral-mediated gene delivery against cancer metastasis......................................................... 234

    Metal nanoparticle production assisted by -amylase............................................................ 235

    Co-delivery of shRNA and DNA by a neutral phospholipid-based bilayer nanosystem ............. 236

    Transcriptional targeting of breast cancer stem cells using anti-HER2 nanobody targeted

    dendrimeric nanoparticles ..................................................................................................... 237

    Spectroscopic studies of the interaction of a novel silver nanoparticles with bovine serum

    albumin ................................................................................................................................. 239

    Antibacterial properties of magnetic hydrogel nanocomposite based on salep- poly (acrylic acid)

    .............................................................................................................................................. 240

    Controlled release of defrasirox through magnetic hydrogel nanocomposite based on salep-

    poly (acrylic acid) ................................................................................................................... 241

    RNAi-based fusion oncogene knockdown; a plausible strategy for cancer therapy ................. 242

    Investigation of the effects of nanoparticles ZnO on the histopathological of lung rat ............ 243

    ( )

    Monobromobimane ....................................................................................... 244

    Fluorescence spectroscopic evaluation of Cu-diamsar-bovine serum albumin interactions .... 245

  • 3rd International Student Biotechnology Congress

    11

    Study of the Forster resonance energy transfer between [Co (diNOsar)] Cl3 and bovine serum

    albumin ................................................................................................................................. 246

    Bioinformatics ........................................................................................................................... 247

    (SNPs) (GWAS)

    .............................................................................................................................................. 247

    ...... 248

    Evaluating relationship in cytokines level, Fibromyalgia Impact Questionnaire and Body Mass

    Index in women with Fibromyalgia Syndrome ........................................................................ 249

    Modeling and Molecular Dynamics Simulation of Survivin and Effect of T34A Mutation on its

    Structure ............................................................................................................................... 250

    Prediction and modeling of Phytasethermostable structure based on bioinformatics tool ..... 251

    Determination of Listeriolysin O protein structure using Homology Modeling ........................ 252

    Using percolation theory for studying Studying the relationship between robustness against

    mutations in metabolic networks and lifestyle of organisms .................................................. 253

    Phylogenetic Analysis of HLA-B27 Various Alleles based on Coding Sequence Using in silico AFLP

    Technique .............................................................................................................................. 254

    cDNA ....... 255

    Prediction of subnuclear location of proteins using Artificial Immune System ........................ 256

    Analysis Some of the Features Bioinformatics CSN3 Gene in Dairy Cattle ............................... 257

    The Study of Human Glucose-6 Phosphatase Protein Structure using Homology Modeling .... 258

    In silico Search and Synthesis Design of 3- (phenyl) acrylonitrile Derivatives and Evaluation Anti-

    inflammatory Properties with Marvin Sketch Software .......................................................... 260

    Bioinformatics Study Of microRNAs To Identify Genes and Cellular Pathways Associated With

    Medulloblastoma................................................................................................................... 261

    The Identifying Of Diagnostic Markers In Prostate Cancer By The Use Of EST-SSRs ................. 262

    General Biotechnology .............................................................................................................. 263

    ................................................................... 263

    .................................................................................................... 264

    ........................................................................................... 265

    .................................................................................. 266

  • 3rd International Student Biotechnology Congress

    12

    Oral Presentation Abstracts

    Medical Biotechnology

    Human Papillomavirus Type 16- E7 DNA Vaccine: Mutation in the RB binding

    site of E7 gene Enhances Specic Cytotoxic T-Lymphocyte Induction and

    Antitumor Activity

    Armina Alaghebandbahrami golestan university of medical science

    Amir Ghaemi* golestan university of medical science

    *: [email protected]

    Introduction:Increasing evidences has suggest that infection with high-risk human papillomavirus

    (HPVs) is closely associated with cervical cancer. The HPV16-E7 oncoprotein has been shown to be

    continuously expressed in cervical carcinoma cells, therefore it is an attractive tumor-specic

    antigen target for immunotherapy of patients with cervix dysplasia and cancer.For safety reasons,

    we design and construct a modified the E7 gene with reduced oncogenecity (HPV-16 MUT E7).

    Material and Methods:The construct was synthesized and cloned in pEX cloning vector and its

    accuracy was confirmed by sequencing. Then the construct was transformed to competent E.coli

    Top10F and prepared in mini scale. After Subcloning in to pCDNA3 eukaryotic expression vector,

    CHO cell line were transfected with vectors expressing MUTE7 and wild E7 and characterized by SDS

    page and Western Blotting. Confirmed constructs were administrated in C57BL/6 tumor mice model

    as therapeutic vaccines and different aspects of cellular immune response were evaluated. For this

    purpose, MTT cell proliferation assay, LDH assay and cytokine assay were performed.

    Results:The results showed that the genes of E7 wild and E7 MUT were successfully cloned and

    expressed compared to negative control vector.

    Immunization of mice with vaccine expressing the MUT E7 gene produced signicantly stronger E7-

    specic cytotoxic T-lymphocyte response and better tumor suppression in mice than did a wild-type

    E7 DNA vaccine expressing a stable E7 protein.

    Conclusion: Our results suggests that MUT E7 may be useful for DNA immunization and

    development of anti-cancer vaccines against HPV-16 mediated cancers.

    Keywords: cervical cancer, human Papilloma virus,oncogenicity,DNA vaccines,mutation

  • 3rd International Student Biotechnology Congress

    13

    Recombinant 36kDa outer membrane protein (Omp2b) of Brucella abortus

    Elicited Strong Cytokine Responses in BALB/c mice

    Sara Aryanfar * Islamic Azad University-Karaj branch

    Nima Khoramabadi Islamic Azad University-Karaj branch

    Haniyeh Aghababa Tarbiat Modares University

    Majid Sohrabi Tarbiat Modares University

    Nazanin Nazanin Islamic Azad University-Karaj branch

    *: [email protected]

    Introduction : Brucellosis is an important zoonotic disease which is globally prevalent. Prevention of

    the disease in animals is based on attenuated vaccine strains which are highly pathogenic for human

    hosts. Immunologic evaluation of Brucella antigens has a substantial role in vaccine investigations.

    We report the production of recombinant 36kDa outer membrane protein Brucella abortus (Omp2b)

    in E. coli host and evaluation of IFN-, IL-12 and IL-4 responses in mice which were immunized with

    this protein.

    Materials and methods omp2b gene was cloned in pET28a(+) and expression of protein performed

    in E coli BL21(DE3). Recombinant Omp2b (rOmp2bpET28) was purified using nickel affinity

    chromatography. 6-8 weeks old BALB/c mice were immunized with 20g rOmp2bpET28 formulated

    in Freunds adjuvant, subcutaneously. Mice received a primary dose followed by two boosters with

    12 days of interval. A week after last booster, mice were sacrificed and their spleen lymphocytes

    were cultures; all cultures were subsequently stimulated with rOmp2bpET28. Production of IL-4, IL-

    12 and IFN- was evaluated in lymphocyte cultures by ELISA

    Results : Level of IL-4, IL-12 and IFN- were significantly higher in mice immunized with

    rOmp2bpET28. Production of IFN- was higher than that of IL-4 and IFN-/IL-4 ratio suggested that a

    cell-mediated response had been developed in mice receiving rOmp2bpET28.

    Conclusion : rOmp2bpET28 strongly stimulated the development of immune responses in BALB/c

    mice. The cellular-type response also makes it an appropriate antigen for further investigations of

    brucella vaccines.

    Keywords : Brucellosis, Brucella abortus, Omp2b

  • 3rd International Student Biotechnology Congress

    14

    DHPLC-mutation scanning of the breast cancer predisposing gene BRCA2 in

    breast cancer patients from the south of Iran

    Safoora Deihimi Shiraz Institute for Cancer Research, Shiraz University of Medical Sciences

    Nasrollah Erfani Shiraz Institute for Cancer Research, Shiraz University of Medical Sciences

    Abdol Rasoul Talei Department of Surgery, Shiraz University of Medical Sciences

    Abbas Ghaderi * Shiraz Institute for Cancer Research, Shiraz University of Medical Sciences

    *: [email protected]

    Introduction : Germline mutations in Breast Cancer gene (BRCA2) confer an estimated cumulative

    lifetime risk of breast cancer of 5684%. Furthermore, the cancer-founder effects of BRCA mutations

    have been suggested to be race and ethnic population-specific. Previous investigations of our group

    indicated no association of known founder mutations in BRCA genes (185delAG, 5382insC, 6174delT)

    with familial breast cancer in Iranian populations. As a part of a larger project searching for BRCA

    founder mutations in Iranians, we aimed in the present study to investigate germ-line mutations in

    exon 11E of BRCA2 gene in females with familial breast cancer in south of Iran.

    Materials and methods : DNA was extracted from peripheral blood samples of 70 affected women

    with familial breast cancer, and 70 age-sex matched healthy subjects. Denaturing high performance

    liquid chromatography (DHPLC) method, using Transgenomic WAVE 4500 system, was applied for

    genetic pre-screening of BRCA1 gene in order to reduce the cost and time for the analysis of this

    gene. Chromatograms analysis was performed with Navigator Software 2.2.0. Mutation positive

    amplicons had to be subsequently sequenced by direct DNA sequencing using BigDye Terminator

    chemistry and ABI 310 sequencer.

    Results : A Novel point mutation was detected in exon 11E of BRCA2 gene of patients. The frequency

    of G/T missence mutation (c.[5961G>T]) causing Glutamine 1987 with Histidine substitution was

    12.9% of 70 breast cancer patients. The mutation was not detected in none of controls and all the

    patient carriers were heterozygote for the mutation.

    Conclusion : This study indicated identification of a novel mutation in exon 11E of BRCA2 gene,

    suggesting appropriate target for further investigations as a founder mutation in Iranian population.

    In this regard, utilizing a fast and reliable mutation pre-screening method like DHPLC can help to

    accelerate mutations scanning in BRCA genes of carrier females.

    Keywords : Breast Cancer, DHPLC, BRCA2 gene

  • 3rd International Student Biotechnology Congress

    15

    Expression of the TrkC gene and a novel long non-coding RNA located in the

    gene in different cancerous cell lines

    Sadat Dokanehiifard Tarbiat modares university

    Bahram* Mohammad Soltani Tarbiat modares university

    Fahime Hosseini Tarbiat modares university

    Hadi Najafi Tarbiat modares university

    Seyad Ali Mousavizadeh Tarbiat modares university

    *: [email protected]

    Introduction : TrkC gene plays a critical role in proliferation, differentiation and survival of the

    developing neurons. There is no data about the mechanisms of different roles of TrkC gene. There

    are reports on Trk family expression in neoplasms as well, namely, the primitive neuroectodermal

    tumors of childhood, and in adult astrocyticgliomas. TrkC expression is also reported in breast cancer

    samples.

    Materials and methods : In our previous study, a novel long non-coding RNA (N-lncRNA) located in

    TrkC gene was identified. Here we examined 15 tumorcell lines (identified as glioma, lung,

    hepatoma, cervix, breast and etc), for the expression of TrkC gene as well as N-lncRNA located in it.

    Results : Result of our study revealed that TrkC gene and the N-lncRNA are differentially expressed in

    these cell lines.

    Keywords : TrkC, non-coding RNA, cancer

  • 3rd International Student Biotechnology Congress

    16

    Cautiously view point on the effect of essential oils as therapeutic materials

    for neurodegenerative diseases

    Masoome Khalife National Institute of Genetic Engineering and Biotechnology

    Farhang Aliakbari National Institute of Genetic Engineering and Biotechnology

    Dina Morshedi* National Institute of Genetic Engineering and Biotechnology

    *: [email protected]

    Introduction: Neuronal death, mainly apoptosis, is the cause of the indication of many human

    neurodegenerative diseases, such as Parkinsons and Alzheimers. Recognition of the mechanisms

    which prevent or promote apoptosis in nerve cells come new manner for treating

    neurodegenerative disorders. A major component of protein plaques in synucleinopathies, especially

    Parkinsons disease is alpha-synuclein which its aggregation in dopaminergic cells promotes

    apoptosis. Nowadays, preventing protein fibrillation might be one of the main options to treat

    neurodegenerative diseases.

    Materials and Methods: In the present study the effect of several essential oils including Myrtus

    communis, Spearmint, Citrus sinensis, Citrus limon, Tarragon, Mentha pulegium, Thymus vulgaris

    and Rosmarinus officinalis on the inhibition of alpha-synuclein fibril formation was investigated.

    Furthermore their cell cytotoxicity on the pc12 pheochromocytoma cells was assessed using MTT,

    LDH, DNA fragmentation and anexin V methods

    .

    Results: The fibrillation of alpha-synuclein was monitored by the standard tests. Results indicated

    that adding some of these essential oils to the samples could inhibit fibril formation of alpha-

    synuclein significantly. On the other hand some of them did not change the fibrillation process and

    some induced such process. For examining the prevention of apoptosis by adding these supplements

    to fibrils, they exposure to dopaminergic pc12 cell line. Result showed that all essential oil had

    destructive cytotoxicity effects even at low concentrations and it was a general phenomenon for

    essential oils.

    Conclusion: Results demonstrated that albeit some of the noted essential oils had potential to

    prevent fibrillation but they were highly toxic for cell which may lead to apoptosis. Due to their well

    inhibitory effect, essential oil must be fractioned and those fractions which can prevent fibrillation

    with no toxicity on cell, are introduced for further study in neurodegenerative diseases medication.

    Key words: Alpha-synuclein, Essential oils, Neurodegenerative diseases, Park

  • 3rd International Student Biotechnology Congress

    17

    Preparation of EGF Receptor-Targeted Polyplexes for breast cancer therapy

    Mosleh Mohamadi Rad Laboratory of Microanalysis, Institute of Biochemistry and Biophysics, University of Tehran Hedayatollah Ghourchian Laboratory of Microanalysis, Institute of Biochemistry and Biophysics, University of Tehran Davoud Ahmadvand * School of Allied Medical Sciences, Tehran University of Medical Sciences, Tehran, Iran

    *: [email protected]

    Introduction : Breast cancer is one of the problems threatening human health in the developed

    countries. Today, advances in molecular techniques have influenced on the field of cancer

    treatment. Among molecular methods, gene therapy and drug carrier nanoparticles are the most

    prominent threatments. Gene therapy has considerable development in recent years. Successful

    gene therapy depends on several factors; one of the most important is targeted delivery of

    therapeutic genes into cancer cells without trauma to normal cells. Therefore, in this study we

    decided to target the cancer cells at two levels: first, targetting at transcription level and second by

    use of targeted nanocarriers with antibody against human epidermal growth factor receptor 2

    (HER2) which is over-expressed in breast cancer cells. In this study, we decided to synthesis PAMAM

    (Poly(amido amine))-PEG-Trastuzumab polyplexes containing a killer gene construct.

    Materials and methods : G5 PAMAM dendrimers conjugated to PEG in different ratios and TNBS

    assay was used for determination the number of PEG attached to each dendrimer molecule.

    Thiolated Trastuzumab (a monoclonal anti-HER2 antibody) was conjugated to PAMAM/PEG.

    Polyplexes (complexes of PAMAM and DNA) were generated at different N/P ratios. Particle size and

    zeta-potential of polyplexes was measured by dynamic light scattering. These polymers were used to

    deliver a killer gene under the control of a breast cancer specific promoter to HER2 expressing BT474

    cell line and HER2 non-expressing MCF10A cell line as negative control. Transfection efficiency of

    different denriplexes was determined using Real Time PCR assay.

    Results : The conjugation of PEG and anti-HER2 antibody was confirmed by TNBS and ELLMAN assay.

    Different Pegylation degree and N/P ratios affect the particle size and zeta-potential. The best

    concentration ratio of the components (PEG and DNA constructs) was determined in order to

    achieve the most efficient complexes for transfection. Real Time PCR results showed that PAMAM-

    PEG-Trastuzumab has higher transfection efficiency than PAMAM alone.

    Conclusion : Results of this study confirmed that Pegylation of dendrimers significantly reduced the

    toxicity of PAMAM dendrimers and conjugation of PAMAM-PEG to trastuzumab antibody make

    these polymers good candidates for targeted cancer gene therapy.

    Keywords : Nanocarrier. PAMAM dendrimer, trastuzumab, genethrapy

  • 3rd International Student Biotechnology Congress

    18

    Relationship between TNF-a(-308) and LT-a(+252) polymorphisms and acute

    lymphoblastic leukemia in Northwest of Iran

    Hajar Nasiri medical tabriz univercity

    Safar Farajna* medical tabriz univercity

    Azim Rezamand medical tabriz univercity

    Amir Monfaredan medical tabriz univercity

    Majid Farshdosti medical tabriz univercity

    Fateme Skandari medical tabriz univercity

    Leyla Sahebi medical tabriz univercity

    *: [email protected]

    Introduction : Acute Lymphoblastic Leukemia (ALL), the main subtype of lymphoid malignancy in

    children overall, almost occurs in 2-5 years old. The etiology of disease is unclear but some

    translocations and genetic variations are effective on occurrence and progress of this malignancy.

    Previous studies have shown TNF-a (-308) and LT-a (+252) polymorphisms have relationship with

    some diseases such as ALL, because these genetic polymorphisms lead to over expression and high

    plasma level of them. This study investigate the association TNF-a (-308) and LT-a(+252)

    polymorphisms between ALL patients and healthy individuals in northwest of Iran .

    Materials and Methods DNA extracted from 5ml peripheral blood of 70 ALL patients and 130 healthy

    population by chloroform salting-out method for RFLP-PCR. After conventional PCR, digestion with

    NCOI as restriction Enzyme was done and acquired data was analyzed with SPSS ver.13

    Results :The TNF-a mutant alleles (GA) in ALL and control are 11.1% to 88.9% respectively and we do

    not have any TNF-a (AA) homozygote in ALL group. The meaningful association of TNF-a variant is

    between ALL and control ( pvalue= 0.005). In contrast with TNF, we do not have any significant

    difference of LT variant between 2 subjected groups (pvalue =0.616)

    Conclusion :Our result shows in ALL and control group from northwest of Iran with Azari ethnicity;

    the TNF-a variant allele has meaningful relationship between ALL and healthy people, although,

    there is not any significant association of LT-a variant in 2 selected groups.

    Keywords: ALL polymorphism, RFLP-PCR, TNF-a

  • 3rd International Student Biotechnology Congress

    19

    Inhibition of oncogenic activity of WWP1 on breast cancer cell line with

    synthetic microRNA

    Fatemeh Nematpour Tarbiat Modares University

    Mahdi Forozandeh * Tarbiat Modares University

    *: [email protected]

    Introduction

    MicroRNAs (miRNA) are small RNAs that regulate gene expression. MiRNAs involve in numerous

    processes such as proliferation, differentiation, apoptosis, etc. These functions support a role for

    miRNAs in initiation and progression of malignancies. MiRNAs act as tumoursuppressor or oncogene,

    these miRNAs named oncomirs and classified into two groups; 1-Tumoursuppressor oncomirs, which

    downregulate expression of the oncogenes, 2-Oncogenic oncomirs, which downregulate expression

    of the tumoursuppressors. We can use this model for regulation of target tumoursuppressor or

    oncogene, so we designed and synthesized miRNA against one of the important oncogene in breast

    cancer, WWP1 (WW domain containing E3 ubiquitin ligase1), which is overexpressed in breast

    cancer. WWP1 promotes cell proliferation and regulates other proteins such as; TGF.B, P53, KLF2,

    KLF5,ErbB2,andEGFR.

    Material and Methods

    MicroRNA was designed by Invitrogen RNAi Designer, and after synthesizing, miRNA gene was

    ligated into a miR-155-based Block-iT Pol II miR RNAi Expression Vector (Invitrogen), and then

    expression level of WWP1 in WWP1-miRNA-transfected breast tumor cells (MCF7) was measured

    with Real-Time PCR. Furthermore cell proliferation was measured by cell counting and MTT assay.

    Results

    This synthetic miRNA reduced expression level of WWP1 up to 70% as compared with control cells

    after 72 hours. Also cell counting and MTT assay showed 30% reduction in cell proliferation of MCF7

    cells.

    Conclusion

    In this experiment we succeed to reduce expression of WWP1 in MCF7 cells via miRNA, which led to

    inhibition of its function too. These data support that we can regulate expression of target gene via

    miRNA. So this new tool has therapeutic potential for treatment of genetically disease such as

    cancers.

    Keywords: Breast cancer, Gen silencing, MicroRNA, WWP1

  • 3rd International Student Biotechnology Congress

    20

    Transcription-mediated Isothermal Amplification for Rapid Identification of

    Lishmania major using Sequence-based Primers

    Alireza Niazi Golestan Univercity of medical univercity

    Oghol Niaz Jorjani* Golestan Univercity of medical univercity

    Hassan Nikbakht Golestan Univercity of medical univercity

    Sareh Zhand** Golestan Univercity of medical univercity

    Pooria Gill*** Golestan Univercity of medical univercity

    *: [email protected] **: [email protected]

    ***: [email protected]

    Introduction: Lishmania major is a flagellate protozoan parasite with a global expansion. This

    parasite is caused cutaneous lishmaniasis in human and considered as fairly prevalent infectious

    agent in the world. Employing advanced diagnostics for molecular identification of this

    microorganism has a more sensitivity and specificity in comparison to the microscopic methods. PCR

    is also introduced as one of the best known techniques for diagnosis of this parasite; however, the

    method is not widely used due to its expensive equipments and the time requested. Main aim of this

    research is diagnosis of L. major via employing an isothermal amplification technology so-called

    transcription-mediated amplification (TMA) using sequence-based primers.

    Materials and methods: Several specimens of cutaneous lishmaniasis were analyzed using TMA and

    RT-PCR in parallel. Total RNA of the specimens were isolated and used in the both assays. Sequence

    specific primers with T7 engineered promoter with hinge were used in the amplification process at

    37 C for targeting L. major 18S rRNA. Dimethylsulfoxide enhanced T7 RNA Polymerase activity in the

    reaction with optimized concentration. The RNA amplicons were produced in less than 90 minutes

    and then identified via electrophoresed agaros gel after staining with SyberGold. RT-PCR assays were

    also done to be compared with TMA.

    Results: Specific 200-nt amplicons of RNAs were characterized in the gel electrophoregram in

    comparison to RNA ladder. In addition, the TMA products could be identified with SyberGold

    fluorescent emission while exposed with ~300 nm UV irradiation wavelength in the reaction

    microtubes.

    Conclusion: TMA technology could be applied for molecular diagnosis of L. major in parallel with the

    culture, microscopy, and PCR. Using a fluorescent dye e.g. SyberGold in the reaction increases the

    sensitivity of the method and provide a significant rapidity in molecular diagnosis of the pathogen.

    Obtained results are also shown a comparable specificity and sensitivity between TMA and RT-PCR.

    Keywords: L. major, TMA, 18S rRNA

  • 3rd International Student Biotechnology Congress

    21

    Prediction of the genes involved in blood disorders during infection by

    Influenza virus A (H1N1) 2009

    Zahra Nurolah university of shahrekord

    Esmaeil Ebrahimi* university of shiraz

    *: [email protected]

    Abstract: The influenza virus belongs to the Orthomyxoviridae family virus. In 2009, a kind of this

    viruses appears in many areas of the word and leads to 18000 mortality. The symptoms of pandemic

    influenza are very different in humans, Including: the neuronal disorders that specially happen in

    children, Respiratory and blood disorders, that eventually lead to disability and death. In this study,

    Using microarray analysis, some genes involved in blood disorders, which are caused by influenza

    virus pandemic, was found. To do this end, microarray data of the effects of the tow mentioned

    viruses, pandemic and seasonal viruse, on Canis lupus (host) were obtained from NCBI (GEO=

    GSE17079). Then, the gene network of these genes was drawing. the results including one down

    regulated genes and 14 up regulated genes, Considering that Pvalue

  • 3rd International Student Biotechnology Congress

    22

    The Differentiation of Mesenchymal Stem Cells into lnsulin-producing Cells

    through Transduction of a Lentivirus Containing IPF-1 Gene

    Saman Rahmati Biochemistry Department, Pasteur Institute of Iran, Tehran, Iran

    Saman Setoodeh Stem Cell Department, Stem Cell Technology Research Centre , Tehran, Iran

    Mahdi Hasanvand Biochemistry Department, Pasteur Institute of Iran, Tehran, Iran

    Mohsen Karimi-Arznani Molecular Medical Department, Pasteur Institute of Iran, Tehran, Iran

    Mehdi Kadivar * Biochemistry Department, Pasteur Institute of Iran, Tehran, Iran

    *: [email protected]

    Introduction: Mesenchymal stem cells, are multifunctional cells with the ability to change and

    differentiate into different cell types such as Insulin-producing cells. Differentiation of mesenchymal

    stem cells into insulin-producing cells can be done by genetic or environmental factors. One of the

    most important factors which is involved in pancreas development and transcription of insulin gene

    is PDX-1 Transcription Factor. The purpose of this study is the differentiation of mesenchymal stem

    cells into insulin-producing cells.

    Materials and Methods: The recombinant lentivirus (made in previous study) was transduced into

    mesenchymal stem cells after being concentrated and titrated by ultracentrifugation and Flow

    cytometry respectively. The expression of pancreatic cell-specific genes, including insulin and Glut-2

    were assessed by RT-PCR in differentiated cells. The differentiated cells were then detected using

    anti-C-peptide antibody in ELISA.

    Results: The titration of viral particles was calculated in transducing unit per ml (TU/ml), in terms of

    the number of cells at the time of transduction and the percentage of the number of GFP-positive

    cells. Semi-quantitative RT-PCR results showed high expression of insulin and Glut-2. Quantitative

    measurement of C-peptide by using anti-C-peptide indicated the existence of cells having C-peptide.

    Conclusion: Regarding the results obtained from current study, mesenchymal stem cells are able to

    differentiate into insulin-producing cells via IPF-1 genetic factors.

    Keywords: Mesenchymal stem cells, IPF-1 gene,Lentivirus

  • 3rd International Student Biotechnology Congress

    23

    Crocetin attenuates spatial learning dysfunction and brain damage after

    chronic cerebral hypoperfusion in rats

    Faezeh Tashakori Sabzevar* Mashhad university of medical science

    *: [email protected]

    Introduction : Cerebral hypoperfusion is a major cause of cognitive deficits and memory

    impairment, in aging and in age-related neurological disorders .Alzheimer's disease (AD), vascular

    dementia and post-stroke hypoperfusion are the most important disorders, especially in elderly

    people after the age 65.The persistent decrease in cerebral blood flow is correlated with above

    mentioned disorders and severity of cognitive impairment. Also, the reduced cerebral blood flow

    (CBF) has been recently suggested as an important factor in progression of AD. Bilateral permanent

    occlusion of the common carotid arteries (2-VO) of rats has been widely used as a suitable model to

    investigate the chronic cerebral hypoperfusion.

    Materials and methods : our process consist of: 1.Preparation of crocetin 2.Analysis of crocetin with

    HPLC,TLC,spec 3.Animals (30 rats were divided into five groups: (1) sham-operated animals (non-

    ischemic group) underwent the same surgical procedure without ligation of the common carotid

    arteries (n=6); (2) control group received vehicle (n=6); treatment groups (group 3-5) received

    crocetin 2, 4 and 8mg/ kg per day, respectively (n=6 in each group). 4.Surgery and experimental

    procedure with 2VO 5.Behavioral experiments(Morris water maze 6.Pathology

    Results : The results indicated that the escape latency time significantly decreased in crocetin

    treated rats, in comparison with control animals. Also, the percentage of time spent and traveled

    distance in target quadrant on final test trial day increased in crocetin 8 mg/kg group, compared to

    control group, while no difference was observed between groups in swimming speed. All behavioral

    results confirmed by histopathological analysis.

    Conclusion : In conclusion, treatment with crocetin could effectively prevent neuropathological

    alterations in hippocampus and thereby resulting in improvement of spatial learning memory in rats

    after chronic cerebral hypoperfusion.

    Keywords : Cerebral hypoperfusion, Crocetin, Morris water, maze, Saffron

  • 3rd International Student Biotechnology Congress

    24

    Cytotoxic and Apoptotic Activity of Scrophularia amplexicaulis in MCF-7

    Human Breast Cancer Cells

    Samira Valiyari* Department of Medical Biotechnology, Pasteur Institute of Iran

    Saeid Yaripour Department of Drug and Food Control, Faculty of Pharmacy, Tehran

    University of Medical Sciences, Tehran, Iran.

    Fateme Zare Shahneh Immunology Research Center, Tabriz University of Medical Sciences

    Behzad Baradaran Immunology Research Center, Tabriz University of Medical Sciences

    Abbas Delazar Drug Applied Research Center, Tabriz University of Medical Sciences

    *: [email protected]

    Introduction : Breast cancer is the most common cancer in women. Therefore, there is an urgent

    need to identify and develop therapeutic strategies against this deadly disease. This study is the first

    to investigate the cytotoxic and apoptotic effects of Scrophularia amplexicaulis in MCF-7 human

    breast cancer cells

    Materials and methods : Three extracts of Scrophularia amplexicaulis including the n-hexane,

    dichloromethane and methanol extracts were examined. MTT and Trypan-blue assays were

    performed in MCF-7 cells as well as control cell line MCF10A to analyze the cytotoxic activity of the

    plant. Further, the apoptosis inducing action of extracts of the plant was evaluated using cell death

    ELISA and TUNEL assay.

    Results : The results showed that dichloromethane and methanol extracts significantly inhibited cell

    growth and viability without inducing damage to MCF10A cells. Cell death ELISA and morphological

    changes of cells in TUNEL assay showed that the induction of apoptosis was the main mechanism of

    cell death.

    Conclusion : Our results strongly suggest that this plant may contain potential bioactive

    compound(s) for the treatment of breast cancer.

    Keywords : Scrophularia amplexicaulis, cytotoxic, MCF-7 cells, apoptosis, anticancer, breast cancer

  • 3rd International Student Biotechnology Congress

    25

    RNA-binding protein Rbm47 binds to Nanog in mouse embryonic stem cells

    Meghdad Yeganeh University of Tehran

    Farnaz Akbari Kamrani Tehran University of Medical Sciences

    Nasser Ghaemi University of Tehran

    Ehsan Seyedjafari * University of Tehran

    *: [email protected]

    Introduction : Embryonic stem cells (ES cells) are pluripotent cells capable for self-renewal and to

    differentiate to all cell types. Finding the molecular mechanisms responsible for these unique

    characteristics of ES cells is important. RNA-binding proteins play important roles in post-

    transcriptional gene regulation by binding to specific mRNA targets. In this study, we investigated

    the targets of RNA binding protein Rbm47 in mouse ES cells.

    Materials and methods : To this aim, we overexpressed HA epitope-tagged Rbm47 in mouse ES cells,

    and then RNA-binding protein immunoprecipitation (RIP) was performed. For the RNA co-

    immunoprecipitated with Rbm47, we did RT-PCR for Oct4, Sox2, and Nanog, which are the main

    pluripotency factors.

    Results : RT-PCR results show that Rbm47 binds to Nanog transcript in mouse ES cells and

    doesnt bind to Sox2 and Oct4 transcripts in these cells.

    Conclusion : This finding can give rise to reveal molecular mechanisms underlying pluripotency and

    stemness of ES cells and will be necessary for efficient application of these cells in regenerative

    medicine and tissue engineering.

    Keywords : Embryonic stem cell, RNA binding protein, Rbm47, RIP

  • 3rd International Student Biotechnology Congress

    26

    Codon optimization, cloning and expression of single-chain variable fragment

    (scFv) antibody against CD22 in PichiaPastoris and optimization of Expression

    conditions

    Najmeh Zarei Pasteur Institute of Iran, Biotechnology Research Center

    VahidKhalaj* Pasteur Institute of Iran, Biotechnology Research Center

    BehruzVaziry Pasteur Institute of Iran, Biotechnology Research Center

    *: [email protected]

    Abstracts : The methylotrophic yeast Pichiapastoris has become a highly popular expression host

    system for the recombinant production of a wide variety of proteins such as antibody fragments.

    Single chain variable fragments (scFv) have many advantages over whole antibodies for use in

    antibody-targeted immunotherapy due to their small size. CD22, a B-cell specific surface molecule, is

    known to be up regulated in Non-Hodgkin's Lymphoma and other types of B-cell Lymphomas. To

    treat B-cell Lymphomas, multiple approaches including CD22 specific antibodies have been

    developed.

    In this project, the methylotrophic yeast Pichiapastoriswas used to produce an anti-CD22 single

    chain variable fragment, with the intention of conjugation to a radioisotope for therapeutic use. The

    scFv gene was designed and synthesized by choosing the P.pastorispreferred codons while keeping

    the G+C content at relatively low level. The full length gene cloned in the yeast vector, pPICZ and

    expressed in P.pastoris strain GS115.SDS-PAGE and western blotting analysis of culture medium

    from methanol-induced expression yeast clones demonstrated that the scFv was secreted into the

    culture medium. To improve scFv production we examined parameters such as time, pH, methanol

    concentration and cell density. Under optimized conditions (culture medium pH: 6-6.5, methanol

    concentaratin:1%, induction time: 72 h)the yield of soluble recombinant scFv was approximately 22

    mg/L. The recombinant protein was purified to greater than 95% purity using Ni-NTA column

    chromatography. Flow cytometry, immunohistochemistry, and western blotting revealed that the

    purified scFv could bind strongly to the membrane of CD22-positive cells, Raji cells, but not to CD22-

    negative cells, Jurkat cells. These results suggest that anti CD22 scFv produced in P. pastoris is active

    and specific toward CD22-positive cells and has potential for use in CD22-targeted immuonotherpy.

  • ssergnoC ygolonhcetoiB tnedutS lanoitanretnI dr3

    72

    ygolonhcetoiB larutlucirgA

    1bbad

    *naihcnahA mahlE ygolonhcetoib dna gnireenigne citeneG fo etutitsni lanoitaN

    ibaltaM afatsoM ygolonhcetoib dna gnireenigne citeneG fo etutitsni lanoitaN

    inamaZazer dammahoM ygolonhcetoib dna gnireenigne citeneG fo etutitsni lanoitaN

    ihcbaruoJ tamsE ygolonhcetoib dna gnireenigne citeneG fo etutitsni lanoitaN

    imorhaJsadahgom arhaZ ygolonhcetoib dna gnireenigne citeneG fo etutitsni lanoitaN

    [email protected]*

    :

    1bbaD .

    .

    fBAD. AND BATC anailaht.A :

    )GTTACACGGCAGAAGAAGTATTCTCGAGC( rBAD )CACGAGCTGCTAACTTCTGTAAGATCTCG(

    . IBCN 1caS 1abX

    . 2.1TEJp . RCP

    . negorcaM AND . )1002( llessuR &koorbmaS

    AND. esreverdrawrof 1bbad :

    . rBADfBAD RCP 1bbad

    . 336 AND RCP

    RocE RCP. 2.1TEJp

    . . V

    . 1bbad

    .

    1bbad :

    .

    1bbad :

  • 3rd International Student Biotechnology Congress

    28

    Transgenic expression and recovery of biologically active recombinant human

    insulin from Arabidopsis thaliana seeds

    BehnazHosseini* Shahidbahonar university of Kerman

    GholamrezaSharifiSirchi** Shahidbahonar university of Kerman

    *[email protected]

    **:[email protected]

    Abstract: The increased incidence of diabetes, coupled with the introduction of alternative delivery

    methods that rely on higher doses, is expected to result in a substantial escalation in the demand for

    affordable insulin in the future. Limitations in the production capacity and economics will make it

    difficult for current manufacturing technologies to meet this demand. We have developed a novel

    expression and recovery technology for the economical manufacture of biopharmaceuticals from

    oilseeds. The production of therapeutic proteins in plant seed augments alternative production

    platforms such as microbial fermentation, cell-based systems, transgenic animals, and other

    recombinant plant production systems to meet increasing demands for the existing biologics, drugs

    under evaluation, and undiscovered therapeutics in the future. A very useful tool in these endeavors

    is the plant model system Arabidopsis thaliana. As a proof of concept for this technology, we have

    produced recombinant human insulin in the model plant species Arabidopsis thaliana. In

    PlantaTransformatin by Agrobactrium is a new, simple and low cost method for plant

    transformation. This method applies successfully in Arabidopsis taliana and great attempts are done

    in applying this method in other speciecs. In this research, kind of Inplanta transformation method

    (Floral dip) was used for transformation of Arabidopsis plant. Agrobacterium strain, C58 containing

    pjawhol III having insulin gene was used in this investigation. In this method, in Floral dip infiltration

    method flowering plant dipped in the Agrobactrium culture. Seeds From infltrated Arabidopsis plant

    were planted in ortder to select transformants in media containig 50 and 30 myl Kanamycin.

    Recombinant insulin from transgenic Arabidopsis seeds was matured in vitro using trypsin and

    further characterized by mass spectral analysis. Using our technology, we have demonstrated that

    insulin can be expressed and recovered as an active molecule at commercially relevant levels from

    transgenic seeds.

    A. thaliana plants were transformed with the plant binary expression vector pJawhol III. Plant

    derived insulin accumulates to significant levels in transgenic seed (0.13% total seed protein) and

    can be enzymatically treated in vitro to generate a product with a mass identical to that of the

    predicted product, DesB(30)-insulin. The biological activity of this product in vivo and in vitro was

    demonstrated using an insulin tolerance test in mice respectively. The study demonstrates

    bioequivalence of purified insulin from Arabidopsis seeds when compared with commercial insulin

    products in an animal model. "Demand for insulin will continue to grow as the incidence of diabetes

    increases