Interactions phage-hôte chez Streptococcus

pneumoniae

Thèse

SIHAM OUENNANE

Doctorat en microbiologie

Philosophiae doctor (Ph. D.)

Québec, Canada

©Siham Ouennane, 2017

ii

Interactions phage-hôte chez Streptococcus

pneumoniae

Thèse

SIHAM OUENNANE

Sous la direction de :

Sylvain Moineau, directeur de recherche

iii

RÉSUMÉ

Streptococcus pneumoniae est une bactérie à la fois commensale et pathogène

opportuniste chez l’humain. Elle est responsable de nombreuses infections telles que la

pneumonie, la méningite, l’otite moyenne et la sinusite. En maladie infectieuse, S.

pneumoniae occupe une place importante en tant que l’une des principales causes de

morbidité et de mortalité dans le monde. Elle est dotée de plusieurs capacités fascinantes,

comme la compétence naturelle pour l’aider à résister aux antibiotiques et la grande

diversité des sérotypes capsulaires pour contourner la vaccination. Puisque la résistance aux

antibiotiques ne cesse de menacer l’efficacité des thérapies standards, la thérapie par phage

est maintenant reconsidérée comme une des alternatives thérapeutiques. La réévaluation

des phages fait renaitre l’espoir thérapeutique, mais sans élucider leur mécanisme

d’interaction et décortiquer leur mystère cet espoir restera modeste.

Ce projet de doctorat consiste à mieux comprendre les phages infectant S.

pneumoniae et les interactions phage-hôte. Dans un premier temps, le potentiel des

pneumophages à infecter Streptococcus mitis, une espèce phylogénétiquement proche de S.

pneumoniae, a été mis en évidence. Deux pneumophages se sont avérés les premiers phages

virulents capables d’infecter S. mitis, bactérie pathogène responsable d’endocardite. Les

deux phages pouvaient non seulement se répliquer dans S. mitis mais également produisent

des plages de lyses plus visibles. Ensuite, la comparaison du génome des phages a confirmé

que le changement de l’hôte n’induit aucune variation aux génomes des phages testés.

Cependant, plusieurs mutations ont été observées dans la séquence génomique du

podophage sauvage et il a fait ensuite l’objet d’une nouvelle annotation. Dans un deuxième

temps, l’étude des interactions phage-hôte chez S. pneumoniae a été approfondie. Pour ce

faire, l’implication de plusieurs facteurs de l’hôte dans la réplication des pneumophages a

été étudiée. Plusieurs gènes pneumococciques se sont avérés nécessaires ou impliqués pour

assurer l'efficacité de la réplication des phages seuls ou en cocktail. D’un autre côté, en

étudiant ces facteurs de l’hôte, des gènes/ protéines potentiellement essentiels à la viabilité

de S. pneumoniae ont été identifiés.

iv

Cette étude a aussi permis d’identifier de nouvelles cibles thérapeutiques et donne

un nouvel aperçu du réseau complexe des interactions phage-hôte.

v

ABSTRACT

Streptococcus pneumoniae is a commensal and opportunistic pathogen bacterium,

exclusively found in humans. It is the main agent of many infections such as pneumonia,

meningitis, otitis media and sinusitis. S. pneumoniae infections are a major cause of

morbidity and mortality worldwide. S. pneumoniae has several fascinating abilities, such as

natural competence to facilitate the acquisition of antibiotic resistance genes and diversity

of capsular serotypes to circumvent the vaccination. The rise of antibiotic resistant bacteria

continues to threaten the effectiveness of standard therapies and as such phage therapy is

now reconsidered as a therapeutic alternative. The reevaluation of phages as therapeutic

agents must go through a better understanding of phage-bacterium interactions.

This PhD thesis aims to better understand S. pneumoniae virulent phages and phage-

host interactions. First, the ability of pneumophages to infect Streptococcus mitis, a species

phylogenetically related to S. pneumoniae, was demonstrated. The pneumophages are the

first two virulent phages able to infect this pathogenic bacterium, the common cause of

bacterial endocarditis. Both pneumophages could not only replicate in S. mitis but also

produced more visible plaques on this host. The comparison of the genomes of each phage

grown on both hosts produced identical nucleotide sequences, confirming that S. mitis as a

host does not induce any nucleotide variation. However, the genomic sequence of wild-type

podophage was different than the previously reported sequence and it was the subject of a

new annotation. In addition, S. pneumoniae phage-host interactions were investigated. The

involvement of several host factors in replication of both pneumophages was observed.

Indeed, several pneumococcal genes were found to be necessary or involved to ensure

efficient phage replication. Moreover, the study of these host factors has led to the

identification of new genes that appear to be essential for viability and normal growth of S.

pneumoniae.

This project led to identify new potential therapeutic targets and provided new

insight into the complex network of phage-host interactions.

vi

vii

Table des matières

RÉSUMÉ ..................................................................................................................................... iii

ABSTRACT ................................................................................................................................. v

Table des matières ...................................................................................................................... vii

Liste des tableaux ........................................................................................................................ xi

Liste des figures .......................................................................................................................... xii

Liste des abréviations ................................................................................................................ xiii

Remerciements ........................................................................................................................... xv

Chapitre I. Introduction ................................................................................................................ 1

Avant-propos ................................................................................................................................ 1

Streptococcus pneumoniae ........................................................................................................... 1

Présentation .............................................................................................................................. 1

Mécanisme de la transformation naturelle ............................................................................ 3

Croissance et division cellulaire ........................................................................................... 6

Physiopathologie des infections à S. pneumoniae .................................................................. 12

Données épidémiologiques ................................................................................................. 12

Mécanismes de la colonisation de l’hôte ............................................................................ 14

Processus d’infection et infections associées ...................................................................... 18

Facteurs de virulence .............................................................................................................. 19

Capsule polysaccharidique ................................................................................................. 20

Pneumolysine ...................................................................................................................... 22

Protéines de surface ............................................................................................................ 22

Traitements antipneumococciques ......................................................................................... 25

Traitements préventifs ........................................................................................................ 25

Traitement et résistance aux antibiotiques .......................................................................... 27

Bactériophages ........................................................................................................................... 30

Rappel historique .................................................................................................................... 30

Classification des bactériophages ........................................................................................... 32

Réplication des bactériophages .............................................................................................. 34

Phages infectant Streptococcus pneumoniae .......................................................................... 36

Problématique, hypothèses et objectifs du projet ....................................................................... 41

viii

Chapitre 2. Diverse virulent pneumophages infect Streptococcus mitis .................................... 43

Résumé ................................................................................................................................... 43

Avant-propos .......................................................................................................................... 43

Contributions des auteurs.................................................................................................... 43

Publication .......................................................................................................................... 44

Abstract ................................................................................................................................... 44

Introduction ............................................................................................................................ 44

Materials and Methods ........................................................................................................... 47

Results .................................................................................................................................... 50

Discussion ............................................................................................................................... 58

Acknowledgments .................................................................................................................. 60

References .............................................................................................................................. 61

Supporting information ........................................................................................................... 65

Chapitre 3. Identification of host factors involved in the interaction of Streptococcus

pneumoniae with its virulent phages .......................................................................................... 68

Résumé ................................................................................................................................... 68

Avant-propos .......................................................................................................................... 69

Contributions des auteurs.................................................................................................... 69

Publication .......................................................................................................................... 69

Abstract ................................................................................................................................... 69

Introduction ............................................................................................................................ 70

Results .................................................................................................................................... 72

Discussion ............................................................................................................................... 88

Materials and Methods ........................................................................................................... 91

Acknowledgements ................................................................................................................ 95

References .............................................................................................................................. 98

Supporting Information ........................................................................................................ 102

Chapitre 4: Discussion et perspectives ..................................................................................... 115

Conclusions .............................................................................................................................. 124

Bibliographie ............................................................................................................................ 125

Annexe ...................................................................................................................................... 149

Gagner la guerre contre les bactéries résistantes aux antibiotiques ...................................... 149

ix

Résumé de la publication ...................................................................................................... 149

Avant-propos ........................................................................................................................ 149

Contributions des auteurs.................................................................................................. 149

Publication ........................................................................................................................ 149

Abstract .................................................................................................................................... 150

Introduction .............................................................................................................................. 150

1. Bacteriophage therapy....................................................................................................... 153

Other phage applications in human diseases .................................................................... 157

Phage applications in industries ........................................................................................ 158

Phage components as antibacterial agents ........................................................................ 159

2. Immune modulation therapy ............................................................................................. 159

3. Antimicrobial peptides ...................................................................................................... 163

4. Probiotics and prebiotics ................................................................................................... 165

5. Other antimicrobial agents ................................................................................................ 167

Medicinal Plants ............................................................................................................... 167

Essential oils ..................................................................................................................... 168

Conclusions .............................................................................................................................. 168

References ................................................................................................................................ 169

x

xi

Liste des tableaux

Table 2.1. Putative Open Reading Frames deduced from SOCP genome sequences and their

predicted functions ............................................................................................................... 55

Table S2.1 Primers used in this study to confirm variations within the genome of phage

SOCP. ................................................................................................................................... 65

Table S2.2 Primer sequences of four housekeeping genes. .................................................. 65

Table S2.3 Differences between the genomes of phage SOCP and Cp-1. ........................... 65

Table S2.4. Codon usage of pneumophages Dp-1 and SOCP for selected amino acids

compared to the hosts S. pneumoniae and S. mitis. .............................................................. 67

Table 3.1 A summary and general function of S. pneumoniae genes and the lytic phages

used in this study, based on Y2H screens by Mariano et al. ................................................ 75

Table 3.2 Effect of gene inactivation and host-phage interactions of S. pneumoniae .......... 76

Table 3. 3 Bacterial strains, plasmids and phages used in this study ................................... 91

Table S3.1 Protein-protein interaction in S. pneumoniae. .................................................. 104

Table S3.2 Primers used for gene knockout assays ............................................................ 110

Table S3.3 Primers used for complementation assays ....................................................... 112

Table A. 1 Summary of the bacterial anti-phage mechanisms and strategies used by phage

to avoid host resistance. ...................................................................................................... 155

xii

Liste des figures

Figure 1.1 Morphologie des colonies de diverses souches de S. pneumoniae cultivées sur

gélose sang .............................................................................................................................. 2

Figure 1.2 Principe de fratricide chez S. pneumoniae ............................................................ 6

Figure 1.3 Représentation schématique de la synthèse de la paroi cellulaire....................... 10

Figure 1.4 Interaction entre S. pneumoniae et les cellules épithéliales. ............................... 17

Figure 1.5 Principaux facteurs de virulence de S. pneumoniae. ........................................... 20

Figure 2.1 Electron microscopy of virulent phage Dp-1 (A) and phage SOCP (D) ............. 51

Figure 2.2 Genome alignment of phages SOCP and Cp-1 ................................................... 54

Figure 2. 3 Comparison of the proteome of pneumophage SOCP/ Cp-1 ............................. 58

Figure 3. 1 Schematic representation of the genes involved in host-phage interaction. ...... 73

Figure 3. 2 Efficiency of plating of two pneumococcal virulent phages on various

knockouts in S. pneumoniae ................................................................................................. 82

Figure 3. 3 Efficiency of plating of two pneumococcal virulent phages on S. pneumoniae

strains complemented with wild-type genes ......................................................................... 84

Figure 3. 4 Schematic representation of construction of pFF3 plasmid, using TA cloning-

like system ............................................................................................................................ 94

Figure S3. 1 Map of pLS1RGFP vector showing key features of the plasmid .................. 102

Figure S3. 2 Comparison of the maltose effect on phage infection. .................................. 103

Figure A. 1 Summary of antibiotic target site and resistance mechanisms in Gram-positive

and Gram-negative bacteria. ............................................................................................... 152

Figure A. 2 Main strategies of applying bacteriophages in phage .................................... 154

xiii

Liste des abréviations

ADN acide désoxyribonucléique

ADNdb acide désoxyribonucléique double brin

ADNsb acide désoxyribonucléique simple brin

AMPs antimicrobial peptides

ARN acide ribonucléique

ARNr acide ribonucléique ribosomique

ARNt acide ribonucléique de transfert

BCWH hydrolases de la paroi bactérienne (bacterial cell wall hydrolases)

BHI infusion de cœurs et cervelles (brain heart infusion)

BIM mutant bactérien résistant aux bactériophages (bacteriophage insensitive

mutant)

CAP pneumonie communautaire acquise (community acquired pneumonia)

CBPs protéines de liaison à la choline (choline-binding proteins)

CRISPR clustered regularly interspaced short palindromic repeats

CsCl chlorure de césium

CSP peptide de stimulation de la compétence (competence stimulating peptide).

EOP efficacité à former des plages de lyse (efficiency of plaquing)

GFP green fluorescent protein

IgA1 immunoglobuline A1

LytA autolysine majeure

mAb anticorps monoclonaux (monoclonal antibodies)

MgSO4 sulfate de magnésium

MitC mitomycine C

MOI multiplicité d’infection

NanA neuraminidase A

OD densité optique

ORFs cadre de lecture ouvert (open reading frame)

PAF facteur d'activation plaquettaire

PCR réaction en chaîne de la polymérase (polymerase chain reaction)

PFU plaque forming units

xiv

PG peptidoglycan

PLPs protéines liant la pénicilline

PsaA adhésine A de surface du pneumocoque

PspA protéine A de surface du pneumocoque

RBP protéine de liaison au récepteur (receptor binding protein)

TSA trypticase soy agar

Y2H yeast 2-hybrid assay

xv

Remerciements

C’est enfin l’accomplissement de plusieurs années de travail qui ont nécessité une grande

volonté et beaucoup d’effort. Sans l’encouragement et le soutien de plusieurs personnes, je

n’aurais pas pu voir la fin de cette thèse.

Tout d’abord, je remercie vivement mon directeur de thèse, Prof Sylvain Moineau, de

m’avoir accueillie dans son laboratoire et de m’avoir fait découvrir le monde fascinant des

bactériophages. Je vous suis infiniment reconnaissante pour votre disponibilité

inconditionnelle, vos précieux conseils et votre grande expertise. Votre passion pour les

phages et surtout pour les CRISPR m’a beaucoup impressionné et m’a donné de vraies

leçons de la vie. J’ai appris grâce à vous qu’aimer ce qu’on fait est un véritable enjeu pour

réussir la vie professionnelle. Je vous remercie pour votre simplicité, gentillesse et

amabilité. Merci d’avoir était un leader exemplaire qui a toujours su comment rendre la vie

d’un grand groupe au laboratoire un meilleur environnement d’échange, d’apprentissage et

de brassage culturel.

Un grand merci à tous mes collègues de travail. Merci pour vos conseils et vos explications.

Je remercie surtout ma collègue, ma sœur et mon amie Lynn. Merci pour ta présence, tes

encouragements et pour les meilleurs moments de bonheur qu’on a partagé et ceux de stress

que j’ai pu surmonter. Si simple si gentille et si franche tout simplement Lynn, merci pour

tout. Je remercie également Geneviève. Merci pour tes conseils, tes explications et pour vos

qualités humaines et professionnelles. Merci également à Denise pour l’ambiance et le sens

d’organisation qui règne dans le laboratoire. Merci à mes amis et collègues Alfonso, Hany

et Cas pour tous les meilleurs moments qu’on a pu partager.

Il y’a quelque années, je suis arrivée toute seule et me voilà aujourd’hui entourée de

beaucoup d’amis. Merci à vous tous, vous avez su rendre mon intégration si facile et

plaisante.

Merci à ma chère sœurette Houda et à mon adorable frère Reda. Merci de m’avoir

encouragé et soutenu toujours. Merci pour les longues heures au téléphone. Vous avez

toujours su me supporter et partager avec moi, même à distance, tous mes grands moments.

xvi

Que ce travail soit un témoignage de tous mes sentiments et toute ma gratitude pour le

soutien, la compréhension, l’encouragement et la patience dont vous avez fait preuve.

Un grand merci infini à mes chers parents, Maria et Abdellah. C’était difficile d’être si loin

de vous et malgré vous étiez toujours présents pour m’écouter et me faire sortir de ma

solitude. Merci d’avoir toujours cru en moi, vos encouragements m’ont beaucoup aidé pour

finir cette thèse. Merci pour tous les sacrifices, le soutien et l’affection. Sans vous je

n’aurais jamais pu surpasser tous les écueils. Puisse ce modeste travail être le témoignage

de ma profonde gratitude et mon profond amour.

Un grand Merci à Saleh. Par où commencer, ici t’étais pour moi toute ma famille! Merci

d’avoir toujours été là pour moi et de m’avoir soutenu tout au long de cette thèse. Merci

pour ton encouragement, ta confiance et ton support moral. Merci d’avoir toujours cru en

moi et en mon potentiel. Merci pour ta compréhension et ton sens d’humour. Tu as toujours

su me faire rire et me sortir de mes moments de stress et de panique. Merci pour tout.

xvii

Leonardo da Vinci

xviii

1

Chapitre I. Introduction

Avant-propos

L’introduction de cette thèse est divisée en plusieurs sections. Les deux premières sections

permettent de décrire la bactérie Streptococcus pneumoniae qui fait l’objet de cette étude et

traite de son phénotype de résistance aux antibiotiques et de son impact sur la santé

publique. La troisième section présente l’histoire des phages, leurs diversités et leurs

caractéristiques. Enfin, la dernière section de l’introduction aborde les méthodes

alternatives pour le traitement des infections causées par des bactéries pathogènes

résistantes aux antibiotiques, présentée sous la forme d’un article de revue en annexe.

L’article fait aussi le point sur les différents aspects de la thérapie par phage, les produits de

phage et leurs applications dans le domaine médical et agroalimentaire.

Streptococcus pneumoniae

Présentation

Streptococcus pneumoniae est une bactérie de grande importance clinique connue aussi

sous le nom de pneumocoque en référence à sa morphologie et à la pneumonie

communautaire acquise (PCA) causée principalement par cet agent pathogène. Cette

bactérie à Gram-positif appartient à la famille des Streptococcaceae et au genre

Streptococcus qui regroupe actuellement 72 espèces, incluant plusieurs bactéries très

pathogènes pour l’homme (Richards, et al., 2014). Découverte pour la première fois en

1881 par Leo Escolar, elle a aussi été isolée simultanément par Louis Pasteur et George

Miller Sternberg à partir d'échantillons de salive humaine (Watson, et al., 1993). Au fil du

temps, cette bactérie a porté plusieurs noms pour mettre en évidence à la fois ses

particularités bactériologique et taxonomique, passant de Microbe septicémique de la

salive, nom donné par Pasteur, puis Micrococcus pasteuri par Sternberg à Pneumococcus

par Albert Fraenkel (1886) (Watson, et al., 1993). Ce pathogène a été renommé

2

Diplococcus pneumoniae, de 1920 à 1974, avant d’être finalement rebaptisé à son nom

actuel, Streptococcus pneumoniae (Watson, et al., 1993).

S. pneumoniae se présente sous forme de coque, de 0,5 à 1,25 micromètre de diamètre,

souvent groupé en diplocoque ou en courte chaînette. Cette bactérie ne forme pas de spores

et est non-motile malgré la présence de pili (Muschiol, et al., 2015). Le pneumocoque a un

métabolisme anaérobie facultatif produisant une hémolyse partielle, de type alpha, due à la

lyse des globules rouges, visible par une coloration verdâtre autour des colonies ayant

poussé sur une gélose sang. Une hémolyse de type bêta a été aussi observée en conditions

d'anaérobie lors d’une incubation à basse température (entre 6 et 22°C) (Lorian & Popoola,

1972). La forme virulente du pneumocoque est entourée d’une capsule polysaccharidique et

présente une morphologie coloniale d’aspect lisse sur gélose sang, tandis qu’une souche

non capsulée, avirulente, donne des colonies d’aspects rugueux (Belanger, et al., 2004)

(Figure 1.1).

Figure 1.1 Morphologie des colonies de diverses souches de S. pneumoniae cultivées

sur gélose sang. (A) souche D39; (B) R6; (C) AB2; (D) AB7; (E) AB28; (F) R36A; (G)

AB14; (H) AB15. Figure tirée de Bélanger et al. (2004).

Cette bactérie est catalase négative donc elle a recourt à d’autres sources exogènes de

catalase, dont celles dans une gélose sang frais, par exemple pour dégrader la grande

quantité de peroxyde d'hydrogène produit lors de sa croissance (Ranjan, et al., 2014). Elle

se différencie des autres Streptococcus par sa sensibilité à l’optochine, sa lyse par la bile et

surtout par la caractérisation de ses antigènes polysaccharidiques capsulaires. S.

pneumoniae est incapable d’obtenir l’énergie (ATP) par respiration et opte pour un

métabolisme fermentaire homolactique en fermentant les sucres en acide lactique. En effet,

le pneumocoque possède de nombreux gènes impliqués dans le métabolisme des sucres et

3

leur transport, ce qui permet le métabolisme d’une large variété de substrats carbonés

(Hoskins, et al., 2001).

Mécanisme de la transformation naturelle

S. pneumoniae fait partie des bactéries ayant une capacité inhérente d’incorporer l’ADN

exogène par la transformation génétique naturelle. En 1928, Frederick Griffith a démontré

pour la première fois le phénomène de la transformation naturelle par transfert de caractères

entre deux souches de S. pneumoniae. Ce n’est qu’en 1944 que cette découverte a été

valorisée et reprise par Avery, MacLeod et McCarty qui ont montré que c’est l’ADN qui

permet le transfert de caractères d’une bactérie à l’autre (Avery, et al., 1944). Leurs travaux

ont permis d’identifier le principe de la transformation et de supporter l'hérédité génétique.

Cette propriété a fait de cette bactérie un microorganisme modèle pour l’étude de la

transformation, de l’acquisition d’ADN de l’environnement et de l’intégration dans son

génome par recombinaison homologue. Actuellement, la transformation naturelle a été

démontrée chez plus de 80 espèces bactériennes permettant à la cellule receveuse

d’acquérir de nouveaux gènes pour mieux s’adapter et persister face aux changements des

conditions environnementales (Johnston, et al., 2014). Chez la plupart des bactéries

transformables, les protéines impliquées dans la transformation sont directement codées par

le génome de la bactérie et ne s’expriment pas de façon permanente mais exigent des

conditions spécifiques pour assurer leur expression. En effet, le pneumocoque a la capacité

de s’adapter naturellement pour incorporer l’ADN exogène, et ceci lorsque la bactérie est

dans un état spécifique nommé état de compétence, ou x-state, obtenue à un moment

spécifique de sa phase exponentielle de croissance (Campbell, et al., 1998). L'induction de

la compétence génétique est une stratégie utilisée par les bactéries afin d’augmenter leur

répertoire génétique sous des conditions de stress (Perry, et al., 2009).

Chez S. pneumoniae, l’état physiologique transitoire est coordonné par un peptide de

stimulation de la compétence CSP (Competence Stimulating Peptide). Le CSP est une sorte

d’hormone polypeptidique extracellulaire de 17 acides aminés (Johnsborg & Havarstein,

2009). Il est particulièrement important pour initier la compétence et sa présence dans le

milieu active la transcription de deux gènes, comX et comW. Il active également 15 autres

4

gènes précoces et 60 autres gènes tardifs impliqués soit dans les mécanismes de la fixation

et d’internalisation de l’ADN exogène ou dans le devenir de cet ADN internalisé

(Johnsborg & Havarstein, 2009, Piotrowski, et al., 2009). Chez le pneumocoque, il existe

six isoformes de ce peptide, mais la majorité des souches produisent soit le CSP-1 ou le

CSP-2, qui s’attachent respectivement aux récepteurs ComD-1 et ComD-2 et diffèrent de

12 acides aminés (Allan, et al., 2007, Johnsborg & Havarstein, 2009). Lors de la

transformation chez le pneumocoque, la première étape du processus d’entrée est la fixation

de l’ADN double brin à la surface des cellules transformables et qui requiert la présence de

protéines codées par les gènes tardifs comGs. L’entrée d’un brin et la dégradation

simultanée du brin complémentaire se produisent à des vitesses similaires, ~100 nucléotides

s-1

à 30°C, et avec des polarités opposées, ce qui est compatible avec un modèle de

couplage de la dégradation d’un brin et de l’internalisation de son complément (Mejean &

Claverys, 1993, Berge, et al., 2002). Par ailleurs, il a été proposé que la rétraction de pili et

la formation de pores par des protéines membranaires puissent avoir un rôle dans la fixation

et l’internalisation d’ADN exogène dans la bactérie (Chen & Dubnau, 2004, Laurenceau, et

al., 2013). Lee pore d’entrée de l’ADN est composé de deux pseudo-pili apparentés aux

systèmes de sécrétion de type IV et ayant une structure homologue à la protéine majeure de

piline ComGC (Muschiol, et al., 2015).

En 2005, il a été démontré que la transformation chez S. pneumoniae touche l’ensemble des

cellules d’une culture bactérienne et que l’état de compétence induit la lyse de toutes les

bactéries non compétentes, de la même espèce ou d’espèces proches, par les pneumocoques

compétents, (Gilmore & Haas, 2005, Guiral, et al., 2005), un phénomène nommé au début

allolyse puis fratricide (Claverys & Havarstein, 2007) (Figure 1.2).

Le phénomène fratricide implique l’activation d’un système enzymatique dont les cellules

compétentes sont immunisées. La plupart des protéines intervenant dans ce phénomène sont

codées par des gènes tardifs. Des enzymes lytiques, comme l’autolysine majeure LytA, sont

requises pour induire le fratricide chez S. pneumoniae et pour lyser les cellules non

compétentes. D’autres enzymes nécessaires incluent LytC codant pour une hydrolase du

peptidoglycane dont l’expression est constitutive, CbpD codant pour une amidase et CibAB

codant pour une bactériocine (Guiral, et al., 2005). Cependant, les bactéries compétentes

5

sont immunisées contre l’action de ces protéines lytiques par l’expression des protéines

d’immunité comme CibC et ComM (Muschiol, et al., 2015).

Ce mécanisme de fratricide joue un rôle important en diminuant la compétition pour les

nutriments, augmentant l’efficacité de la transformation et la libération de facteurs de

virulence, comme la pneumolysine (Havarstein, et al., 2006). Cela permet de stimuler le

système de défense des bactéries et surtout leur permet d’avoir un groupe de gènes

communs qui représente une véritable voie pour échapper aux pressions de sélection

comme les antibiotiques.

6

Figure 1.2 Principe de fratricide chez S. pneumoniae. Figure tirée et adaptée de Claverys

& Havarstein (2007).

Croissance et division cellulaire

Comme tous les microorganismes, l’accroissement du nombre de cellules est un processus

biologique fondamental pour assurer la survie de l’espèce. Chez les bactéries, la croissance

implique la division des cellules mères en deux cellules filles. Cette croissance bactérienne

est contrôlée par plusieurs mécanismes pour permettre à la fois de choisir le site exact de la

7

division, de dupliquer fidèlement le génome et de partager équitablement l’information

génétique entre deux cellules filles. La disponibilité des nutriments dans le milieu et

d’autres facteurs physicochimiques comme la température, le pH du milieu et la pression

osmotique influencent fortement la division cellulaire (Monahan, et al., 2014).

Plusieurs études ont été déployées pour élucider les mécanismes intervenant au cours de la

division bactérienne et pourtant ce processus vital reste encore relativement mal compris.

La machinerie de la division bactérienne met en jeu plusieurs processus comme la synthèse

du peptidoglycane (PG) septal, les protéines liant la pénicilline (PLPs) et plusieurs

hydrolases pour l’autolyse, le clivage de septum de séparation et la séparation des cellules

filles (Typas, et al., 2012, Sundararajan, et al., 2015). Durant la division cellulaire, le PG

joue un rôle clé pour parvenir à l’augmentation du volume de la cellule, la formation du

septum de séparation et la séparation des cellules filles. Ainsi, son intégrité est

indispensable pour la survie bactérienne (Pinho, et al., 2013). Du point de vue général, les

bactéries sont dotées de mécanismes de croissance différents étroitement liés à leur

diversité morphologique pour guider la division bactérienne et la ségrégation des

chromosomes (Pinho, et al., 2013). Jusqu’à tout récemment, les travaux pour élucider les

mécanismes de la division bactérienne ont été réalisés essentiellement chez deux bacilles:

E. coli et B. subtilis (den Blaauwen, et al., 2008). Dans le but d’élargir les connaissances

sur les mécanismes sous-jacents de ce processus vital, plusieurs études récentes ont adopté

comme modèle la forme la plus simple des bactéries; les coques dont les plus connus sont

S. pneumoniae (ovocoque) et Staphylococcus aureus (bactérie sphérique) et ayant deux

modes distincts de synthèse du PG (Pinho, et al., 2013).

Le PG est un composant majeur de la paroi bactérienne qui maintient la forme cellulaire et

assure une protection mécanique contre la pression osmotique. D’autre part, son intégrité

est cruciale pour la survie de la bactérie afin d’empêcher la lyse cellulaire. D’ailleurs,

l’inhibition de la synthèse de la paroi bactérienne est la cible vitale des antibiotiques de la

famille des β-lactamines. Toutefois, l’usage excessif des antibiotiques de cette famille dans

le traitement des infections à pneumocoque a grandement favorisé l’émergence des souches

de S. pneumoniae résistantes et multi-résistantes aux β-lactamines, comme on le verra plus

loin dans cette présentation bibliographique. Une stratégie pour faire face au problème de la

8

résistance de S. pneumoniae aux β-lactamines consiste à étudier et à combler le manque de

connaissances reliées à la composition et au mécanisme de remodelage du PG ainsi qu’au

processus de la division cellulaire.

Le pneumocoque adopte à la fois deux modèles de synthèse du PG; périphérique (Higgins

& Shockman, 1970) et septal (Tomasz, et al., 1964). La synthèse du PG, se déroule en trois

étapes qui se produisent à trois endroits différents dans la cellule (Pinho, et al., 2013).

D’abord, au niveau du cytoplasme, un ensemble de réactions enzymatiques permet la

formation des précurseurs du PG grâce aux protéines de la famille Mur (Pagliero, et al.,

2005), puis l’association à un groupement undécaprényl-phosphate au niveau interne de la

membrane cytoplasmique pour former le lipide I (MurNAc-pentapeptide) (van Heijenoort,

2001, Pinho, et al., 2013). Après le groupe GlcNAc est ajouté par la protéine MurG pour

générer le lipide II qui va être transloqué à travers la membrane (van Heijenoort, 2001). À

ce stade, la biosynthèse du PG implique deux types d’activités pour polymériser l’unité

monomère du PG: les glycosyltransférases (GTases) pour polymériser les chaînes glycanes

et les DD-transpeptidases (dd-TPases) pour réticuler les peptides (Typas, et al., 2012). Ces

deux réactions enzymatiques sont résidentes sur les domaines extracellulaires des PLPs, qui

sont des molécules associées à la membrane (Pagliero, et al., 2005).

Les PLPs sont associées à la membrane et participent aux étapes finales de synthèse du PG.

Le nombre de PLP varie considérablement chez les bactéries. Les bacilles en ont

habituellement un grand nombre comme E. coli et B. subtilis ayant respectivement 12 et 16

PLPs. Elles sont moins nombreuses chez les coques, souvent entre quatre et sept (Zapun, et

al., 2008). Les protéines PLPs sont fréquemment divisées en deux catégories: PLPs de

haute masse moléculaire (HMM) et PLPs de faible masse moléculaire (FMM) (Goffin &

Ghuysen, 1998). S. pneumoniae possède six PLPs dont cinq PLPs de HMM, regroupées en

deux classes A et B, et une PLP de FMM. Les PLPs de classe A comprennent les protéines

PLP1a, PLP1b et PLP2a qui sont bifonctionnelles ayant à la fois une activité GTase pour la

synthèse des brins glycanes et une activité dd-TPase pour la réticulation du peptidoglycane.

Les protéines PLP2b et PLP2x font partie de la classe B et sont monofonctionnelles ayant

seulement une activité dd-TPase (Typas, et al., 2012, Pinho, et al., 2013). PLP3 est une

protéine de FMM et a une activité carboxypeptidase. Chez d’autres bactéries, les protéines

9

de cette catégorie peuvent avoir une activité endopeptidase (Zapun, et al., 2008, Pinho, et

al., 2013). La plupart des PLPs du pneumocoque ont des fonctions redondantes ce qui a

rendu difficile d'assigner une fonction spécifique à chaque PLP (Zapun, et al., 2008).

Chez S. pneumoniae, l’utilisation de nouveaux outils comme le marquage avec la

vancomycine fluorescente a démontré que la synthèse du PG survient au milieu de la

cellule, nommé site de division, entre les anneaux équatoriaux (Daniel & Errington, 2003,

Ng, et al., 2004, Zapun, et al., 2008). D’autre part, chez les ovocoques, la synthèse du PG

périphérique et du septum de séparation se produisent lors de la division cellulaire (Pinho,

et al., 2013). La synthèse du PG périphérique est catalysée par la protéine PLP2b qui se

produit près du site de la division, conduisant à l’insertion du PG entre ce site et les futurs

sites de division, anneaux équatoriaux, et provoquant une légère élongation longitudinale

(Pinho, et al., 2013). De même, les protéines PLP1a et PLP2x catalysent la synthèse du

septum de séparation qui conduit à la formation du septum perpendiculairement à l’axe

longitudinal (Pinho, et al., 2013). Les gènes PLP2x et PLP2b sont essentiels pour S.

pneumoniae et font partie du groupe de gènes dcw (division and cell wall) qui est un

complexe multienzymatique codant pour des protéines impliquées dans la biosynthèse de la

paroi cellulaire et la division cellulaire (Massidda, et al., 1998).

D’autres PLPs, comme PLP1b, PLP2a et PLP3, sont également impliquées dans l’insertion

et la synthèse du néo-PG, cependant leurs rôles exacts restent inconnus (Pinho, et al.,

2013). De même, le mode de recrutement des PLPs sur le site de la division n’est pas clair.

Cependant, uniquement l’implication de la reconnaissance du substrat dans la localisation

des PLPs de HMM a été observée (Pinho, et al., 2013). De plus, la protéine PLP3 est

répartie uniformément dans les deux hémisphères du pneumocoque et semble être absente

au futur site de division pendant les étapes initiales de la division pour permettre d’enrichir

cette zone en substrats des PLPs. Une fois la croissance et la division en cours, PLP3

semble être plus concentrée au niveau du site de division cellulaire pour réguler le degré de

réticulation du PG mature en inhibant toute réaction de trans-peptidation (Morlot, et al.,

2004) (Figure 1.3).

La division cellulaire nécessite une identification précise du site de division et de placement

de la machinerie de la division. La protéine FtsZ, en référence à la filamentation

10

thermosensible, est une protéine responsable de l’organisation du complexe de septation du

PG et aussi la première protéine recrutée dans la formation du futur site de division, où elle

polymérise pour former un anneau cytoplasmique (Pinho, et al., 2013, Fleurie, et al., 2014).

Son positionnement est guidé par la protéine MapZ (Fleurie, et al., 2014). Également, MreB

est une protéine essentielle pour la bactérie et homologue à la protéine d'actine intervenant

dans l’organisation des protéines de la synthèse du PG ainsi que dans la voie de biosynthèse

du PG, induisant ainsi un allongement préseptal chez les bacilles (Typas, et al., 2012).

Figure 1.3 Représentation schématique de la synthèse de la paroi cellulaire (PG septal

et PG périphérique) chez les ovocoques (ex. S. pneumoniae). Figure tirée et adaptée de

Pinho et al. (2013).

Toutefois, l’absence de la protéine MreB chez la plupart des ovocoques remet en question

les mécanismes qui orchestrent la synthèse périphérique. Il est suggéré que FtsZ coordonne

11

et organise non seulement la synthèse du peptidoglycane septal, mais aussi la synthèse du

peptidoglycane périphérique (Typas, et al., 2012). Certains chercheurs suggèrent aussi que

chez les ovocoques, la protéine FtsZ agit comme un échafaudage topologique pour les PLPs

impliquées à la fois dans la synthèse du PG septal et du PG périphérique (Pinho, et al.,

2013). D’autres travaux ont montré que la protéine StkP, du type sérine-thréonine kinase, a

un rôle clé dans la coordination et le contrôle de la synthèse du PG septale et périphérique

de la paroi cellulaire et cette protéine pourrait fonctionnellement remplacer la protéine

MreB (Beilharz, et al., 2012). L'analyse génomique de l’organisation des gènes du dcw

chez S. pneumoniae a permis l'identification d'une région en aval des gènes FtsA et FtsZ,

regroupant des gènes encore non caractérisés et des gènes codant pour des homologues de

YlmG, YlmF/SepF et DivIVA qui sont généralement impliqués dans la ségrégation des

chromosomes, la morphologie cellulaire et/ou la division cellulaire chez diverses espèces

(Fadda, et al., 2007, Massidda, et al., 2013).

La séparation des cellules filles lors de la division de cellules bactériennes nécessite le

clivage du PG septal. Chez les bactéries, plusieurs hydrolases du PG sont impliquées dans

ce processus (Typas, et al., 2012). Les hydrolases ne sont pas essentielles pour la survie de

la bactérie, mais importantes pour maintenir la morphologie de la cellule (Sun, et al., 2000).

Chez S. pneumoniae, de nombreuses hydrolases ont été mises en évidence, mais le

mécanisme moléculaire sous-jacent de ce processus fondamental reste encore mal compris

(Bartual, et al., 2014). Chez le pneumocoque, les hydrolases LytA, LytB, LytC, PcsB et

CbpD sont responsables du clivage du PG septal pour séparer les cellules (Bartual, et al.,

2014). PcsB semble responsable de l’hydrolyse de la partie peptidique du peptidoglycane.

D’ailleurs PcsB est essentiel pour la viabilité de S. pneumoniae et est considéré comme un

des principaux candidats pour une nouvelle génération de vaccins contre le pneumocoque

(Bartual, et al., 2014). Pmp23 catalyse l’hydrolyse des chaines glycanes et pourrait initier la

synthèse septale en permettant le recrutement des PLPs (Barendt, et al., 2011). Les deux

protéines Pmp23 et DacA semblent affecter la division cellulaire du pneumocoque et la

forme des cellules (Barendt, et al., 2011).

12

Au cours des dernières années, des progrès considérables ont été réalisés, mais on est

encore loin de la compréhension globale du mécanisme de synthèse du peptidoglycane et

de son contrôle malgré que les coques soient la forme bactérienne la plus simple. De plus,

le rôle exact de la plupart des acteurs fonctionnels impliqués dans ce processus reste encore

mal compris. Aussi, il n’est pas clair comment ils sont connectés entre eux pour avoir une

telle concordance spatiale et temporale. Une meilleure compréhension de la croissance et

de la division permettra sans doute d’avoir de nouvelles cibles thérapeutiques pour le

développement de nouveaux antimicrobiens.

Physiopathologie des infections à S. pneumoniae

Données épidémiologiques

S. pneumoniae colonise de façon asymptomatique les muqueuses des voies respiratoires

supérieures de l’homme principalement au niveau du nasopharynx (Chao, et al., 2014).

Ainsi, cette bactérie est reconnue comme étant à la fois commensale et pathogène

opportuniste exclusivement chez l’humain. Jusqu’à nos jours, l’infection par S. pneumoniae

représente encore un problème de santé publique majeur dans les pays développés et en

voie de développement. Les infections par S. pneumoniae sont toujours l’une des

principales causes de morbidité et de mortalité dans le monde, chez les enfants et les

adultes avec une prédominance aux âges extrêmes. Le pneumocoque fait partie de la flore

normale des voies nasales ou du pharynx de plus d'un tiers de la population et se transmet

de personne à personne via les aérosols ou par le contact direct (Bedos, et al., 1999). Chez

les enfants, S. pneumoniae colonise le nasopharynx au cours des premières années de la vie

(Syrjänen, et al., 2001). En effet, le taux de colonisation augmente de la naissance jusqu’à

ce qu’il culmine vers l’âge de deux à trois ans et puis il baisse avec l’âge (Donkor, 2013).

Cependant, le taux de colonisation de S. pneumoniae est très élevé chez les enfants en

comparaison avec les adultes, entre 20 à 50 % chez les enfants avec un maximum de

colonisation vers l’âge de deux à trois ans et de 5 à 20% chez les adultes (Chao, et al.,

2014). Le taux est encore plus élevé dans les pays en développement où presque 90% des

13

enfants et plus de la moitié des adules sont porteurs de la bactérie, et il est favorisé par le

froid avec un niveau élevé durant la période de janvier à mars (Donkor, 2013, Chao, et al.,

2014) (Figure 1.4).

Le pneumocoque est responsable de nombreuses infections telles que la pneumonie, la

méningite, l’otite moyenne et la sinusite. Chaque année, environ un million de nouveaux

cas d’infection par S. pneumoniae sont enregistrés partout dans le monde (Donkor, 2013).

Chez les enfants, l’infection par le pneumocoque est considérée comme la deuxième cause

de méningite bactérienne et d’otite moyenne après l’infection par Haemophilus influenzae

(AlonsoDeVelasco, et al., 1995). Selon les données de l’Organisation mondiale de la Santé

pour l’année 2015, la pneumonie est la cause du décès de 15% d’enfants de moins de 5 ans

représentant ainsi 922 000 décès; dont environ 476 000 décès causés par la pneumonie due

à S. pneumoniae (http://www.who.int/en). Chez les adultes, les données épidémiologiques

ont montré que l’infection par S. pneumoniae est la deuxième cause de méningite

bactérienne derrière Neisseria meningitidis et aussi la cause principale de la pneumonie

communautaire acquise (CAP) avec 2 858 000 cas de pneumonie graves en 2011

(AlonsoDeVelasco, et al., 1995, Walker, et al., 2013).

Au Canada, le taux d’incidence générale des infections invasives à pneumocoque est plus

élevé en hiver mais aussi au printemps, ce taux est d’environ 9,7 cas pour 100 000 habitants

durant la période de 2008 à 2012, affectant principalement les jeunes enfants âgés de moins

de cinq ans et les personnes âgées de 65 ans et plus (Agence de la santé publique du

Canada, 2012). En 2014, ce taux a diminué à 8,9 cas par 100 000 habitants avec 16,9 cas

pour 100 000 chez les nourrissons d’un an et moins, 11,0 cas pour 100 000 chez les enfants

de 1 à 4 ans et 21,5 cas pour 100 000 chez les personnes âgées de 60 ans et plus (Agence de

la santé publique du Canada, 2014).

Les enfants et les personnes âgées sont principalement affectés par des infections

pneumococciques sévères, mais d’autres personnes sont aussi des cibles vulnérables. En

outre, plusieurs facteurs influencent significativement le risque de contracter des infections

à S. pneumoniae; comme l’alcoolisme, l’exposition à la fumée de cigarette, la

drépanocytose, le diabète, l’infection par le virus de l’immunodéficience humaine, une

maladie rénale ou cardiaque, une maladie hépatique y compris la cirrhose du foie, une

14

maladie pulmonaire (l’asthme, l’emphysème et la bronchite chronique) et aussi en cas d’un

cancer ou une immunosuppression due à la maladie ou l'usage de médicaments comme les

cortistéroïdes (Talbot, et al., 2005).

En raison du rôle clé de la colonisation du nasopharynx dans les maladies à pneumocoques

et la propagation du pneumocoque au site d’infection, il est important de comprendre les

différents éléments de cette colonisation et d’élucider les facteurs qui favorisent le passage

d’un agent commensal à un agent pathogène capable d’induire des maladies sévères.

Mécanismes de la colonisation de l’hôte

La composition de la microflore du nasopharynx peut soutenir ou entraver la colonisation et

l'invasion par symbiose ou par compétition de plusieurs espèces. On estime qu’environ 700

espèces diverses qui partagent cette niche écologique; comme Haemophilus influenzae,

Moraxella catarrhalis, Staphylococcus aureus, Neisseria meningitidis et plusieurs espèces du

genre Streptococcus, tel que S. mutans, S. gordonii, S. pyogenes, S. salivarius, S. pneumoniae,

S. oralis et S. mitis (Donkor, 2013, Adegbola, et al., 2014). S. pneumoniae colonise les surfaces

muqueuses du rhinopharynx et des voies respiratoires supérieures de l’homme et est un

constituant normal de cette niche écologique dont la colonisation est asymptomatique. Cette

spécificité d’hôte strict n’est pas encore claire, mais de nombreux facteurs bactériens et

interactions hôte-pathogène assurent cette colonisation et jouent un rôle dans le développement

des pathologies invasives et non invasives. Le mécanisme sous-jacent d’adhésion aux cellules

de l'épithélium du nasopharynx ou d'autres cellules eucaryotes implique des interactions de type

bactérie-bactérie et bactérie-hôte.

L'adhésion aux cellules épithéliales peut-être facilitée par des pili, qui sont attachés à la paroi

de la cellule bactérienne et ils sont généralement codés par un ensemble de gènes groupés en

îlots de pathogénicité (Zahner, et al., 2011). La découverte des ilots de pathogénicité dans le

génome de S. pneumoniae (Brown, et al., 2001) a permis par la suite la découverte de gènes

indispensables pour la synthèse des pili. Ces gènes sont contenus dans deux types d’ilots de pili

différents, ilot PI-1 et ilot PI-2 (Barocchi, et al., 2006, Bagnoli, et al., 2008). PI-1 comprend

sept gènes dont trois gènes (SrtC-1, SrtC-2 et SrtC-3) codent pour des sortases, plus trois gènes

15

qui codent pour des protéines structurales (RrgA, RrgB et RrgC) et un régulateur positif rlrA

(Barocchi, et al., 2006). PI-2 code pour un deuxième pilus fonctionnel composé de deux gènes

codant pour des protéines structurales pitA, pitB et les deux gènes srtG1 et srtG2 codant pour

des sortases (Bagnoli, et al., 2008). L’analyse globale d’une collection d’isolats de S.

pneumoniae a montré que PI-1 est présent dans 30% des souches notamment chez S.

pneumoniae TIGR4, souche encapsulée et pathogène, et dans 50% des souches résistantes aux

antibiotiques, alors que PI-2 est présent dans environ 16% des souches mais il est absent chez la

souche S. pneumoniae TIGR4 (Bagnoli, et al., 2008). La présence de pili améliore la capacité

des pneumocoques à adhérer aux cellules épithéliales et elle pourrait induire une exacerbation

de la virulence comme rapportée dans le cas de pili de type PI-1 (Barocchi, et al., 2006).

S. pneumoniae produit plusieurs protéines de surface ayant probablement un rôle important

dans la colonisation, la dissémination et l’invasion de l’hôte. En revanche, on sait peu de choses

sur les adhésines bactériennes qui peuvent se comporter comme des facteurs stimulant la

colonisation et/ou la virulence (Figure 1.4). Le pneumocoque adhère à des cellules différentes

chez l’hôte selon le stade d’infection, et ce par divers mécanismes d’adhésion qui restent encore

mal compris. Cependant, l’adhésion au nasopharynx est l’un des mécanismes les mieux

élucidés. L’attachement du pneumocoque aux cellules épithéliales est médié par des récepteurs

disaccharidiques retrouvés sur la fibronectine, qui est la matrice extracellulaire présente sur les

cellules épithéliales pharyngées (Berry, et al., 1999). La colonisation asymptomatique nécessite

l’adhésion du pneumocoque à la muqueuse épithéliale des voies respiratoires par des protéines

de surface bactérienne comme les adhésines PsaA et CbpA ou par des enzymes de clivages

comme les neuraminidases (Bogaert, et al., 2004). L’adhésine de surface PsaA est une

lipoprotéine qui assure l’adhérence du pneumocoque aux cellules du nasopharynx par le biais

d’une interaction avec la E-cadhérine et intervient aussi dans le transport du manganèse et du

zinc (Hammerschmidt, 2006). Une fonction directe dans l’adhésion du pneumocoque est

attribuée à l’adhésine majeure multifonctionnelle CbpA (aussi appelée PspC) dont le récepteur

est un polymère d’immunoglobuline (plgR) et les acides sialiques, ce qui accroît la migration

de la bactérie à travers la barrière muqueuse (Hammerschmidt, 2006).

L’acide sialique est un des hydrates de carbone importants pour le pneumocoque en raison de

son rôle comme source de carbone et d'énergie (Gualdi, et al., 2012). Chez l’homme, cet acide

sialique est l’acide N-acétylneuraminique utilisé par le pneumocoque comme récepteur pour

l’adhésion nasopharyngée (Gualdi, et al., 2012). L’exposition de ces récepteurs nécessite

16

l’intervention des neuraminidases du pneumocoque pour cliver l’acide sialique. Cette bactérie a

deux neuraminidases communes à tous les pneumocoques, NanA et NanB, permettant de

révéler les récepteurs de surface pour l’adhésion (Fillon, et al., 2006). Ces deux enzymes

possèdent des propriétés physicochimiques différentes permettant au pneumocoque de persister

à des pH différents (Berry, et al., 1996). Ces enzymes participent aussi lors de l’invasion de

l’hôte en raison de la présence de l’acide sialique à plusieurs endroits dont les muqueuses et

fluides du corps comme les poumons et surtout le cerveau qui présente la plus grande

concentration d’acide sialique dans le corps humain (Uchiyama, et al., 2009). L’acide sialique

se caractérise aussi par sa capacité d’agir comme un signal moléculaire dans le cas d’infection

invasive à S. pneumoniae, entrainant une augmentation de transport et la translocation du

pneumocoque dans les poumons (Gualdi, et al., 2012).

Éventuellement, des facteurs de l'hôte sont aussi des éléments clés qui interviennent dans

l'interaction des bactéries avec les cellules humaines en facilitant et en augmentant l'adhésion

aux cellules (Mushtaq, et al., 2011). Ainsi, il a été démontré que le récepteur du facteur

d'activation plaquettaire (PAF) est un ligand permettant l'adhésion des pneumocoques aux

cellules endothéliales vasculaires et épithéliales pulmonaires humaines (Iovino, et al., 2013).

PAF est aussi un puissant médiateur pro-inflammatoire ayant un rôle important en immunité

innée (Iovino, et al., 2013). Un récepteur PAF reconnait des motifs moléculaires associés à des

pathogènes et procure un système de reconnaissance inné à la phosphocholine exprimée à

surface du pneumocoque et des pathogènes respiratoires bactériens à Gram-positif (Fillon, et

al., 2006, Iovino, et al., 2013).

17

Figure 1.4 Interaction entre S. pneumoniae et les cellules épithéliales.

Figure tirée et adaptée de Bogaert et al. 2004.

Malgré que la paroi bactérienne est pro-inflammatoire dans certaines circonstances, la

liaison du récepteur PAF à la paroi bactérienne est silencieuse et n’induit pas de réponse

des cellules endothéliales et des neurones (Fillon, et al., 2006).

L’attachement de la bactérie aux cellules épithéliales de l’hôte nécessite un rapprochement

et un contact physique dont les mécanismes sont encore peu connus. L’adhésion du

pneumocoque aux cellules épithéliales pulmonaires est augmentée en présence de

l’immunoglobuline A1 (IgA1) (Bogaert, et al., 2004). Le pneumocoque synthétise une

protéase IgA1 qui clive les IgA1 sécrétoires ce qui se traduit par une variation de la charge

de la surface de la bactérie et un grand rapprochement physique de la protéine de liaison à

la choline (CbpA) du pneumocoque et le récepteur PAF (Weiser, et al., 2003, Bogaert, et

al., 2004). De même, le clivage des IgA1 permet à la bactérie de persister et d’échapper à

l'opsonisation par le complément et la phagocytose par les leucocytes.

Les interactions virus-bactérie ont un impact important sur l’évolution des infections. En

effet, les co-infections des voies respiratoires par les virus respiratoires permettent de

promouvoir l’adhérence, la croissance et la virulence des bactéries par divers mécanismes

18

(Brealey, et al., 2015). Par exemple, l’infection par le virus de la grippe augmente la

surface d’adhésion du pneumocoque aux cellules épithéliales en exposant plus de

récepteurs pour le pneumocoque, grâce à l’action de la neuraminidase virale (Plotkowski, et

al., 1986). De même, le virus respiratoire syncitial agit comme médiateur qui facilite

l’adhésion entre le pneumocoque et les cellules épithéliales par un pont liant la

glycoprotéine G du virus et la protéine PLP1a de S. pneumoniae (Smith, et al., 2014).

Processus d’infection et infections associées

La propagation du pneumocoque à partir du nasopharynx peut conduire à des infections

locales telles que la sinusite ou l'otite moyenne. L'aspiration du pneumocoque peut

entraîner une propagation directe dans les poumons, entraînant la pneumonie. La forme la

plus commune des pneumonies bactériennes est celle de la pneumonie à S. pneumoniae qui

représente la cause majeure de la pneumonie acquise en communauté (PAC). Il existe deux

types de pneumonie; bronchique et lobaire selon la zone du poumon atteinte (Donkor,

2013). Au début de l’infection, S. pneumoniae se loge au niveau des alvéoles pulmonaires

et sa multiplication à ce site induit une réaction inflammatoire qui se traduit par un

remplissage de pus et mucus empêchant le fonctionnement normal des alvéoles, soit la

distribution efficace de l’oxygène dans le sang (Kadioglu, et al., 2008, Donkor, 2013).

L’emphysème pleural est une complication qui survient chez 5% des cas atteints de PAC

(Fernandez-Cotarelo, et al., 2007). Le pneumocoque peut également se propager via le sang

pour atteindre le cerveau, provoquant la méningite à pneumocoques qui est responsable

d’un taux de mortalité très élevé d’environ 20% à 50% (Bogaert, et al., 2004). La méningite

est généralement causée par des bactéries qui passent de la circulation sanguine au cerveau

et ce à travers la barrière hémato-encéphalique (Mook-Kanamori, et al., 2011). La

translocation du pneumocoque à travers cette barrière est facilitée par l’enzyme NanA qui

favorise l’invasion des cellules endothéliales du cerveau. La pneumolysine et la protéine

CbpA sont aussi importantes pour le développement de la méningite (Iovino, et al., 2016).

La péritonite, l'arthrite et l'ostéomyélite sont des manifestations rares de la maladie à

pneumocoque (Donkor, 2013). Chez les personnes âgées, la PAC est souvent accompagnée

d’un risque de myocardite qui est une inflammation du cœur (Brown, et al., 2014). Dans ce

19

cas, le pneumocoque atteint le myocarde et forme des microlésions qui perturbent la

fonction cardiaque induisant ainsi une insuffisance et une arythmie cardiaque (Brown, et

al., 2014).

Facteurs de virulence

La connaissance des facteurs de virulence et de leur mode d’action représente une voie

prometteuse dans la compréhension, la prévention et l’élaboration de traitements efficaces

des infections à S. pneumoniae. Pendant plusieurs années, le pouvoir pathogène du

pneumocoque a été attribué en grande partie à la capsule polysaccharidique qui s'oppose à

la phagocytose et à un petit nombre de facteurs de virulence. Avec l’avancement des

recherches et le séquençage du génome de S. pneumoniae R6 et TIGR4 en 2001, de

nombreux autres facteurs de virulence ont été mis en évidence et la liste est probablement

loin d’être terminée (Hoskins, et al., 2001, Tettelin, et al., 2001). En outre, environ 387

gènes sont impliqués dans la virulence du pneumocoque et exprimés de façon coordonnée

pour contribuer à la colonisation, l’échappement à la phagocytose, l'invasion et la

destruction des tissus de l’hôte (Hava & Camilli, 2002). Les facteurs de virulence du

pneumocoque peuvent être classés en trois groupes: capsule, toxines, et protéines de surface

(Figure 1.5). Dans cette section, seulement les principaux facteurs de chaque groupe seront

détaillés.

20

Figure 1.5 Principaux facteurs de virulence de S. pneumoniae.

Figure tirée et adaptée de van der Poll et al. 2009.

Capsule polysaccharidique

La capsule de nature polysaccharidique est probablement le facteur de virulence le plus

important du pneumocoque. Elle forme une couche protectrice antiphagocytaire qui entoure

et couvre diverses protéines de surface de S. pneumoniae. La capsule favorise

l’échappement de la bactérie au système immunitaire et son expression réduit le piégeage

par le mucus favorisant ainsi l’accès aux surfaces des cellules épithéliales (Kadioglu, et al.,

2008). Cependant, la capsule induit une réaction immunogène qui reste gravée dans la

mémoire de l’hôte et le protège contre toute attaque future par un pneumocoque portant le

même antigène polysaccharidique capsulaire. Pour pallier cette reconnaissance immune, le

locus codant pour la capsule du S. pneumoniae a subi plusieurs variations et ce en intégrant

21

un grand nombre de gènes codant pour diverses capsules par l’acquisition d'ADN étranger

(Wen, et al., 2016). Actuellement, environ 97 sérotypes capsulaires contribuent à

l’importance des infections par S. pneumoniae (Geno, et al., 2015). Cependant, seulement

20 à 30 sérotypes capsulaires du pneumocoque présentent un risque accru de maladies

invasives (Geno, et al., 2015).

Une fois que le pneumocoque a atteint la surface de la cellule épithéliale, l'expression d'une

capsule épaisse semble être désavantageuse pour la bactérie, en raison de son effet

inhibiteur sur l'adhérence (Kadioglu, et al., 2008). En effet, le pneumocoque présente deux

aspects de colonies : rugeuses (transparentes non-encapsulées ou faiblement encapsulées) et

colonies lisses (opaques et encapsulées) qui sont en relation avec une variation de phase

réversible entre les deux phénotypes sans changement de sérotype (Geno, et al., 2015). La

variation de phase est une étape importante dans la virulence et aussi un processus adaptatif

qui conduit à la propagation et la distribution des bactéries dans l’organisme de l’hôte, dont

le mécanique est encore mal compris (Donkor, 2013). Ce mécanisme augmente jusqu'à six

fois l'invasion du pneumocoque dans les cellules endothéliales du cerveau humain (Ring, et

al., 1998). Les variations de phase induisent des altérations dans les structures et les

composantes associés à la surface (Mitchell & Mitchell, 2010, Donkor, 2013). La présence

de la capsule limite également l'autolyse et réduit l'exposition à plusieurs antibiotiques.

Les pneumocoques peuvent aussi altérer leur sérotype par des recombinaisons affectant la

synthèse de la capsule polysaccharidique. Les sérotypes du pneumocoque sont regroupés en

48 sérogroupes en fonction de l'hétérogénéité des structures et de la composition chimique

des polysaccharides ainsi que sur la base des propriétés antigéniques de polysaccharides

capsulaires (Croucher, et al., 2015). Cette variation antigénique permet au pneumocoque de

basculer d’un sérotype à un autre au sein du même sérogroupe et échappe au système

immunitaire de l’hôte (Croucher, et al., 2015). Le pneumocoque peut alors causer des

infections ou induire à nouveau les mêmes maladies puisqu’il sera considéré par l’immunité

comme un nouvel agent pathogène. De même, la bactérie sera en mesure d’échapper à

l’immunité induite par la vaccination dirigée vers un sérotype différent.

22

Pneumolysine

La pneumolysine est un facteur de virulence puissant produit par tous les sérotypes de

pneumocoque. C’est une hémolysine de la famille des thiol-activables qui utilise le

cholestérol présent dans les membranes cellulaires comme un récepteur pour son activité

cytolytique (Barocchi, et al., 2007). La pneumolysine représente la protéine principale de la

virulence de S. pneumoniae dont la libération entraîne une réaction inflammatoire intense

via l’induction des lésions tissulaires et provoque des pathologies plus graves (Marriott, et

al., 2008). Cette cytotoxine est libérée sous l’action de l’autolysine majeure. La

pneumolysine est produite sous la forme d'une protéine soluble de 52 kDa, la liaison au

cholestérol, des cellules de l’hôte, est suivie de la formation de pores membranaires par

oligomérisation (Kadioglu, et al., 2008). Deux modèles sont proposés pour le

développement des pores sous l’action de la pneumolysine. Dans le premier modèle, il est

suggéré que les unités se réunissent dans la membrane de la cellule hôte pour former des

complexes oligomériques et des pores matures. Dans le deuxième modèle, il est proposé

que les sous-unités subissent un pré-assemblage après la liaison à la membrane de la cellule

hôte, et forment un complexe pré-pore avant l'insertion dans la membrane (Marriott, et al.,

2008). La formation des pores provoque la lyse des cellules ciblées. Au niveau des voies

respiratoires, cette toxine favorise l’accès au poumon par la lyse des cellules hôtes,

l’inhibition du rythme mucociliaire des cellules respiratoires, et la séparation des jonctions

serrées des cellules épithéliales (Henriques-Normark & Tuomanen, 2013). La

pneumolysine active la voie classique du complément et peut induire une réponse

inflammatoire ou des phénomènes d’apoptose chez les cellules hôtes (Henriques-Normark

& Tuomanen, 2013). De plus, la libération de la pneumolysine au niveau du sang favorise

l’accès au système nerveux central, en dégradant les tissus conjonctifs, et le passage de la

barrière hémato-encéphalique provoquant ainsi la méningite pneumococcique et des

dommages cérébraux importants (Mitchell & Mitchell, 2010).

Protéines de surface

Le pneumocoque possède une panoplie de protéines de surface dont beaucoup jouent un

rôle dans la pathogénicité et la virulence. Ces protéines peuvent être divisées en trois

groupes: les lipoprotéines, les protéines à motif LPxTG et les protéines liant la choline.

23

Toutes ces protéines peuvent être exportées à travers la membrane plasmique grâce à un

peptide signal (Mitchell, 2003). Toutefois, peu est connu sur le mode de production (le

terme expression est réservé aux gènes) de ses protéines, le tropisme tissulaire, l'invasion

et l’évolution de la maladie.

1- Lipoprotéines

La famille des lipoprotéines pneumocociques regroupe entre 42 à 47 lipoprotéines qui font

partie des transporteurs de type ABC impliquées dans le transport des métaux (Kadioglu, et

al., 2008). La protéine PsaA est une importante lipoprotéine présente chez tous les

pneumocoques. Outre son rôle dans l’adhésion et la colonisation, comme mentionné

précédemment, elle joue un rôle clé dans la virulence et le transport du manganèse

(Bogaert, et al., 2004). Cette protéine présente un site potentiel de liaison divalent aux ions

métalliques comme des ions zinc ou manganèse (Kadioglu, et al., 2008). L’importance de

cette protéine dans la persistance du pneumocoque est en relation directe avec le

manganèse qui joue le rôle de cofacteur pour plusieurs protéines de la virulence et dans la

croissance bactérienne (Dintilhac, et al., 1997). De plus, le manganèse est impliqué dans la

résistance au stress oxydatif qui peut résulter de la production de peroxyde d'hydrogène, au

cours du métabolisme pneumococcique, ainsi que la production d'espèces réactives

d'oxygène, lors de la réponse immunitaire innée de l'hôte (Kadioglu, et al., 2008). Plusieurs

travaux ont élucidé le rôle de PsaA dans l’adhésion mais sans confirmer s’il s’agit d’une

action directe ou indirecte en modulant l’expression d'autres adhésines via la concentration

de manganèse (Mitchell, 2003).

2- Protéines à motif LPxTG

Les protéines à motif LPxTG sont ancrées au peptidoglycane par une transpeptidase qui

reconnaît la séquence d'acides aminés LPxTG. Comme plusieurs bactéries à Gram-positif,

le pneumocoque utilise une sortase pour ce processus d'ancrage. Les sortases assurent

l’assemblage et la fixation des pili au peptidoglycane, cependant c’est la sortase A qui

catalyse l’ancrage des protéines à motif LPXTG et n’assure aucun rôle dans la synthèse des

pili (Kadioglu, et al., 2008). Cette sortase influence la colonisation et la virulence du

pneumocoque grâce son importance pour plusieurs protéines de surface (Paterson &

Mitchell, 2006).

24

L’analyse du génome de S. pneumoniae a montré la présence de 19 et 13 gènes codant pour

des protéines à motif LPXTG chez les souches TIGR4 et R6, respectivement (Hoskins, et

al., 2001, Tettelin, et al., 2001). Les principales protéines de ce groupe sont les enzymes

neuraminidase et hyaluronidase. Le rôle des neuraminidases NanA et NanB dans la

colonisation et l’invasion de l’hôte est déjà mentionné dans cette revue de la littérature. La

hyaluronidase est présente dans la majorité des isolats cliniques de S. pneumoniae et son

rôle est l’hydrolyse de l’acide hyaluronique, un composant important des tissus conjonctifs

et de la matrice extracellulaire des mammifères (Duran-Reynals, 1933). Cette action permet

la migration du pneumocoque du site de la colonisation vers le système sanguin et facilite

ainsi la dissémination et l’invasion de l’hôte. (Mitchell, 2003). Le génome du pneumocoque

code aussi pour quatre métalloprotéases à motif LPXTG, protéases IgA1, ZmpB, ZmpC et

ZmpD qui contribuent à la virulence de cette bactérie (Bergmann & Hammerschmidt,

2006).

3- Protéines liant la choline

La famille des protéines liant la choline (CBPs) reconnaît la phosphorylcholine des acides

lipoteichoiques et téichoiques. La phosphorylcholine ancre les CBPs à la paroi cellulaire

(Bergmann & Hammerschmidt, 2006). La famille des CBPs comprend 13 à 16 protéines

favorisant la virulence du pneumocoque (Bergmann & Hammerschmidt, 2006). Les CBPs

incluent quatre hydrolases connues pour leur rôle dans la lyse cellulaire et la virulence:

l'autolysine majeure LytA, LytB, lysozyme LytC et une phosphorylcholine estérase

(Bergmann & Hammerschmidt, 2006). L’activation de LytA est induite par certaines

conditions comme le stress et le traitement à la pénicilline (Mitchell, 2000). La contribution

de LytA à la virulence est liée à l’hydrolyse du peptidoglycane qui peut provoquer une

inflammation et aussi à la lyse cellulaire qui libère plusieurs toxines comme la

pneumolysine. La protéine de surface PspA, présente à la surface de tous les

pneumocoques, est nécessaire pour le développement de la virulence (Mitchell, 2000).

PspA interfère avec la fixation du facteur de complément C3 à la surface bactérienne et

inhibe ainsi l'activation du complément par S. pneumoniae (Bogaert, et al., 2004, Kadioglu,

et al., 2008). De plus, PspA est une protéine de liaison à la lactoferrine. Cette activité

protège la bactérie de l'activité bactéricide de l'apolactoferrine, une forme de

25

la lactoferrine pauvre en fer (Bergmann & Hammerschmidt, 2006). L'apolactoferrine

bloque l’activité de plusieurs enzymes bactériennes dépendantes en fer et provoque

généralement un effet bactériostatique ou bactéricide (Kadioglu, et al., 2008). La liaison du

PspA à l’apolactoferrine bloque son activité et assure la survie du pneumocoque.

Traitements antipneumococciques

Comme on vient de le voir, le développement des maladies locales et invasives est sous le

contrôle de plusieurs facteurs. Cette bactérie représente l'exemple d'un pathogène bactérien

hautement invasif provoquant plus de décès que n’importe quel autre microorganisme

évitable par la vaccination.

Traitements préventifs

Les premiers efforts pour développer des vaccins pneumococciques efficaces remontent au

début du vingtième siècle. Les efforts visant à lutter contre l'infection par S. pneumoniae

ont conduit au développement de deux types de vaccins contre le pneumocoque.

Vaccin polysaccharidique

La reconnaissance de l'antigénicité des polysaccharides capsulaires a conduit au

développement de vaccins antipneumococcique à base de polysaccharides capsulaires

(Barocchi, et al., 2007). Le premier vaccin polysaccharidique était conçu pour immuniser

contre six sérotypes capsulaires et était autorisé pour l’usage général après des essais sur

des militaires durant la seconde guerre mondiale (Barocchi, et al., 2007). Un deuxième

vaccin à base de quatorze sérotypes capsulaires a été développé en 1977 (Robbins &

Schneerson, 1983). Ce vaccin a été rapidement remplacé en 1983 par le vaccin actuel

(PPV23) couvrant plus de sérotypes capsulaires (1,2, 3, 4, 5, 6B, 7F, 8, 9N, 9V, 10A, 11A,

12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F, 33F) responsable d’environ 90% des

infections causées par S. pneumoniae aux États-Unis (Robbins & Schneerson, 1983). Ce

vaccin couvre 23 sérotypes capsulaires les plus fréquemment associés aux souches

26

responsables des infections pneumocociques invasives. PPV23 est destiné aux personnes

âgées et aux personnes à haut risque d’infection pneumococcique. Il n’est pas recommandé

pour les enfants de moins de 2 ans, car leur système immunitaire répond mal à la

stimulation par des polysaccharides dû au niveau insuffisant de l’immaturité de leurs

lymphocytes B, ce qui empêche le déclenchement d’une réponse immunitaire.

Vaccins conjugués

Les vaccins conjugués ont été développés comme une solution alternative pour stimuler le

système immunitaire des jeunes enfants. Le principe est basé sur l’association de façon

covalente des polysaccharides capsulaires à une protéine porteuse. Cela permet de rendre le

polysaccharide immunogène en le présentant au système immunitaire comme un antigène

thymodépendant qui est normalement thymo-indépendant (AlonsoDeVelasco, et al., 1995).

Ce vaccin permet de stimuler les lymphocytes T matures dès la première année de la vie.

Dans le cas des vaccins antipneumocociques conjugués, trois vaccins ont été développés.

Deux vaccins conjugués hepta-valent (4, 6B, 9V, 14, 18C, 19F et 23F) et 13-valent (1, 3, 4,

5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F) utilisent comme protéine porteuse une toxine

diphtérique modifiée (CRM197) liée aux sérotypes capsulaires. Pour le vaccin déca-valent,

il couvre dix sérotypes (1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, 23F) qui sont conjugués à une

protéine d’Haemophilus influenzae (Barocchi, et al., 2007, van der Poll & Opal, 2009). Les

sérotypes incluent dans ces vaccins ont été choisis pour couvrir les principaux sérotypes

causant les maladies invasives aux États-Unis, un choix qui signifie qu'ils ne sont pas bien

adaptés à d'autres zones géographiques avec une distribution différente de sérotypes. Une

autre limitation est en relation avec le nombre restreint de sérotypes capsulaires que peut

contenir un vaccin conjugué, par rapport au vaccin polysaccharidique, qui est liée à

l’immunogénicité de la protéine porteuse.

La diversité des sérotypes capsulaires du pneumocoque représente un sérieux obstacle dans

la conception d'un vaccin universel. Les vaccins actuels sont basés sur un nombre limité de

polysaccharides capsulaires alors que la bactérie présente un grand nombre de sérotypes

capsulaires qui atteint 97 sérotypes. De plus, les sérotypes responsables des infections

invasives se sont avérés différents d'une région géographique à l'autre et la distribution

dépend également de la période étudiée. De même, la variation antigénique donne au

27

pneumocoque la possibilité de basculer d’un sérotype à un autre ce qui permet d’échapper à

la vaccination.

Vaccins protéiques

L’émergence rapide de sérotypes non-vaccinaux a encouragé le développement d’un vaccin

indépendant du sérotype capsulaire. Au cours de la dernière décennie, l'intérêt a été déplacé

vers les facteurs de virulence. Les protéines de surface sont des cibles potentielles pour

assurer un effet protecteur contre une infection pneumococcique. Pour concevoir un vaccin

efficace, ces protéines doivent être conservées chez la majorité des souches cliniques de S.

pneumoniae. Bien que de nombreuses protéines du pneumocoque ont été proposées comme

des vaccins potentiels, PspA, PsaA et la pneumolysine sont actuellement les

plus prometteurs (AlonsoDeVelasco, et al., 1995, Barocchi, et al., 2007). L’application de

vaccin à base de protéines de surface pourra conférer une meilleure protection puisque

plusieurs protéines de surfaces sont impliquées dans la colonisation et l’infection par S.

pneumoniae et cela pourrait limiter l’émergence de nouvelles souches et assurer une

protection à long terme.

Traitement et résistance aux antibiotiques

En dépit de la disponibilité des antibiotiques, les infections à S. pneumoniae demeurent un

problème de santé publique critique avec un impact significatif sur la morbidité et la

mortalité. Cette situation est liée à un niveau inhabituellement élevé de résistance aux

antibiotiques communs, chez les souches cliniques de S. pneumoniae, en particulier la

résistance aux bêta-lactamines. Cette augmentation de souches résistantes est corrélée avec

l’utilisation intensive de ces antibiotiques considérés pendant plusieurs décennies comme

les plus efficaces de tous les antibiotiques contre les streptocoques oraux.

En 1941, l’introduction de la pénicilline pour le traitement des maladies infectieuses a été

une étape importante dans le traitement des infections mortelles avec espoir d’éradiquer

toutes les infections bactériennes. Les infections causées par S. pneumoniae ont été traitées

28

principalement par des bêta-lactamines surtout la pénicilline G. Cependant en 1970, une

résistance intermédiaire des souches de S. pneumoniae à la pénicilline a été constatée

(Ohsaki, et al., 2008). En 1980, un niveau élevé de résistance a été constaté dans plusieurs

régions du monde. La résistance à la pénicilline n’était pas unique, le pneumocoque a

acquis la résistance à plusieurs bêta-lactamines et même pour plusieurs familles

d’antibiotiques. Aujourd’hui, environ 40% des souches de S. pneumoniae présentent des

phénotypes multirésistants variables selon la distribution géographique (Reinert, 2009).

La résistance du pneumocoque aux bêta-lactamines est corrélée avec une diminution

d'affinité de ces antibiotiques pour les PLPs (Ohsaki, et al., 2008). Les bêta-lactamines

inhibent la synthèse du peptidoglycane en se liant avec les PLPs qui sont des

transpeptidases responsables de l’étape finale de la synthèse du peptidoglycane. Les gènes

codant pour les PLPs acquièrent des gènes exogènes avec des mutations génétiques ce qui

altèrent l’affinité des bêta-lactamines aux PLPs. Ces évènements de recombinaison entre les

gènes de PLPs des streptocoques et le pneumocoque produisant ainsi des gènes mosaïques

(Reinert, 2009). L’analyse du génome de S. pneumoniae a montré la présence de six PLPs

(PLP1a, PLP1b, PLP2x, PLP2a, PLP2b et PLP3) et que seulement trois gènes (PLP2b,

PLP2x et PLP1a) sont en relation avec la résistance aux bêta-lactamines (Ohsaki, et al.,

2008, Reinert, 2009).

Le pneumocoque possède aussi d’autres formes de résistance aux bêta-lactamines qui ont

été récemment détectées. Comme le cas de la protéine MurM qui est impliquée dans la

synthèse de branches peptidiques courtes dans la paroi cellulaire du pneumocoque (Fiser, et

al., 2003). Une autre protéine impliquée dans le transport du phosphate, la protéine PstS qui

semble être surexprimée seulement chez les souches résistantes aux bêta-lactamines et

l’inactivation du gène codant pour cette protéine augmente la susceptibilité des souches à la

pénicilline (Soualhine, et al., 2005).

Les macrolides inhibent la synthèse des protéines bactériennes en se liant à la grande sous-

unité ribosomale 50S et en perturbant l'élongation de la synthèse de la traduction par la

dissociation du peptidyl-ARNt (Schroeder & Stephens, 2016). La résistance de S.

pneumoniae aux macrolides est due à plusieurs mécanismes. La méthylation de la cible

ribosomale par les gènes ermA et ermB qui modifient l'ARNr 23S prévenant ainsi la liaison

29

aux antibiotiques chez les pneumocoques (Johnston, et al., 1998). Également, l’efflux actif

des antibiotiques par des pompes de types MFS est un mécanisme de résistance aux

macrolides et aux fluoroquinolones (Watson, et al., 1993, Reinert, 2009). Les gènes MefA

et MefE confèrent au pneumocoque la résistance aux macrolides (Watson, et al., 1993).

La résistance de cette bactérie aux antibiotiques ne cesse d’augmenter au fil du temps

limitant ainsi les moyens de contrôle des infections à S. pneumoniae.

30

Bactériophages

Rappel historique

Les bactériophages (virus des bactéries) constituent une variété particulière de virus dont

l’hôte exclusif est une bactérie. Ils sont programmés pour accomplir une unique mission qui

est d’infecter une bactérie spécifique et éventuellement la détruire. Les phages ont été

découverts de façon indépendante par l’anglais Frederick Twort et le franco-canadien Félix

d'Hérelle respectivement en 1915 et 1917 (Twort, 1915, D'Herelle, 2007). Même avant leur

découverte formelle, le phénomène semble avoir été observé par plusieurs scientifiques,

dont la première description d’activité antibactérienne aurait été faite par le chimiste

britannique Ernest Hanbury Hankin en 1896 (Abedon, et al., 2011). Hankin a constaté

l’action bactéricide des eaux troubles des rivières Gange et Jumna en Inde sur la bactérie du

choléra, grâce à une substance qui traverse le filtre de Chamberland sans déterminer sa

nature ni son origine. Au début, la nature de ces entités biologiques a été mal comprise.

Toutefois, les travaux de d’Hérelle ont permis de conclure que l’action lytique est le

résultat d’un virus spécifique de bactérie et non pas une enzyme ou produit chimique et que

l’action est spécifique à une espèce bactérienne (Parisien, et al., 2008). Le nom

bactériophage (mangeur de bactérie) a été proposé par d’Hérelle en référence à deux mots

grec, baktêria qui signifie « bâton » en référence à la première forme de bactérie en

bâtonnet et phagos qui désigne mangeur.

À cette époque, les épidémies bactériennes faisaient des ravages en Europe. En 1919, une

épizootie de fièvre typhoïde a touché les volailles en France. Pour d’Hérelle, c’était une

opportunité pour tester les phages et leur potentiel thérapeutique. Il a pu guérir la majorité

des poules mettant ainsi en évidence l’efficacité des phages dans le traitement des

infections chez les animaux (Dublanchet & Bourne, 2007). Au cours de la même année, il a

fait les premiers essais cliniques sur des patients atteints de dysenterie bacillaire et il a pu

assurer la convalescence de la totalité des patients en quelques heures, de quatre à vingt

heures selon le cas du patient (d'Herelle, 1931). C’était la naissance de la thérapie par phage

incitant ainsi plusieurs scientifiques à travers le monde à l’utiliser pour le traitement des

infections pathogènes (Peitzman, 1969). D’Hérelle a rapidement commencé la

31

commercialisation des préparations phagiques et à partir de 1923 plusieurs articles sont

apparus en relation avec les bactériophages, l’isolement et le traitement par phage

(d'Herelle, 1931). Malgré le grand succès de la thérapie phagique la paternité du principe de

la lyse a été toujours remise en question par les scientifiques, ainsi que la nature de la lyse

bactérienne par le prétendu bactériophage. L’ampleur de la polémique a duré pendant de

longues années et d’Hérelle a été toujours convaincu que la lyse est le résultat d’un

nouveau microorganisme, le bactériophage. Jules Bordet et Mihai Ciuca présumaient que la

lyse était le résultat d’une autolyse bactérienne résultant d’un fonctionnement anormal du

métabolisme bactérien transmissible par l’hérédité (Duckworth, 1976). Cependant, les

résultats de la croissance du phage en une seule étape suggéraient qu’il s’agissait d’un

microorganisme, dont la croissance est divisée en trois périodes (adsorption, croissance et

lyse bactérienne avec libération de nouveaux phages) (Ellis & Delbruck, 1939). Pour le

visualiser, il fallait attendre jusqu’à la mise au point des microscopes électroniques en 1940

pour voir le bactériophage pour la première fois et reconnaitre qu’il s’agit d’une entité

distincte et nouvelle (Luria & Anderson, 1942). Malgré toutes les évidences, le conseil

scientifique avait beaucoup de doute en relation avec le danger d’application de la thérapie.

phagique. En même temps, environ 10 ans après la découverte de la pénicilline, les

chercheurs ont enfin pu la purifier et l’avoir en forme stable soulignant ainsi le début de

l’antibiothérapie.

Au cours de la dernière décennie, le potentiel thérapeutique des phages a été réévalué. Cette

redécouverte permet de mieux comprendre l’efficacité de la phagothérapie, en utilisant un

seul phage ou un cocktail de phages dans le traitement des infections bactériennes. De

même, les enzymes lytiques produites par les phages ont montré leur efficacité pour

détruire la paroi bactérienne et lyser les bactéries ciblées. La phagothérapie et les

applications en médecine ou en biotechnologie et comme un moyen de biocontrôle ont été

largement abordées dans la revue (voir annexe).

32

Classification des bactériophages

Les phages sont ubiquitaires et représentent les entités biologiques les plus abondantes sur

terre. On estime une population d’environ 1031

à 1032

particules de phage existant sur la

planète à un moment donné et 1025

infections se produiraient chaque seconde pour de

maintenir ce nombre (Breitbart & Rohwer, 2005, Deresinski, 2009). Jusqu’en 2009, plus de

5 500 bactériophages ont été examinés par microscopie électronique (Ackermann, 2009).

La découverte de nombreux virus a favorisé le développement d’un système de

classification universelle. En 1966, le Comité international de nomenclature des virus

(ICNV) a été créé au Congrès international de microbiologie à Moscou. En 1973, ce comité

est devenu le comité international de taxonomie des virus (ICTV) (International Committee

on Taxonomy of Viruses) chargé de développer, de perfectionner et de maintenir une

taxonomie universelle des virus (Fenner, 1995). La classification traditionnelle, basée sur la

morphologie des virus, a subi un champ évolutif et s'est davantage déplacée vers la

génomique, grâce au séquençage de génome (ADN/ARN, sb/db) qui est devenu beaucoup

moins coûteux.

La morphologie des phages est caractérisée par une extrême diversité dans un petit groupe

de phages isométriques, filamenteux ou pléomorphes représentant environ 4% des

bactériophages isolés, alors qu'environ 96% des phages possèdent une queue et

appartiennent à un seul ordre, les Caudovirales (Klumpp, et al., 2010) (Figure 1.6). Cet

ordre est composé de trois familles Myoviridae, Podoviridae et Siphoviridae regroupant des

phages à ADN double brin et qui diffèrent par leur morphologie et la taille de leur génome

qui varie entre 15 000 et 500 000 paires de bases (Fokine & Rossmann, 2014).

33

Figure 1.6 Représentation schématique des différentes familles de virus des

procaryotes.

Figure tirée et adaptée de Hyman & Abedon. (2015).

Les phages de la famille des Myoviridae se caractérisent par leurs queues contractiles et

représentent 25% des phages à queue caractérisés. Les phages de la famille des Podoviridae

ont des queues courtes et non contractiles et ne représentent que 14% de l’ensemble des

phages de cet ordre. La famille des Siphoviridae est la plus grande famille des

bactériophages à queue représentant environ 61% et regroupe des phages à longues queues

non contractiles (Ackermann, 2007). Récemment, l'ordre des Caudovirales a fait l’objet de

modifications par l’introduction de plusieurs sous-familles (Adriaenssens, et al., 2012).

D’après les données récentes de l’ICTV, la famille des Myoviridae regroupe 28 genres

appartenant à 6 sous-familles et 39 genres non classés. De plus, la famille des Podoviridae

regroupe 10 genres appartenant aux 3 sous-familles ainsi que 20 genres non classés. Le

phage Cp-1 était une espèce non assignée dans cette famille et maintenant il est considéré

comme l'espèce type d'un nouveau genre, Cp1virus dans la sous-famille des Picovirinae.

Pour la famille des Siphoviridae, elle est divisée en 6 sous-familles regroupant 21 genres et

aussi 94 genres non classés. Le pneumophage Dp-1 demeure un virus non classé dans la

famille des Siphoviridae.

34

Réplication des bactériophages

Les bactériophages sont des prédateurs naturels et parasites obligatoires des bactéries. Pour

infecter une bactérie hôte, le phage va se lier à un récepteur spécifique à la surface de la

cellule bactérienne pour injecter son propre génome. Cette étape ne se fait pas au hasard,

elle nécessite une étroite sélectivité entre le phage et son hôte. Chaque phage cible une

souche particulière d'une espèce bactérienne pour s’adsorber à son récepteur bactérien. On

distingue deux principaux cycles de réplication du phage; lytique et lysogénique, selon

qu’il s’agisse d’un phage virulent ou tempéré, respectivement. Le choix du cycle de

réplication des phages est défini par leur génétique, leur interaction avec l'hôte bactérien

ainsi que les stimuli environnementaux.

Dans le cas des phages virulents, le phage débute immédiatement un cycle de réplication et

la production de nouveaux virions. Le cycle s’achève par la lyse bactérienne et la libération

d’une nouvelle progéniture. Pour les phages tempérés, le phage s’intègre au génome

bactérien, on le nomme un prophage. Ce prophage reste en quiescence tout en se répliquant

en même temps que son hôte bactérien sans induire une lyse bactérienne. Sous l’effet d’un

stress tel que la température, le stress oxydatif, les rayons ultra-violets ou la mitomycine C,

ce prophage s’excise et entame la réplication en rejoignant le cycle de réplication lytique

comme les phages virulents (Figure 1.7).

Pour les deux types de phages, la première étape du cycle d’infection est l’adsorption. Les

phages peuvent reconnaitre divers récepteurs dont la nature varie selon la bactérie ciblée

(peptidoglycane, acides teichoïques, lipopolysaccharides, capsule ou oligosaccharides).

Cette étape fait appel à des structures de la queue qui jouent un rôle dans la reconnaissance

du récepteur et participent aussi dans la perforation des membranes cellulaires et l’injection

de l’ADN viral (Salmond & Fineran, 2015). Pour la majorité des phages caudés,

l’adsorption se déroule en deux parties, un premier attachement réversible et un deuxième

irréversible.

35

Figure 1.7 Cycle de réplication des bactériophages. Cycle lytique des phages virulents (gauche) et cycle lysogénique des phages

tempérés (droite). Figure tirée et adaptée de Salmond & Fineran. (2015).

Dans le cas du myophage T4, le premier attachement fait appel à un minimum de trois

fibres caudales (fibres de la queue) puis la totalité des fibres pour augmenter la surface de

contact avec la bactérie (Rakhuba, et al., 2010). Ensuite, le phage fait appel à une protéine

de liaison au récepteur (RBP) qui assure l’attachement à un récepteur bactérien et stimulant

ainsi l’altération de la conformation de la plaque basale et la contraction de la queue pour

perforer la membrane bactérienne et injecter l’ADN viral. Le phage exploite la machinerie

cellulaire pour assurer la réplication de son génome et pour la synthèse des protéines de la

capside et de la queue. C’est alors que l’assemblage des composants du phage et

l’encapsidation de l’ADN ont lieu pour générer des phages identiques qui seront libérés

dans l’environnement suite à la lyse de la bactérie (Rakhuba, et al., 2010, Salmond &

Fineran, 2015).

36

Contrairement aux phages virulents, les phages tempérés entrent en lysogénie et

maintiennent une association à long terme avec leur hôte bactérien avant de rejoindre le

cycle de réplication. Les prophages s’excisent alors du génome bactérien et se comportent

comme un phage virulent pour le reste du cycle. Cependant, ce n’est pas l’unique cas où le

prophage peut s’exciser du génome bactérien. De nouveaux travaux ont permis de mettre en

évidence quelques circonstances où le prophage est capable de s’exciser du génome et de

s’insérer à nouveau (Feiner, et al., 2015). Ce mécanisme conduit à la régulation de

processus bactériens cruciaux. Par exemple, dans les cas de S. aureus, la synthèse d’une

hémolysine de type bêta joue un rôle important pour passer de la colonisation à la

pathogénicité. Cependant le gène codant pour cette hémolysine est interrompu par la

présence d’un prophage. Pour cela, le prophage s’excise et s’insère à un autre locus ce qui

permet la synthèse de cette toxine (Goerke, et al., 2006).

Phages infectant Streptococcus pneumoniae

Les phages infectant S. pneumoniae ont été isolés pour la première fois en 1975 par deux

groupes indépendants, à partir de prélèvements (écouvillonnage) de la gorge de patients

présentant une infection des voies respiratoires supérieures. Le premier groupe a isolé des

phages nommés Omega () et le deuxième groupe; le premier phage lytique nommé

Diplophage 1 (Dp-1) (McDonnell, et al., 1975, Tiraby, et al., 1975). En 1981, le phage Cp-

1 (phage complutence) a été isolé (Ronda, et al., 1981). Depuis, plusieurs phages tempérés

ont été isolés de souches cliniques de S. pneumoniae, comme HB-3, MM1, SV1 et VO1. En

effet, les phages tempérés ont été identifiés dans le génome d’environ 76% des isolats

cliniques (Ramirez, et al., 1999). Ces prophages semblent avoir un rôle important dans la

virulence du pneumocoque, toutefois la façon dont ces phages affectent leur hôte pendant la

colonisation et la virulence demeure inconnue.

La présence d’un prophage intégré au chromosome bactérien peut induire un changement

des propriétés d’une bactérie hôte. Ce phénomène est nommé la conversion lysogénique qui

procure à la bactérie un nouvel arsenal pour mieux persister. Un prophage peut être un

vecteur de gènes de résistance aux antibiotiques, de gènes de métabolisme pour utiliser de

37

nouvelles sources nutritives ou de gènes codant pour des facteurs de virulence (Feiner, et

al., 2015). En effet, la virulence de plusieurs souches bactériennes est associée à la présence

de toxines codées par des prophages, qui sont soit sécrétées ou libérées lors de la lyse

bactérienne (Salmond & Fineran, 2015). Cependant, les prophages de S. pneumoniae ne

codent pour aucune toxine et semblent jouer davantage un rôle dans la biologie de S.

pneumoniae. Tous les phages tempérés du pneumocoque codent pour une enzyme lytique

(endolysine) de 318 acides aminés, impliquée dans la lyse de la paroi bactérienne. Cette

endolysine ressemble étroitement à l'enzyme LytA de S. pneumoniae, une N-

acetylmuramoyl-L-alanine amidase (Morales, et al., 2010). Cette enzyme est absente dans

le cas des phages virulents du pneumocoque. La présence du prophage SV1 semble

améliorer la formation de biofilm et le prophage MM1 augmente l’adhérence de S.

pneumoniae aux cellules épithéliales (Loeffler & Fischetti, 2006, Carrolo, et al., 2010).

À ce jour, la liaison entre la virulence et la présence des prophages dans le génome du

pneumocoque demeure mal comprise. Cependant, environ 72% des prophages codent pour

des facteurs de virulence (Brueggemann, et al., 2017). Les gènes putatifs de virulence pblA

et pblB coderaient aussi pour des protéines de la queue d’un phage. Chez S. mitis, on

retrouve des gènes similaires dans des prophages et ils coderaient pour des protéines

associées à une liaison plaquettaire et à un risque accru d'endocardite (Bensing, et al., 2001,

Mitchell, et al., 2007). Chez S. pneumoniae, la présence du gène pblB codé par un

prophage, est associée à l'adhérence du pneumocoque aux cellules épithéliales pulmonaires

humaines et à une persistance accrue dans le nasopharynx et le poumon (Brueggemann, et

al., 2017). De plus, pblB est associée avec une mortalité accrue chez les patients atteints

d’infections invasives à S. pneumoniae (Tunjungputri, et al., 2017). Les prophages peuvent

aussi être des médiateurs de gènes de résistance aux antibiotiques. En effet, la résistance de

S. pneumoniae à la tétracycline semble être liée à la présence d’un prophage qui code pour

des gènes de résistance pour cet antibiotique (Wyres, et al., 2013).

Les génomes de souches cliniques du pneumocoque regorgent d’un grand nombre de

prophages dont le maintien suggère que ces prophages apportent un bénéfice au

pneumocoque. La contribution de ces prophages dans la pathogenèse et la virulence du

pneumocoque nécessite une compréhension plus approfondie. La présence de ces

38

nombreux prophages dans le génome de S. pneumoniae représente aussi un véritable

paradoxe vue le nombre restreint des phages virulents isolés. En effet, seulement deux

phages virulents sont à présent disponibles, le phage Cp-1 et Dp-1, appartenant à la famille

des Podoviridae et des Siphoviridae, respectivement. Récemment, le groupe de Clokie a

isolé un nouveau phage virulent SPQS1 capable d’infecter des souches capsulées de S.

pneumoniae D39. Le phage SPQS1 appartient à la famille des Siphoviridae et au genre

de Sap6virus. Avec une taille du génome de 58305 pb, il code pour 104 protéines, le

génome est disponible dans la base de données GenBank (numéro d’accession:

NC_021868). Ce phage s’est avéré capable d’éliminer les infections pneumococciques

invasives (pneumonie et septicémie) chez des souris. Toutefois, ces travaux ne sont pas

encore publiés à ce jour. Après plusieurs années à l’ombre, les phages virulents Cp-1 et Dp-

1 ont reçu plus d’attention au cours de ces dernières années et ont fait l’objet de quelques

études.

Le phage Dp-1 est le premier phage virulent à avoir été isolé pour S. pneumoniae et

pourtant l’annotation complète de son génome n’a été faite que récemment. Son analyse

génomique a montré que ce phage coderait pour 72 protéines (Sabri, et al., 2011). De plus,

ces protéines structurales ont aussi été identifiées par spectrométrie de masse (Sabri, et al.,

2011). Un réseau de ces protéines phagiques structurales a aussi été établi afin de mieux

comprendre ce phage (Sabri, et al., 2011). Par ailleurs, l’étude des protéines du phage Cp-1

par SDS-PAGE et spectrométrie de masse a permis d’identifier une douzaine de protéines

structurales (Hauser, et al., 2011). Pour ces deux phages, l’étude des interactions

intravirales a permis de prédire la fonction de certaines protéines et de proposer un modèle

structurel du phage Dp-1 et du phage Cp-1(Hauser, et al., 2011, Sabri, et al., 2011). À ce

jour, la fonction de la moitié des protéines codées par les gènes de ces deux phages

demeure inconnue, représentant ainsi un véritable obstacle à la compréhension globale de la

biologie des phages virulents du pneumocoque.

Comme on le verra plus loin dans cette thèse, la relation des phages virulents avec leur

bactérie hôte représente une étape clé dans la compréhension du mécanisme d’infection et

dans la façon dont les phages interagissent avec la cellule bactérienne. L’étude des

interactions des protéines de S. pneumoniae avec les protéines des deux phages Cp-1 et Dp-

39

1 par la technique de double hybride (Y2H) a récemment permis de cibler quelques

protéines du pneumocoque qui semblent interagir avec des protéines phagiques, du moins

in vitro (Mariano, et al., 2016). Dans le cas du phage Cp-1, un total de 11 interactions ont

été détectées par Y2H (yeast 2-hybrid assay) entre 7 protéines du phage et 10 protéines de

S. pneumoniae. Pour le phage Dp-1, 49 interactions ont été identifiées par Y2H entre 19

protéines du phage et 28 protéines du pneumocoque (Mariano, et al., 2016). Seulement

deux protéines du pneumocoque auraient une interaction avec les deux phages, soit l’ADN

hélicase RuvB et un regulateur transcriptionel de la famille de DeoR.

Une autre étude des interactions entre S. pneumoniae et les phages Cp-1 et Dp-1 a été

réalisée récemment et cette étude était basée sur des souches mutantes résistantes aux

pneumophages (Leprohon, et al., 2015). Le principe est relativement simple. Il s’agit de

générer en laboratoire des mutants naturels résistants aux phages en mettant en contact une

bactérie sensible aux phages avec des concentrations variables de phages. Après une

période prolongée d’incubation, des colonies résistantes aux phages vont émerger sur des

boites de Petri. Le séquençage du génome de ces bactéries mutantes permet ensuite

d’identifier des mutations possiblement impliquées dans la résistance aux phages.

Évidemment des tests de génétiques classiques (complémentation, reconstruction) sont

nécessaires pour confirmer que ces mutations sont bel et bien impliquées dans la résistance

aux phages. Toutefois avec S. pneumoniae cette approche a été un peu plus difficile puisque

cela impliquait la disponibilité des méthodologies efficaces pour l’infection sur boite de

Petri avec des pneumophages ainsi que des outils de modifications génétiques. Malgré les

embuches techniques, cette étude a réussi à détecter plusieurs mutations dans le génome de

pneumocoques résistants aux phages. Au total, onze mutations dans le cas de souches

résistantes au phage Cp-1 ont été détectées, ciblant huit gènes dont trois mutations étaient

additives pour augmenter la résistance à ce phage. De même, cinq mutations dans la souche

résistante au phage Dp-1 ont été détectées, ciblant deux gènes du pneumocoque (Leprohon,

et al., 2015). L’adsorption du phage Cp-1 à la souche mutante a été partiellement réduite

alors que pour l’adsorption du phage Dp-1 n’a subi aucune réduction. Ces mutations ne

semblent pas tout à fait liées au processus d’adsorption, mais plutôt auraient des rôles dans

d’autres étapes du processus d’infection phagique.

40

Puisque les phages sont dépendants de leur bactérie hôte pour se reproduire et qu’ils font

appel à un réseau d’interactions, ces études phages-bactéries sont cruciales pour améliorer

notre compréhension du processus d’infection. Elles représentent une étape déterminante

pour une éventuelle application de la thérapie par les phages.

41

Problématique, hypothèses et objectifs du projet

Les infections par S. pneumoniae demeurent l’un des grands chapitres de la pathologie

infectieuse. S. pneumoniae est à l’origine de la pneumonie, la bronchite, la sinusite, l’otite

moyenne et des infections invasives telles que la bactériémie, la septicémie et la méningite.

Le pneumocoque est associé à un taux élevé de morbidité et de mortalité chez les enfants et

les adultes avec une prédominance aux âges extrêmes. La prévalence des souches de S.

pneumoniae résistantes et multirésistantes ne cesse d’augmenter au fil du temps. Face à ce

problème de santé publique majeur; la recherche de nouveaux remèdes est imminente. La

réévaluation de la thérapie par phages est maintenant considérée comme une alternative

thérapeutique pour résoudre cette impasse thérapeutique.

Plusieurs travaux sont menés sur l’isolement des phages et l’étude de l’efficacité de la

phagothérapie. Cependant, cela ne permet pas de comprendre le comportement des phages

et leurs interactions avec leurs bactéries hôte ni les facteurs qui peuvent influencer leur

efficacité. Le point de départ de ce travail de thèse est l’étude des interactions phage-hôte

dans le cas de S. pneumoniae. Deux objectifs ont été envisagés, un objectif mineur et un

objectif majeur.

1. Objectif mineur: Étude de l’efficacité des phages du pneumocoque à infecter S.

mitis une bactérie proche de S. pneumoniae (chapitre 2)

Lors de ce projet, nous avons malheureusement obtenu un nombre limité de phages

virulents infectant S. pneumoniae et même pour des bactéries proches du pneumocoque.

Cela nous a incités à investir la capacité des pneumophages à infecter d’autre bactérie

comme S. mitis. S. mitis est une bactérie pathogène responsable d’endocardite, pour

laquelle aucun phage virulent n’a été encore isolé. Pour tester cette hypothèse, la capacité

des pneumophages virulents Dp-1 et Cp-1 à infecter des souches de S. mitis a été vérifiée.

Spécifiquement, des analyses microbiologiques et génomiques ont été effectuées pour

comparer le comportement des phages chez les deux espèces bactériennes.

42

2. Objectif majeur: Étude des interactions phage-hôte chez S. pneumoniae (chapitre 3)

Cet objectif a pour but d’approfondir nos connaissances sur les interactions phage-hôte

chez S. pneumoniae. Après l'infection par un phage virulent, le phage détourne la

machinerie de l’hôte bactérienne par diverses interactions phage-hôte. Dans ce processus,

des facteurs de l’hôte sont essentiels pour assurer la réplication du phage. Pour cela, nous

avons étudié l’implication de plusieurs facteurs de l’hôte dans la réplication de ces deux

pneumophages. Tout d’abord, nous avons inactivé indépendamment plusieurs gènes de S.

pneumoniae et on a évalué l’effet de l’inactivation sur la croissance de la souche. L’étude

de l’impact de ces altérations sur le pneumocoque pourra aider à identifier de nouvelles

cibles thérapeutiques thérapeutiques. Par la suite, pour vérifier l’importance de ces facteurs

d’hôte pour les phages, nous avons testé les deux phages sur toutes ces souches. Pour

confirmer ces résultats, nous avons étudié l’effet de la complémentation et l’expression de

ces gènes sur la réplication des pneumophages.

43

Chapitre 2. Diverse virulent pneumophages infect Streptococcus mitis

Résumé

Streptococcus mitis est une bactérie proche de Streptococcus pneumoniae, et elle a émergé

comme l'une des principales causes d'endocardite bactérienne. La résistance aux

antibiotiques a également augmenté chez les souches de S. mitis et de S. pneumoniae. Pour

gérer les infections, les phages sont reconsidérés comme des alternatives aux antibiotiques.

Dans cette étude, les deux phages virulents Cp-1 (Podoviridae) et Dp-1 (Siphoviridae),

auparavant isolés de S. pneumoniae, se sont avérés capable d’infecter aussi S. mitis. Les

essais microbiologiques ont montré que les deux pneumophages pouvaient non seulement

se répliquer sur S. mitis mais également produisent des plaques plus visibles chez cet hôte.

Cependant, la taille de la progéniture et les données d'adsorption étaient plus faibles chez S.

mitis par rapport à S. pneumoniae. La comparaison génomique de chaque phage propagé

sur les deux hôtes montre des séquences nucléotidiques identiques, confirmant que les

mêmes phages infectent les deux espèces bactériennes. Nous avons également découvert

que la séquence du génome du podophage Cp-1 de la collection de Félix d'Hérelle est

différente de la séquence précédemment rapportée. Ainsi le phage de la collection a été

renommé SOCP.

Avant-propos

Contributions des auteurs

Philippe Leprohon a sélectionné les souches de S. mitis potentiellement sensibles aux

pneumophages. J’ai réalisé les expériences et rédigé l’article. Sylvain Moineau a co-rédigé

le manuscrit en plus d’avoir supervisé le projet.

44

Publication

Siham Ouennane, Philippe Leprohon and Sylvain Moineau. 2015. Diverse virulent

pneumophages infect Streptococcus mitis. PloS One. 10:e0118807.

Abstract

Streptococcus mitis has emerged as one of the leading causes of bacterial endocarditis and

is related to Streptococcus pneumoniae. Antibiotic resistance has also increased among

strains of S. mitis and S. pneumoniae. Phages are being reinvestigated as alternatives to

antibiotics for managing infections. In this study, the two virulent phages Cp-1

(Podoviridae) and Dp-1 (Siphoviridae), previously isolated from S. pneumoniae, were

found to also infect S. mitis. Microbiological assays showed that both pneumophages could

not only replicate in S. mitis but also produced more visible plaques on this host. However,

the burst size and phage adsorption data were lower in S. mitis as compared to S.

pneumoniae. A comparison of the genomes of each phage grown on both hosts produced

identical nucleotide sequences, confirming that the same phages infect both bacterial

species. We also discovered that the genomic sequence of podophage Cp-1 of the Félix

d’Hérelle collection is different than the previously reported sequence and thus renamed

SOCP.

Introduction

The Mitis group of streptococci is a member of the viridans group of streptococci [VGS],

which includes several species that reside in the human oral cavity and the upper

respiratory tract. In the Mitis group, Streptococcus pneumoniae and Streptococcus mitis are

closely related species, making discrimination between them very difficult (Arbique, et al.,

2004). Although both bacteria are oral commensals they can cause a wide variety of human

invasive diseases (Doern & Burnham, 2010). S. pneumoniae (pneumococcus) is the most

common cause of community-acquired pneumonia worldwide and is also associated with a

range of other diseases, including otitis media, meningitis, and septicemia (Joyce, et al.,

45

2009). S. mitis has traditionally been regarded as an innocuous commensal of the

oropharynx, skin, and both the gastrointestinal and genitourinary tracts (Carrascosa, et al.,

1994). Some S. mitis strains have been shown to cause endocarditis and blood stream

infections (Mitchell, 2011). The transition from commensalism to pathogenesis is likely

related to the acquisition of virulence genes.

S. pneumoniae and S. mitis have emerged as significant pathogens but differ in their

expression of virulence factors. For example, phase variation is an important step in

virulence and also an adaptive process that leads to the distribution of bacteria to other

sites, causing disease (Donkor, 2013). The switching of phenotypes was noted in S.

pneumoniae where phase variation changes the colony morphology from opaque to

transparent without any change in the serotype. To our knowledge, this type of phase

variation has not been observed for S. mitis (Arai, et al., 2011), however, strains of S. mitis

were recently shown to have a capsule, a well known virulence factor in S. pneumoniae

(Rukke, et al., 2012). In fact, genomic analysis of S. mitis revealed the presence of several

virulence factors similar to those found in S. pneumoniae. However, it has not been

confirmed whether these virulence factors are just implicated in adhesion and attachment of

S. mitis or whether they are related to pathogenicity as in S. pneumoniae (Madhour, et al.,

2011, Mitchell, 2011).

Strains nonsusceptible to the common antimicrobial drugs were detected among S.

pneumoniae and S. mitis, especially to beta-lactams which have been widely used to treat

such bacterial infections (Sunderkotter & Becker, 2014). It was also reported for S.

pneumoniae and other bacterial species that low concentrations of some antibiotics induces

natural transformation and mutagenesis (Henderson-Begg, et al., 2006, Prudhomme, et al.,

2006, Gutierrez, et al., 2013). The ubiquitous nature of antibiotic resistance genes may also

be due to horizontal gene transfer among strains of the naturally transformable Mitis group.

Therefore, there is pressure to develop novel antibacterial alternatives.

Virulent phages may represent such an alternative strategy to combat antibiotic-resistant

bacteria. Phages are recognized as the most abundant biological entities in the biosphere

46

(Serwer, et al., 2007). The study of phages of hemolytic streptococci began decades ago

(Krause, 1957), and the vast majority of phages currently isolated from S. mitis and S.

pneumoniae are temperate phages. In fact, both bacterial species contain many prophages in

their genomes (Ramirez, et al., 1999, Romero, et al., 2009). Prophage carriage was

identified in clinical isolates of S. pneumoniae by hybridation and also via induction by

mitomycin C (Ramirez, et al., 1999, Romero, et al., 2009). At least seven phage-related

gene clusters were detected in the genome of S. mitis B6 and two complete prophages (SM1

and phiB6) were isolated and sequenced (Siboo, et al., 2003, Denapaite, et al., 2010).

Because temperate phages have the ability to transfer host DNA, which may encode

virulence genes or toxins, into other bacterial strains (Gindreau, et al., 2000, Denapaite, et

al., 2010), virulent phages are thought to be better suited for biocontrol purposes.

Very few lytic phages have been isolated for either of these two bacterial species. Despite

the isolation of pneumophages, also called Omega phages (Tiraby, et al., 1975), only two

virulent pneumococcus phages are readily available today. Phage Dp-1 was the first

virulent pneumophage isolated in 1975 (McDonnell, et al., 1975, Tiraby, et al., 1975) and

belongs to the Siphoviridae family. Phage Cp-1 was isolated in 1981 (Ronda, et al., 1981)

and is a member of the Picovirinae subfamily of the Podoviridae family, with a linear

double-stranded DNA genome (Martin, et al., 1998). One virulent phage of S. mitis,

vB_SmM_GEC-SmitisM_2, was isolated in 2012 from sewage water and belongs to the

Myoviridae family (Rigvava, et al., 2013).

Of interest, enzymes from virulent pneumococcal phages have also shown promise as

antimicrobials (Nelson, et al., 2001, Loeffler, et al., 2003, Loeffler & Fischetti, 2003,

Djurkovic, et al., 2005, McCullers, et al., 2007, Witzenrath, et al., 2009, Doehn, et al.,

2013). At the end of their lytic cycle, virulent phages produce an enzyme [endolysin or

lysin] that degrades the bacterial peptidoglycan to release new virions. A number of studies

have demonstrated the potential of the lysin [Cpl-1] from phage Cp-1 to eradicate

nasopharyngeal colonization and bacteremia (Loeffler, et al., 2003), and to prevent otitis

media (McCullers, et al., 2007). The administration of Cpl-1 by inhalation (Doehn, et al.,

47

2013) or by repetitive intraperitoneal injections even rescued mice from severe

pneumococcal pneumonia (Witzenrath, et al., 2009).

In this study, we show that the virulent pneumophages Dp-1 and Cp-1 can infect S. mitis.

Microbiological assays and genomic analyses were performed to compare phage behavior

in both bacterial species.

Materials and Methods

Bacterial strains and culture conditions

The unencapsulated strain S. pneumoniae R6 (host of phage Cp-1), a derivative of S.

pneumoniae strain R36A [host strain of phage Dp-1], was grown on TSA (Trypticase Soy

Agar) containing 5% sheep’s blood at 37°C in the presence of 5% CO2. Single colonies

were suspended in filtered BHI (Brain heart infusion) broth containing 0.5% yeast extract

and incubated at 37°C in the presence of 5% CO2. S. mitis CCRI-15019 was grown at 30°C

in BHI supplemented with 0.2 mM magnesium sulfate and 0.25 mM calcium chloride to

prevent cell aggregation. The bacterial strains are stored at the Félix d’Hérelle Reference

Center for Bacterial Viruses (www.phage.ulaval.ca).

Bacterial species identification

The bacterial housekeeping genes recA, recP, HexB, and xpt were amplified by PCR using

the primers listed in Table S2.1 (McDonnell, et al., 1975). The PCR products were

sequenced by the Plateforme de Séquençage et de Génotypage des Génomes service at the

CHUL/CHUQ Research Center using the ABI data 3730XL DNA analyzer. Both DNA

strands of the amplicons were sequenced using the same primer pairs used for PCR

amplification. Sequences were aligned and analysed using the bioinformatics tools (Clustal

W2 and BioEdit).

Phages

Pneumophages Cp-1 (Ronda, et al., 1981) and Dp-1 (McDonnell, et al., 1975) were

obtained from the Félix d’Hérelle Reference Center for Bacterial Viruses. For phage

48

amplification, and to facilitate enumeration, we used liquid BHI+ medium, which consisted

of BHI supplemented with 8 µM MnCl2, 0.25 mM CaCl2, 0.2 mM MgSO4, Tris-HCl 50

Mm pH 7.5, 50 ng/µl choline chloride, 0.4% glycine, and 100 µl/ml catalase.

Amplifications of phage Cp-1 on S. pneumoniae and on S. mitis were performed with

agitation, as follows: a single colony, isolated from overnight culture on BHI blood agar,

was used for cultivation in BHI. After overnight growth of the host strains an aliquot of

the culture was transferred into fresh BHI and incubated until it reached an optical density

at 600 nm (OD600nm) of 0.06-0.08. The culture was diluted with an equal volume of BHI+,

phages were added and incubated overnight at 30°C. Phage titers were obtained using a

standard, double-layer agar assay method. To maximize plaque visualization, the bottom

layer of BHI+ contained 1.5% agarose while the top agar contained 0.4% agarose.

Microbiological assays

Phage lytic development was assessed using a one-step growth curve assay, in triplicate, as

described elsewhere (Moineau, et al., 1993). After overnight growth of the host strain in

BHI, an aliquot of the culture was transferred into fresh BHI and incubated until it reached

an OD600nm of 0.06-0.08. The bacterial culture was diluted 1:3 in BHI+ and then infected at

a multiplicity of infection of 0.05 at 30°C. Phages were allowed to adsorb to the host cells

for 10 min. Unadsorbed phages were removed by centrifugation, the bacterial pellet was

washed twice with BHI media and then we proceeded as described elsewhere (Moineau, et

al., 1993). The plates were incubated at 30°C overnight with 5% CO2, and the plaque

forming units (PFU) were counted. The burst size was determined by calculating the ratio

of the average phage titer after the exponential phase to the average titer before the infected

cells began to release virions (Moineau, et al., 1993). Phage adsorption tests were also

carried out on S. pneumoniae R6 and S. mitis CCRI-15019, in triplicate, essentially as

previously reported (Duplessis & Moineau, 2001). Modifications: BHI+ broth was used,

CaCl2 was not added again at phage infection and the incubation was carried out at 30°C for

10 min.

49

Electron microscopy

Phage preparations produced on S. pneumoniae and S. mitis were purified using a CsCl

gradient, as previously described (Sambrook, et al., 1989). Phages were then centrifuged

and 100 µl of the pellet were kept and washed with 1.5 ml of ammonium acetate (0.1 M,

pH 7.5). This process was repeated twice and 100 µl from the final wash was retained for

observation by transmission electron microscopy. Grid preparation and observation were

performed as previously described (Rousseau & Moineau, 2009). Phages were observed at

80 kV using a JEOL 1230 transmission electron microscope.

Phage DNA preparation and sequencing

Genomic DNAs of phages Cp-1 and Dp-1 amplified on S. mitis CCRI-15019 were isolated

using a Lambda Maxi Kit (Qiagen). Phage Cp-1 DNA was also isolated after propagation

on S. pneumoniae R6. Genome sequencing was performed on a 454 FLX instrument at the

Plateforme d’Analyses Génomiques of the Université Laval (IBIS). The genomic sequences

were completed by primer walking (primer sequences are listed in Table S2.1) and by

sequencing of PCR products. All mutations were also confirmed by primer walking.

Phage genome analyses

Genomic sequences were analyzed using BioEdit 7.2.0

(http://www.mbio.ncsu.edu/bioedit/bioedit.html) and the Staden package (Staden, et al.,

2000, Kraemer, et al., 2009) (http://staden.sourceforge.net/). Sequence alignments were

performed using BioEdit and Clustal W2 software

(http://www.ebi.ac.uk/Tools/msa/clustalw2/). Open reading frames [ORFs] were identified

using GenMark (http://exon.gatech.edu/) and ORFinder (http://www.ncbi

.nlm.nih.gov/projects/gorf/). Sequences were considered to be ORFs if they showed a

putative ribosome binding site (RBS) at a reasonable distance from the starting codon

(AUG, UUG, or GUG) and they consisted of at least 29 amino acids (aa). Function was

attributed to an ORF by comparing the translated product to proteins available at the

National Center for Biotechnology Information (BLASTp,

http://blast.ncbi.nlm.nih.gov/Blast.cgi). The annotations were reinforced by searching for

protein functional domains using the NCBI Conserved Domain Database

50

(http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) and EMBL InterProScan

(http://www.ebi.ac.uk/Tools/InterProScan/). The theoretical molecular masses [MM] and

isoelectric points [pI] of each deduced phage protein were determined using the ProtParam

software tool available on the bioinformatics resource portal ExPASy Web site

(http://ca.expasy.org/tools/protparam.html). The genomes of phages Cp-1 and Dp-1 were

searched for tRNAs using tRNAscan-SE (Lowe & Eddy, 1997) and BLASTn from NCBI.

Bacterial codon usage for the host strains was obtained from the Kazusa DNA Research

Institute database (http://www.kazusa.or.jp/codon/) while codon usage for the phages was

determined using the DNA 2.0 web server (Menlo Park, CA); the frequency per thousand

codons was then calculated. The complete genome sequence of phage SOCP has been

deposited in GenBank under accession number KJ617393.

Results

Speciation of bacterial hosts

The species identification of S. mitis from the closely related S. pneumoniae represents a

challenge. For example, significant sequence conservation of the 16S rRNA gene sequence

within the Mitis group limits the use of these sequences for species differentiation (Kilian,

et al., 2008). To confirm the bacterial strains used in this study, degenerate primers were

used and the PCR products of four housekeeping genes, recA, recP, hex B and xpt (Table

S2.2) (Kilian, et al., 2008) were amplified and sequenced. Our results confirmed that the

isolate CCRI-15019 is highly related to S. mitis B6 (Denapaite, et al., 2010). Our S.

pneumoniae R6 and R36A strains were similarly confirmed.

51

Figure 2.1 Electron microscopy of virulent phage Dp-1 (A) and phage SOCP (D). Scale

bars correspond to 50 nm. Photographic images (B, C, E, F) show plaques of phages Dp-1

and SOCP propagation in media containing agarose. Plaques produced by phage Dp-1 on

strains S pneumoniae R6 (B) and S. mitis CCRI-15019 (C). Plaques produced by phage

SOPC on strains S pneumoniae R6 (E) and S. mitis CCRI-15019 (F).

Morphological analysis of phages Dp-1 and SOCP

As documented previously (Kilian, et al., 2008), phage Dp-1 belongs to the Siphoviridae

family. It has an icosahedral capsid with an estimated diameter of 69.8 ± 1.2 nm (Fig. 2.1A)

and a long non-contractile tail of 169.9 ± 3.6 nm in length and 19.6 ± 2 nm in width. Phage

Cp-1, used in this study and stored at the d’Hérelle Center, was re-named SOCP due to

genome variations (see below). Phage SOCP belongs to the Podoviridae family and has a

hexagonal capsid of 65.8 ± 1.1 nm (top to bottom) and 42.1 ± 1.7 nm in width (Fig. 2.1D).

This phage has a short non-contractile tail, 19.3 ± 1 nm in length and 7.5 ± 1.2 nm in width.

Observations of phages Dp-1 and SOCP, amplified on both bacterial species, confirmed

that the general morphology of these virions was not affected by growth in either hosts.

Microbiological assays

One of the great difficulties of working with virulent pneumophages is the ability to

visualize plaques consistently. We were able to observe plaques for both phages using

BHI+ media (Figs. 2.1B & E). We also noticed that liquid cultures of S. pneumoniae grew

52

better in BHI+ when started from colonies grown on blood agar. Finally, replacing agar by

agarose in both top and bottom media led to an improvement in the plaque size and

visibility.

The availability of an improved plaque assay allowed us to investigate the host range of

phages Dp-1 and SOCP. Interestingly, we observed that they could both replicate on a S.

mitis strain (CCRI-15019). Moreover, even larger phage plaques were obtained on S. mitis,

compared to S. pneumoniae host cells grown under the same conditions (Figs. 2.1BC &

EF). To further investigate the behavior of the two phages on both bacterial species, one-

step growth curve assays were performed using S. pneumoniae R6 and S. mitis CCRI-

15019. The latent period of phage Dp-1 was calculated to be 71 ± 4 min when amplified on

S. pneumoniae and 59 ± 4 min on S. mitis. The burst sizes were 73 ± 6 plaque-forming units

(PFU) per infected cell and 63 ± 6 PFU for S. pneumoniae and S. mitis, respectively.

Similarly, the latent period of phage SOCP was estimated to be 78 ± 2 min on S.

pneumoniae and 66 ± 5 min on S. mitis, while the burst size was 94 ± 4 PFU on its

pneumococcal host and 53 ± 4 PFU on S. mitis. These data indicated a lower burst size for

both phages on S. mitis cells but a shorter latent period.

Adsorption to the cell surface was also evaluated for the two phages on both strains. Under

the conditions tested, the percentage of adsorption of phage Dp-1 on S. pneumoniae R6 was

95% ± 1.8% and was 79% ±1% on S. mitis. The adsorption of phage SOCP was 94% ±

0.6% on S. pneumoniae R6 and 86 ± 1.3% on S. mitis B6. Thus, both pneumophages could

also readily adsorb to the S. mitis cell surface.

The efficacy of plaquing (EOP) of both phages on the two propagating hosts was

determined. When phages Dp-1 and SOCP were amplified on their S. pneumoniae hosts

they had EOPs of 10-1

and 10-4

on S. mitis, respectively. Similarly, when Dp-1 and SOCP

were amplified on S. mitis, their EOPs on S. pneumoniae were 10-1

and 10-3

, respectively.

These data suggest the presence of host factors that modify the phage behavior.

53

Genome analysis

To determine if replicating these phages on various hosts had an impact at the nucleotide

level, we determined the complete genome sequence of both phages after amplification on

S. pneumoniae or S. mitis. The double-stranded DNA (dsDNA) genome of phage Dp-1 is

made of 56,506 bp. The analysis of the sequence found no nucleotide variation compared to

the genomic sequence recently reported for Dp-1 (Sabri, et al., 2011). Moreover, the

sequence was identical when Dp-1 was amplified on both S. pneumoniae and S. mitis hosts,

indicating that propagating this siphophage on two distinct streptococcal species did not

lead to genomic changes.

Similarly, the genome of the podophage was also identical when propagated on either S.

pneumoniae or S. mitis. However, analysis of the genomic sequence of the phage Cp-1 used

in this study showed variations compared to the GenBank sequence no. NC_001825.1. As

indicated above, we thus renamed our Cp-1-like phage SOCP due to these differences. The

dsDNA genome of SOCP is 19,347 bp long, while the reported genome of phage Cp-1 is

19,343 bp. Comparative analyses revealed 31 variations in the genome of SOCP as

compared to Cp-1 (Table S2.3). These differences were confirmed through primer walking

directly on the phage genome.

The genome of phage SOCP has a GC content of 38.8%. It has 27 open reading frames,

each preceded by a putative ribosome-binding site (RBS) (Table 2.1). Putative functions

could be attributed to only 12 ORFs (44%). Interestingly, we found two additional ORFs in

SOCP as compared to Cp-1, namely ORF23 and ORF25 (Fig. 2.2). Of interest were also

the products of genes orf5 and orf6, which likely code for DNA polymerase subunits (Mark

& Richardson, 1976, Samson & Moineau, 2010), whereas only one (orf5) was found in Cp-

1. Conversely in the case of orf18, one gene was found in SOCP whereas it was split into

two genes (orf17 and orf18) in Cp-1. The major capsid protein ORF10 was also affected by

mutations, although its size remained the same (Table S2.3). Other notable ORFs

containing mutations included the tail protein ORF19, the collar protein ORF12, as well as

ORF4, ORF9, ORF12, ORF16, ORF23, ORF25, and ORF27.

54

Figure 2.2 Genome alignment of phages SOCP and Cp-1.The scale above the phage

genome SOCP is in base pairs. Each arrow represents a gene, and the numbering for

SOCP refers to Table 2.1. Some putative functions of the deduced proteins are indicated

above the arrows (see Table 2.1 for details). Grey arrows indicate that no putative

function was attributed to the deduced protein. Arrows with the same color indicate the

same general function and have at least 90% identity at the amino acid level.

Heterologous regions are shaded gray, and the shaded numbers indicate the number of

base pairs between the corresponding gene sequences. Shadows light with colored

contour highlight ORFs not found in the genome of phage Cp-1.

Three open reading frames were identified on the negative strand of the SOCP genome,

specifically within three other ORFs (major capsid protein, tail protein and one hypothetical

protein). These ORFs were not included in the annotation of the phage genome since no

BLAST data support these proteins as valid protein products.

55

Table 1.1. Putative Open Reading Frames deduced from SOCP genome sequences and their predicted functions ORF Start End Strand Length

(aa) a

Pi b Mw

(kDa) c

Putative RBS d

and start codon

Putative function Best hit

with Blast

‘Locus tag’

ORF

in

Cp-1

# of identical aa/

size of the

alignment

(% aa identity)

Length

(aa)

E-value Accession

number

(GenBank) e

1 376 642 + 88 4.4 10.4 AAAGGAGAAAGAAAACATG Hypothetical protein Cp-1, p01 1 88/88(100%) 88 3E-57 NP_044813.1

2 657 947 + 96 6.6 11.7 AAAGGAGATAATAAAAATG Hypothetical protein Cp-1, p02 2 96/96(100%) 96 5E-61 NP_044814.1

3 1074 1346 + 90 4.7 10.5 AAAGGAGTAAAAGCACTTG Hypothetical protein Cp-1, p03 3 63/64(98%) 64 3E-36 NP_044815.1

4 1351 2043 + 230 10.1 26.7 AAGGGGTGTAATTAAATG Terminal protein Cp-1, p04 4 229/230(99%) 230 7E-165 NP_044816.1

5 2040 2609 + 189 4.6 22.1 AAAGAAGCGAGGGAAGAAGTG DNA polymerase Cp-1, p05 5 178/179(99%) 568 3E-123 NP_044817.1

6 2681 3745 + 354 6.8 40.8 AATCTTAGATGAAAAGGTG DNA polymerase Cp-1, p05 5 341/354(96%) 568 0 NP_044817.1

7 3702 4148 + 148 9.2 17.6 AAAGGGGGTACGCTGATTTATG Hypothetical protein Cp-1, p06 6 148/148(100%) 148 1E-100 NP_044818.1|

8 4141 4653 + 170 4.8 18.9 AAACGGAGATAAACAAAATG Hypothetical protein Cp-1, p07 7 170/170(100%) 170 5E-118 NP_044819.1

9 4875 5165 + 96 4.2 10.5 AAAGGAGAGGGCTATG Scaffolding protein Cp-1, p08 8 95/96(99%) 96 4E-59 NP_044820.1

10 5409 6506 + 365 5.4 41.7 AAGAGGGAGAAGAATAGAATG Major head protein Cp-1, p09 9 352/365(96%) 365 0 NP_044821.1

11 6563 7576 + 337 5.3 39.5 AAAGGGGACTAAATG Connector protein Cp-1, p11 10 337/337(100%) 337 0 NP_044823.1

12 7563 8210 + 215 5.1 24.7 AAAAGGAGGGGACAATCATTG Collar protein Cp-1, p12 11 192/194(99%) 194 2E-137 NP_044824.1

13 8223 8807 + 194 8.6 22.8 AAAGGTGTATAGATG Hypothetical protein Cp-1, p13 12 194/194(100%) 194 5E-140 NP_044825.1

14 8804 9118 + 104 5.8 11.9 AAAGAGGACATGAAAACCTATG Hypothetical protein Cp-1, p14 13 104/104(100%) 104 7E-67 NP_044826.1

15 9102 9989 + 295 4.9 32.9 AAAAAGAGGTAGAAACAAATG Hypothetical protein Cp-1, p15 14 295/295(100%) 295 0 NP_044827.1

16 10011 10787 + 258 5.0 29.4 AAAGGATTTTAAAACATG Hypothetical protein Cp-1, p16 15 192/207(93%) 288 4E-132 NP_044828.1

17 10787 11548 + 253 6.0 28.4 AGGAGGTATCTAATG Hypothetical protein Cp-1, p18 16 253/253(100%) 253 0 NP_044830.1

18 11515 13077 + 520 5.7 59.0 AAAGTCGGGTCAATG Tail protein Cp-1, p19 /

Cp-1, p20

17

18

210/224(94%)/

236/237(99%)

230

/237

6e-149/

2E-164

NP_044831.1 /

NP_044832.1

19 13081 14919 + 612 4.8 67.5 AAAGGGTAAACAATG Tail protein Cp-1, p21 19 582/583(99%) 586 0 NP_044833.1

20 14993 16039 + 348 7.6 40.8 AAATGGTACAATCCGCAGAAAAT

G

Encapsidation protein Cp-1, p23 20 348/348(100%) 360 0 NP_044835.1

21 16029 16433 + 134 7.9 15.5 AGGTTATCAATCATG Holin protein Cp-1, p24 21 134/134(100%) 134 1E-89 NP_044836.1

22 16433 17452 + 339 4.6 39.2 AAAGGAGAAAAGAAATAATG Lysozyme Cp-1, p25 22 339/339(100%) 339 0 NP_044837.1

23 17480 17896 - 139 5.62 15.8 AAAACGTAGGGGGTTAATACTAT

G

Hypothetical protein SP058_003

95

24/65(37%) 234 6E+00 YP_008239483.1

24 17901 18143 - 80 9.9 9.4 AAATTGAGGTATTAAGAAAATG Hypothetical protein Cp-1, p26 c 80/80(100%) 80 5E-50 NP_044838.1

56

(orfc)

25 18148 18423 - 91 5.1 10.9 AAGGGACGGTTACTAGATG Hypothetical protein AGR66263 14/44(32%) 410 8E-01 gb|AGR66263.1

26 18424 18693 - 89 7.7 10.8 ACAAATAGGAGGGTAAACATG Hypothetical protein Cp-1,

p27(orfb)

b 89/89(100%) 89 5E-58 NP_044839.1

27 18704 18973 - 89 5.0 10.2 AAAGAGGTATAACAAAATG Hypothetical protein Cp-1, p28

(orfa)

a 60/61(98%) 62 7E-35 NP_044840.1

a Number of amino acids (aa), b IP, isoelectric point and c MM, molecular mass. d RBS, ribosomal binding site. Bases in bold correspond to nucleotides identical to the RBS consensus; lowercase indicates

57

Codon usage

No tRNAs were found in either of the two pneumophages. Still, the codon usage frequency

was investigated for the phage genomes and compared with the codon usage of S.

pneumoniae and S. mitis (Table S2.4). The codon usage of pneumophages mostly

corresponds to the codons most frequently used by these two bacteria, although the codon

usage of the phages was closer to S. pneumoniae, suggesting that both phages are mode

adapted to this bacterial species. In a few cases, some codons were over-represented in the

phages as compared to the two bacterial hosts, likely to favor phage multiplication (Table

S2.4).

Comparative genomics

Protein-primed DNA replication was reported for phage Cp-1 (Martin, et al., 1996). Few

other phages of the Podoviridae family replicate using this mechanism of DNA replication

(Martin, et al., 1996, Kotsonis, et al., 2008, Longas, et al., 2008) and, in general, initiation

of replication arises at the 3’ nucleotide of the DNA (Martin, et al., 1996). The genomes of

phages SOCP and Cp-1 were aligned with the genomes of five phages infecting other

Gram-positive bacteria, namely Bacillus subtilis phage phi29, Lactococcus lactis phage

asccphi28, Weissella cibaria phage phiYS6 as well as Bacillus sp. phages GA-1 and Nf

(Fig. 2.3). The genome organization of the two pneumophages is somewhat different from

the other phages due to alternate orientations of some genes, although a few annotated

proteins are related (Fig. 2.3). The genes coding for the DNA polymerase and terminal

proteins are on the positive strand in one group (phage Cp-1, SOCP, phiYS61 and

asccphi28) and on the opposite strand for another group (phage GA-1, Nf and phi29).

Moreover, the genes for structural proteins in the lactococcal phage asccphi28 are in the

opposite direction, compared to the other podophages shown in Fig. 2.3. Overall, a low

level of identity was found between phages Cp-1/SOCP and these podophages, which is

likely due to their distinct ecological niches and host strains.

58

Figure 2. 3 Comparison of the proteome of pneumophage SOCP/ Cp-1 with other

related phages replicating through a protein priming DNA replication system. Phage

genome sequences were downloaded from GenBank, aligned in BioEdit and each deduced

protein was compared using BioEdit and protein BLAST. Arrows of the same color

correspond to ORFs with the same general function.

Discussion

S. mitis is a species closely related to S. pneumoniae that colonizes the human oral cavity.

Both species have emerged as multidrug-resistant pathogens due to their ability to acquire

foreign DNA by natural competence. The genome of S. mitis has significant similarity to

the genome of S. pneumoniae and shares a core of 900 genes (Denapaite, et al., 2010).

59

Since the publication of the S. mitis B6 genome, studies have been carried out to understand

this relationship and a number of studies support the hypothesis of evolution of S.

pneumoniae from S. mitis by acquisition of virulence factors and numerous sugar-related

transport systems (Raskin, et al., 2006, Denapaite, et al., 2010). Other studies have

proposed that a more likely concept is the evolution from a pathogenic bacterium, S.

pneumoniae, to a commensal, S. mitis, through loss of virulence genes (Kilian, et al., 2008,

Denapaite, et al., 2010). Virulence genes could also have been acquired through horizontal

gene transfer between other related species (Zahner, et al., 2011). Many virulence factors

are cell surface proteins that play a role in the interaction with host cells (Ikryannikova, et

al., 2013). Other pneumococcal cell surface components such as choline-containing

teichoic acid, are components of the Dp-1 phage receptors (Lopez, et al., 1982).

Here, we report that two pneumophages can efficiently replicate on a S. mitis strain. These

two virulent phages were initially isolated from throat swabs of patients with upper

respiratory infections – the natural habitat of S. mitis. The ability of phage Dp-1 to infect S.

mitis may be related to the choline-binding proteins found in S. mitis (Lopez, et al., 1982).

Homologues of pneumococcal surface choline-binding proteins are present in S. mitis but

their role in this bacterium remains unknown (Mitchell, 2011). The host autolysin system,

involved in pneumophage virion release (Ronda-Lain, et al., 1977), is also found in both S.

pneumoniae and S. mitis (Sheppard, et al., 2004). The adsorption of phages Dp-1 and

SOCP was slightly higher on the S. pneumoniae host compared to S. mitis and this may be

due to the availability of phage receptors on the cell surface or differences in receptor

sequences. It was previously reported that phage Cp-1 adsorbed very poorly to the host cell

surface (Sheppard, et al., 2004). Phage SOPC adsorbed very well to its host as well as the

S. mitis strain. This could be due to the mutations observed in the genome of SOCP or the

experimental conditions used in our study.

The burst size and latent period reported here are rather different from previous studies for

both pneumophages (Lopez, et al., 1977, Ronda, et al., 1981). Again, this could be due to

the difference in experimental conditions and media used. For phage Dp-1, the host

bacterial strain used by Lopez et al. (Lopez, et al., 1977) was S. pneumoniae R36A and in

60

our study we used the S. pneumoniae R6, a derivative of R36A. Likewise for phage SOCP,

its burst size was much higher than reported for Cp-1 [41]. It is not known if this difference

is due to the experimental conditions or the genomic variations. Of note, it was previously

reported that phage Cp-1 can infect some Streptococcus oralis strains (Ronda, et al., 1989).

SOCP can also infect a few S. oralis strains (data not shown).

In addition to the observations that pneumophages can replicate on S. mitis, the other most

striking finding was the difference (0.16%) in the genome sequences between SOCP and

Cp-1. The nature of such discrepancies remains unclear. Phage SOCP was retrieved from

the Félix d’Hérelle Reference Center for Bacterial Viruses and was initially believed to be

Cp-1. Either sequencing errors occurred in the original deposited sequence (GenBank no.

Z47794) or a very efficient pneumophage was recovered. The latter could be due to phage

host-adaptation, giving SOCP the ability to efficiently infect its hosts (Benmayor, et al.,

2009). It has been reported that viral adaptation occurs through numerous mutations in the

genome at low frequency that increases fitness of the phage (Benmayor, et al., 2009, Hall,

et al., 2013). It will thus be interesting to assess whether some of the nucleotide variations

detected in SOCP are enabling such increased fitness.

This study on virulent phages provides another example of the relatedness of S.

pneumoniae and S. mitis. Both species also carry numerous temperate phages in their

genomes that are probably involved in their evolution. Further study is needed to identify

most of the hypothetical genes in phage SOCP as well as to increase our understanding of

phage-host interactions, with a goal of eventually using virulent streptococcal phages in

medical applications.

Acknowledgments

We are grateful to M. Boissinot for the Streptococcus mitis strain CCRI-15019 and to D.

Tremblay for electron microscopy.

61

References

Arai, J., M. Hotomi, S. K. Hollingshead, Y. Ueno, D. E. Briles, and N. Yamanaka. 2011.

Streptococcus pneumoniae isolates from middle ear fluid and nasopharynx of children

with acute otitis media exhibit phase variation. J Clin Microbiol 49:1646-1649.

Arbique, J. C., C. Poyart, P. Trieu-Cuot, G. Quesne, G. Carvalho Mda, A. G. Steigerwalt,

R. E. Morey, D. Jackson, R. J. Davidson, and R. R. Facklam. 2004. Accuracy of

phenotypic and genotypic testing for identification of Streptococcus pneumoniae and

description of Streptococcus pseudopneumoniae sp. nov. J Clin Microbiol 42:4686-

4696.

Benmayor, R., D. J. Hodgson, G. G. Perron, and A. Buckling. 2009. Host mixing and

disease emergence. Curr Biol 19:764-767.

Carrascosa, M., J. L. Perez-Castrillon, I. Sampedro, R. Valle, L. Cillero, and M. A.

Mendez. 1994. Lung abscess due to Streptococcus mitis: case report and review. Clin

Infect Dis 19:781-783.

Denapaite, D., R. Bruckner, M. Nuhn, P. Reichmann, B. Henrich, P. Maurer, Y. Schahle,

P. Selbmann, W. Zimmermann, R. Wambutt, and R. Hakenbeck. 2010. The

genome of Streptococcus mitis B6--what is a commensal? PLoS One 5:e9426.

Djurkovic, S., J. M. Loeffler, and V. A. Fischetti. 2005. Synergistic killing of Streptococcus

pneumoniae with the bacteriophage lytic enzyme Cpl-1 and penicillin or gentamicin

depends on the level of penicillin resistance. Antimicrob Agents Chemother 49:1225-

1228.

Doehn, J. M., K. Fischer, K. Reppe, B. Gutbier, T. Tschernig, A. C. Hocke, V. A.

Fischetti, J. Loffler, N. Suttorp, S. Hippenstiel, and M. Witzenrath. 2013. Delivery

of the endolysin Cpl-1 by inhalation rescues mice with fatal pneumococcal pneumonia.

J Antimicrob Chemother 68:2111-2117.

Doern, C. D., and C. A. Burnham. 2010. It's not easy being green: the viridans group

streptococci, with a focus on pediatric clinical manifestations. J Clin Microbiol

48:3829-3835.

Donkor, E. S. 2013. Understanding the pneumococcus: transmission and evolution. Front Cell

Infect Microbiol 3:7.

Duplessis, M., and S. Moineau. 2001. Identification of a genetic determinant responsible for

host specificity in Streptococcus thermophilus bacteriophages. Mol Microbiol 41:325-

336.

Gindreau, E., R. Lopez, and P. Garcia. 2000. MM1, a temperate bacteriophage of the type

23F Spanish/USA multiresistant epidemic clone of Streptococcus pneumoniae:

structural analysis of the site-specific integration system. J Virol 74:7803-7813.

Gutierrez, A., L. Laureti, S. Crussard, H. Abida, A. Rodriguez-Rojas, J. Blazquez, Z.

Baharoglu, D. Mazel, F. Darfeuille, J. Vogel, and I. Matic. 2013. Beta-Lactam

antibiotics promote bacterial mutagenesis via an RpoS-mediated reduction in

replication fidelity. Nat Commun 4:1610.

Hall, J. P., E. Harrison, and M. A. Brockhurst. 2013. Viral host-adaptation: insights from

evolution experiments with phages. Curr Opin Virol 3:572-577.

Henderson-Begg, S. K., D. M. Livermore, and L. M. Hall. 2006. Effect of subinhibitory

concentrations of antibiotics on mutation frequency in Streptococcus pneumoniae. J

Antimicrob Chemother 57:849-854.

62

Ikryannikova, L. N., A. V. Filimonova, M. V. Malakhova, T. Savinova, O. Filimonova, E.

N. Ilina, V. A. Dubovickaya, S. V. Sidorenko, and V. M. Govorun. 2013.

Discrimination between Streptococcus pneumoniae and Streptococcus mitis based on

sorting of their MALDI mass spectra. Clin Microbio Infect 19:1066-1071.

Joyce, E. A., S. J. Popper, and S. Falkow. 2009. Streptococcus pneumoniae nasopharyngeal

colonization induces type I interferons and interferon-induced gene expression. BMC

Genomics 10:404.

Kilian, M., K. Poulsen, T. Blomqvist, L. S. Havarstein, M. Bek-Thomsen, H. Tettelin, and

U. B. Sorensen. 2008. Evolution of Streptococcus pneumoniae and its close

commensal relatives. PLoS One 3:e2683.

Kotsonis, S. E., I. B. Powell, C. J. Pillidge, G. K. Limsowtin, A. J. Hillier, and B. E.

Davidson. 2008. Characterization and genomic analysis of phage asccphi28, a phage of

the family Podoviridae infecting Lactococcus lactis. Appl Environ Microbiol 74:3453-

3460.

Kraemer, L., B. Beszteri, S. Gabler-Schwarz, C. Held, F. Leese, C. Mayer, K. Pohlmann,

and S. Frickenhaus. 2009. STAMP: extensions to the STADEN sequence analysis

package for high throughput interactive microsatellite marker design. BMC

Bioinformatics 10:41.

Krause, R. M. 1957. Studies on bacteriophages of hemolytic streptococci. I. Factors

influencing the interaction of phage and susceptible host cell. J Exp Med 106:365-384.

Loeffler, J. M., S. Djurkovic, and V. A. Fischetti. 2003. Phage lytic enzyme Cpl-1 as a novel

antimicrobial for pneumococcal bacteremia. Infect Immun 71:6199-6204.

Loeffler, J. M., and V. A. Fischetti. 2003. Synergistic lethal effect of a combination of phage

lytic enzymes with different activities on penicillin-sensitive and -resistant

Streptococcus pneumoniae strains. Antimicrob Agents Chemother 47:375-377.

Longas, E., L. Villar, J. M. Lazaro, M. de Vega, and M. Salas. 2008. Phage phi29 and Nf

terminal protein-priming domain specifies the internal template nucleotide to initiate

DNA replication. Proc Natl Acad Sci U S A 105:18290-18295.

Lopez, R., E. Garcia, P. Garcia, C. Ronda, and A. Tomasz. 1982. Choline-containing

bacteriophage receptors in Streptococcus pneumoniae. J Bacteriol 151:1581-1590.

Lopez, R., C. Ronda, A. Tomasz, and A. Portoles. 1977. Properties of "diplophage": a lipid-

containing bacteriophage. J Virol 24:201-210.

Lowe, T. M., and S. R. Eddy. 1997. tRNAscan-SE: a program for improved detection of

transfer RNA genes in genomic sequence. Nucleic Acids Res 25:955-964.

Madhour, A., P. Maurer, and R. Hakenbeck. 2011. Cell surface proteins in S. pneumoniae,

S. mitis and S. oralis. Iran J Microbiol 3:58-67.

Mark, D. F., and C. C. Richardson. 1976. Escherichia coli thioredoxin: a subunit of

bacteriophage T7 DNA polymerase. Proc Natl Acad Sci U S A 73:780-784.

Martin, A. C., L. Blanco, P. Garcia, M. Salas, and J. Mendez. 1996. In vitro protein-primed

initiation of pneumococcal phage Cp-1 DNA replication occurs at the third 3'

nucleotide of the linear template: a stepwise sliding-back mechanism. J Mol Biol

260:369-377.

Martin, A. C., R. Lopez, and P. Garcia. 1998. Pneumococcal bacteriophage Cp-1 encodes its

own protease essential for phage maturation. J Virol 72:3491-3494.

McCullers, J. A., A. Karlstrom, A. R. Iverson, J. M. Loeffler, and V. A. Fischetti. 2007.

Novel strategy to prevent otitis media caused by colonizing Streptococcus pneumoniae.

PLoS Pathog 3:e28.

McDonnell, M., R. Lain, and A. Tomasz. 1975. "Diplophage": a bacteriophage of

Diplococcus pneumoniae. Virology 63:577-582.

63

Mitchell, J. 2011. Streptococcus mitis: walking the line between commensalism and

pathogenesis. Mol Oral Microbiol 26:89-98.

Moineau, S., E. Durmaz, S. Pandian, and T. R. Klaenhammer. 1993. Differentiation of two

abortive mechanisms by using monoclonal antibodies directed toward lactococcal

bacteriophage capsid proteins. Appl Environ Microbiol 59:208-212.

Nelson, D., L. Loomis, and V. A. Fischetti. 2001. Prevention and elimination of upper

respiratory colonization of mice by group A streptococci by using a bacteriophage lytic

enzyme. Proc Natl Acad Sci U S A 98:4107-4112.

Prudhomme, M., L. Attaiech, G. Sanchez, B. Martin, and J. P. Claverys. 2006. Antibiotic

stress induces genetic transformability in the human pathogen Streptococcus

pneumoniae. Science 313:89-92.

Ramirez, M., E. Severina, and A. Tomasz. 1999. A high incidence of prophage carriage

among natural isolates of Streptococcus pneumoniae. J Bacteriol 181:3618-3625.

Raskin, D. M., R. Seshadri, S. U. Pukatzki, and J. J. Mekalanos. 2006. Bacterial genomics

and pathogen evolution. Cell 124:703-714.

Rigvava, S., I. Tchgkonia, D. Jgenti, T. Dvalidze, J. Carpino, and M. Goderdzishvili. 2013.

Comparative analysis of the biological and physical properties of Enterococcus faecalis

bacteriophage vB_EfaS_GEC-EfS_3 and Streptococcus mitis bacteriophage

vB_SmM_GEC-SmitisM_2. Can J Microbiol 59:18-21.

Romero, P., N. J. Croucher, N. L. Hiller, F. Z. Hu, G. D. Ehrlich, S. D. Bentley, E. Garcia,

and T. J. Mitchell. 2009. Comparative genomic analysis of ten Streptococcus

pneumoniae temperate bacteriophages. J Bacteriol 191:4854-4862.

Ronda-Lain, C., R. Lopez, A. Tapia, and A. Tomasz. 1977. Role of the pneumococcal

autolysin (murein hydrolase) in the release of progeny bacteriophage and in the

bacteriophage-induced lysis of the host cells. J Virol 21:366-374.

Ronda, C., J. L. Garcia, and R. Lopez. 1989. Infection of Streptococcus oralis NCTC 11427

by pneumococcal phages. FEMS Microbiol Lett 53:187-192.

Ronda, C., R. Lopez, and E. Garcia. 1981. Isolation and characterization of a new

bacteriophage, Cp-1, infecting Streptococcus pneumoniae. J Virol 40:551-559.

Rousseau, G. M., and S. Moineau. 2009. Evolution of Lactococcus lactis Phages within a

Cheese Factory. App Enviro Microbio 75:5336-5344.

Rukke, H. V., I. K. Hegna, and F. C. Petersen. 2012. Identification of a functional capsule

locus in Streptococcus mitis. Mol Oral Microbiol 27:95-108.

Sabri, M., R. Hauser, M. Ouellette, J. Liu, M. Dehbi, G. Moeck, E. Garcia, B. Titz, P.

Uetz, and S. Moineau. 2011. Genome annotation and intraviral interactome for the

Streptococcus pneumoniae virulent phage Dp-1. J Bacteriol 193:551-562.

Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual.

Cold Spring Harbor, N.Y: CSH Protoc; 3v p.

Samson, J. E., and S. Moineau. 2010. Characterization of Lactococcus lactis phage 949 and

comparison with other lactococcal phages. Appl Environ Microbiol 76:6843-6852.

Serwer, P., S. J. Hayes, J. A. Thomas, and S. C. Hardies. 2007. Propagating the missing

bacteriophages: a large bacteriophage in a new class. Virol J 4:21.

Sheppard, C. L., T. G. Harrison, R. Morris, A. Hogan, and R. C. George. 2004. Autolysin-

targeted LightCycler assay including internal process control for detection of

Streptococcus pneumoniae DNA in clinical samples. J Med Microbiol 53:189-195.

Siboo, I. R., B. A. Bensing, and P. M. Sullam. 2003. Genomic organization and molecular

characterization of SM1, a temperate bacteriophage of Streptococcus mitis. J Bacteriol

185:6968-6975.

64

Staden, R., K. F. Beal, and J. K. Bonfield. 2000. The Staden package, 1998. Methods Mol

Biol 132:115-130.

Sunderkotter, C., and K. Becker. 2014. Systemic therapy with antibiotics: overview of

important antibiotics in dermatology. Hautarzt 65:113-124.

Tiraby, J. G., E. Tiraby, and M. S. Fox. 1975. Pneumococcal bacteriophages. Virology

68:566-569.

Witzenrath, M., B. Schmeck, J. M. Doehn, T. Tschernig, J. Zahlten, J. M. Loeffler, M.

Zemlin, H. Muller, B. Gutbier, H. Schutte, S. Hippenstiel, V. A. Fischetti, N.

Suttorp, and S. Rosseau. 2009. Systemic use of the endolysin Cpl-1 rescues mice with

fatal pneumococcal pneumonia. Crit Care Med 37:642-649.

Zahner, D., A. R. Gandhi, H. Yi, and D. S. Stephens. 2011. Mitis group streptococci express

variable pilus islet 2 pili. PLoS One 6:e25124.

65

Supporting information

Table S2.1 Primers used in this study to confirm variations within the genome of

phage SOCP. Primer pair

name

Primer sequence (5’-3’) PCR size

(bp)

p1

F : CGCTGATTTTAAACAATAATGTGAATATTTTG

R : TTCAAGTTTAATCTCATTTCCTAGGTCTAC

1442

p2

F : CGTACTCAAGTATTTGGCAATCATG

R : GAGATTATGAAAGAATATGATAAATTCATCTTCTCC

725

p3

F : GATTAAGCCAGAATGGATTGACTACA

R : CTCTATATACAGTTTAGAGCGTAAATATTTTG

1054

p4

F : CCTTGAAAAGCCTTACAGGTTTATC

R : GAAAATTCTGCTGAGATAACCAGATATTG

1425

p5 F : CGATTGCAACCTTTTTAAAATCCAGATATAG

R : GGTTTCTTTTAGTCCTGTGATGTTCA

1094

p6 F : CTTTGCTTATCCGTAGATACATGGAG

R : CTATCTGTCCTTGTCCTATCCATTG

1280

p7 F : GACGTTCTCTATATCAATGAAGATGCTAC

R : CCACTGTCCTATCCCAATACCTATC

960

p8 F : GATAGGACAGTGGACGGGAC

R : CTAACTGTCTATCTCCTGTGTTACC

814

p9 F : GCTATGACGTTATAGAACAAAATTATGC

R : GCTTCTGCGTCATTCAAAATAGC

663

p10 F : GTCTCCCTAGCTCAAAAAGAAATCA

R : CGAGATACCTCTTTTTACTGGTAACG

812

p11 F : GCTAGTAGGATTTTCCTACTAGCTG

R : GTTTCCAGACGATAAACTGGAAAC

1167

F, forward; R, reverse.

Table S2.2 Primer sequences of four housekeeping genes. Locus

tag

Gene Primer sequence 5’-3’ Reference

rec A Recombinase F: GCCTTYATCGATGCBGARCA

R: GTTTCCGGRTTDCCRAACAT

(Zbinden, et al., 2011)

rec P Transketolase F: ACCGCGACCGCTTTATTCTTTC

R: ATGCTGACTACGCGGGATTTTTC

(Whatmore, et al., 2000)

hex B DNA mismatch repair F: CCATTGACGCGGGCTCTA

R: CCTGAATACGTCGGAACATCTTT

(Whatmore, et al., 2000)

xpt Xanthine

phosphoribosyltransferase

F: GAAATTATTAGAAGARCGCATC

R: TTAGAGATCTGCCTCCWTARAA

(Whatmore, et al., 2000)

F, forward; R, reverse.

66

Table S2.1 Differences between the genomes of phage SOCP and Cp-1. Phage mutation

Phage Cp-1

Amino acid

variation

SOCP Cp-1 Positiona Putative function

a SOCP CP-1

G C 1870 Terminal protein Ala Arg

C G 1871 Terminal protein

- T 2579 DNA polymerase Leu Phe

A - Between 2701-2102 DNA polymerase Ala His

- G 2747 DNA polymerase Gly Ala

A G 3116 DNA polymerase Thr His

G A 3118 DNA polymerase Gly Asp

T C 5036 Scaffolding protein Leu Pro

- T 5197 Non-coding region

C - Between 5338-5339 Non-coding region

A - Between 5959-5960 Major capsid protein Lys Arg

- C 6003 Major capsid protein Asp Thr

G C 8137 Collar protein Ala Arg

C G 8138 Collar protein

G - Between 10578-10579 Hypothetical protein Ala Leu

A - Between 12206-12207 Tail protein Arg Ser

G - Between 13027-13028 Tail protein Gln His

G - Between 13027-13028 Tail protein Ala

G - Between 13163-13164 Tail protein Gly Arg

A T 13669 Tail protein Glu Val

C G 14955 Encapsidation protein Ala Glu

G - Between 17703-17704 Non-coding region

G - Between 17799-17800 Non-coding region

- C 18220 Non-coding region

- G 18261 Non-coding region

T - Between 18266-18267 Non-coding region

G - Between 18266-18267 Non-coding region

- G 18275 Non-coding region

A T 18747 Non-coding region

A G 18748 Non-coding region

- C 18787 Hypothetical protein Asp Glu a relative to the genome of phage Cp-1.

- absence of the nucleotide.

67

Table S2.2 Codon usage of pneumophages Dp-1 and SOCP for selected amino acids

compared to the hosts S. pneumoniae and S. mitis.

The values represent the frequency of codon usage per thousand.

The phage preferentially used codons for each amino acid are displayed in bold.

Phage Bacteria

Amino acid Codon

Dp-1

SOCP S. pneumoniae S. mitis

Ala GCG 8.4 7.5 8 3.3

GCT 28.5 21.4 30.4 27.4

GCC 8.4 11.4 15.8 7.7

Arg AGG 5.0 3.0 2.0 3.3

AGA 10.6 11.4 7.0 10.9

CGG 1.8 3.8 1.9 0.0

Asn AAC 20.8 38.3 14.1 20.8

Asp GAC 36.8 36.6 17.8 28.4

Cys TGC 3.4 3.2 1.7 0.0

Gln CAA 30.1 24.2 26.7 15.3

Glu GAA 58.3 49.5 51.1 47.0

Gly GGC 10.8 11.7 9.1 23.0

GGG 28.0 13.9 8.5 8.8

Ile ATC 17.7 24.7 25.1 15.3

ATT 41.7 30.9 39.5 33.9

Leu TTA 12.8 21.1 20 32.8

CTG 11.6 8.1 9 3.3

CTC 8.1 4.7 12.4 0.0

Lys AAA 44.0 50.1 43.2 47.0

AAG 28.4 28.1 24.5 30.6

Phe TTC 22.0 14.4 13.7 17.5

Pro CCC 1.6 3.5 2.9 1.1

Ser AGC 9.7 17.4 8.2 5.5

TCA 17.1 17.4 15.9 17.5

TCC 4.2 3.3 5.1 4.4

TCG 6.9 1.3 3.8 1.1

Thr ACA 14.8 22.7 18.5 23.0

ACC 8.4 10.4 12 4.4

Val GTA 15.4 18.5 14.4 23.0

GTC 14.2 8.0 15.1 8.8

GTG 8.1 10.4 12.2 8.8

GTT 27.4 18.0 27.4 25.2

Tyr TAC 24.3 18.2 13.2 25.2

End TAA 2.0 4.2 2.1 3.3

TAG 1.2 0.8 0.8 0.0

68

Chapitre 3. Identification of host factors involved in the interaction of

Streptococcus pneumoniae with its virulent phages

Résumé

Streptococcus pneumoniae est une bactérie pathogène, responsable d'un large éventail de

maladie. L'apparition de souches de pneumocoques résistantes et multirésistantes aux

antibiotiques souligne l’importance de trouver de nouvelles alternatives thérapeutiques. La

phagothérapie est une alternative prometteuse. Lors de l'infection d'une cellule bactérienne

par un phage, de nombreuses interactions se produisent entre les protéines bactériennes et

phagiques. Cependant, notre compréhension de ces interactions phage-hôte et les facteurs

hôtes impliqués dans ce processus est limitée. Nous avons étudié les interactions entre S.

pneumoniae et deux pneumophages virulents SOCP (famille Podoviridae) et Dp-1

(Siphoviridae) en nous basant sur les données récentes d’interactome réalisés in vitro par la

technique du double hybride. Plus précisément, nous avons étudié l'implication de 36 gènes

identifiés de S. pneumoniae dans la réplication des phages. L’importance de chaque gène de

l’hôte dans le processus d’infection phagique a été évaluée en inactivant les gènes dans la

souche S. pneumoniae R6 puis en testant l’effet de cette inactivation sur la multiplication

des phages Dp-1 et SOCP, individuellement et les deux ensembles. Des essais d'infection

par des phages ont révélé qu'au moins six gènes pneumococciques sont absolument

nécessaires pour la réplication du phage Dp-1 et un gène dans le cas du SOCP. Des essais

de complémentation ont restauré le phénotype de sensibilité aux phages. De plus, nous

avons identifié d'autres gènes hôtes qui réduisaient l'efficacité de la réplication des phages.

Par ailleurs, nous avons aussi identifié huit nouveaux gènes de S. pneumoniae qui semblent

être essentiels pour la croissance du pneumocoque et, ces gènes peuvent représenter de

nouvelles cibles médicamenteuses. Cette étude donne un aperçu du réseau complexe

impliqué dans les interactions phage-hôte.

69

Avant-propos

Contributions des auteurs

J’ai réalisé toutes les expériences, analysé les résultats et rédigé l’article au complet. Le

professeur Sylvain Moineau a supervisé le projet et co-rédigé le manuscrit.

Publication

S. Ouennane and S. Moineau. Identification of host factors involved in the interaction of

Streptococcus pneumoniae with its virulent phages. In preparation for submission.

Abstract

Streptococcus pneumoniae is a human respiratory pathogen responsible for a wide range of

diseases. The emergence of antibiotic-resistant pneumococcal strains highlights the need

for alternative therapeutic options. One such option is phage therapy. During phage

infection of a bacterial cell, many interactions occur between bacterial and phage proteins;

however, our understanding of these phage-host interactions and the host factors involved

in this process is limited. We investigated the interactions between S. pneumoniae and two

pneumococcal virulent phages, SOCP (Podoviridae family) and Dp-1 (Siphoviridae) by

exploiting the recently published in vitro interactome obtained using the yeast two-hybrid

system. Specifically, we characterized 36 pneumococcal genes identified as potential host

factors involved in phage replication by inactivating each of them and testing for resistance

to phages SOCP and Dp-1, individually and in combination. Phage infection assays

revealed that at least six pneumococcal genes are necessary for phage Dp-1 replication and

one gene for phage SOCP. Complementation assays restored the phage-sensitivity

phenotype. We also identified other host genes that reduced the efficiency of phage

replication. Finally, we identified eight new S. pneumoniae genes that appear to be essential

for pneumococcal growth and, as such, they may represent new drug targets. This study

offers a glimpse of the complex network involved in phage-host interactions.

70

Keywords: Streptococcus pneumoniae, virulent phage, phage therapy, host-phage interactions,

phage cocktail.

Introduction

Streptococcus pneumoniae (pneumococcus) is the leading cause of community-acquired

pneumonia (CAP) worldwide, estimated to cause one million infections each year, in

particular among children and the elderly (O'Brien, et al., 2009, Donkor, 2013). Humans

are the only recognized natural hosts of S. pneumoniae (Lu, et al., 2008). The

pneumococcus can also adhere to the nasopharyngeal epithelium and colonize the mucosal

surface of the upper respiratory tract of healthy individuals. Beside asymptomatic carriage,

S. pneumoniae is responsible for serious infections, invasive and non-invasive diseases,

including bacteremia, meningitis, pneumonia, otitis media and sinusitis (Valentino, et al.,

2014). The mechanisms involved in pneumococcal translocation from the nasopharynx to

the lung or blood remain poorly understood (Marks, et al., 2013). Despite advances in

antibiotic therapy and the availability of vaccinations, these pneumococcal diseases are still

serious issues. Over 90 pneumococcal capsule serotypes have been identified (Park, et al.,

2007, Calix & Nahm, 2010, Nahm, et al., 2011) and this diversity impedes the development

of a universal vaccine. In addition, widespread antibiotic resistance among strains of S.

pneumoniae has become a challenge (Domingues, et al., 2012). Taken together, S.

pneumoniae infections have become a serious global public health concern and alternative

treatment strategies are needed.

Bacteriophage therapy or phage by-products may represent alternative approaches against

bacterial infectious agents. Phages and bacteria are the most abundant biological entities on

the planet and are in a constant arms race (Hendrix, 2002, Hendrix, 2003, Morris, et al.,

2008). For several decades, phages have been used to control specific bacterial infections in

Eastern Europe, the former Soviet Union and Georgia (Sulakvelidze, et al., 2001, Abedon,

et al., 2011). While phages are potentially attractive therapeutic agents, many questions

remain to ensure efficient application. Our understanding of phage-host interactions is still

71

scant for many bacteria, including the intracellular factors needed for efficient phage

replication. It is also unclear how to limit the development of phage resistance (Vieira, et

al., 2012). Therefore, the application of phages as therapeutic or biocontrol agents requires

more knowledge of the complex interactions between bacteria and phages.

After phage infection, a virulent phage typically hijacks the bacterial host machinery

through various interactions involving the participation of host factors to ensure phage

replication. However, knowledge of these bacterial factors involved during phage infection

has been lacking for most phage-host systems, including in S. pneumoniae.

Recently, a genomic approach was used to study the interactions between S. pneumoniae

and two virulent phages (Leprohon, et al., 2015). Specifically, natural S. pneumoniae

mutants were selected for resistance to the virulent phages SOCP or Dp-1. Mutations in a

GntR-type regulator, in a glycerophosphoryl phosphodiesterase and in a Mur ligase were

responsible for resistance to phage SOCP. Resistance to Dp-1 resulted from mutations in a

gene coding for a type IV restriction endonuclease (Leprohon, et al., 2015). In another

study, a yeast-two hybrid approach was used to screen a collection of 1,704 prey clones

derived from S. pneumoniae host with all 28 genes of phage Cp-1 (a derivative of SOCP

phage) as well as the 72 genes of phage Dp-1 (Mariano, et al., 2016). The Cp-1 screens

found 11 interactions between 7 phage and 10 host proteins, while the Dp-1 screens

identified 38 interactions between 19 Dp-1 and 24 proteins of S. pneumoniae. The

biological significance of these in vitro interactions remains unknown. Overall, the Y2H

analysis revealed 49 unique host-phage interactions with 36 S. pneumoniae genes/proteins

with the two pneumococcal phages.

To further our understanding of the S. pneumoniae host factors required to replicate the

virulent pneumophages SOCP and Dp-1, we used the host genes detected in the Y2H

screen (Mariano, et al., 2016). First, we investigated the importance of these genes for

bacterial growth and identified new potential essential genes that may become novel drug

targets. Then, we independently inactivated each non-essential gene in S. pneumoniae R6

and tested for resistance to each phage or to a cocktail of both phages. We also investigated

72

the effects of complementation of these S. pneumoniae genes on phage replication. Finally,

we carried out additional bioinformatics analyses to build a network of host factors that

participate in or are affected by the phage infection process.

Results

S. pneumoniae genes of interest

First, we investigated whether the yeast two-hybrid in vitro data (Mariano, et al., 2016)

could be confirmed in an in vivo model of S. pneumoniae. Figure 3.1 and Table 3.1

summarize the 36 pneumococcal genes previously identified in these in vitro interactions.

Phages SOCP (Podoviridae) and Dp-1 (Siphoviridae) shared interactions with only two

host proteins, the Holliday junction DNA helicase RuvB (Sp_0259) and a DeoR family

transcriptional regulator (Sp_2168). The 36 deduced proteins of S. pneumoniae were

classified using COG (Clusters of Orthologous Groups of proteins) functional categories

(http://www.ncbi.nlm.nih.gov/COG/) and the Comprehensive Microbial Resource (CMR)

(http://cmr.jcvi.org/cgi bin/CMR/CmrHomePage.cgi,) (Fig 3.1C). Table 3.1 showed that

phage proteins appear to interact with a wide variety of bacterial processes involved in

metabolism, signalling, information storage, and processing. Also, some pneumococcal

genes encoded hypothetical proteins for which no putative function could be inferred

(Table 3.1). Based on previous studies (Lee, et al., 1999, Thanassi, et al., 2002, Song, et al.,

2005, van Opijnen, et al., 2009), 13 out of these 36 pneumococcal genes appeared to be

essential for the growth of S. pneumoniae (Table 3.1).

73

Figure 3. 1 Schematic representation of the genes involved in host-phage interaction

based on the results of the yeast two-hybrid screens of Mariano et al. (A) and (B) genome

organization of phages Dp-1 and SOCP. The open reading frames and directions of

transcription of the phages genes involved in host interactions are indicated in color. (C)

Classification, based on function, of the pneumococcal genes/proteins reported to interact

with pneumophages using COG (Clusters of Orthologous Groups of proteins) functional

categories and the Comprehensive Microbial Resource (CMR).

Gene knockout and identification of potential essential genes

To evaluate the effect of these genes on bacterial growth and cell behavior, and to identify

host factors involved in phage interactions in vivo, we tried to inactivate each of the 36

pneumococcal genes using insertional mutagenesis. For each gene, we cloned an internal

gene fragment into the plasmid pFF3, which does not replicate in S. pneumoniae. The

constructs were then transformed into S. pneumoniae strain R6 gene to inactivate the genes

by homologous recombination (Mortier-Barriere, et al., 1997). We used the strain R6,

which is an unencapsulated avirulent strain, because it is sensitive to both phages. Of note,

these pneumococcal genes have similar or identical orthologues in S. pneumoniae TIGR4, a

capsulated and pathogenic strain.

74

The gene knockout assay also allowed to evaluate which genes were essential for S.

pneumoniae growth. Mutated strains in which gene inactivation still permitted colony

formation in the presence of chloramphenicol indicated that the gene was non-essential.

When gene disruption inhibited cell growth and did not allow colony formation, we

considered it a potential essential gene for the growth of S. pneumoniae, as described

elsewhere (Thanassi, et al., 2002). When we did not obtain colonies, we repeated the gene

disruption assay two more times. For each experiment, we also included two controls, one

to inactivate the non-essential gene LytA (major autolysin), which led to colonies, and

another to inactivate the essential gene FtsZ (cell division protein), which led to no

colonies.

The constructs were designed so that flanking genes and intergenic regions, including

potential promoters, would remain intact to minimize possible polar effects. Southern blots

were used to confirm the gene knockouts (data not shown). Table 3.2 shows the results for

all disrupted genes. Of 36 disrupted genes, 17 were likely to be essential genes for growth

of S. pneumoniae. Of these 17 genes, nine had already been reported to be essential for S.

pneumoniae (Lee, et al., 1999, Thanassi, et al., 2002, Song, et al., 2005, van Opijnen, et al.,

2009).

75

Table 3.1 A summary and general function of S. pneumoniae genes and the lytic phages used in this study, based on Y2H

screens by Mariano et al. Gene symbol Gene description

R6 TIGR4

*Gene known as potential essential gene (Lee, et al., 1999, Thanassi, et al., 2002, Song, et al., 2005, van Opijnen, et al., 2009).

(a) 36 S. pneumoniae genes represented in four functional categories.

Poorl

y

chara

cter

ized

spr0177 Sp_0194 Hypothetical protein

spr0761 Sp_0859 Uncharacterized membrane protein

spr0966 Sp_1088 Hypothetical protein*

spr1041 Sp_1153 Hypothetical protein

spr1094 Sp_1213 Hypothetical protein

spr1356 Sp_1504 Hypothetical protein

spr1391 Sp_1536 Hypothetical protein

spr1576 Sp_1731 Uncharacterized membrane protein

spr1934 Sp_2125 Hypothetical protein

Met

ab

oli

sm

spr0402 Sp_0446 Acetolactate synthase, small subunit

spr0602 Sp_0687 ABC transporter, ATP-binding protein

spr0882 Sp_0979 Oligopeptidase F *

spr1090 Sp_1208 Uridine kinase

spr1596 Sp_1751 Magnesium transporter

spr1825 Sp_2012 Glyceraldehyde 3-phosphate dehydrogenase *

spr1836 Sp_2024 PTS cellobiose system transporter subunit IIA

spr1847 Sp_2036 PTS ascorbate system transporter subunit IIA

spr1963 Sp_2157 Lactaldehyde reductase *

spr1974 Sp_2168 DeoR family transcriptional regulator

Info

rmati

on

sto

rag

e a

nd

pro

cess

ing

spr0238 Sp_0259 Holliday junction DNA helicase RuvB *

spr1211 Sp_1354 50S ribosomal protein L7/L12 *

spr1395 Sp_1540 Single-stranded DNA binding protein *

spr1433 Sp_1575 DNA replication protein DnaD*

spr1439 Sp_1584 Transcriptional repressor CodY *

spr1513 Sp_1669 MutT/nudix family protein

spr1516 Sp_1672 Recombination protein RecR *

spr1557 Sp_1713 Transcriptional regulator NrdR *

spr1569 Sp_1725 LacI family transcriptional regulator

spr1731 Sp_1915 DNA-binding protein

spr1794 Sp_1980 3'-5' exoribonuclease

Cel

lula

r

pro

cess

es

a

nd

sign

ali

ng

spr0951 Sp_1050 Antitoxin PezA

spr1252 Sp_1395 PhoU family transcriptional regulator

spr1357 Sp_1505 Autoinducer-2 Exporter Family

spr1459 Sp_1606 Glycosyl transferase, family 2

spr1591 Sp_1746 HD domain-containing protein

spr1696 Sp_1881 Glutamate racemase *

a. b. Phage SOCP

ORF Putative function Host protein interaction

Ph

ag

e S

OC

p-1

orf6 Hypothetical protein Sp_1713

orf10 Connector protein Sp_1354 Sp_1881

orf16 Hypothetical protein Sp_0259

orf17 Tail protein Sp_0979

orf21 Holin protein Sp_1208

orfb Hypothetical protein Sp_0859 Sp_1213 Sp_1980 Sp_2168

orfc Hypothetical protein Sp_0979

c. Phage Dp-1 ORF Putative function Host protein interaction

P

hag

e D

p-1

orf4 Queuosine biosynthesis protein QueE Sp_2036

orf9 Hypothetical protein Sp_0259 Sp_1395 Sp_1504 Sp_2168

orf12 RecU Holliday junction-specific endonuclease Sp_2168

orf14 dUTPase Sp_2125

orf16 NAD-dependent DNA ligase Sp_0259

orf18 DNA polymerase III gamma/tau subunit Sp_1584

orf29 Hypothetical protein Sp_2012

orf31 Hypothetical protein Sp_0259 Sp_1153

Sp_2168 orf32 Hypothetical protein Sp_0194 Sp_0259

Sp_1540 Sp_1669 Sp_1915

orf33 Hypothetical protein Sp_1088

orf34 Hypothetical protein Sp_0446 Sp_2157

orf39 Zinc finger domain protein, putative Sp_0259

orf44 Rho-like domain lipoprotein, putative Sp_0446 Sp_1050

Sp_1536 Sp_1575

Sp_1725 Sp_2157 orf47 Hypothetical protein Sp_0687

orf48 Hypothetical protein Sp_1746 Sp_2168

orf51 Hypothetical protein Sp_1672

orf58 Holin Sp_1505 Sp_1606 Sp_1731 Sp_1751

orf60 S-layer protein membrane peptidase Sp_2024

orf72 Signal peptide membrane protein Sp_1606

76

Table 3.2 Effect of gene inactivation and host-phage interactions of S. pneumoniae

Gene Gene / Protein Function Essential gene LocateP c

R6 TIGR4 Literature a In vivo

b Subcellular Location

spr0238

Sp_0259

holliday junction DNA helicase RuvB Yes No growth Intracellular Cytoplasmic

spr0996

Sp_1088

hypothetical protein Yes No growth Intracellular Cytoplasmic

spr1211

Sp_1354

ribosomal protein L7/L12 Yes No growth Intracellular Cytoplasmic

spr1395

Sp_1540

single-stranded DNA binding protein Yes No growth Intracellular Cytoplasmic

spr1433

Sp_1575

DNA replication protein DnaD Yes No growth Intracellular Cytoplasmic

spr1439

Sp_1584

transcriptional repressor CodY Yes No growth Intracellular Cytoplasmic

spr1516

Sp_1672

recombination protein RecR Yes No growth Intracellular Cytoplasmic

spr1557

Sp_1713

transcriptional regulator, NrdR family Yes No growth Intracellular Cytoplasmic

spr1696

Sp_1881

glutamate racemase Yes No growth Intracellular Cytoplasmic

spr0602

Sp_0687

ABC transporter, ATP-binding protein No growth Intracellular Cytoplasmic

spr0951

Sp_1050

antitoxin PezA No growth Intracellular Cytoplasmic

spr1041

Sp_1153

hypothetical protein No growth Intracellular Cytoplasmic

spr1513

Sp_1669

MutT/nudix family protein No growth Intracellular Cytoplasmic

spr1596

Sp_1751

magnesium transporter No growth Multi-transmembrane Membrane

spr1794

Sp_1980

3'-5' exoribonuclease No growth Intracellular Cytoplasmic

spr1934

Sp_2125

hypothetical protein No growth Intracellular Cytoplasmic

spr1974

Sp_2168

DeoR family transcriptional regulator No growth Intracellular Cytoplasmic

spr0177

Sp_0194

hypothetical protein Intracellular Cytoplasmic

spr0402

Sp_0446

acetolactate synthase, small subunit Multi-transmembrane Membrane

77

spr0761

Sp_0859

uncharacterized membrane protein Multi-transmembrane Membrane

spr0882

Sp_0979

oligopeptidase F Yes Intracellular Cytoplasmic

spr1090

Sp_1208

uridine kinase Intracellular Cytoplasmic

spr1094

Sp_1213

hypothetical protein Intracellular Cytoplasmic

spr1252

Sp_1395

PhoU family transcriptional regulator Intracellular Cytoplasmic

spr1356

Sp_1504

hypothetical protein Intracellular Cytoplasmic

spr1357

Sp_1505

autoinducer-2 Exporter Family Multi-transmembrane Membrane

spr1391

Sp_1536

hypothetical protein Small colonies Intracellular Cytoplasmic

spr1459

Sp_1606

lycosyl transferase, family 2 Multi-transmembrane Membrane

spr1569

Sp_1725

LacI family transcriptional regulator Intracellular Cytoplasmic

spr1576

Sp_1731

uncharacterized probable membrane protein Multi-transmembrane Membrane

spr1591

Sp_1746

HD domain-containing protein Intracellular Cytoplasmic

spr1731

Sp_1915

DNA-binding protein Intracellular Cytoplasmic

spr1825

Sp_2012

glyceraldehyde 3-phosphate dehydrogenase Yes Intracellular Cytoplasmic

spr1836

Sp_2024

PTS cellobiose system transporter subunit IIA Intracellular Cytoplasmic

spr1847

Sp_2036

PTS ascorbate system transporter subunit IIA Intracellular Cytoplasmic

spr1963

Sp_2157

Lactaldehyde reductase Yes Small colonies Intracellular Cytoplasmic a. Identification of the essential host proteins was previously determined (Lee, et al., 1999, Thanassi, et al., 2002, Song, et al., 2005, van Opijnen, et al., 2009).

b. Gene knockout by homologous recombination.

c. LocateP (http://www.cmbi.ru.nl/locatep-db/cgi-bin/locatepdb.py).

78

Surprisingly, we found three genes previously reported to be essential for S. pneumoniae to

be non-essential here: Sp_0979 (oligopeptidase F), Sp_2012 (glyceraldehyde 3-phosphate

dehydrogenase) and Sp_2157 (lactaldehyde reductase) (Figure 3.2). We also identified

eight new potential essential genes related to metabolism (Sp_0687, Sp_1751, and

Sp_2168), information storage and processing (Sp_1669 and Sp_1980), cellular processes

and signaling (Sp_1050) and two poorly characterized genes (Sp_1153 and Sp_2125).

Gene disruption gave rise to several phenotypes including altered behavior and growth. We

followed the growth kinetics of each knockout strain, as well as the wild type strain (S.

pneumoniae R6), by measuring the optical density of the cultures every 30 minutes for a

24-hour period (data not shown). The growth of the strains deficient in gene Sp_0859

(uncharacterized membrane protein) or Sp_1208 (uridine kinase) was slow compared to the

wild-type strain. Bacterial growth was faster when genes Sp_1725 (LacI family

transcriptional regulator), Sp_1915 (DNA-binding protein) and Sp_1731 (uncharacterized

membrane protein) were inactivated. The growth of Sp_1213 (hypothetical protein) was

also faster than wild type but slower than the three above mutants. On blood agar plates,

colonies with larger alpha-hemolytic zones (green zones) appeared after overnight culture,

of strains deficient in gene Sp_0859 (uncharacterized membrane protein) or Sp_1213

(hypothetical protein). Inactivation Sp_1536 (hypothetical protein) and Sp_2157

(lactaldehyde reductase) in S. pneumoniae R6 led to a smaller colony size phenotype (Table

3.2).

Protein interaction networks in S. pneumoniae

Preserving the integrity of cellular processes is crucial for bacterial survival and most are

mediated by protein-protein interactions. However, little is known about protein interaction

networks inside bacteria. We generated a network of protein-protein interactions in S.

pneumoniae TIGR4 using the above 36 host proteins and the STRING (Search Tool for the

Retrieval of Interacting Genes/Proteins) database (http://string-db.org/). The STRING

database includes known or predicted protein interactions in an organism that integrate all

types of interactions to map useful networks of interactions (Szklarczyk, et al., 2015). A

screen of the identified proteins of interest yielded 357 putative interactions (Table S3.1).

79

Among others, we determined that 127 of these potential interactions involved an essential

gene, representing 36% of the interaction networks indicating that the inactivation of some

genes may have a profound effect on the host protein network, which may explain some of

the above in vivo data.

Subcellular localization and conserved domains

The study of phage proteins with host factors requires an understanding of host protein

functions. However, several S. pneumoniae proteins have no known function. This

represents an important challenge in this study. As a first step to puzzle out their functions,

we investigated the theoretical proteins’ subcellular locations. We used the LocateP

database (http://www.cmbi.ru.nl/locatep-db) to predict subcellular locations of the proteins

(Zhou, et al., 2008). This database combines numerous bioinformatics tools by mimicking

the cellular processes of protein synthesis and protein secretion to allow accurate prediction

of protein subcellular localization (Zhou, et al., 2008). Using LocateP, we determined that

most proteins of interest in this study are intracellular, seven out of nine hypothetical

proteins are intracellular and two are multi-transmembrane proteins (Table 3.2). Of note,

most bacterial proteins are generally intracellular and perform various functions (Zhou, et

al., 2008, Amblee & Jeffery, 2015). The majority of intracellular proteins are involved in

central pathways of metabolism and some could significantly impact bacterial survival

(Amblee & Jeffery, 2015). We identified three hypothetical proteins (Sp_1088, Sp_1153

and Sp_2125) that may be essential proteins for bacterial growth as well as being

intracellular proteins involved in important pneumococcal functions.

Using these bioinformatic results, we found that the functions previously predicted for

some proteins of S. pneumoniae R6 and TIGR4 may not be clear-cut. For example, gene

Sp_1088 was described to code for a DNA repair protein RadC (accession number

AE005672.3) but was replaced by a hypothetical protein for S. pneumoniae TIGR4

(NC_003028.3). Similarly, RadC of S. pneumoniae R6 was replaced by another

hypothetical protein (NC_003098.1). We then investigated these hypothetical proteins by

searching for conserved domains. Hypothetical protein Sp_1504 contains a tetratricopeptide

(TPR) repeat domain suggesting protein-protein interaction with possible assembly of

80

multiprotein complexes. This protein could be involved in essential processes such as in

type IV pilus biogenesis involved in virulence-associated functions (Cerveny, et al., 2013).

Likewise, Sp_1536 has a conserved domain similar to S-adenosyl-methionine-dependent

methyltransferases, suggesting that Sp_1536 may act as a cofactor catalysing the transfer of

methyl groups. Gene Sp_2125 has a conserved domain predicted to function as a potential

protein involved in the synthesis of metal-sulfur clusters, suggesting that this gene could

play a role in biometal metabolism.

Effect of gene knockout on pneumophage infections

We assessed the effect of gene inactivation on the replication of the virulent pneumophages

SOCP and Dp-1, both independently and in combination. Specifically, we compared the

phage infection of wild-type S. pneumoniae strain with the 19 knockout strains deficient in

one of the identified host genes, which allows bacterial survival. Using the double-layer

agar plate method, we measured the ratio of plaque-forming units per milliliter (PFU/ml)

from reference strain S. pneumoniae R6 and compared this to the other strains tested to

determine the efficiency of plating (EOP). The results of testing 19 strains against two

phages and phage cocktail are summarized in Figure 3.2. Overall, the EOP values varied

considerably according to the gene disrupted and the phage tested. An EOP value of 1

means the phage grew well and lysed the test strains with same efficiency as its host,

whereas a reduced EOP indicate that tested strain was partially insensitive or resistant to the

phage, and totally resistant when the EOP value was equal to 10-8

.

Of significant interest, six disrupted genes significantly impacted phage Dp-1 replication

(Figure 3.2). Phage replication was completely inhibited (EOP <10-8

) in S. pneumoniae

strains with these disrupted genes. Two of the genes (Sp_0194, Sp_1536) code for

hypothetical proteins, three deduced proteins are involved in cellular processes and

signalling (Sp_1505 autoinducer-2 exporter family; Sp_1606 glycosyl transferase family

protein, and Sp_1746 HD domain-containing protein) and one (Sp_1915) is involved a

DNA-binding protein in transcription and signal transduction. On the other hand, only one

gene, Sp_1505 (autoinducer-2 exporter family), also completely inhibited (EOP <10-8

)

81

phage SOCP replication, similar to phage Dp-1. Disrupting the glycosyl transferase family

protein (Sp_1606) did produce also a significant reduction in the efficiency of phage SOCP

(EOP of 10-5

).

Disrupting the gene Sp_1725 (LacI family transcriptional regulator) also negatively

affected the replication of both phages, reducing the EOP of Dp-1 by 5 log and the EOP of

SOCP by 3 log, while inactivation of Sp_1915 DNA-binding partially reduced the

efficiency of phage SOCP by 3 log (Figure 3.2). Remarkably, disruption of gene Sp_0979

coding for an oligopeptidase F increased the efficiency of phage SOCP by one log

compared to the reference strain (Figure 3.2).

However, some genes seem to be unimportant for phage replication. Phage SOCP

efficiency was not affected on strains S. pneumoniae R6Sp_0859

, S. pneumoniae R6Sp_1731

and S. pneumoniae R6Sp_2012

compared to the WT strain. The Sp_0859 and Sp_1731

proteins are hypothetical proteins while Sp_2012 codes for a glyceraldehyde 3-phosphate

dehydrogenase involved in carbohydrate metabolism. Similarly, phage Dp-1 propagated

normally on S. pneumoniae R6Sp_1213

(hypothetical protein) and S. pneumoniae R6Sp_2157

(lactaldehyde reductase). Moreover, when the other phage was tested on these strains, there

was only a 1 or 2 log reduction, indicating that these host genes are not critical for

replication of both phages.

Since virulent phages Dp-1 and SOCP belong to two different families, we investigated the

effects of a phage cocktail on the inactivated strains. Notably, the phage cocktail produced

similar results to the reference strain when propagated on seven tested strains, while the

EOP dropped by one or two logs in most cases (Figure 3.2), indicating a synergistic effect

of the phage cocktail compared to each monophage. This could also be related to the ability

of one or both phages to increase the infection properties of one phage. In contrast, the

EOPs were reduced by 5 and 3 logs when the phage cocktail was propagated on S.

pneumoniae R6Sp_1915

and S. pneumoniae R6Sp_1606

, respectively. Similar to both

monophages, S. pneumoniae R6Sp_1505

was completely resistant to the phage cocktail. The

phage cocktail was less efficient than each monophage when propogated on S.

82

pneumoniaeSp_1395

. The drop in EOP when using phage cocktail could be due to

interference between phages in the absence of this host factor. In general, phage SOCP

seems to be more dominant in this phage cocktail.

Figure 3. 2 Efficiency of plating of two pneumococcal virulent phages on various

knockouts in S. pneumoniae. All pneumococcal bacterial genes are grouped based on their

biological function. The efficiency of plating (EOP) on plates was obtained by dividing the

titer of the phage grown on the inactivated strain by the phage titer obtained using the wild

type strain S. pneumoniae R6. A star symbol (*) indicates an EOP value of 1, meaning that

the phage lysed the tested strains with the same efficiency as the reference strain. EOP

values varied considerably according to gene disruption. In total, 19 strains were tested

against two phages and one phage cocktail.

Effect of gene complementation on pneumophage infections

To confirm the effect of gene knockouts on pneumophage behaviors, we added the wild-

type genes into the inactivated strains using the maltose-inducible vector pLS1RGFP. This

vector also allowed us to regulate gene expression from the PM promoter by adding maltose

to the growth medium to release MalR repression of the PM promoter (Nieto, et al., 2000).

Plasmid pLS1RGFP was also sequenced (Figure S3.1) to design specific primers to confirm

the clones and transformants.

83

To show that the vector itself did not affect phage infection, we introduced the pLS1RGFP

vector without insert into various strains and incubated them with or without maltose

(Figure S3.2). Growing the strains harboring pLS1RGFP (expression vector) in presence of

0.5% maltose had no effect on phage replication. However growing the strains with

pLS1RGFP in presence of 5% maltose (over-expression) slightly increased the

effectiveness of phage SOCP by one log on six strains (Figure S3.2). S. pneumoniae has

many carbohydrate transporters and phosphotransferase systems (PTS) for several sugar-

specific uptakes which allow the organism to metabolize different sugars as carbon sources.

Growth of this bacterium in the presence of maltose was reported to be involved in

upregulation of the maltose gene cluster as well as some operons and genes (Afzal, et al.,

2015). The slight increase in SOCP phage efficiency could be due to upregulation of some

host factors.

To further confirm the role of the inactivated host genes in phage infection, we cloned of

the 19 genes into pLS1RGFP and introduced them into the respective inactivated strain.

(Figure 3.3). Our results showed that in most induced strains the phage sensitivity

phenotype was restored. For some strains, the EOP remained lower as compared to the

wild-type strain when induced with 0.5% maltose (Figure 3.3A). Over-expressing the genes

with 5% maltose restored normal phage infection in most of these strains (Figure 3.3B).

Surprisingly, overexpression in S. pneumoniaeSp_0979

and S. pneumoniaeSp_1213

led to a

reduced EOP mainly for SOCP, while making S. pneumoniaeSp_1606

slightly more phage-

sensitive than S. pneumoniae R6 (Figure 3.3B).

84

Figure 3. 3 Efficiency of plating of two pneumococcal virulent phages on S.

pneumoniae strains complemented with wild-type genes. Efficiency of plating of two

pneumococcal virulent phages on S. pneumoniae strains complemented with wild-type

genes. Gene complementation was performed using the maltose-inducible vector

pLS1RGFP. A. Induction using 0.5% maltose. B. Induction using 5% maltose. The

efficiency of plaquing (EOP) on plates was obtained by dividing the titer of the phage

grown on the inactivated strain by the phage titer obtained using the wild type strain S.

pneumoniae R6. A star symbol (*) indicates an EOP value of 1, meaning that the phage

lysed the tested strains with the same efficiency as the reference strain. EOP values varied

considerably according to gene disruption. In total, 19 strains were tested against two

phages and one phage cocktail.

85

Host factors with a significant impact on phage replication

Sp_1505, autoinducer-2 (AI-2), seems to perform a key role in pneumophage replication

since its disruption completely inhibited the replication of both SOCP and Dp-1 virulent

phages. Autoinducer-2 is synthesized and controlled by LuxS, then exported through

membrane-spanning transporters. It is reported to act as a universal signalling molecule in

quorum sensing for bacterial interspecies communication (Vidal, et al., 2013). The

transcription of quorum-controlled genes by AI-2 is involved in biofilm formation and

virulence factor production, while different receptors were found to be under control of AI-

2 intracellular/extracellular concentration to switch on and off (Taga, et al., 2001, Sztajer,

et al., 2008, Guo, et al., 2013). Autoinducer-2 was also reported to regulate membrane

transport proteins based on increasing external concentration during bacterial growth,

leading to the induction of ABC transporters to import AI-2 into the cytoplasm (Taga, et

al., 2001, Guo, et al., 2013). It is possible that AI-2 regulates the expression of other host

genes important during phage replication and its absence provides a mechanism of defence

against phages. AI-2 could also act somehow at the membrane level during, for example,

phage DNA injection (Molineux & Panja, 2013) or the release of new virions (Catalao, et

al., 2013, Frias, et al., 2013). To accomplish host lysis at the end of phage replication,

pneumophages depend on a holin-endolysin system. Holins are synthesized and inserted

into the cytoplasmic membrane to form pores that will induce membrane depolarization and

allow access of the endolysin to the cell wall. Some phages use holins to mediate the export

of phage endolysins to the cell envelope while others remain under control until the correct

time, or require the contribution of a host secretion pathway (Sec system), as is the case for

pneumophage (Molineux & Panja, 2013). Reduced AI-2 activity was reported to weaken

the expression of genes associated with the type III secretion system in Vibrio harveyi and

Escherichia coli (Sperandio, et al., 1999, Henke & Bassler, 2004). Thus, inactivation of AI-

2 in S. pneumoniae could modulate negatively the expression of the host Sec system.

Disruption of the glycosyltransferase family 2 (GT) gene in Sp_1606 inhibited infection by

phage Dp-1 and provided partial resistance to phage SOCP. Glycosyltranferases catalyse

transfer of a glycosyl group from a sugar substrate donor to an acceptor, including other

86

sugars, lipids, proteins, nucleic acids, antibiotics, or other small molecules (Lairson, et al.,

2008). Glycosyltransferases have been previously involved in phage resistance, by

inhibiting phage adsorption as a result of serotype conversion encoded by temperate phages

(Markine-Goriaynoff, et al., 2004). Several studies have also shown the importance of GT

in ensuring propagation of some phages which express their own GT to glycosylate their

genome as a protection strategy to avoid digestion by host restriction endonucleases (Wang,

et al., 1993, Markine-Goriaynoff, et al., 2004, Lehane, et al., 2005, Lairson, et al., 2008).

Other phages can also regulate expression of the bacterial GT to glycosylate its genome

(Markine-Goriaynoff, et al., 2004). The results obtained by disrupting the host GT may be

related to its involvement in the glycosylation of wall teichoic acids (WTA) needed for

phage adsorption. Thus, phage infection could induce increased expression of this enzyme

since GT was more efficient when overexpressed, mainly in the case of Dp-1 compared to

the WT strain. It has been shown that some Staphylococcus aureus phages, albeit of the

Podoviridae family, required a specific host GT, TarS, responsible for glycosylation of wall

teichoic acid with β-GlcNAc (Xia, et al., 2010). TarS was found to be overexpressed during

the first stage of infection to promote adsorption (Xia, et al., 2010, Li, et al., 2015).

Glycosyltransferase are also involved in peptidoglycan biosynthesis (Tseng, et al., 2009,

McCann & St Geme, 2014) and consequently could also have an impact on phage DNA

injection or lysis. Considering the importance of GT in several biological processes, they

may participate in different stages of the phage lytic cycle.

The Sp_1746 protein is predicted to be an HD domain-containing protein. Disrupting this

gene significantly affected replication of phage Dp-1. The CD-Search tool assigns this gene

to the superfamily of metal-dependent phosphohydrolases which is part of a diverse,

uncharacterized group of proteins and domains associated with nucleotidyltransferases and

helicases (Yakunin, et al., 2004). The HD protein domain protein catalyzes

phosphomonoesterase or phosphodiesterase reactions using a wide range of substrates, such

as nucleotides and nucleic acids, and functions primarily in nucleic acid metabolism and

signal transduction (Yakunin, et al., 2004). The involvement of this protein in phage

infection remains unclear; however, it could be related to cyclic nucleotides. Indeed, the

HD superfamily is related to both the cyclic adenosine monophosphate (cAMP) and cyclic

87

guanosine monophosphate (cGMP) phosphodiesterases, while five distinct metal-dependent

phosphohydrolases were found to be involved in cAMP phosphodiesterases (Galperin, et

al., 1999, Rao, et al., 2010). Various bacterial cyclic nucleotides, such as cAMP and

cGMP, act as second messengers and are involved in signaling systems and control several

key processes (Seshasayee, et al., 2010). Other researchers speculate that CRP is one of the

key signalling molecules to respond after phage infection as it upregulated over 22 genes in

Thermus thermophilus, including those involved in energy regulation, metabolism and even

two Cas operons (Agari, et al., 2010).

88

Discussion

Nowadays, phages are attractive therapeutic agents but many questions remain as they are

not fully understood. Phages are natural predators of bacteria that replicate only inside them

and their ability to eliminate a specific bacterium depends on efficient phage-host

interactions. These interactions include adsorption to host receptors, injection of phage

DNA, synthesis of all viral components, virion assembly and release of new phages by

bacterial host lysis. The application of phages as potential therapeutic or biocontrol agents

requires a better understanding of the complex interactions between bacteria and phages,

including host factors required for the phage lytic cycle.

The inactivation of the 36 pneumococcal genes led us to also identify eight new seemingly

essential genes for the growth of S. pneumoniae R6. We also confirmed nine previously

reported essential genes based on previous studies (Lee, et al., 1999, Thanassi, et al., 2002,

Song, et al., 2005, van Opijnen, et al., 2009). We also found three genes (Sp_0979,

oligoendopeptidase F; Sp_2012, glyceraldehyde 3-phosphate dehydrogenase; Sp_2157,

lactaldehyde reductase) previously reported to be essential for S. pneumoniae to be non-

essential in our study. These differences are likely due to the use of different mutagenesis

stategies or growth conditions. We also noticed that some genes affected hemolysis

(Sp_0859 and Sp_1213), colony size (Sp_1536 and Sp_2157) and bacterial growth rate

(Sp_1213, Sp_1725, Sp_1731, Sp_1915). We cannot rule out that some of these effects

were due to a polar effect leading to the alteration of downstream genes or due to other

protein-protein interactions in S. pneumoniae. In addition, we performed additional

bioinformatics analyses to build a network of host factors that participate in or are affected

by phage infection. Thus, we identified many putative host protein-protein interactions in S.

pneumoniae, including several interaction networks involving essential genes needed for

normal pneumococcal growth. Taken altogether, these data improve our understanding of S.

pneumoniae growth behaviour and identifies prospective new antimicrobial drug targets by

highlighting essential host genes.

89

The selection of the 36 pneumococcal genes was based on a recent study using a Y2H

screen that reported 49 unique interactions between proteins of phages Dp-1 and SOCP and

proteins of S. pneumoniae R6 (Mariano, et al., 2016). The main objective of this study was

to confirm these interactions in vivo and thereby determine the involvement of these S.

pneumoniae host factors in the replication of the two virulent pneumophages. The Y2H

screens were performed in yeast, which obviously is a different environment than inside a

bacterium. As such, false positive interactions as well as false negative interactions have

likely occurred with the Y2H screens but it was still a good starting point to study phage-

host interactions.

The Y2H study reported that 36 host proteins interacted with proteins of one of the two

phages, as well as two proteins, which were found to interact with both phages. As

mentioned above, we could only inactivate 19 out of the 36 host genes and obtained viable

mutants. These knockout strains were then tested against each of the two virulent phages

and both phages together. We found six genes (Sp_1505, Sp_1606, Sp_1746, Sp_1915)

necessary for phage Dp-1 replication, including two (Sp_0194, Sp_1536) coding for

hypothetical proteins. Based on the Y2H screen, one of these genes, Sp_1536, was

previously reported to interact with a putative phage Rho-like domain (Mariano, et al.,

2016). The investigation of conserved domains suggested that this protein might be

involved in methyl group transfer. Only one gene (Sp_1505) had a major impact on SOCP

replication and it was not detected by the Y2H screen. Interestingly, deleting an

oligopeptidase increased SOCP and phage cocktail efficiency. None of the identified genes

detected by Y2H and seemingly involved in bacterial metabolism were found to be

important for phage replication in vivo. Gene complementation assays coupled with maltose

induction restored most of the WT phenotypes, confirming the phage resistance results

obtained with the knockout strains.

Recently, a different approach was used to study the interactions between S. pneumoniae

and two virulent phages (Leprohon, et al., 2015). Specifically, natural bacteriophage-

insensitive mutants (BIMs) of S. pneumoniae mutants were selected following a challenge

with either the virulent phage SOCP or Dp-1. Genome and genetic analyses revealed that

90

the mutations of three genes were responsible for resistance to phage SOCP while the

mutation of a single gene was necessary to provide resistance to Dp-1. None of these genes

were identified in the Y2H screen. Another challenge encountered during this study was the

presence of many genes/proteins of S. pneumoniae that remain only predicted or poorly

characterized. These data illustrate the complexity of the phage-host interactions and that

multiple approaches will be needed to construct a network of host factors that participate in

phage infection.

The fact that only one bacterial gene was found to be necessary for the replication of both

phages support the strategy of using phage cocktail for antibacterial applications as it will

reduce the likelihood of the rapid emergence of phage resistant mutants. Moreover, we

observed a synergistic effect when simultaneously testing both phages on the same mutated

strain.

At each stage of the phage replication process, it is likely that distinct host factors are

involved. We speculated on the importance of some host factors and their possible

interactions with phage at specific stages of phage replication. We also found that most

identified proteins are intracellular and while others appear to have an impact at the cell

membrane or in cell communication. Perhaps some of these host proteins could be

considered moonlighting proteins and have an additional function in phage replication.

Moonlighting proteins are intracellular proteins that perform several functions in the cell

but can also be found on the cell surface performing another function. These proteins are

reported to play a key role in colonisation, adhesion and virulence (Amblee & Jeffery,

2015).

Although this study on S. pneumoniae using two virulent phages does not represent the

complete range of host factors involved in infection mechanisms used by pneumococcal

phages, the results provide novel insights into general host-phage interaction and further

understanding about S. pneumoniae. Our results represent a pipeline toward a

comprehensive understanding of the molecular mechanism underlying host-phage

interactions.

91

Materials and Methods

Bacterial strains and growth conditions. The strains, plasmids and phages used in this

study are shown in Table 3.3. S. pneumoniae R6 was used for all pneumococcal

transformation. S. pneumoniae strains were grown in brain heart infusion (BHI),

supplemented with 0.5% yeast extract and 5% (vol/vol) defibrinated sheep’s blood, at 37°C

in the presence of 5% CO2. For plasmid maintenance, bacterial strains were grown using

media supplemented with chloramphenicol (6 µg ml-1

) for inactivation assays or

erythromycin (1 µg ml-1

) for complementation assays. Escherichia coli DH5α strains were

grown in Luria Bertani (LB) medium at 37°C, supplemented with chloramphenicol (20 µg

ml-1

) as needed. Lactococcus lactis MG1363 was grown in M17 medium (Oxoid) at 30°C

with added erythromycin (5 µg ml-1

), as needed.

Table 3. 3 Bacterial strains, plasmids and phages used in this study

Strains, plasmids,

phages

Relevant characteristic(s) Reference or source

Bacterial strains

E. coli XL1-Blue

L. lactis MG1363

S. pneumoniae R6

Plasmids

pFF3

pNZ123

pLS1RGFP

Phages

SOCP

Dp-1

recA1 endA1 gyrA96 thi-1 hsdR17

supE44 relA1 lac [F´ proAB lacIq

Z∆M15 Tn10 (Tetr)].

Plasmid free, cloning strain

Nonencapsulated strain, type 2

3.1 kb; CmR

2.5 kb; CmR

9.4 kb; MalR, EmR

Virulent phage, Podoviridae

Virulent phage, Siphoviridae

Stratagene

(Wegmann, et al., 2007)

(Hoskins, et al., 2001)

(Lupien, et al., 2013)

(De Vos, 1987)

(Nieto, et al., 2000)

(Martin, et al., 1996,

Ouennane, et al., 2015)

(Sabri, et al., 2011) R

Antibiotic resistance; Cm, chloramphenicol; Em, erythromycin; MalR, repression by maltose.

92

Primers, PCR amplification. DNA templates were prepared as described previously

(Wang, et al., 2007). Briefly, S. pneumoniae was grown overnight on trypticase soy agar

(TSA) containing 5% sheep’s blood, at 37°C in the presence of 5% CO2. Single colonies

were suspended in filtered BHI broth containing 0.5% yeast extract and incubated at 37°C

in the presence of 5% CO2 until the culture reached an optical density (OD) at 600 nm of

0.2 to 0.8. One hundred microliters of each culture were suspended in 0.2 ml of buffer (10

mM Tris-HCl, pH 8.0, 0.45% Triton X-100, and 0.45% Tween 20) in an Eppendorf tube.

These mixtures were heated at 100°C for 10 min, cooled on ice and centrifuged for 2 min at

14,000 rpm to pellet bacterial cell debris. A 2-μl aliquot of each supernatant containing the

extracted DNA was used for the PCR template. For gene knockouts, PCR was performed

using a DNA template and the primers listed in Supplementary Table S3.2. For PCR,

internal primers were used for all genes and gene size was between 305 and 1802 bp.

Primers were designed to be around 100 bp from each external part. The PCR conditions

were: denaturation at 95°C for 5 min followed by 30 cycles of 95°C for 1 min, 52°C for 45s

and 72°C for 1 min (actual annealing temperature depended on which primers were used);

and one cycle of elongation at 72°C for 1 to 3 min (1 min for each 1 kb of expected

product). A 5-µl sample of the PCR product was analyzed by agarose gel electrophoresis.

The PCR products were purified using the QIAquick PCR Purification Kit (Qiagen) before

ligation to the vector. Gene knockouts of FtsZ (cell division protein) and LytA (major

autolysin) were used as controls for bacterial growth and plasmid pNZ123 was used as a

control for transformation efficiency in S. pneumoniae.

Plasmid construction and cloning. The plasmid pFF3 was used to inactivate the 36

pneumococcal genes of interest as previously described (Fani, et al., 2011). This plasmid

carries a chloramphenicol resistance gene and replicates in E. coli but not in S. pneumoniae.

Plasmid pFF3 was digested with AhdI (GACNNN^NNGTC) to generate a single thymidine

residue at both 3′ ends of the vector. Polymerase chain reactions were used to amplify

specific host regions using Taq DNA polymerase, which added a single deoxyadenosine

(A) to each 3' end of the PCR products. Resulting plasmids were transformed into E. coli

and then into S. pneumoniae R6. Transformants were selected on chloramphenicol and

confirmed by sequencing the insert. The general cloning strategy is presented in Figure 3.4.

93

For complementation assays, we used the maltose-inducible pLS1RGFP vector (Nieto, et

al., 2000, Standish, et al., 2007). To confirm transformants, plasmid-specific and gene-

specific primers were used. Vector primers were designed for the XbaI cloning site (5’-

GGATCAATTCTGATTAACTTTATAAGGAGGAAAAAC-3’ and 5’-CAAACGTTTGCGTTACTTATAAGTATACTCC-3’)

and the EcoRI site (5’- GTTTTATTGATAAGGAAACGCAAACGTTTTC-3’ and 5’-

GTTATAAAAAAAGGATCAATTTTGAACTCTCTCCC-3’). PCR Products containing the complete

pneumococcal gene of interest were obtained using primers listed in Supplementary Table

S3.3. For each gene, XbaI sites were added to the 5’ ends of each primer sequence, which

were then used to clone the amplified PCR product into XbaI-digested pLS1RGFP vector.

When an XbaI site was present within the gene of interest, EcoRI sites were added to the

primers and used for cloning into EcoRI-digested pLS1RGFP vector. The amplicons

digested and ligated to the digested pLS1RGFP were transformed into L. lactis MG1363 by

electroporation using a Gene Pulser II apparatus, then extracted and transformed into S.

pneumoniae R6. Some ligated products were also directly transformed into S. pneumoniae

R6. Transformants were selected for erythromycin resistance (1 µg/ml) and clones were

confirmed by sequencing at the Plateforme de séquençage et de génotypage des génomes of

the CHUL/CHUL Center. To induce expression, cells containing the plasmid pLS1RGFP

(or derivatives) were grown to mid-log phase in BHI medium, pelleted by centrifugation

and resuspended in BHI containing maltose (0.5 and 5%).

94

Figure 3. 4 Schematic representation of construction of pFF3 plasmid, using TA

cloning-like system. The enzyme AhdI recognized two specific restriction sites within the

sequence of the pFF3 vector, generating a 33 bp fragment and linearizing the vector with a

single 3’ overhanging thymine residue on each blunt. Internal PCR primers were used for

all genes (gene lengths of 305 to 1802 bp) and were designed to be approximately 100 bp

from each external part. Taq DNA polymerase, which adds an adenine to the 3’ end, was

used to amplify the PCR products. Ligase was added to join the PCR product and vector

due to the complementary base pairs of the overhangs. The gene knockouts of FtsZ (cell

division protein) and LytA (major autolysin) were used as controls for bacterial growth and

plasmid pNZ123 was used as a control for the efficiency of transformation in S.

pneumoniae.

Preparation of competent cells and transformation. Competent E. coli cells were

prepared from 1 ml of overnight culture added to 100 ml of LB medium and grown at 37°C

to an OD 600nm of 0.5-0.8. Then, the culture was incubated for 15 min on ice and

centrifuged for 5 min at 14,000 rpm. The pellet was re-suspended in 40 ml of

transformation buffer 1 (Tfb1) and incubated on ice for 15 min. The mixture was

centrifuged again, the pellet re-suspended in 40 ml of transformation buffer 2 (Tfb2) and

flash frozen in 250 to 500 µl aliquots in pre-cooled 1.5 ml Eppendorf tubes and stored

immediately at -80°C. E. coli transformation was achieved using a thermal treatment.

95

Electro-competent cells of L. lactis MG1363 were prepared using the glycine method (Holo

& Nes, 1989). L. lactis cells were electroporated with 500 ng to 1 µg of plasmid DNA,

fresh media was immediately added and the cells were plated on GM17 media containing

erythromycin at a concentration of 2 µg ml-1

. Extraction and purification of plasmid DNA

from E. coli and L. lactis were performed using a Qiagen Plasmid kit according to the

manufacturer's instructions. For L. lactis strains, 30 mg ml-1

of lysozyme was added at the

beginning with incubation for 30 min at 37°C to facilitate cell lysis. The quality of the

extracted plasmids was analyzed on agarose gel electrophoresis (0.8%). Competent cells

were prepared from an overnight culture of S. pneumoniae R6 grown in BHI broth

containing 0.5% yeast extract and incubated at 37°C in the presence of 5% CO2. An aliquot

of the previous culture was transferred into fresh BHI and incubated until it reached an

OD600nm of 0.25. Then, cells were frozen in 1 ml of BHI media containing 15% glycerol.

S. pneumoniae was transformed using natural transformation and the competence

stimulating peptide 1 (CSP-1), as described previously (Fani, et al., 2011). The plasmid and

CSP were added to final concentrations of 2 µg ml-1

each. Cultures were then incubated at

30°C for 1 hour followed by incubation at 37°C for 2.5 h. Plates were incubated for 24 h to

48 h at 37°C in the presence of 5% CO2, with 6 ug ml-1

of chloramphenicol and/or 1 ug ml-1

erythromycin for selection.

Phage infection. Phage infection of S. pneumoniae strains were performed as previously

described (Ouennane, et al., 2015). To obtain phage preparations, phage-infected

pneumococcal cultures were incubated until complete cell lysis and the resulting lysate was

filtered using a 0.45 µm syringe filter. The efficiency of plating (EOP) on plates was

obtained by dividing the titer of the phage grown on the transformed strain by the phage

titer obtained using the wild type strain. Two biological and three technical repetitions were

done for each phage and strain.

Acknowledgements

We thank Manuel Espinosa for providing pLS1RGFP plasmid and Marc Ouelette for providing

plasmid pFF3. We thank Peter Uetz and Alfonso H. Magadan for useful discussion and

96

technical support. We are grateful to the original authors of the yeast-two hybrid screens used

in this analysis. This work was funded by a grant from the Canadian Institute of Health

Research to SM. SM holds a Tier 1 Canada Research Chair in Bacteriophages.

97

98

References

Abedon, S. T., S. J. Kuhl, B. G. Blasdel, and E. M. Kutter. 2011. Phage treatment of human

infections. Bacteriophage 1:66-85.

Afzal, M., S. Shafeeq, I. Manzoor, and O. P. Kuipers. 2015. Maltose-dependent

transcriptional regulation of the mal regulon by MalR in Streptococcus pneumoniae.

PLoS One 10:e0127579.

Agari, Y., K. Sakamoto, M. Tamakoshi, T. Oshima, S. Kuramitsu, and A. Shinkai. 2010.

Transcription profile of Thermus thermophilus CRISPR systems after phage infection. J

Mol Bio 395:270-281.

Amblee, V., and C. J. Jeffery. 2015. Physical features of intracellular proteins that moonlight

on the cell surface. PLoS One 10:e0130575.

Calix, J. J., and M. H. Nahm. 2010. A new pneumococcal serotype, 11E, has a variably

inactivated wcjE gene. J Infect Dis 202:29-38.

Catalao, M. J., F. Gil, J. Moniz-Pereira, C. Sao-Jose, and M. Pimentel. 2013. Diversity in

bacterial lysis systems: bacteriophages show the way. FEMS Microbiol Rev 37:554-

571.

Cerveny, L., A. Straskova, V. Dankova, A. Hartlova, M. Ceckova, F. Staud, and J. Stulik. 2013. Tetratricopeptide repeat motifs in the world of bacterial pathogens: role in

virulence mechanisms. Infect Immun 81:629-635.

De Vos, W. M. 1987. Gene cloning and expression in lactic streptococci. FEMS Microbiol Lett

46:281-295.

Domingues, S., K. M. Nielsen, and G. J. da Silva. 2012. Various pathways leading to the

acquisition of antibiotic resistance by natural transformation. Mob Gen Elements

2:257-260.

Donkor, E. S. 2013. Understanding the pneumococcus: transmission and evolution. Front Cell

Infect Microbiol 3:7.

Fani, F., P. Leprohon, D. Legare, and M. Ouellette. 2011. Whole genome sequencing of

penicillin-resistant Streptococcus pneumoniae reveals mutations in penicillin-binding

proteins and in a putative iron permease. Genome Biol 12:R115.

Frias, M. J., J. Melo-Cristino, and M. Ramirez. 2013. E Export of the pneumococcal phage

SV1 lysin requires choline-containing teichoic acids and is holin-independent. Mol

Microbiol 87:430-445.

Galperin, M. Y., D. A. Natale, L. Aravind, and E. V. Koonin. 1999. A specialized version of

the HD hydrolase domain implicated in signal transduction. J Mol Microbiol

Biotechnol 1:303-305.

Guo, M., S. Gamby, Y. Zheng, and H. O. Sintim. 2013. Small molecule inhibitors of AI-2

signaling in bacteria: state-of-the-art and future perspectives for anti-quorum sensing

agents. Int J Mol Sci 14:17694-17728.

Hendrix, R. W. 2002. Bacteriophages: evolution of the majority. Theor Popul Biol 61:471-

480.

Hendrix, R. W. 2003. Bacteriophage genomics. Curr Opin Microbiol 6:506-511.

Henke, J. M., and B. L. Bassler. 2004. Quorum sensing regulates type III secretion in Vibrio

harveyi and Vibrio parahaemolyticus. J Bacteriol 186:3794-3805.

Holo, H., and I. F. Nes. 1989. High-frequency transformation, by electroporation, of

Lactococcus lactis subsp. cremoris grown with glycine in osmotically stabilized media.

Appl Environ Microbiol 55:3119-3123.

99

Hoskins, J., W. E. Alborn, Jr., J. Arnold, L. C. Blaszczak, S. Burgett, B. S. DeHoff, S. T.

Estrem, L. Fritz, D. J. Fu, W. Fuller, C. Geringer, R. Gilmour, J. S. Glass, H.

Khoja, A. R. Kraft, R. E. Lagace, D. J. LeBlanc, L. N. Lee, E. J. Lefkowitz, J. Lu,

P. Matsushima, S. M. McAhren, M. McHenney, K. McLeaster, C. W. Mundy, T. I.

Nicas, F. H. Norris, M. O'Gara, R. B. Peery, G. T. Robertson, P. Rockey, P. M.

Sun, M. E. Winkler, Y. Yang, M. Young-Bellido, G. Zhao, C. A. Zook, R. H. Baltz,

S. R. Jaskunas, P. R. Rosteck, Jr., P. L. Skatrud, and J. I. Glass. 2001. Genome of

the bacterium Streptococcus pneumoniae strain R6. J Bacteriol 183:5709-5717.

Lairson, L. L., B. Henrissat, G. J. Davies, and S. G. Withers. 2008. Glycosyltransferases:

structures, functions, and mechanisms. Annu Rev of Biochem 77:521-555.

Lee, M. S., B. A. Dougherty, A. C. Madeo, and D. A. Morrison. 1999. Construction and

analysis of a library for random insertional mutagenesis in Streptococcus pneumoniae:

use for recovery of mutants defective in genetic transformation and for identification of

essential genes. Appl Environ Microbiol 65:1883-1890.

Lehane, A. M., H. Korres, and N. K. Verma. 2005. Bacteriophage-encoded

glucosyltransferase GtrII of Shigella flexneri: membrane topology and identification of

critical residues. Biochem J 389:137-143.

Leprohon, P., H. Gingras, S. Ouennane, S. Moineau, and M. Ouellette. 2015. A genomic

approach to understand interactions between Streptococcus pneumoniae and its

bacteriophages. BMC Genomics 16:972.

Li, X., D. Gerlach, X. Du, J. Larsen, M. Stegger, P. Kuhner, A. Peschel, G. Xia, and V.

Winstel. 2015. An accessory wall teichoic acid glycosyltransferase protects

Staphylococcus aureus from the lytic activity of Podoviridae. Sci Rep 5:17219.

Lu, L., Z. Ma, T. S. Jokiranta, A. R. Whitney, F. R. DeLeo, and J. R. Zhang. 2008.

Species-specific interaction of Streptococcus pneumoniae with human complement

factor H. J Immunol 181:7138-7146.

Lupien, A., D. S. Billal, F. Fani, H. Soualhine, G. G. Zhanel, P. Leprohon, and M.

Ouellette. 2013. Genomic characterization of ciprofloxacin resistance in a laboratory-

derived mutant and a clinical isolate of Streptococcus pneumoniae. Antimicrob Agents

Chemother 57:4911-4919.

Mariano, R., S. Wuchty, M. G. Vizoso-Pinto, R. Hauser, and P. Uetz. 2016. The

interactome of Streptococcus pneumoniae and its bacteriophages show highly specific

patterns of interactions among bacteria and their phages. Sci Rep 6:24597.

Markine-Goriaynoff, N., L. Gillet, J. L. Van Etten, H. Korres, N. Verma, and A.

Vanderplasschen. 2004. Glycosyltransferases encoded by viruses. J Gen Virol

85:2741-2754.

Marks, L. R., B. A. Davidson, P. R. Knight, and A. P. Hakansson. 2013. Interkingdom

signaling induces Streptococcus pneumoniae biofilm dispersion and transition from

asymptomatic colonization to disease. MBio 4: e00438-13.

Martin, A. C., R. Lopez, and P. Garcia. 1996. Analysis of the complete nucleotide sequence

and functional organization of the genome of Streptococcus pneumoniae bacteriophage

Cp-1. J Virol 70:3678-3687.

McCann, J. R., and J. W. St Geme, 3rd. 2014. The HMW1C-like glycosyltransferases--an

enzyme family with a sweet tooth for simple sugars. PLoS Pathog 10:e1003977.

Molineux, I. J., and D. Panja. 2013. Popping the cork: mechanisms of phage genome ejection.

Nat Rev Microbiol 11:194-204.

Morris, P., L. J. Marinelli, D. Jacobs-Sera, R. W. Hendrix, and G. F. Hatfull. 2008.

Genomic characterization of mycobacteriophage Giles: evidence for phage acquisition

of host DNA by illegitimate recombination. J Bacteriol 190:2172-2182.

100

Mortier-Barriere, I., O. Humbert, B. Martin, M. Prudhomme, and J. P. Claverys. 1997.

Control of recombination rate during transformation of Streptococcus pneumoniae: an

overview. Microb Drug Resist 3:233-242.

Nahm, M. H., M. B. Oliver, L. Siira, T. Kaijalainen, L. M. Lambertsen, and A.

Virolainen. 2011. A report of Streptococcus pneumoniae serotype 6D in Europe. J Med

Microbiol 60:46-48.

Nieto, C., P. Fernandez de Palencia, P. Lopez, and M. Espinosa. 2000. Construction of a

tightly regulated plasmid vector for Streptococcus pneumoniae: controlled expression

of the green fluorescent protein. Plasmid 43:205-213.

O'Brien, K. L., L. J. Wolfson, J. P. Watt, E. Henkle, M. Deloria-Knoll, N. McCall, E. Lee,

K. Mulholland, O. S. Levine, and T. Cherian. 2009. Burden of disease caused by

Streptococcus pneumoniae in children younger than 5 years: global estimates. Lancet

374:893-902.

Ouennane, S., P. Leprohon, and S. Moineau. 2015. iverse virulent pneumophages infect

Streptococcus mitis. PLoS One 10:e0118807.

Park, I. H., D. G. Pritchard, R. Cartee, A. Brandao, M. C. Brandileone, and M. H. Nahm. 2007. Discovery of a new capsular serotype (6C) within serogroup 6 of Streptococcus

pneumoniae. J Clin Microbiol 45:1225-1233.

Rao, F., Y. Qi, E. Murugan, S. Pasunooti, and Q. Ji. 2010. 2',3'-cAMP hydrolysis by metal-

dependent phosphodiesterases containing DHH, EAL, and HD domains is non-specific:

implications for PDE screening. Biochem Biophys Res Commun 398:500-505.

Sabri, M., R. Hauser, M. Ouellette, J. Liu, M. Dehbi, G. Moeck, E. Garcia, B. Titz, P.

Uetz, and S. Moineau. 2011. Genome annotation and intraviral interactome for the

Streptococcus pneumoniae virulent phage Dp-1. J Bacteriol 193:551-562.

Seshasayee, A. S., G. M. Fraser, and N. M. Luscombe. 2010. Comparative genomics of

cyclic-di-GMP signalling in bacteria: post-translational regulation and catalytic activity.

Nucleic Acids Res 38:5970-5981.

Song, J. H., K. S. Ko, J. Y. Lee, J. Y. Baek, W. S. Oh, H. S. Yoon, J. Y. Jeong, and J.

Chun. 2005. Identification of essential genes in Streptococcus pneumoniae by allelic

replacement mutagenesis. Mol Cells 19:365-374.

Sperandio, V., J. L. Mellies, W. Nguyen, S. Shin, and J. B. Kaper. 1999. Quorum sensing

controls expression of the type III secretion gene transcription and protein secretion in

enterohemorrhagic and enteropathogenic Escherichia coli. Proc Natl Acad Sci U S A

96:15196-15201.

Standish, A. J., U. H. Stroeher, and J. C. Paton. 2007. The pneumococcal two-component

signal transduction system RR/HK06 regulates CbpA and PspA by two distinct

mechanisms. J Bacteriol 189:5591-5600.

Sulakvelidze, A., Z. Alavidze, and J. G. Morris, Jr. 2001. Bacteriophage therapy.

Antimicrob Agents Chemother 45:649-659.

Szklarczyk, D., A. Franceschini, S. Wyder, K. Forslund, D. Heller, J. Huerta-Cepas, M.

Simonovic, A. Roth, A. Santos, K. P. Tsafou, M. Kuhn, P. Bork, L. J. Jensen, and

C. von Mering. 2015. STRING v10: protein-protein interaction networks, integrated

over the tree of life. Nucleic Acids Res 43:D447-452.

Sztajer, H., A. Lemme, R. Vilchez, S. Schulz, R. Geffers, C. Y. Yip, C. M. Levesque, D. G.

Cvitkovitch, and I. Wagner-Dobler. 2008. Autoinducer-2-regulated genes in

Streptococcus mutans UA159 and global metabolic effect of the luxS mutation. J

Bacteriology 190:401-415.

101

Taga, M. E., J. L. Semmelhack, and B. L. Bassler. 2001. The LuxS-dependent autoinducer

AI-2 controls the expression of an ABC transporter that functions in AI-2 uptake in

Salmonella typhimurium. Mol Microbiol 42:777-793.

Thanassi, J. A., S. L. Hartman-Neumann, T. J. Dougherty, B. A. Dougherty, and M. J.

Pucci. 2002. Identification of 113 conserved essential genes using a high-throughput

gene disruption system in Streptococcus pneumoniae. Nucleic Acids Res 30:3152-

3162.

Tseng, T. T., B. M. Tyler, and J. C. Setubal. 2009. Protein secretion systems in bacterial-host

associations, and their description in the Gene Ontology. BMC Microbiol 9 Suppl

1:S2.

Valentino, M. D., A. M. McGuire, J. W. Rosch, P. J. Bispo, C. Burnham, C. M. Sanfilippo,

R. A. Carter, M. E. Zegans, B. Beall, A. M. Earl, E. I. Tuomanen, T. W. Morris,

W. Haas, and M. S. Gilmore. 2014. Unencapsulated Streptococcus pneumoniae from

conjunctivitis encode variant traits and belong to a distinct phylogenetic cluster. Nat

Commun 5:5411.

van Opijnen, T., K. L. Bodi, and A. Camilli. 2009. Tn-seq: high-throughput parallel

sequencing for fitness and genetic interaction studies in microorganisms. Nat Methods

6:767-772.

Vidal, J. E., K. E. Howery, H. P. Ludewick, P. Nava, and K. P. Klugman. 2013. Quorum-

sensing systems LuxS/autoinducer 2 and Com regulate Streptococcus pneumoniae

biofilms in a bioreactor with living cultures of human respiratory cells. Infect Immun

81:1341-1353.

Vieira, A., Y. J. Silva, A. Cunha, N. C. Gomes, H. W. Ackermann, and A. Almeida. 2012.

Phage therapy to control multidrug-resistant Pseudomonas aeruginosa skin infections:

in vitro and ex vivo experiments. Eur J Clin Microbiol Infect Dis 31:3241-3249.

Wang, I. N., Y. Li, Q. Que, M. Bhattacharya, L. C. Lane, W. G. Chaney, and J. L. Van

Etten. 1993. Evidence for virus-encoded glycosylation specificity. Proc Natl Acad Sci

U S A 90:3840-3844.

Wang, Q., M. Wang, F. Kong, G. L. Gilbert, B. Cao, L. Wang, and L. Feng. 2007.

Development of a DNA microarray to identify the Streptococcus pneumoniae serotypes

contained in the 23-valent pneumococcal polysaccharide vaccine and closely related

serotypes. J Microbiol Methods 68:128-136.

Wegmann, U., M. O'Connell-Motherway, A. Zomer, G. Buist, C. Shearman, C.

Canchaya, M. Ventura, A. Goesmann, M. J. Gasson, O. P. Kuipers, D. van

Sinderen, and J. Kok. 2007. Complete genome sequence of the prototype lactic acid

bacterium Lactococcus lactis subsp. cremoris MG1363. J Bacteriol 189:3256-3270.

Xia, G., L. Maier, P. Sanchez-Carballo, M. Li, M. Otto, O. Holst, and A. Peschel. 2010.

Glycosylation of wall teichoic acid in Staphylococcus aureus by TarM. J Biol Chem

285:13405-13415.

Yakunin, A. F., M. Proudfoot, E. Kuznetsova, A. Savchenko, G. Brown, C. H.

Arrowsmith, and A. M. Edwards. 2004. The HD domain of the Escherichia coli

tRNA nucleotidyltransferase has 2',3'-cyclic phosphodiesterase, 2'-nucleotidase, and

phosphatase activities. J Biol Chem 279:36819-36827.

Zhou, M., J. Boekhorst, C. Francke, and R. J. Siezen. 2008. LocateP: genome-scale

subcellular-location predictor for bacterial proteins. BMC Bioinformatics 9:173.

102

Supporting Information

Figure S3. 1 Map of pLS1RGFP vector showing key features of the plasmid: ErmR,

erythromycin resistance; GFP, Green Fluorescent Protein; MalA, maltose transport; MalR,

maltosaccharide regulator transcriptional; Mob, mobilization protein gene; Pm, promoter M

of the malMP operon; Pt, promoter T coupled to the malR gene; Px, promoter induction by

maltose; RepA, recombinase functioning in recombinational DNA repair in bacteria; RepB,

replication initiator protein; TetL, tetracycline resistance gene; Topo, topoisomerase type I.

103

Figure S3. 2 Comparison of the maltose effect on phage infection . Efficiency of plating

of pneumophages on S. pneumoniae strains harboring pLS1RGFP without insert. A. Effect

of 0.5% maltose needed for complementation to induce gene expression. B. Effect of 5%

maltose used to induce a higher level of gene expression.

104

Table S3. 1 Protein-protein interaction in S. pneumoniae. Interactions determinded

using String database and gene essentiality was investigated as descrived elsewhere. Red

was used for genes of this study found to interact with others gnes. Green genes that

interact more than one time with the pneumococcal proteins.

Protein

interaction Function Essentiality

Sp

_0

19

4

sp_0192 UPF0297 protein (hypothetical protein?) Yes

sp_0196 Putative uncharacterized protein

sp_0400 Trigger factor; Involved in protein export

sp_0670 Putative uncharacterized protein

sp_0748 UPF0298 protein (hypothetical protein)

sp_0865 DNA polymerase III, gamma and tau subunits Yes

sp_1152 Exonuclease RexA Yes

sp_1383 Alanyl-tRNA synthetase Yes

sp_2040 jag protein, putative Yes

sp_2069 Glutamyl-tRNA synthetase Yes

Sp

_0

25

9

Sp_0260 Putative uncharacterized protein

Sp_1790 ATPase, AAA family

Sp_1922 UPF0082 protein SP_1922

Sp_2096 Peptidase, M20/M25/M40 family

Sp_0179 Holliday junction DNA helicase RuvA Yes

SP_1416 S-adenosylmethionine-tRNA ribosyltransferase-isomerase

SP_0264 Prolyl-tRNA synthetase Yes

SP_2058 Queuine tRNA-ribosyltransferase

SP_2114 Aspartyl-tRNA synthetase Yes

SP_2203 Replicative DNA helicase Yes

Sp

_0

44

6

SP_0445 Acetolactate synthase large subunit

SP_0447 Ketol-acid reductoisomerase

SP_0450 Threonine dehydratase

Sp_1258 2-isopropylmalate synthase, putative

SP_0730 Truncated pyruvate oxidase Yes

SP_1392 Alpha-acetolactate decarboxylase

SP_0251 Formate acetyltransferase, putative

SP_0459 Formate acetyltransferase

SP_1163 acetoin dehydrogenase, E1 component, beta subunit

SP_1164 acetoin dehydrogenase, E1 component, alpha subunit

Sp_0111 amino acid ABC transporter, ATP-binding protein, putative

Sp

_0

68

7

Sp_0600 ABC transporter, ATP-binding protein Vexp2

sp_0684 Putative uncharacterized protein

sp_0685 Putative uncharacterized protein

sp_0686 Putative uncharacterized protein

sp_0912 ABC transporter, ATP-binding protein

sp_1341 ABC transporter, ATP-binding protein

sp_1653 ABC transporter, ATP-binding protein

sp_1957 ABC transporter, ATP-binding protein

sp_1987 ABC transporter, ATP-binding protein

Sp

_0

97

9

SP_0980 O-methyltransferase

SP_0978 Competence protein CoiA Yes

SP_0976 SsrA-binding protein

SP_1599 tRNA pseudouridine synthase A

SP_2121 Histidyl-tRNA synthetase Yes

SP_0981 Foldase protein prsA

SP_1577 Adenine phosphoribosyltransferase

SP_0977 Tellurite resistance protein TehB

SP_0237 50S ribosomal protein L17

SP_0236

DNA-directed RNA polymerase subunit alpha

Yes

105

Sp

_1

05

0

SP_1051 Putative uncharacterized protein

SP_1052 Hypothetical protein

SP_1053 Conserved domain protein

SP_1049 Putative uncharacterized protein

Sp

_1

08

8

SP_1087 ATP-dependent DNA helicase PcrA

SP_0568 Valyl-tRNA synthetase Yes

SP_2058 Queuine tRNA-ribosyltransferase

SP_0672 GTP-binding protein HflX

SP_1084 Methionine aminopeptidase Yes

SP_0457 Undecaprenyl-diphosphatase Yes

SP_0021 Putative deoxyuridine 5'triphosphate nucleotidohydrolase

SP_2218 Rod shape-determining protein MreC Yes

SP_1231 phosphopantothenoylcysteine synthase/decarboxylase Yes

SP_0843 Deoxyribose-phosphate aldolase

Sp

_1

15

3

SP_1004 Surface protein BVH-3

SP_1687 neuraminidase B

SP_1833 Cell wall surface anchor family protein

SP_1340 Putative uncharacterized protein

SP_1824 ABC transporter, permease protein

SP_1139 Putative uncharacterized protein

SP_0641 Serine protease

SP_1154 Immunoglobulin A1 protease

SP_0200 Competence-induced protein Ccs4

SP_0965 Putative endo-beta-N-acetylglucosaminidase

Sp

_1

20

8

SP_0745 Uracil phosphoribosyltransferase

SP_0844 Cytidine deaminase

SP_1603 Cytidylate kinase Yes

SP_0944 Uridylate kinase Yes

SP_0701 Orotidine 5'-phosphate decarboxylase Yes

SP_0842 Pyrimidine-nucleoside phosphorylase

SP_1278 Bifunctional protein pyrR Yes

SP_0980 O-methyltransferase

SP_1518 Putative uncharacterized protein Yes

SP_1517 Transcription elongation factor greA Yes

Sp

_1

21

3

Sp_1213 tRNA pseudouridine synthase B

SP_1110 riboflavin kinase/flavin adenine dinucleotide synthase yes

SP_1211 Putative uncharacterized protein

SP_1233 Putative uncharacterized protein

SP_1754 Putative uncharacterized protein

SP_1234 Transcriptional regulator

SP_1404 UPF0223 protein

SP_1403 Inositol monophosphatase family protein

SP_1402 NOL1/NOP2/sun family protein

SP_0842 Pyrimidine-nucleoside phosphorylase

Sp

_1

35

4

SP_1355 50S ribosomal protein L10 Yes

SP_0220 50S ribosomal protein L24 Yes

SP_0630 50S ribosomal protein L11 Yes

SP_0212 50S ribosomal protein L2 Yes

SP_0219 50S ribosomal protein L14 Yes

SP_0221 50S ribosomal protein L5 Yes

SP_0225 50S ribosomal protein L6 Yes

SP_0237 50S ribosomal protein L17 Yes

SP_0229 50S ribosomal protein L15 Yes

SP_0631 50S ribosomal protein L1

Sp

_1

39

5 SP_1396 Phosphate import ATP-binding protein pstB 1

SP_1397 Phosphate import ATP-binding protein pstB 2

SP_1400

Phosphate-binding protein pstS 1

106

Sp_1399 Putative phosphate ABC transporter

Sp_1358 Putative phosphate ABC transporter

SP_2087 Phosphate import ATP-binding protein pstB 3

SP_2085 Phosphate ABC transporter

SP_2086 Transmembrane protein PstA

SP_2083 sensor histidine kinase PnpS

SP_1226 sensory box sensor histidine kinase Yes

Sp

_1

50

4

Sp_1505 Membrane protein

SP_1392 Alpha-acetolactate decarboxylase

SP_1168 Mutator mutT protein

Sp_1506 Putative uncharacterized protein Yes

SP_1554 CCA-adding enzyme Yes

SP_1571 Dihydrofolate reductase Yes

SP_1371 3-phosphoshikimate 1-carboxyvinyltransferase

SP_1113 DNA-binding protein HU

Sp_0119 MutT/nudix family protein

Sp_0947 UPF0346 protein SP_0947

Sp

_1

50

5

Sp_1504 TPR domain protein

SP_0044 Phosphoribosylaminoimidazole-succinocarboxamide synthase

SP_0047 Phosphoribosylformylglycinamidine cyclo-ligase

SP_0048 Phosphoribosylglycinamide formyltransferase Yes

Sp_1506 Putative uncharacterized protein Yes

SP_2222 CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase Yes

SP_0516 Heat shock protein GrpE

SP_1168 Mutator mutT protein

Sp_0486 RNA methyltransferase

SP_0591 Cysteinyl-tRNA synthetase Yes

Sp

_1

53

6

Sp_1535 UPF0213 protein

SP_0935 Thymidylate kinase Yes

SP_0938 Tetrapyrrole methylase family protein

Sp_0975 exoribonuclease, VacB/Rnb family

SP_0788 Methionyl-tRNA synthetase Yes

SP_0865 DNA polymerase III, gamma and tau subunits Yes

SP_0936 DNA polymerase III, delta prime subunit

SP_1672 Recombination protein recR Yes

Sp_1537 Putative general stress protein 13

Sp_1538 Cof family protein/peptidyl-prolyl cis-trans isomerase

Sp

_1

54

0

Sp_0004 GTP-binding protein Yes

SP_1541 30S ribosomal protein S6 Yes

SP_1539 30S ribosomal protein S18 (rpsR) Yes

SP_2204 50S ribosomal protein L9 (rplI)

Sp_2203 Replicative DNA helicase (dnaC) Yes

SP_0186 UvrABC system protein A (uvrA) Yes

SP_1228 A/G-specific adenine glycosylase (mutY)

SP_2114 Aspartyl-tRNA synthetase (aspS) Yes

SP_1845 Exodeoxyribonuclease (exoA) Yes

SP_1542 Asparaginyl-tRNA synthetase (asnS) Yes

Sp

_1

57

5

SP_1576 Homoserine O-succinyltransferase Yes

Sp_0673 Putative uncharacterized protein

Sp_0937 Initiation-control protein yabA Yes

Sp_1459 Putative uncharacterized protein Yes

Sp_0563 Putative uncharacterized protein

Sp_1368 Psr protein

Sp_1289 putative uncharacterized protein

Sp_1609 UPF0135 protein

Sp_1610 SAM-dependent methyltransferase Yes

SP_1449 C3-degrading proteinase

107

Sp

_1

58

4

Sp_1583 Isochorismatase family protein

Sp_1288 UPF0122 protein Yes

Sp_0192 UPF0297 protein Yes

Sp_1564 Putative uncharacterized protein

SP_2195 Transcriptional regulator CtsR

Sp_1585 Putative uncharacterized protein

Sp_1368 Psr protein

SP_0943 Methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase trmFO

SP_1263 DNA topoisomerase Yes

SP_0588 Polyribonucleotide nucleotidyltransferase

Sp

_1

60

6

SP_1607 UDP-glucose 4-epimerase Yes

Sp_1838 glycosyl transferase, putative Yes

Sp_1076 Glycosyl transferase, group 1 Yes

SP_1075 CpoA protein Yes

Sp_0102 Glycosyl transferase Yes

Sp_1837 capsular polysaccharide biosynthesis Yes

Sp_0486 RNA methyltransferase

SP_1169 Uracil-DNA glycosylase

SP_0825 Bifunctional protein folD(methylenetetrahydrofolate dehydrogenase) Yes

SP_2188 Redox regulated molecular chaperone

Sp

_1

66

9

SP_1670 D-alanine--D-alanine adding enzyme (UDP-N-acetylmuramoylalanyl...) Yes

SP_0437 Glutamyl-tRNA(Gln) amidotransferase subunit A Yes

SP_0438 Glutamyl-tRNA(Gln) amidotransferase subunit C Yes

Sp_1408 acyl-ACP thioesterase, putative

Sp_1407 Hydrolase, haloacid dehalogenase-like family

SP_1671 D-alanine-D-alanine ligase (D-alanyl-alanine synthetase A) Yes

Sp_1668 Putative uncharacterized protein

Sp_1406 Putative uncharacterized protein

Sp_1462 Putative uncharacterized protein

Sp_1409 Putative oxygen-independent coproporphyrinogen III oxidase

Sp

_1

67

2

SP_1673 Penicillin-binding protein 2b Yes

Sp_1102 UPF0133 protein

SP_0865 DNA polymerase III, gamma and tau subunits Yes

SP_0935 Thymidylate kinase Yes

Sp_0938 Tetrapyrrole methylase family protein

SP_1117 DNA ligase Yes

Sp_0020 Cytidine/deoxycytidylate deaminase family protein

SP_0936 DNA polymerase III, delta prime subunit

Sp_1536 Putative uncharacterized protein

SP_0825 Bifunctional protein fold Yes

Sp

_1

71

3

Sp_1710 Nitroreductase family protein

SP_1711 Primosomal protein DnaI Yes

Sp_1712 Putative uncharacterized protein Yes

SP_1709 GTP-binding protein engA Yes

SP_0178 Riboflavin biosynthesis protein RibD

Sp_1024 Serine hydroxymethyltransferase; Interconversion of serine and glycine

SP_0177 Riboflavin synthase, alpha subunit

SP_0175 6,7-dimethyl-8-ribityllumazine synthase

SP_0176 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II

SP_0433 transcription antitermination protein NusB Yes

Sp

_1

72

5

SP_1724 Sucrose-6-phosphate hydrolase Yes

SP_1721

SP_1722

Fructokinase

PTS system IIABC components

Sp_1723

Putative uncharacterized protein

108

Sp

_1

73

1

Sp_1730 Putative uncharacterized protein

Sp_1729 IS1381, transposase OrfB, truncation

Sp_1728 Putative uncharacterized protein

SP_1732 Serine/threonine protein kinase Yes

SP_1733 Putative uncharacterized protein phpP Yes

SP_1734 rRNA methyltransferase RsmB

SP_1735 Methionyl-tRNA formyltransferase Yes

SP_1736 primosome assembly protein PriA Yes

SP_0012

SP_2061

Hypoxanthine-guanine phosphoribosyltransferase

Putative uncharacterized protein

Sp

_1

74

6

SP_1747 Probable nicotinate-nucleotide adenylyltransferase

Sp_1744 Iojap-related protein

Sp_1748 Putative uncharacterized protein yes

Sp_1745 Isochorismatase family protein

Sp_1079 GTP-binding protein, GTP1/Obg family yes

SP_1200 GTP-binding protein lepA

SP_1107 50S ribosomal protein L27 yes

SP_1105 50S ribosomal protein L21 yes

SP_0976 SsrA-binding protein

SP_0991 5'-methylthioadenosine yes

Sp

_1

75

1

Sp_1749 GTP-binding protein Yes

Sp_1750 Putative uncharacterized protein Yes

Sp_1752 mechanosensitive ion channel, putative

SP_1152 Exonuclease RexA Yes

SP_1151 Exonuclease RexB Yes

Sp_1748 Putative uncharacterized protein Yes

Sp_2048 Putative uncharacterized protein

Sp

_1

88

1

Sp_1880 Nucleoside-triphosphatase

SP_1306 NADP-specific glutamate dehydrogenase

SP_1544 Aspartate aminotransferase Yes

Sp_1994 aspartate aminotransferase Yes

SP_0502 Glutamine synthetase, type I

SP_0688

UDP-N-acetylmuramoylalanine--D-glutamate ligase; Cell wall

formation Yes

SP_2069 Glutamyl-tRNA synthetase Yes

SP_0931 Glutamate 5-kinase (gamma-glutamyl kinase)

SP_1008 Peptidase T

SP_0713 Lysyl-tRNA synthetase Yes

Sp

_1

91

5

Sp_1914 Putative uncharacterized protein

Sp_0160 Conserved domain protein

Sp_1916 PAP2 family protein

Sp_1917 Putative uncharacterized protein

Sp_0141 Transcriptional regulator

SP_1499 bacterocin transport accessory protein

Sp_1548 Putative uncharacterized protein

Sp_1918 ABC transporter, ATP-binding protein

Sp_1919 ABC transporter, permease protein

Sp_0184 Putative uncharacterized protein

Sp

_1

98

0

Sp_1851 Competence-induced protein Ccs50 Yes

Sp_1852 Thiamine pyrophosphokinase

Sp_1983 Ribulose-phosphate 3-epimerase Yes

Sp_1984 Putative ribosome biogenesis GTPase rsgA Yes

Sp_1985 Dimethyladenosine transferase Yes

Sp_1698 Alanine racemase Yes

Sp_1554 CCA-adding enzyme Yes

Sp_0976 SsrA-binding protein

Sp_0935 Thymidylate kinase Yes

Sp_1263

DNA topoisomerase

Yes

109

Sp

_2

01

2

Sp_0499 Phosphoglycerate kinas yes

Sp_0605 Fructose-bisphosphate aldolase yes

Sp_1574 Triosephosphate isomerase yes

Sp_1128 Enolase yes

Sp_2030 RecP gene protein (Transketolase) (Tranketolase) (RecP protein) yes

Sp_0974 Acylphosphatase

Sp_0317 4-hydroxy-2-oxoglutarate aldolase

Sp_2070 Glucose-6-phosphate isomerase yes

Sp_0668

Sp_0843

Glucose kinase (Gki)

Deoxyribose-phosphate aldolase

Sp

_2

02

4

Sp_2023 PTS system, IIB component

Sp_2022 PTS system, IIC component

Sp_0248 PTS system, IIA component

Sp_0308 PTS system, IIA component

Sp_2021 Glycosyl hydrolase, family 1

Sp_0249 PTS system, IIB component

Sp_0474 PTS system, cellobiose-specific IIC component

Sp_0310 PTS system, IIC component

Sp_0250 PTS system, IIC component

Sp_2020 Transcriptional regulator, GntR family

Sp

_2

03

6

Sp_2037 PTS system, IIB componen

Sp_2038 ascorbate-specific PTS system enzyme IIC

Sp_2129 ascorbate-specific PTS system enzyme IIC

Sp_2035 hexulose-6-phosphate synthase, putative

Sp_2031 Putative uncharacterized protein

Sp_2034 hexulose-6-phosphate isomerase, putative

Sp_2130 PTS system, IIB component, putative

Sp_2033 Putative L-ribulose 5-phosphate 4-epimerase AraD

Sp_0306 transcriptional regulator, putative

Sp_0394 PTS system mannitol-specific EIICB component Yes

Sp

_2

12

5

Sp_0871 conserved hypothetical intein-containing protein Yes

Sp_0867 ABC transporter, ATP-binding protein Yes

Sp_0869 Aminotransferase, class-V Yes

Sp_0870 NifU family protein Yes

Sp_2124 Putative uncharacterized protein

Sp_0868 Putative uncharacterized protein Yes

Sp_0519 Heat shock protein DnaJ

Sp_2058 Queuine tRNA-ribosyltransferase

Sp

_2

15

7

Sp_1119 Glyceraldehyde-3-phosphate dehydrogenase, NADP-dependent

Sp_2186 Glycerol kinase

Sp_2026 Alcohol dehydrogenase, iron-containing

Sp_0445 acetolactate synthase large subunit

Sp_0253 Glycerol dehydrogenase

Sp_0285 Alcohol dehydrogenase, zinc-containing

Sp_2158 L-fucose isomerase

Sp_1855 Alcohol dehydrogenase, zinc-containing

Sp_2055 Alcohol dehydrogenase, zinc-containing

Sp_2167 L-fuculose kinase fucK, putative Yes

Sp

_2

16

8

Sp_2167 L-fuculose kinase fucK, putative Yes

Sp_2162 PTS system, IIC component

Sp_2163 PTS system, IIB component

Sp_2159 Fucolectin-related protein

Sp_2166 L-fuculose phosphate aldolase

Sp_2161 PTS system, IID component

Sp_2158 L-fucose isomerase

Sp_2164 PTS system, IIA component

Sp_2165 Fucose operon FucU protein Yes

Sp_2160 Putative uncharacterized protein

110

Table S3.2 Primers used for gene knockout assays

Gene

Primer sequence (5’ – 3’)

Forward/

Reverse

Position within

the gene

PCR product

size (pb)

Sp_0194 ggtaaaaactatgttcttctagtaccagttaacg forward 118-151 306 pb

Sp_0194 gcttggatttcaacttgtccgtcttc reverse 188-163

Sp_0259 gatctttatcgaagccgctaaaatgcg forward 116-143 1000 pb

Sp_0259 ctgtctcacgctcttcggcgatattc reverse 880-855

Sp_0446 gcaacagaagatccgaatgtatcgc forward 109-134 477 pb

Sp_0446 ctacgtctactactgttgcacggaaaggttg reverse 349-318

Sp_0687 ggacgattggagccatatgacaaagg forward 142-167 642 pb

Sp-0687 ggggtctaaggaagcggttggttc reverse 504-481

Sp_0859 ggacatctgcattttggactctattgtc forward 113-140 924 pb

Sp_0859 gtcaataaggtcccacaataacctgc reverse 782-757

Sp_0979 catctcttggatagtgcggataacctact forward 134-163 1803 pb

Sp_0979 cgacttacctgccttgaggtagtcgatat reverse 1668-1640

Sp_1050 cagtctctaccgaattaatagacatcatttg forward 119-149 477 pb

Sp_1050 cactcattaaaatccaaggattagactcatc reverse 346-316

Sp_1088 gtcaagctagcgtttttgaaattgccc forward 119-145 681 pb

Sp_1088 cctgaaggatgattgtggaccaag reverse 536-513

Sp_1153 gccgtagcaattgtgtctgtggaaatg forward 119-145 1179 pb

Sp_1153 gaagctcacgaaaataggaattgaggatcc reverse 913-884

Sp_1208 gagcatgattcatactacaaggatcag forward 112-139 639 pb

Sp_1208 tcgataaactggtggtacattggtttgac reverse 493- 521

Sp_1213 gagcaaaaggccatgaatgagcaacag forward 142-168 1275 pb

Sp_1213 gtcaggaatttcttaacctcttccatgcg reverse 1157-1129

Sp_1354 tgaacgaccttgtaaaagctatcg forward 59-82 238pb

Sp_1354 gccttctttaacaagtgctggtg reverse 275-297

Sp_1395 atgaccgtgacctggcaaaag forward 112-137 653

Sp_1395 cgtcgtcaacagaacttaag reverse 417-439

Sp_1504 ggcaacttatcttgaagggattgg forward 96-119 1025 pb

Sp_1504 tgtcccaattcacgcaagag reverse 1105-1124

Sp_1505 cacctgttttagactttttagcagttgtgatg forward 140-171 1167pb

Sp_1505 ctccccagataccaaacatagatc reverse 1045-1022

Sp_1536 gatttccacgttttcctaagaaggggttg forward 122-150 750 pb

Sp_1536 cgcctcaatcaaaagcatattggcttcc reverse 642-615

Sp_1540 gagtcaaaatggtgaacgtgaggctg forward 114-139 471 pb

Sp_1540 cagttggtgcagagtaagctccac reverse 341-364

Sp_1575 ggcttagaagaaatgtcgccaagc forward 133-156 678 pb

Sp_1575 ccagtttctcaaaatcgcctgaatgtac reverse 552-525

Sp_1584 gcaatgcctgcattatcaatagtaaggg forward 122-149 789 pb

Sp_1584 cattgacaatcacagagcgagtgattc reverse 670-644

Sp_1606 caagtgatgggaccttggaactcttaaag forward 125-153 963 pb

Sp_1606 ccaatggtcaagagttgaatgcctccaag reverse 842-814

Sp_1713 agacgtgagtgcgacgaatg forward 82-103 344 PB

Sp_1713 gctctctaactcactgacatcc reverse 405-426

111

Sp_1669 gttgaatcaagcatcagaccttgattccg forward 129-157 612 pb

Sp_1669 ggaattgtccatcaagaagcttacatcc reverse 454-472

Sp_1672 gggatgtctgctgatgatgtcaatg forward 100-124 597 pb

Sp_1672 gaaagatacatggaagtcgcttcacc reverse 470-445

Sp_1725 gaagccatgcgagaattgggctataaac forward 115-142 966 pb

Sp_1725 ggttgcttgatagtagccaattgaggg reverse 848-822

Sp-1731 ggattgtggattgcaatgtccttgc forward 128-152 759 pb

Sp_1731 catgaccgcaccagctataatcaaatc reverse 609-582

Sp-1746 gaattagctcagcgctttggtgtag forward 115-139 594 pb

Sp-1746 cgatagacttgcaatctcacgcgc reverse 468-445

Sp_1751 ccattgaatacgcactggatagaaacg forward 110-136 909 pb

Sp_1751 gccaaaacagctagcaagactgaaatg Reverse 767-741

Sp_1881 gctgagcaaattcgtgaatatacttggc Forward 139-166 797 pb

Sp_1881 gtaagactgagatatcccgtacg Reverse 652-630

Sp_1915 gctccgaggttgactttttacaaggg Forward 118-143 450

Sp_1915 gagtaaatctgacggatgtttgcgatcg Reverse 332-305

Sp_1980 caacctcataacattgaggcctttacc Forward 139-165 927pb

Sp_1980 gataatctctgcttccataatgcgtgg Reverse 769-795

Sp_2012 gttatgcttgcacacttgttgaaatacgac Forward 115-144 1008pb

Sp_2012 cgtcaagaactttagtttgagttgcgtc Reverse 901-874

Sp_2024 ctagctaaggcaggaaatttaaaagaagcg Forward 103-132 327 pb

Sp_2024 gtatgagattagagtgaatcttgtgcgcttc Reverse 199-169

Sp_2036 gtggggcaattttgccagagtattacg Forward 107-133 486 pb

Sp_2036 gggcaataatttgtggaatggctacac Reverse 364-338

Sp_2125 gaaatcaatctggatgaaacggggctc Forward 124-150 327pb

Sp_2125 cagacctgccacgatttcaataggc Reverse 228-204

Sp_2157 gacagataagtacatcgaaggcagt Forward 115-129 1153pb

Sp2157 gtcgaaatctttttcttcaatacc Reverse 1047-1023

Sp_2168 caaaagaaagcacggatacgtgaccc Forward 147-172 773

Sp_2168 cagtaagatggtttcatgggctttg Reverse 599-624

112

Table S3. 3 Primers used for complementation assays Gene

TIGR4

Gene

R6

Primer

name

F/R

Primer sequence

position

5'

Position

3'

Size

Digestion

site in

R6

Digestion

site in

TIGR4

SP_0259 spr0238 DT304 for gctagcgctagcGAGTCACCCAATCAGGTGGCTT 232128 233126 998

SP_0259 DT305 rev gctagcgctagcGGTTATGAATACAGTGAAAAATAA 0

SP_1208 spr1090 DT306 for gctagcgctagcTGTGATAGAATAGACGACGG 1086075 1085437 -638

SP_1208 DT307 rev gctagcgctagcTTATTTGCTGTTTCGAGCTTC 0

SP_1540 spr1395 DT308 for gctagcgctagcTCACATGATCGTCAAAATTGA 1375311 1374841 -470

SP_1540 DT309 rev gctagcgctagcGTCCATTAGAATGGTAAATCATC 0

SP_1584 spr1439 DT310 for gctagcgctagcCGTTTTTATGTTATAATGATAGCG 1423524 1422736 -788

SP_1584 DT311 rev gctagcgctagcTCATTAGTAATCTCTTTTCTTCAC 0

SP_1713 spr1557 DT312 for gctagcgctagcAATGGTATAATGAAAAGAAAACG 1538731 1538258 -473

SP_1713 DT313 rev gctagcgctagcTTGGCTTCATTTATCTTTCCTT 0

SP_1881 spr1696 DT314 for gctagcgctagcAATCATAATGAACGATCAATCAG 1665693 1664899 -794

SP_1881 DT315 rev gctagcgctagcTGTCATAATTCTACATGCTCC 0

SP_1395 spr1252 DT316 for gctagcgctagcAAGACTATATTACAGGAAAATTTGG 1252240 1251587 -653

SP_1395 DT317 rev gctagcgctagcTTATAGTTCGACAATCTTACCTG 0

SP_2168 spr1974 DT318 for gctagcgctagcCCTCCAATTTGTGCTATAATAT 1964196 1964969 773 XbaI

SP_2168 DT319 rev gctagcgctagcTCATTGAATATCAGAAACCC 0

SP_0194 spr0177 DT320 for gctagcgctagcTATAAAGGAGAGGCTATGTCAC 185057 185362 305

SP_0194 DT321 rev gctagcgctagcTCACTCCTCCATAAAGCTGT 0

SP_0446 spr0402 DT322 for gctagcgctagcTGTTACCAATGGTACCGGCT 399026 399526 500

SP_0446 DT323 rev gctagcgctagcTTAATCGCGGGTAAATCCAG 0

SP_0687 spr0602 DT324 for gctagcgctagcCTCGTGTTTCTATGACAATTATG 614626 615267 641

SP_0687 DT325 rev gctagcgctagcTCATCTATGTGATAAATCGGTA 0

SP_0859 spr0761 DT326 for gctagcgctagcTATCAAAAAAGACTAGGGGAGGAG 757384 758307 923

SP_0859 DT327 rev gctagcgctagcCTAAAATGCGAGAAAGTACATT 0

SP_0979 spr0882 DT328 for gctagcgctagcAATATGGTAGAATAGAAAGGATGG 872639 874441 1802

SP_0979 DT329 rev gctagcgctagcTTATGCCAATCCTAATTTTTCA 0

SP_1050 DT330 for gctagcgctagcTGCGTTATGCTTTTTTATGC 934883 935352 469

SP_1050 DT331 rev gctagcgctagcGCATGTTTGAATTCACTATCAG 0

SP_1088 spr0996 DT332 for tctagatctagaAATTTTCCATCCTTCTCACG 981461 982156 695 NheI NheI

SP_1088 DT333 rev tctagatctagaTTAGATTAAATCTGTCTTTTCACG 0

SP_1153 spr1041 DT334 for gctagcgctagcGTTTGCTCTTTGATTTTTATTGAG 1028574 1029752 1178 XbaI XbaI

SP_1153 DT335 rev gctagcgctagcTACTCATATCACTAATCGTTCTA 0

SP_1213 spr1094 DT336 for tctagatctagaAGGCATGATATAATGGTTACAG 1092176 1090902 -1274 NheI NheI

SP_1213 DT337 rev tctagatctagaATAACTTATTTCCTCACTCCC 0

Sp_1354 DT377 for tctagatctagaatggcattgaacattgaaaa 1274614 1274982 -369

Sp_1354 DT378 rev Tctagatctagattatttaagagtaactgaagctccag 0

SP_1504 spr1356 DT340 for gaattcgaattcTGGTATAAGGTAGTCAGTGG 1339622 1338378 -1244 NheIXbaI NheIXbaI

SP_1504 DT341 rev gaattcgaattcCTTACAATCTCTCAAACAGTTC 0

SP_1505 spr1357 DT342 for gctagcgctagcGTTTCAAAAATGGTATAATGAGAG 1340763 1339597 -1166

SP_1505 DT343 rev gctagcgctagcCTATTGTTCACTCTTGACTTC 0

SP_1536 spr1391 DT344 for tctagatctagaTTTGTAATGTTAATATAAATTTGCTA 1372460 1371711 -749 NheI NheI

SP_1536 DT345 rev tctagatctagaTTATGATCCATAATAAATCTCT 0

113

SP_1575 spr1433 DT346 for gctagcgctagcATGATGCATCTGCATATGGG 1417587 1416910 -677

SP_1575 DT347 rev gctagcgctagcGATTAATCCTTCCAGAGATCCA 0

SP_1606 spr1459 DT348 for gctagcgctagcTCCTATTCCTTACCGCATCG 1440863 1439772 -1091

SP_1606 DT349 rev gctagcgctagcCTCTAGTTTAGCACATTTCCATG 0

SP_1669 spr1513 DT350 for gctagcgctagcACTCTATGAATCTAGCCAAG 1490946 1490335 -611 NheI

SP_1669 DT351 rev gctagcgctagcTCTTCTTAGTCAAGATATTGCC 0

SP_1672 spr1516 DT352 for gctagcgctagcTGTATCAAAAATACCATCCAATG 1494205 1493609 -596

SP_1672 DT353 rev gctagcgctagcTACACTTACAACTCTGTCCG 0

SP_1725 spr1569 DT354 for gctagcgctagcATCAAATCTGGAAACCCAAC 1550199 1551164 965

SP_1725 DT355 rev gctagcgctagcGTGTTTAAATACTTTTTCCTGGTA 0

SP_1731 spr1576 DT356 for tctagatctagaGTGATAGAATAGAGGGAGTTG 1555989 1555231 -758 NheI NheI

SP_1731 DT357 rev tctagatctagaTTAGTTCATCAATACCAAGGC 0

SP_1746 spr1591 DT358 for gctagcgctagcCAGTGCTAGACTACATCGAG 1570616 1570023 -593 XbaI

SP_1746 DT359 rev gctagcgctagcTTAGTTCTCTTTCAAATAGTGC 0

SP_1751 spr1596 DT360 for tctagatctagaAATTTGTGGTACAATAGAGGG 1574370 1573474 -896 NheI NheI

SP_1751 DT361 rev tctagatctagaTTCTGGCTCCTTTTCTTAAC 0

SP_1915 spr1731 DT362 for gctagcgctagcCTTGTATTCCTAACTTAGCTTTG 1708821 1708372 -449 XbaI XbaI

SP_1915 DT363 rev gctagcgctagcTTTTACCTCATGTTTCTTAGATTT 0

SP_1980 spr1794 DT364 for gctagcgctagcATTAAACCGTCGTACCATAG 1766927 1765923 -1004

SP_1980 DT365 rev gctagcgctagcTATTAATCTAAATCTGGTTTATAGAAG 0

SP_2012 spr1825 DT366 for gctagcgctagcGCAATTCAACTCAAATAGTTG 1801033 1799954 -1079

SP_2012 DT367 rev gctagcgctagcGAATTATTTAGCAATCTTTGCG 0

SP_2024 spr1836 DT368 for gctagcgctagcCGGAATGATGAATGGAGCAAAAG 1810463 1810789 326

SP_2024 DT369 rev gctagcgctagcGATGGGAACGACAGTGTTCC 0

SP_2036 spr1847 DT370 for gctagcgctagcACTGAGAGTTATCGTTTCTG 1823836 1823351 -485

SP_2036 DT371 rev gctagcgctagcCTAACTTTCCAAATCCAATCC 0

SP_2125 spr1934 DT372 for gctagcgctagcAATAGAGGATATTTATCACGTGGAGG 1915450 1915791 341

SP_2125 DT373 rev gctagcgctagcTTAACGAGGTGGTAGTCCAAG 0

SP_2157 spr1963 DT374 for gctagcgctagcATGTTAAATAGATAGCGCGG 1951484 1950333 -1151

SP_2157 DT375 rev gctagcgctagcATTGTCGTCTAATCTCTTGC 0

114

115

Chapitre 4: Discussion et perspectives

S. pneumoniae est l’un des principaux agents pathogènes de l’homme auquel on associe un

taux élevé de morbidité et de mortalité. Les infections à S. pneumoniae demeurent un

problème de santé publique critique dû à l’émergence de plusieurs souches résistantes et

multirésistantes aux antibiotiques. D’ailleurs, cette situation est devenue le cas pour

plusieurs autres bactéries pathogènes et représente à l’heure actuelle un problème majeur de

santé publique. Aujourd’hui, la réévaluation du pouvoir thérapeutique des phages dans le

traitement des infections bactériennes offre une alternative théoriquement attirante. En

effet, les phages virulents sont naturellement programmés pour détruire une bactérie (ou un

groupe de bactéries spécifiques). Puisque les phages sont des prédateurs naturels des

bactéries, ils ont été envisagés très tôt en tant qu'outils thérapeutiques, mais ils ont aussi été

très tôt abandonnés. Le déclin de la thérapie avec les phages a coïncidé avec la naissance de

l’ère des antibiotiques. Une utilisation efficace des phages à des fins thérapeutiques exigera

une bonne compréhension de ces entités biologiques et de leurs interactions avec leurs

bactéries, et ce dans un contexte clinique.

Malgré que le génome de S. pneumoniae regorge de prophages, seulement deux phages

virulents sont facilement disponibles dans les collections publiques de phages et les essais

pour en isoler d’autres ont été peu fructueux. De plus, aucun phage virulent n’est encore

isolé pour S. mitis, une espèce phylogénétiquement proche de S. pneumoniae. S. mitis est

une bactérie pathogène responsable d’endocardite et plusieurs souches présentent aussi des

taux élevés de résistance aux antibiotiques. Ces deux espèces bactériennes ont plusieurs

points en commun dont la capacité à coloniser les voies respiratoires supérieures de

l’homme, la transition du commensalisme à la virulence et la variation de phase.

Dans le cadre de ce projet de doctorat, j’ai démontré que les pneumophages lytiques Dp-1

et SOCP étaient capables d’infecter des souches de S. mitis. De toute évidence, des

récepteurs phagiques sont similaires chez ces deux espèces bactériennes. Même si les

récepteurs de pneumophages sont pratiquement inconnus, la plupart des protéines de

surface de S. pneumoniae et des homologues de certaines de ces protéines sont présentes

116

chez S. mitis. À noter que le taux d'adsorption des pneumophages est plus élevé pour l'hôte

S. pneumoniae. Ceci pourrait être dû à un nombre limité de récepteurs phagiques chez S.

mitis, à une exposition réduite de ces récepteurs à la surface de S. mitis ou simplement une

affinité plus faible. Une autre observation des plus intéressantes est que les deux

pneumophages analysés forment des plages de lyse nettement plus visibles sur un tapis

bactérien de S. mitis que sur S. pneumoniae. Par contre, la taille de la progéniture est plus

élevée chez l’hôte S. pneumonie alors que le temps de latence est plus court chez S. mitis et

ce, pour les deux phages.

Des analyses des génomes des deux phages propagés chez les deux hôtes ont confirmé que

le changement de l’hôte bactérien n’induit aucune variation dans les génomes des

pneumophages. Cependant, les résultats de séquençage ont montré la présence de plusieurs

variations dans le génome de notre phage Cp-1 par rapport à la séquence disponible dans

GenBank. L’analyse du génome du phage Cp-1 a mené à sa réannotation et à renommer

notre phage SOCP. Il n’est pas impossible que des erreurs de séquençage ont été faites lors

de la description originale de ce phage. Le génome a été séquencé pour la première fois en

1996 environ quinze ans après l’isolement du phage et sa séquence a d’ailleurs subi

plusieurs rectifications au fil du temps. On ne sait pas ni comment ni quand cette évolution

a eu lieu. Les variations dans le génome du phage SOCP pourraient être dues à l'adaptation

du phage à son hôte et cette adaptation pourrait améliorer l'infectivité du phage, incluant la

capacité d’infecter plusieurs hôtes (Benmayor, et al., 2009). Ces variations ont augmenté la

taille de la progéniture à environ 94 UFP dans notre étude par rapport à de 9 à 11 UFP pour

le phage Cp-1 dans la publication originale (Ronda, et al., 1981). L’adaptation du phage

s’est produite à travers de nombreuses mutations dans le génome. Dans le cas du phage

SOCP, la fréquence de mutation était de 0,16%, ce qui est semblable au pourcentage

rapporté dans le cas du phage φX174 (Wichman, et al., 2005). Toutefois, ce dernier est un

phage à ADN simple brin. Ces différences d’infectivité peuvent être aussi le résultat des

conditions utilisées dans les tests et qui sont adaptées pour S. pneumoniae (Ouennane, et

al., 2015). Il est à souligner également que nous avons nettement amélioré, suite à plusieurs

essais, les conditions d’infection et de croissance des pneumophages.

117

Les principales variations dans le génome de SOCP touchent les gènes codant pour la

réplication du phage, les protéines de capside et l'encapsidation, et la protéine de liaison

aux récepteurs. Ce type de mutations a déjà été observé chez d’autres phages (Wichman, et

al., 2005, Paterson, et al., 2010, Hall, et al., 2013). Cette évolution semble avoir conféré au

phage SOCP une nette amélioration à infecter S. pneumoniae et possiblement sa capacité

d’infecter efficacement une autre espèce, S. mitis. Le pneumophage Dp-1 (Siphoviridae) est

également capable d’infecter une souche de S. mitis. Dp-1 reconnaît des récepteurs qui

contiennent des résidus de la choline, un composant de l’acide teichoïque de la paroi

bactérienne. De nombreuses protéines de liaison à la choline sont présentes chez S. mitis.

Ainsi, mes travaux ont permis d’infecter des souches de S. mitis avec deux pneumophages

et appartenant à deux familles différentes. Il serait aussi intéressant de tester des phages de

S. mitis sur des souches de S. pneumoniae. Mais en absence de phages virulents de S. mitis,

cette option n’est pas possible pour le moment. D’ailleurs, il semble que les deux espèces

bactériennes partagent le même niveau de difficulté pour isoler des nouveaux phages

virulents malgré la grande diversité des souches. La difficulté d’isoler des phages virulents

mérite une étude plus approfondie pour mieux comprendre les facteurs impliqués. Par

exemple, un des problèmes qui influence l’efficacité d’infection des souches cliniques de S.

pneumoniae est la présence de la capsule. Plusieurs souches de S. mitis ont aussi un locus

génétique fonctionnel codant pour la production de capsules (Rukke, et al., 2012). Il existe

des phages qui infectent des souches bactériennes qui produisent des capsules, mais pas

chez S. pneumoniae. Qui plus est, le niveau d’expression de la capsule est variable chez S.

pneumoniae. En effet, les variations de phase peuvent induire des altérations dans les

structures et les composantes associées à la surface, par exemple, le niveau de production

de capsules, les protéines de surface et la composition de paroi cellulaire.

Pour l’instant, les deux pneumophages à l’étude ont somme toute un potentiel relativement

limité en phagothérapie. Bien qu’ils soient capables d’éliminer à la fois S. pneumoniae et S.

mitis, ils ne peuvent infecter des souches capsulées de S. pneumoniae. De plus, avec la

grande capacité de ces bactéries à changer leur environnement génétique, leur efficacité in

vivo devra être étudiée davantage. De plus les conditions qui peuvent influencer l’efficacité

des phages, comme le mode d’administration, les concentrations des préparations

118

phagiques et les facteurs bactériens nécessaires à l’infection phagique seront aussi à

déterminer. Ce qui nous amène à notre deuxième objectif qui est l’étude des interactions

phage-hôte chez S. pneumoniae.

L’originalité de notre démarche visait à identifier des facteurs de l’hôte qui modulent

l’infection par les pneumophages. Plusieurs gènes de S. pneumoniae ont été identifiés à la

lumière des résultats d’une étude précédente sur les interactions protéine-protéine par la

technique de double hybride (Mariano, et al., 2016). Au total, 36 gènes du pneumocoque

ont fait l’objet de notre étude. Tout d’abord, l’importance de ces gènes pour la viabilité du

pneumocoque et pour la croissance bactérienne a été évaluée. Les résultats de l’inactivation

des gènes d’intérêt ont permis d’identifier huit nouveaux gènes de S. pneumoniae qui

semblent essentiels à la croissance de cette bactérie. Trois gènes liés au métabolisme

(Sp_0687, Sp_1751 et Sp_2168), deux gènes liés au stockage et au traitement de

l'information (Sp_1669 et Sp_1980), un gène intervenant dans les processus cellulaires et la

signalisation (Sp_1050) et deux gènes encore mal caractérisés (Sp_1153 et Sp_2125). En

outre, certains gènes ont aussi un effet strict sur le phénotype bactérien, comme l'hémolyse,

le changement de la taille des colonies et le taux de croissance bactérienne. À noter que ces

effets observés pourraient être aussi dus à un effet polaire suite à l'altération de l’expression

de certains gènes en aval ou à d’autres interactions intracellulaires.

Des analyses bioinformatiques supplémentaires ont été faites pour construire un réseau de

facteurs hôtes qui participent ou qui peuvent affecter l'infection par les phages. Pour ces

gènes du pneumocoque, de nombreuses interactions au sein du S. pneumoniae ont été

identifiées et ont permis de construire un grand réseau d'interactions. Ce réseau montre la

grande diversité et la complexité de ces interactions.

Par la suite, l’implication de ces facteurs de S. pneumoniae dans la réplication des deux

pneumophages virulents a été évaluée. De plus, l’efficacité du cocktail des deux phages a

aussi été vérifiée. Les tests d'infection des phages en utilisant des souches mutantes (gène

inactivé) nous ont permis d'identifier de nombreux gènes pneumococciques nécessaires à

l'infection phagique. En effet, j’ai identifié six gènes de pneumocoque essentiels à la

réplication du phage Dp-1. Il s’agit de deux gènes codant pour des protéines hypothétiques

119

(Sp_0194, Sp_1536), trois gènes impliqués dans la signalisation et les processus cellulaires

(Sp_1505, Sp_1606 et Sp_1746) et un gène participant à la transcription et à la transduction

du signal (Sp_1915). Cependant, seulement un gène (Sp_1505) a eu un impact majeur sur la

réplication du phage SOCP.

D’autre part, pour confirmer les résultats obtenus suite à l’inactivation des gènes de S.

pneumoniae et l’infection par les pneumophages, j’ai procédé à la complémentation de ces

gènes dans les souches inactivées. Dans une autre série d’expériences, j’ai aussi utilisé un

vecteur permettant la sur-expression de ces gènes. La complémentation a permis de

restaurer le phénotype sauvage et d’obtenir des résultats d’infection par les phages (EOP)

semblables à la souche sauvage; sauf pour certains gènes (Sp_0194, Sp_1208, Sp_1505,

Sp_1606, Sp_1725 et Sp_1915) où la restauration a été obtenue seulement lors de

l’augmentation du niveau d’expression des gènes.

Par ailleurs, l'impact de ces modifications génétiques a aussi été déterminé lors d’essais

avec un cocktail des deux pneumophages. Les cocktails phagiques sont de plus en plus

explorés dans les recherches sur la thérapie par les phages puisqu’il pourraient prévenir ou

réduire l'émergence de souches bactériennes résistantes aux phages. L’utilisation d’un

cocktail pourrait procurer des effets synergiques tels qu'une meilleure activité

antibactérienne par rapport aux monophages. Par opposition, il n’est pas aussi impossible

que la présence d’un phage nuise à l’activité d’un second, on parlera alors d’interférence.

Le cocktail de phages a été préparé à un titre égal de chaque phage. Dans mes expériences

de laboratoire, le cocktail de phage a montré, en général, une meilleure efficacité que le

monophage. Cela pourrait être effectivement lié à des effets synergiques et au fait que les

deux phages n’utilisent pas les mêmes facteurs de l’hôte. Cependant, une réduction de

l’EOP du cocktail de phages a été obtenue lors de la délétion du gène Sp_1395 codant pour

un régulateur transcriptionnel de la famille PhoU. Ceci pourrait être le résultat d’une

interférence entre les deux phages et qui résulte en la réduction de la taille de la progéniture

d’un des deux phages.

120

L'étude des interactions phage-bactérie a permis d'améliorer notre compréhension des

exigences des facteurs de l'hôte pour les pneumophages et a montré qu’il est essentiel de

confirmer les résultats in vitro de la Y2H. En effet, les tests de la Y2H ont été effectués

dans la levure, qui est évidemment un environnement très différent de ce qui se passe dans

une bactérie et infectée par un phage par surcroit. Il est clair que l’étude précédente avec la

Y2H (Mariano, et al., 2016) a généré des interactions faussement positives et aussi manqué

certaines interactions (faux négatifs). D’ailleurs, mes travaux dans un système in vivo, soit

l'hôte bactérien, ont aussi permis de détecter plusieurs interactions qui n’avaient pas été

identifiées par l’étude de la Y2H. Le fait d’étudier l’interaction de la totalité des gènes avec

les deux pneumophages et leur hôte nous a permis de détecter ces interactions non révélées

en Y2H.

Même s’il y avait des différences entre les deux approches; le fait de se baser initialement

sur les résultats obtenus avec la Y2H a permis de cibler rapidement certains gènes pour

notre approche in vivo. Cependant, on est conscient que cette étude n’a pas inclut tous les

gènes qui peuvent participer à ces interactions. De même, ni de déterminer en quelle étape

du cycle de réplication du phage ces facteurs de l’hôte interviennent. Malgré que la

fonction de plusieurs gènes de S. pneumoniae demeure encore mal connue, cette étude aura

permis d’ajouter des rôles à quelques gènes. Cette étude a aussi présenté un aperçu du

réseau complexe des interactions phage-hôte et a permis d’identifier plusieurs gènes de S.

pneumoniae impliqués dans la réplication des pneumophages.

L’étude de bactéries mutantes naturellement résistantes aux phages (BIMs) est

habituellement la méthode de choix pour identifier des facteurs de l’hôte impliqués dans la

réplication des phages. Ces mutants sont obtenus ou sélectionnés suite à une évolution

ciblée sur boîte de Petri en présence de quantités variables de phages. En générant de tels

mutants résistants aux phages et en séquençant leur génome, il est possible d’identifier des

facteurs de l’hôte important pour l’infection phagique. Dans une étude dans laquelle j’ai

récemment participé comme collaboratrice, les analyses d’un BIM résistant au phage SOCP

et d’un autre BIM résistant au phage Dp-1 ont permis d’identifier quelques mutations dans

le génome de S. pneumoniae (Leprohon, et al., 2015). Au total, onze mutations ont été

121

identifiées dans une souche résistante au phage SOCP et ces mutations étaient retrouvées

dans huit gènes. En parallèle, cinq mutations ont été identifiées dans une souche résistante

au phage Dp-1 et elles ciblent deux gènes. L’investigation du rôle de chaque mutation dans

l’infection phagique a permis d’identifier trois gènes de S. pneumoniae dans la résistance au

phage SOCP, soit un gène codant pour un régulateur de type GntR, un autre codant pour

une glycerophosphoryl phosphodiestérase et finalement un gène codant pour une ligase

(Mur. Un seul gène codant pour une endonucléase de type IV a été confirmé dans la

résistance au phage Dp-1 (Leprohon, et al., 2015).

Mes travaux ont également mené à la construction de souches mutantes résistantes aux

phages. En effet, la délétion de certains gènes bactériens a mené à une résistance

bactérienne contre les phages. Un gène bactérien comme étant important pour les deux

phages a été identifié, soit celui codant pour un autoinducer-2, un membre d'une famille de

molécules de signalisation. Ce gène semble jouer un rôle clé puisque son inactivation

inhibe complètement la réplication des pneumophages SOCP et Dp-1. Ce gène pourrait

peut-être contrôler la pression osmotique nécessaire pour l’éjection de l’ADN du phage et

son absence empêcher ce processus (Taga, et al., 2001, Guo, et al., 2013). Une deuxième

possibilité est l'implication de ce gène dans la libération de la descendance virale lors de la

lyse de l’hôte. Certains phages utilisent les holines pour l'exportation des endolysines de

phages vers la membrane cellulaire tandis que d'autres phages nécessitent la contribution

d'une voie de sécrétion de l'hôte (système Sec), comme c'est le cas pour les pneumophages

(Catalao, et al., 2013). L'inactivation de l'AI-2 chez S. pneumoniae pourrait moduler

négativement l'expression du système Sec de l’hôte.

Tel que mentionné précédemment, quelques gènes du pneumocoque se sont avérés

essentiels à la croissance de la bactérie. Ainsi, l’importance de ces gènes pour les

pneumophages n’a pas été étudiée puisque la délétion de ces gènes était létale pour la

bactérie. Il aurait été possible d’étudier le niveau d’expression de ces gènes suite à

l’infection par les phages et voir si effectivement se sont ces protéines qui interagissent

avec les pneumophages. Il serait aussi intéressant de vérifier si ces gènes sont aussi

importants pour d’autres phages ou dans le cas d’autres bactéries, soit en se basant sur la

122

ressemblance entre les phages ou en comparant le pourcentage d’identité de ces

gènes/protéines chez d’autres bactéries.

Cette étude aurait pu être encore plus intéressante si nous avions pu suivre la production de

l’ensemble des protéines de l’hôte à différents temps d’infection et les associer à chaque

étape du cycle de la réplication du phage. Nos données aident à définir une meilleure

compréhension du pneumocoque et des interactions avec certains de ses phages, mais il

reste clairement encore beaucoup de travail. Néanmoins, il s'agit de la première étude à

notre connaissance qui compare le résultat de l'interaction hôte-phage via deux systèmes,

dans la cellule bactérienne comme modèle in vivo et dans levure par Y2H comme modèle

in vitro. Ces deux systèmes modèles représentent une nouvelle façon de faciliter et

d'élucider les interactions hôte-phages, entre autres, pour réduire l’étude du nombre des

gènes dans la cellule hôte.

Dans ce projet, on a aussi fait face à un autre défi qui est le manque d’information sur la

fonction d’un grand nombre de gènes/protéines de S. pneumoniae. En effet, malgré la

disponibilité de la séquence du génome bactérien, la plupart des gènes ont des fonctions

inconnues ou uniquement prédites. D’ailleurs, les prédictions sur plusieurs gènes/protéines

ont grandement fluctuées au cours des cinq dernières années, ce qui a amené de

nombreuses mises à jour de notre réseau d’interactions chez S. pneumoniae.

S. pneumoniae est une bactérie qui présente plusieurs caractéristiques pour assurer sa

virulence et sa pérennité. Son passage d’un agent commensal à un pathogène est

accompagné d’un grand changement dans son réseau d’expression de gènes qui n’est pas

encore bien compris. L’usage des phages à des fins thérapeutiques nécessite d’inclure

divers scénarios du comportement des bactéries lors de l’infection. Par exemple, la

température semble avoir un grand effet sur l’expression des gènes de S. pneumoniae et

aussi sur sa virulence (Pandya, et al., 2005). Le nasopharynx, le lieu de départ de l’infection

et de la colonisation du pneumocoque, est un environnement avec une température

d’environ 33°C. Lorsque la bactérie migre au poumon, le sang et les autres organes ont une

température de 37°C mais celle-ci peut être plus élevée en cas d’infection. Même si l’écart

123

de température ne semble pas si grand, l’expression des gènes à ces températures est

différente (Pandya, et al., 2005). L’impact de ces fluctuations de température sur l’infection

par les phages et les interactions avec les facteurs de l’hôte reste à être investigué. D’autre

part, mes travaux ont aussi permis de constater l’importance de métaux pour la croissance

de la bactérie mais aussi pour l’infection phagique. S. pneumoniae est doté de nombreux

systèmes d'acquisition de métaux qui sont exposés à sa surface. Ces métaux sont

nécessaires pour l'infection invasive du pneumocoque. Dans le corps humain, la bactérie

nécessite ces métaux pour sa virulence mais on ne sait pas si les concentrations seront

suffisantes pour l’infection phagique.

Bien que cette étude de S. pneumoniae et ces deux phages virulents ne représente pas la

gamme complète des facteurs de l’hôte impliqués dans les mécanismes d'infection des

pneumophages, les résultats fournissent un nouvel aperçu sur les interactions phage-

bactérie. Réussir une thérapie avec des phages demeure encore un grand défi. De nouveaux

travaux seront nécessaires pour élucider les éléments clés pour garantir son efficacité

thérapeutique.

124

Conclusions

La résistance aux antibiotiques est maintenant un problème mondial. Cette résistance met

en évidence l'évolution des bactéries sur de nombreuses années et leurs capacités à

s’adapter suite à une pression de sélection. Il existe donc maintenant, peut-être plus que

jamais, un besoin d’alternatives thérapeutiques pour contrôler certaines infections d’origine

bactérienne. Ces alternatives doivent non seulement remplacer l’usage abusif des

antibiotiques dans le traitement des infections chez l’homme mais aussi doivent être en

mesure de les remplacer dans l’agriculture et la pisciculture. Ces nouvelles options

pourraient même être utilisées en synergie avec les antibiotiques. Peut-être faut-il laisser la

nature faire son œuvre et tenter ensuite de la domestiquer. Les phages sont les entités

biologiques les plus abondantes sur la planète. Puisqu’ils sont spécifiques à un groupe

restreint de bactéries, ils n’interviennent que là où sont leurs bactéries hôtes. Auparavant, la

thérapie par phage a été appliquée sans aucune connaissance préalable de ces virus

bactériens, il suffisait d’isoler le bon phage efficace sur la « bonne » souche bactérienne

pour l’utiliser. Cette approche a mené à de nombreux échecs avant de réussir une thérapie

ou une préparation à des fins thérapeutiques. Ce manque de connaissances a précipité le

déclin de cette thérapie, surtout avec l’arrivée des antibiotiques. Aujourd’hui, l’intérêt pour

les phages est revenu et il ne faudrait pas répéter les mêmes erreurs. Cette thèse a permis

d’approfondir nos connaissances sur les pneumophages et sur leur souche hôte. Néanmoins,

notre compréhension de cette mélodie jouée par ces deux chefs d’orchestre et les éléments

qui la définissent reste encore mal comprise. De nombreuses questions demeurent sans

réponses ou ne sont pas encore profondément comprises dont les comportements de phages

in vivo, ainsi que les paramètres requis pour une application efficace de la thérapie par

phage. Les prochaines années seront sans aucun doute très intéressantes puisque de plus en

plus d’équipes de recherche et d’entreprises s’intéressent aux applications médicales des

phages.

125

Bibliographie

Abedon, S. T., S. J. Kuhl, B. G. Blasdel, and E. M. Kutter. 2011. Phage treatment of

human infections. Bacteriophage 1:66-85.

Abedon, S. T., C. Thomas-Abedon, A. Thomas, and H. Mazure. 2011. Bacteriophage

prehistory: is or is not Hankin, 1896, a phage reference? Bacteriophage 1:174-178.

Ackermann, H. W. 2007. 5500 phages examined in the electron microscope. Arch Virol

152:227-243.

Ackermann, H. W. 2009. Phage classification and characterization. Methods Mol Bio

501:127-140.

Adegbola, R. A., R. DeAntonio, P. C. Hill, A. Roca, E. Usuf, B. Hoet, and B. M.

Greenwood. 2014. Carriage of Streptococcus pneumoniae and other respiratory

bacterial pathogens in low and lower-middle income countries: a systematic review

and meta-analysis. PLoS One 9:e103293.

Adriaenssens, E. M., H. W. Ackermann, H. Anany, B. Blasdel, I. F. Connerton, D.

Goulding, M. W. Griffiths, S. P. Hooton, E. M. Kutter, A. M. Kropinski, J. H.

Lee, M. Maes, D. Pickard, S. Ryu, Z. Sepehrizadeh, S. S. Shahrbabak, A. L.

Toribio, and R. Lavigne. 2012. A suggested new bacteriophage genus:

"Viunalikevirus". Arch Virol 157:2035-2046.

Afzal, M., S. Shafeeq, I. Manzoor, and O. P. Kuipers. 2015. Maltose-dependent

transcriptional regulation of the mal regulon by MalR in Streptococcus pneumoniae.

PLoS One 10:e0127579.

Agari, Y., K. Sakamoto, M. Tamakoshi, T. Oshima, S. Kuramitsu, and A. Shinkai. 2010. Transcription profile of Thermus thermophilus CRISPR systems after phage

infection. J Mol Bio 395:270-281.

Akira, S., S. Uematsu, and O. Takeuchi. 2006. Pathogen recognition and innate

immunity. Cell 124:783-801.

Alekshun, M. N., and S. B. Levy. 2006. Commensals upon us. Biochem Pharmacol

71:893-900.

Alexandre, Y., G. Le Blay, S. Boisrame-Gastrin, F. Le Gall, G. Hery-Arnaud, S.

Gouriou, S. Vallet, and R. Le Berre. 2014. Probiotics: a new way to fight

bacterial pulmonary infections? Med Mal Infect 44:9-17.

Allan, E., H. A. Hussain, K. R. Crawford, S. Miah, Z. K. Ascott, M. H. Khwaja, and

A. H. Hosie. 2007. Genetic variation in comC, the gene encoding competence-

stimulating peptide (CSP) in Streptococcus mutans. FEMS Microbiol Lett 268:47-

51.

Allen, H. K., J. Donato, H. H. Wang, K. A. Cloud-Hansen, J. Davies, and J.

Handelsman. 2010. Call of the wild: antibiotic resistance genes in natural

environments. Nat Rev Microbiol 8:251-259.

AlonsoDeVelasco, E., A. F. Verheul, J. Verhoef, and H. Snippe. 1995. Streptococcus

pneumoniae: virulence factors, pathogenesis, and vaccines. Microbiol Rev 59:591-

603.

Amalaradjou, M. A., and A. K. Bhunia. 2012. Modern approaches in probiotics research

to control foodborne pathogens. Adv Food Nutr Res 67:185-239.

126

Amblee, V., and C. J. Jeffery. 2015. Physical features of intracellular proteins that

moonlight on the cell surface. PLoS One 10:e0130575.

Andersson, D. I., and D. Hughes. 2010. Antibiotic resistance and its cost: is it possible to

reverse resistance? Nat Rev Microbiol 8:260-271.

Arai, J., M. Hotomi, S. K. Hollingshead, Y. Ueno, D. E. Briles, and N. Yamanaka. 2011. Streptococcus pneumoniae isolates from middle ear fluid and nasopharynx of

children with acute otitis media exhibit phase variation. J Clin Microbiol 49:1646-

1649.

Arbique, J. C., C. Poyart, P. Trieu-Cuot, G. Quesne, G. Carvalho Mda, A. G.

Steigerwalt, R. E. Morey, D. Jackson, R. J. Davidson, and R. R. Facklam. 2004.

Accuracy of phenotypic and genotypic testing for identification of Streptococcus

pneumoniae and description of Streptococcus pseudopneumoniae sp. nov. J Clin

Microbiol 42:4686-4696.

Avery, O. T., C. M. Macleod, and M. McCarty. 1944. Studies on the chemical nature of

the substance inducing transformation of pneumococcal types: induction of

transformation by a desoxyribonucleic acid fraction isolated from pneumococcus

type III. J Exp Med 79:137-158.

Bagnoli, F., M. Moschioni, C. Donati, V. Dimitrovska, I. Ferlenghi, C. Facciotti, A.

Muzzi, F. Giusti, C. Emolo, A. Sinisi, M. Hilleringmann, W. Pansegrau, S.

Censini, R. Rappuoli, A. Covacci, V. Masignani, and M. A. Barocchi. 2008. A

second pilus type in Streptococcus pneumoniae is prevalent in emerging serotypes

and mediates adhesion to host cells. J Bacteriol 190:5480-5492.

Baker, J. R., S. Dong, and D. G. Pritchard. 2002. The hyaluronan lyase of Streptococcus

pyogenes bacteriophage H4489A. Biochem J 365:317-322.

Bakhshinejad, B., and M. Sadeghizadeh. 2014. Bacteriophages and their applications in

the diagnosis and treatment of hepatitis B virus infection. World J Gastroenterol

20:11671-11683.

Bakhshinejad, B., and M. Sadeghizadeh. 2014. Bacteriophages as vehicles for gene

delivery into mammalian cells: prospects and problems. Expert Opin Drug Deliv:1-

14.

Balogh, B., J. B. Jones, F. B. Iriarte, and M. T. Momol. 2010. Phage therapy for plant

disease control. Curr Pharm Biotechnol 11:48-57.

Barendt, S. M., L. T. Sham, and M. E. Winkler. 2011. Characterization of mutants

deficient in the L,D-carboxypeptidase (DacB) and WalRK (VicRK) regulon,

involved in peptidoglycan maturation of Streptococcus pneumoniae serotype 2

strain D39. J Bacteriol 193:2290-2300.

Barocchi, M. A., S. Censini, and R. Rappuoli. 2007. Vaccines in the era of genomics: the

pneumococcal challenge. Vaccine 25:2963-2973.

Barocchi, M. A., J. Ries, X. Zogaj, C. Hemsley, B. Albiger, A. Kanth, S. Dahlberg, J.

Fernebro, M. Moschioni, V. Masignani, K. Hultenby, A. R. Taddei, K. Beiter,

F. Wartha, A. von Euler, A. Covacci, D. W. Holden, S. Normark, R. Rappuoli,

and B. Henriques-Normark. 2006. A pneumococcal pilus influences virulence and

host inflammatory responses. Proc Natl Acad Sci U S A 103:2857-2862.

Bartual, S. G., D. Straume, G. A. Stamsas, I. G. Munoz, C. Alfonso, M. Martinez-

Ripoll, L. S. Havarstein, and J. A. Hermoso. 2014. Structural basis of PcsB-

mediated cell separation in Streptococcus pneumoniae. Nat Commun 5:3842.

127

Bashir, S., B. M. Khan, M. Babar, S. Andleeb, M. Hafeez, S. Ali, and M. F. Khan. 2014. Assessment of bioautography and spot screening of tlc of green tea

(Camellia) plant extracts as antibacterial and antioxidant agents. Indian J Pharm Sci

76:364-370.

Bedi, D., T. Musacchio, O. A. Fagbohun, J. W. Gillespie, P. Deinnocentes, R. C. Bird,

L. Bookbinder, V. P. Torchilin, and V. A. Petrenko. 2011. Delivery of siRNA

into breast cancer cells via phage fusion protein-targeted liposomes. Nanomedicine

7:315-323.

Bedos, J. P., C. Rivier, E. Azoulay-Dupuis, and P. Moine. 1999. Current microbiologic

problems. Pulmonary infection by Streptococcus pneumoniae. Current

physiopathological aspects. Presse Med 28:442-449.

Beilharz, K., L. Novakova, D. Fadda, P. Branny, O. Massidda, and J. W. Veening. 2012. Control of cell division in Streptococcus pneumoniae by the conserved

Ser/Thr protein kinase StkP. Proc Natl Acad Sci U S A 109:E905-913.

Belanger, A. E., M. J. Clague, J. I. Glass, and D. J. LeBlanc. 2004. Pyruvate oxidase is a

determinant of Avery's rough morphology. J Bacteriol 186:8164-8171.

Benmayor, R., D. J. Hodgson, G. G. Perron, and A. Buckling. 2009. Host mixing and

disease emergence. Curr Biol 19:764-767.

Bensing, B. A., I. R. Siboo, and P. M. Sullam. 2001. Proteins PblA and PblB of

Streptococcus mitis, which promote binding to human platelets, are encoded within

a lysogenic bacteriophage. Infect Immun 69:6186-6192.

Berge, M., M. Moscoso, M. Prudhomme, B. Martin, and J. P. Claverys. 2002. Uptake

of transforming DNA in Gram-positive bacteria: a view from Streptococcus

pneumoniae. Mol Microbiol 45:411-421.

Bergman, P., L. Johansson, V. Asp, L. Plant, G. H. Gudmundsson, A. B. Jonsson, and

B. Agerberth. 2005. Neisseria gonorrhoeae downregulates expression of the

human antimicrobial peptide LL-37. Cell Microbiol 7:1009-1017.

Bergmann, S., and S. Hammerschmidt. 2006. Versatility of pneumococcal surface

proteins. Microbiology 152:295-303.

Bermudez-Brito, M., J. Plaza-Díaz, S. Muñoz-Quezada, C. Gómez-Llorente, and A.

Gil. 2012. Probiotic mechanisms of action. Ann Nutr Metab 61:160-174.

Berry, A. M., R. A. Lock, and J. C. Paton. 1996. Cloning and characterization of nanB, a

second Streptococcus pneumoniae neuraminidase gene, and purification of the

NanB enzyme from recombinant Escherichia coli. J Bacteriol 178:4854-4860.

Berry, A. M., A. D. Ogunniyi, D. C. Miller, and J. C. Paton. 1999. Comparative

virulence of Streptococcus pneumoniae strains with insertion-duplication, point, and

deletion mutations in the pneumolysin gene. Infect Immun 67:981-985.

Bertozzi Silva, J., and D. Sauvageau. 2014. Bacteriophages as antimicrobial agents

against bacterial contaminants in yeast fermentation processes. Biotechnol Biofuels

7:123.

Bidnenko, E., S. D. Ehrlich, and M. C. Chopin. 1998. Lactococcus lactis phage operon

coding for an endonuclease homologous to RuvC. Mol Microbiol 28:823-834.

Biswas, B., S. Adhya, P. Washart, B. Paul, A. N. Trostel, B. Powell, R. Carlton, and C.

R. Merril. 2002. Bacteriophage therapy rescues mice bacteremic from a clinical

isolate of vancomycin-resistant Enterococcus faecium. Infect Immun 70:204-210.

128

Blower, T. R., T. J. Evans, R. Przybilski, P. C. Fineran, and G. P. Salmond. 2012.

Viral evasion of a bacterial suicide system by RNA-based molecular mimicry

enables infectious altruism. PLoS Genet 8:e1003023.

Blower, T. R., F. L. Short, P. C. Fineran, and G. P. Salmond. 2012. Viral molecular

mimicry circumvents abortive infection and suppresses bacterial suicide to make

hosts permissive for replication. Bacteriophage 2:234-238.

Bogaert, D., R. De Groot, and P. W. Hermans. 2004. Streptococcus pneumoniae

colonisation: the key to pneumococcal disease. Lancet Infect Dis 4:144-154.

Bondy-Denomy, J., A. Pawluk, K. L. Maxwell, and A. R. Davidson. 2013.

Bacteriophage genes that inactivate the CRISPR/Cas bacterial immune system.

Nature 493:429-432.

Borysowski, J., B. Weber-Dabrowska, and A. Gorski. 2006. Bacteriophage endolysins

as a novel class of antibacterial agents. Exp Biol Med 231:366-377.

Boudreau, M. A., J. F. Fisher, and S. Mobashery. 2012. Messenger functions of the

bacterial cell wall-derived muropeptides. Biochemistry 51:2974-2990.

Bowdish, D. M., D. J. Davidson, Y. E. Lau, K. Lee, M. G. Scott, and R. E. Hancock. 2005. Impact of LL-37 on anti-infective immunity. J Leukoc Biol 77:451-459.

Braff, M. H., A. Bardan, V. Nizet, and R. L. Gallo. 2005. Cutaneous defense

mechanisms by antimicrobial peptides. J Invest Dermatol 125:9-13.

Brealey, J. C., P. D. Sly, P. R. Young, and K. J. Chappell. 2015. Viral bacterial co-

infection of the respiratory tract during early childhood. FEMS Microbiol Lett 362.

Breitbart, M., and F. Rohwer. 2005. Here a virus, there a virus, everywhere the same

virus? Trends Microbiol 13:278-284.

Brogden, K. A. 2005. Antimicrobial peptides: pore formers or metabolic inhibitors in

bacteria? Nat Rev Microbiol 3:238-250.

Brouns, S. J., M. M. Jore, M. Lundgren, E. R. Westra, R. J. Slijkhuis, A. P. Snijders,

M. J. Dickman, K. S. Makarova, E. V. Koonin, and J. van der Oost. 2008.

Small CRISPR RNAs guide antiviral defense in prokaryotes. Science 321:960-964.

Brown, A. O., B. Mann, G. Gao, J. S. Hankins, J. Humann, J. Giardina, P. Faverio,

M. I. Restrepo, G. V. Halade, E. M. Mortensen, M. L. Lindsey, M. Hanes, K. I.

Happel, S. Nelson, G. J. Bagby, J. A. Lorent, P. Cardinal, R. Granados, A.

Esteban, C. J. LeSaux, E. I. Tuomanen, and C. J. Orihuela. 2014. Streptococcus

pneumoniae translocates into the myocardium and forms unique microlesions that

disrupt cardiac function. PLoS Pathog 10:e1004383.

Brown, J. S., S. M. Gilliland, and D. W. Holden. 2001. A Streptococcus pneumoniae

pathogenicity island encoding an ABC transporter involved in iron uptake and

virulence. Mol Microbiol 40:572-585.

Brueggemann, A. B., C. L. Harrold, R. Rezaei Javan, A. J. van Tonder, A. J.

McDonnell, and B. A. Edwards. 2017. Pneumococcal prophages are diverse, but

not without structure or history. Sci Rep 7:42976.

Bull, J. J., A. Jacobson, M. R. Badgett, and I. J. Molineux. 1998. Viral escape from

antisense RNA. Mol Microbiol 28:835-846.

Calix, J. J., and M. H. Nahm. 2010. A new pneumococcal serotype, 11E, has a variably

inactivated wcjE gene. J Infect Dis 202:29-38.

Campbell, E. A., S. Y. Choi, and H. R. Masure. 1998. A competence regulon in

Streptococcus pneumoniae revealed by genomic analysis. Mol Microbiol 27:929-

939.

129

Carmona-Ribeiro, A. M., and L. D. de Melo Carrasco. 2014. Novel formulations for

antimicrobial peptides. Int J Mol Sci 15:18040-18083.

Carrascosa, M., J. L. Perez-Castrillon, I. Sampedro, R. Valle, L. Cillero, and M. A.

Mendez. 1994. Lung abscess due to Streptococcus mitis: case report and review.

Clin Infect Dis 19:781-783.

Carrolo, M., M. J. Frias, F. R. Pinto, J. Melo-Cristino, and M. Ramirez. 2010.

Prophage spontaneous activation promotes DNA release enhancing biofilm

formation in Streptococcus pneumoniae. PLoS One 5:e15678.

Catalao, M. J., F. Gil, J. Moniz-Pereira, C. Sao-Jose, and M. Pimentel. 2013. Diversity

in bacterial lysis systems: bacteriophages show the way. FEMS Microbiol Rev

37:554-571.

Cerveny, K. E., A. DePaola, D. H. Duckworth, and P. A. Gulig. 2002. Phage therapy of

local and systemic disease caused by Vibrio vulnificus in iron-dextran-treated mice.

Infect Immun 70:6251-6262.

Cerveny, L., A. Straskova, V. Dankova, A. Hartlova, M. Ceckova, F. Staud, and J.

Stulik. 2013. Tetratricopeptide repeat motifs in the world of bacterial pathogens:

role in virulence mechanisms. Infect Immun 81:629-635.

Chan, B. K., and S. T. Abedon. 2012. Phage therapy pharmacology phage cocktails. Adv

Appl Microbiol 78:1-23.

Chan, B. K., S. T. Abedon, and C. Loc-Carrillo. 2013. Phage cocktails and the future of

phage therapy. Future Microbiol 8:769-783.

Chao, Y., L. R. Marks, M. M. Pettigrew, and A. P. Hakansson. 2014. Streptococcus

pneumoniae biofilm formation and dispersion during colonization and disease.

Front Cell Infect Microbiol 4:194.

Chatterjee, S., and E. Rothenberg. 2012. Interaction of bacteriophage l with its E. coli

receptor, LamB. Viruses 4:3162-3178.

Chen, I., and D. Dubnau. 2004. DNA uptake during bacterial transformation. Nat Rev

Microbiol 2:241-249.

Claverys, J.-P., and L. S. Havarstein. 2007. Cannibalism and fratricide: mechanisms and

raisons d'etre. Nat Rev Microbiol 5:219-229.

Clokie, M. R., A. D. Millard, A. V. Letarov, and S. Heaphy. 2011. Phages in nature.

Bacteriophage 1:31-45.

Cornelissen, A., P. J. Ceyssens, V. N. Krylov, J. P. Noben, G. Volckaert, and R.

Lavigne. 2012. Identification of EPS-degrading activity within the tail spikes of the

novel Pseudomonas putida phage AF. Virology 434:251-256.

Courvalin, P. 2006. Antibiotic resistance: the pros and cons of probiotics. Dig Liver Dis

38 Suppl 2:S261-265.

Cowen, L. E. 2008. The evolution of fungal drug resistance: modulating the trajectory

from genotype to phenotype. Nat Rev Microbiol 6:187-198.

Croucher, N. J., L. Kagedan, C. M. Thompson, J. Parkhill, S. D. Bentley, J. A.

Finkelstein, M. Lipsitch, and W. P. Hanage. 2015. Selective and genetic

constraints on pneumococcal serotype switching. PLoS Genet 11:e1005095.

d'Hérelle, F. 1931. Bacteriophage as a treatment in acute medical and surgical infections.

Bull N Y Acad Med 7:329-348.

D'Hérelle, F. 2007. On an invisible microbe antagonistic toward dysenteric bacilli: brief

note by Mr. F. D'Herelle, presented by Mr. Roux. 1917. Res Microbiol 158:553-

554.

130

Daniel, R. A., and J. Errington. 2003. Control of cell morphogenesis in bacteria: two

distinct ways to make a rod-shaped cell. Cell 113:767-776.

Davies, J., and D. Davies. 2010. Origins and evolution of antibiotic resistance. Microbiol

Mol Biol Rev 74:417-433.

De Vos, W. M. 1987. Gene cloning and expression in lactic streptococci. FEMS Microbiol

Lett 46:281-295.

den Blaauwen, T., M. A. de Pedro, M. Nguyen-Disteche, and J. A. Ayala. 2008.

Morphogenesis of rod-shaped sacculi. FEMS Microbiol Rev 32:321-344.

Denapaite, D., R. Bruckner, M. Nuhn, P. Reichmann, B. Henrich, P. Maurer, Y.

Schahle, P. Selbmann, W. Zimmermann, R. Wambutt, and R. Hakenbeck. 2010. The genome of Streptococcus mitis B6--what is a commensal? PLoS One

5:e9426.

Deresinski, S. 2009. Bacteriophage therapy: exploiting smaller fleas. Clin Infect Dis

48:1096-1101.

Deutscher, S. L. 2010. Phage display in molecular imaging and diagnosis of cancer. Chem

Rev 110:3196-3211.

Deveau, H., R. Barrangou, J. E. Garneau, J. Labonte, C. Fremaux, P. Boyaval, D. A.

Romero, P. Horvath, and S. Moineau. 2008. Phage response to CRISPR-encoded

resistance in Streptococcus thermophilus. J Bacteriol 190:1390-1400.

Dintilhac, A., G. Alloing, C. Granadel, and J. P. Claverys. 1997. Competence and

virulence of Streptococcus pneumoniae: Adc and PsaA mutants exhibit a

requirement for Zn and Mn resulting from inactivation of putative ABC metal

permeases. Mol Microbiol 25:727-739.

Djurkovic, S., J. M. Loeffler, and V. A. Fischetti. 2005. Synergistic killing of

Streptococcus pneumoniae with the bacteriophage lytic enzyme Cpl-1 and penicillin

or gentamicin depends on the level of penicillin resistance. Antimicrob Agents

Chemother 49:1225-1228.

Doehn, J. M., K. Fischer, K. Reppe, B. Gutbier, T. Tschernig, A. C. Hocke, V. A.

Fischetti, J. Loffler, N. Suttorp, S. Hippenstiel, and M. Witzenrath. 2013.

Delivery of the endolysin Cpl-1 by inhalation rescues mice with fatal pneumococcal

pneumonia. J Antimicrob Chemother 68:2111-2117.

Doern, C. D., and C. A. Burnham. 2010. It's not easy being green: the viridans group

streptococci, with a focus on pediatric clinical manifestations. J Clin Microbiol

48:3829-3835.

Domingues, S., A. Chopin, S. D. Ehrlich, and M. C. Chopin. 2004. A phage protein

confers resistance to the lactococcal abortive infection mechanism AbiP. J Bacteriol

186:3278-3281.

Domingues, S., K. M. Nielsen, and G. J. da Silva. 2012. Various pathways leading to the

acquisition of antibiotic resistance by natural transformation. Mob Gen Elements

2:257-260.

Donkor, E. S. 2013. Understanding the pneumococcus: transmission and evolution. Front

Cell Infect Microbiol 3:7.

Dublanchet, A., and S. Bourne. 2007. The epic of phage therapy. Can J Infect Dis Med

Microbiol 18:15-18.

Dubreuil, J. D. 2013. Antibacterial and antidiarrheal activities of plant products against

enterotoxinogenic Escherichia coli. Toxins 5:2009-2041.

Duckworth, D. H. 1976. "Who discovered bacteriophage?". Bacteriol Rev 40:793-802.

131

Duplessis, M., and S. Moineau. 2001. Identification of a genetic determinant responsible

for host specificity in Streptococcus thermophilus bacteriophages. Mol Microbiol

41:325-336.

Dupuis, M. E., M. Villion, A. H. Magadan, and S. Moineau. 2013. CRISPR-Cas and

restriction-modification systems are compatible and increase phage resistance. Nat

Commun 4:2087.

Duran-Reynals, F. 1933. Studies on a certain spreading factor existing in bacteria and its

significance for bacterial invasiveness. J Exp Med 58:161-181.

Durmaz, E., and T. R. Klaenhammer. 2007. Abortive phage resistance mechanism AbiZ

speeds the lysis clock to cause premature lysis of phage-infected Lactococcus lactis.

J Bacteriol 189:1417-1425.

Durmaz, E., S. M. Madsen, H. Israelsen, and T. R. Klaenhammer. 2002. Lactococcus

lactis lytic bacteriophages of the P335 group are inhibited by overexpression of a

truncated CI repressor. J Bacteriol 184:6532-6544.

Ellis, E. L., and M. Delbruck. 1939. The growth of bacteriophage. J Gen Physiol 22:365-

384.

Fadda, D., A. Santona, V. D'Ulisse, P. Ghelardini, M. G. Ennas, M. B. Whalen, and O.

Massidda. 2007. Streptococcus pneumoniae DivIVA: localization and interactions

in a MinCD-free context. J Bacteriol 189:1288-1298.

Falconer, S. B., T. L. Czarny, and E. D. Brown. 2011. Antibiotics as probes of biological

complexity. Nat Chem Biol 7:415-423.

Fani, F., P. Leprohon, D. Legare, and M. Ouellette. 2011. Whole genome sequencing of

penicillin-resistant Streptococcus pneumoniae reveals mutations in penicillin-

binding proteins and in a putative iron permease. Genome Biol 12:R115.

Feiner, R., T. Argov, L. Rabinovich, N. Sigal, I. Borovok, and A. A. Herskovits. 2015.

A new perspective on lysogeny: prophages as active regulatory switches of bacteria.

Nat Rev Microbiol 13:641-650.

Fenner, F. 1995. ICNV 1966 to ICTV 1994: The contribution of veterinary virology. Vet

Microbiol 46:3-13.

Fernandez-Cotarelo, M. J., F. Lopez-Medrano, R. San Juan, C. Diaz-Pedroche, M.

Lizasoain, F. Chaves, and J. M. Aguado. 2007. Protean manifestations of pleural

empyema caused by Streptococcus pneumoniae in adults. Eur J Intern Med 18:141-

145.

Fillon, S., K. Soulis, S. Rajasekaran, H. Benedict-Hamilton, J. N. Radin, C. J.

Orihuela, K. C. El Kasmi, G. Murti, D. Kaushal, M. W. Gaber, J. R. Weber, P.

J. Murray, and E. I. Tuomanen. 2006. Platelet-activating factor receptor and

innate immunity: uptake of gram-positive bacterial cell wall into host cells and cell-

specific pathophysiology. J Immunol 177:6182-6191.

Fischetti, V. A., D. Nelson, and R. Schuch. 2006. Reinventing phage therapy: are the

parts greater than the sum? Nat Biotechnol 24:1508-1511.

Fiser, A., S. R. Filipe, and A. Tomasz. 2003. Cell wall branches, penicillin resistance and

the secrets of the MurM protein. Trends Microbiol 11:547-553.

Fleurie, A., C. Lesterlin, S. Manuse, C. Zhao, C. Cluzel, J. P. Lavergne, M. Franz-

Wachtel, B. Macek, C. Combet, E. Kuru, M. S. VanNieuwenhze, Y. V. Brun, D.

Sherratt, and C. Grangeasse. 2014. MapZ marks the division sites and positions

FtsZ rings in Streptococcus pneumoniae. Nature 516:259-262.

132

Fokine, A., and M. G. Rossmann. 2014. Molecular architecture of tailed double-stranded

DNA phages. Bacteriophage 4:e28281.

Fox, J. L. 2013. Anthrax drug first antibacterial mAb to win approval. Nat Biotechnol

31:8.

Frias, M. J., J. Melo-Cristino, and M. Ramirez. 2013. Export of the pneumococcal phage

SV1 lysin requires choline-containing teichoic acids and is holin-independent. Mol

Microbiol 87:430-445.

Fujimori, S., K. Gudis, K. Mitsui, T. Seo, M. Yonezawa, S. Tanaka, A. Tatsuguchi,

and C. Sakamoto. 2009. A randomized controlled trial on the efficacy of synbiotic

versus probiotic or prebiotic treatment to improve the quality of life in patients with

ulcerative colitis. Nutrition 25:520-525.

Galperin, M. Y., D. A. Natale, L. Aravind, and E. V. Koonin. 1999. A specialized

version of the HD hydrolase domain implicated in signal transduction. J Mol

Microbiol Biotechnol 1:303-305.

Ganju, L., D. Karan, S. Chanda, K. K. Srivastava, R. C. Sawhney, and W.

Selvamurthy. 2003. Immunomodulatory effects of agents of plant origin. Biomed

Pharmacother 57:296-300.

Garneau, J. E., and S. Moineau. 2001. CRISPR/Cas system and resistance to

bacteriophage infection. In: eLS. John Wiley & Sons, Ltd.

Geno, K. A., G. L. Gilbert, J. Y. Song, I. C. Skovsted, K. P. Klugman, C. Jones, H. B.

Konradsen, and M. H. Nahm. 2015. Pneumococcal capsules and their types: past,

present, and future. Clin Microbiol Rev 28:871-899.

Gilmore, M. S., and W. Haas. 2005. The selective advantage of microbial fratricide. Proc

Natl Acad Sci U S A 102:8401-8402.

Gindreau, E., R. Lopez, and P. Garcia. 2000. MM1, a temperate bacteriophage of the

type 23F Spanish/USA multiresistant epidemic clone of Streptococcus pneumoniae:

structural analysis of the site-specific integration system. J Virol 74:7803-7813.

Goeders, N., and L. Van Melderen. 2014. Toxin-antitoxin systems as multilevel

interaction systems. Toxins 6:304-324.

Goerke, C., C. Wirtz, U. Fluckiger, and C. Wolz. 2006. Extensive phage dynamics in

Staphylococcus aureus contributes to adaptation to the human host during infection.

Mol Microbiol 61:1673-1685.

Goffin, C., and J. M. Ghuysen. 1998. Multimodular penicillin-binding proteins: an

enigmatic family of orthologs and paralogs. Microbiol Mol Biol Rev 62:1079-1093.

Gomez-Estaca, J., A. Lopez de Lacey, M. E. Lopez-Caballero, M. C. Gomez-Guillen,

and P. Montero. 2010. Biodegradable gelatin-chitosan films incorporated with

essential oils as antimicrobial agents for fish preservation. Food Microbiol 27:889-

896.

Grimoud, J., H. Durand, C. Courtin, P. Monsan, F. Ouarne, V. Theodorou, and C.

Roques. 2010. In vitro screening of probiotic lactic acid bacteria and prebiotic

glucooligosaccharides to select effective synbiotics. Anaerobe 16:493-500.

Gu, J., X. Liu, Y. Li, W. Han, L. Lei, Y. Yang, H. Zhao, Y. Gao, J. Song, R. Lu, C.

Sun, and X. Feng. 2012. A method for generation phage cocktail with great

therapeutic potential. PLoS One 7:e31698.

Gualdi, L., J. K. Hayre, A. Gerlini, A. Bidossi, L. Colomba, C. Trappetti, G. Pozzi, J.

D. Docquier, P. Andrew, S. Ricci, and M. R. Oggioni. 2012. Regulation of

neuraminidase expression in Streptococcus pneumoniae. BMC Microbiol 12:200.

133

Guiral, S., T. J. Mitchell, B. Martin, and J. P. Claverys. 2005. Competence-programmed

predation of noncompetent cells in the human pathogen Streptococcus pneumoniae:

genetic requirements. Proc Natl Acad Sci U S A 102:8710-8715.

Guo, M., S. Gamby, Y. Zheng, and H. O. Sintim. 2013. Small molecule inhibitors of AI-

2 signaling in bacteria: state-of-the-art and future perspectives for anti-quorum

sensing agents. Int J Mol Sci 14:17694-17728.

Guo, Y., C. Quiroga, Q. Chen, M. J. McAnulty, M. J. Benedik, T. K. Wood, and X.

Wang. 2014. RalR (a DNase) and RalA (a small RNA) form a type I toxin-antitoxin

system in Escherichia coli. Nucleic Acids Res 42:6448-6462.

Gutierrez, A., L. Laureti, S. Crussard, H. Abida, A. Rodriguez-Rojas, J. Blazquez, Z.

Baharoglu, D. Mazel, F. Darfeuille, J. Vogel, and I. Matic. 2013. Beta-Lactam

antibiotics promote bacterial mutagenesis via an RpoS-mediated reduction in

replication fidelity. Nat Commun 4:1610.

Haaber, J., J. E. Samson, S. J. Labrie, V. Campanacci, C. Cambillau, S. Moineau, and

K. Hammer. 2010. Lactococcal abortive infection protein AbiV interacts directly

with the phage protein SaV and prevents translation of phage proteins. Appl

Environ Microbiol 76:7085-7092.

Haba, E., S. Bouhdid, N. Torrego-Solana, A. M. Marqués, M. J. Espuny, M. J. García-

Celma, and A. Manresa. 2014. Rhamnolipids as emulsifying agents for essential

oil formulations: antimicrobial effect against Candida albicans and methicillin-

resistant Staphylococcus aureus. Int J Pharm 476:134-141.

Hall, J. P., E. Harrison, and M. A. Brockhurst. 2013. Viral host-adaptation: insights

from evolution experiments with phages. Curr Opin Virol 3:572-577.

Hammerschmidt, S. 2006. Adherence molecules of pathogenic pneumococci. Curr Opin

Microbiol 9:12-20.

Hancock, R. E., A. Nijnik, and D. J. Philpott. 2012. Modulating immunity as a therapy

for bacterial infections. Nat Rev Microbiol 10:243-254.

Hancock, R. E., and H. G. Sahl. 2006. Antimicrobial and host-defense peptides as new

anti-infective therapeutic strategies. Nat Biotechnol 24:1551-1557.

Hauser, R., M. Sabri, S. Moineau, and P. Uetz. 2011. The proteome and interactome of

Streptococcus pneumoniae phage Cp-1. J Bacteriol 193:3135-3138.

Hava, D. L., and A. Camilli. 2002. Large-scale identification of serotype 4 Streptococcus

pneumoniae virulence factors. Mol Microbiol 45:1389-1406.

Havarstein, L. S., B. Martin, O. Johnsborg, C. Granadel, and J. P. Claverys. 2006.

New insights into the pneumococcal fratricide: relationship to clumping and

identification of a novel immunity factor. Mol Microbiol 59:1297-1307.

Hemarajata, P., and J. Versalovic. 2013. Effects of probiotics on gut microbiota:

mechanisms of intestinal immunomodulation and neuromodulation. Therap Adv

Gastroenterol 6:39-51.

Henderson-Begg, S. K., D. M. Livermore, and L. M. Hall. 2006. Effect of subinhibitory

concentrations of antibiotics on mutation frequency in Streptococcus pneumoniae. J

Antimicrob Chemother 57:849-854.

Hendrix, R. W. 2002. Bacteriophages: evolution of the majority. Theor Popul Biol 61:471-

480.

Hendrix, R. W. 2003. Bacteriophage genomics. Curr Opin Microbiol 6:506-511.

Henke, J. M., and B. L. Bassler. 2004. Quorum sensing regulates type III secretion in

Vibrio harveyi and Vibrio parahaemolyticus. J Bacteriol 186:3794-3805.

134

Henriques-Normark, B., and E. I. Tuomanen. 2013. The pneumococcus: epidemiology,

microbiology, and pathogenesis. Cold Spring Harb Perspect Med 3:7 a010215.

Henry, M., and L. Debarbieux. 2012. Tools from viruses: bacteriophage successes and

beyond. Virology 434:151-161.

Higgins, M. L., and G. D. Shockman. 1970. Model for cell wall growth of Streptococcus

faecalis. J Bacteriol 101:643-648.

Holo, H., and I. F. Nes. 1989. High-frequency transformation, by electroporation, of

Lactococcus lactis subsp. cremoris grown with glycine in osmotically stabilized

media. Appl Environ Microbiol 55:3119-3123.

Hoskins, J., W. E. Alborn, Jr., J. Arnold, L. C. Blaszczak, S. Burgett, B. S. DeHoff, S.

T. Estrem, L. Fritz, D. J. Fu, W. Fuller, C. Geringer, R. Gilmour, J. S. Glass,

H. Khoja, A. R. Kraft, R. E. Lagace, D. J. LeBlanc, L. N. Lee, E. J. Lefkowitz,

J. Lu, P. Matsushima, S. M. McAhren, M. McHenney, K. McLeaster, C. W.

Mundy, T. I. Nicas, F. H. Norris, M. O'Gara, R. B. Peery, G. T. Robertson, P.

Rockey, P. M. Sun, M. E. Winkler, Y. Yang, M. Young-Bellido, G. Zhao, C. A.

Zook, R. H. Baltz, S. R. Jaskunas, P. R. Rosteck, Jr., P. L. Skatrud, and J. I.

Glass. 2001. Genome of the bacterium Streptococcus pneumoniae strain R6. J

Bacteriol 183:5709-5717.

Ikryannikova, L. N., A. V. Filimonova, M. V. Malakhova, T. Savinova, O. Filimonova,

E. N. Ilina, V. A. Dubovickaya, S. V. Sidorenko, and V. M. Govorun. 2013.

Discrimination between Streptococcus pneumoniae and Streptococcus mitis based

on sorting of their MALDI mass spectra. Clin Microbiol Infect 19:1066-1071.

Iovino, F., M. C. Brouwer, D. van de Beek, G. Molema, and J. J. Bijlsma. 2013.

Signalling or binding: the role of the platelet-activating factor receptor in invasive

pneumococcal disease. Cell Microbiol 15:870-881.

Iovino, F., D. L. Hammarlof, G. Garriss, S. Brovall, P. Nannapaneni, and B.

Henriques-Normark. 2016. Pneumococcal meningitis is promoted by single cocci

expressing pilus adhesin RrgA. J Clin Invest 126:2821-2826.

Jenssen, H., P. Hamill, and R. E. Hancock. 2006. Peptide antimicrobial agents. Clin

Microbiol Rev 19:491-511.

Jiang, X. R., A. Song, S. Bergelson, T. Arroll, B. Parekh, K. May, S. Chung, R.

Strouse, A. Mire-Sluis, and M. Schenerman. 2011. Advances in the assessment

and control of the effector functions of therapeutic antibodies. Nat Rev Drug Discov

10:101-111.

Jikia, D., N. Chkhaidze, E. Imedashvili, I. Mgaloblishvili, G. Tsitlanadze, R.

Katsarava, J. Glenn Morris, Jr., and A. Sulakvelidze. 2005. The use of a novel

biodegradable preparation capable of the sustained release of bacteriophages and

ciprofloxacin, in the complex treatment of multidrug-resistant Staphylococcus

aureus-infected local radiation injuries caused by exposure to Sr90. Clin Exp

Dermatol 30:23-26.

Johnsborg, O., and L. S. Havarstein. 2009. Regulation of natural genetic transformation

and acquisition of transforming DNA in Streptococcus pneumoniae. FEMS

Microbiol Rev 33:627-642.

Johnston, C., B. Martin, G. Fichant, P. Polard, and J. P. Claverys. 2014. Bacterial

transformation: distribution, shared mechanisms and divergent control. Nat Rev

Microbiol 12:181-196.

135

Johnston, N. J., J. C. De Azavedo, J. D. Kellner, and D. E. Low. 1998. Prevalence and

characterization of the mechanisms of macrolide, lincosamide, and streptogramin

resistance in isolates of Streptococcus pneumoniae. Antimicrob Agents Chemother

42:2425-2426.

Joyce, E. A., S. J. Popper, and S. Falkow. 2009. Streptococcus pneumoniae

nasopharyngeal colonization induces type I interferons and interferon-induced gene

expression. BMC Genomics 10:404.

Jung, E., N. K. Lee, S. K. Kang, S. H. Choi, D. Kim, K. Park, K. Choi, Y. J. Choi, and

D. H. Jung. 2012. Identification of tissue-specific targeting peptide. J Comput

Aided Mol Des 26:1267-1275.

Kadioglu, A., J. N. Weiser, J. C. Paton, and P. W. Andrew. 2008. The role of

Streptococcus pneumoniae virulence factors in host respiratory colonization and

disease. Nat Rev Microbiol 6:288-301.

Kaufmann, S. H., and U. E. Schaible. 2005. Antigen presentation and recognition in

bacterial infections. Curr Opin Immunol 17:79-87.

Kawai, T., and S. Akira. 2010. The role of pattern-recognition receptors in innate

immunity: update on Toll-like receptors. Nat Immunol 11:373-384.

Kilian, M., K. Poulsen, T. Blomqvist, L. S. Havarstein, M. Bek-Thomsen, H. Tettelin,

and U. B. Sorensen. 2008. Evolution of Streptococcus pneumoniae and its close

commensal relatives. PLoS One 3:e2683.

Klumpp, J., R. Lavigne, M. J. Loessner, and H. W. Ackermann. 2010. The SPO1-

related bacteriophages. Arch Virol 155:1547-1561.

Kotsonis, S. E., I. B. Powell, C. J. Pillidge, G. K. Limsowtin, A. J. Hillier, and B. E.

Davidson. 2008. Characterization and genomic analysis of phage asccphi28, a

phage of the family Podoviridae infecting Lactococcus lactis. Appl Environ

Microbiol 74:3453-3460.

Kotsovilis, S., and E. Andreakos. 2014. Therapeutic human monoclonal antibodies in

inflammatory diseases. Methods Mol Biol 1060:37-59.

Kotzampassi, K., and E. J. Giamarellos-Bourboulis. 2012. Probiotics for infectious

diseases: more drugs, less dietary supplementation. Int J Antimicrob Agents

40:288-296.

Kraemer, L., B. Beszteri, S. Gabler-Schwarz, C. Held, F. Leese, C. Mayer, K.

Pohlmann, and S. Frickenhaus. 2009. STAMP: extensions to the STADEN

sequence analysis package for high throughput interactive microsatellite marker

design. BMC Bioinformatics 10:41.

Krause, R. M. 1957. Studies on bacteriophages of hemolytic streptococci. I. Factors

influencing the interaction of phage and susceptible host cell. J Exp Med 106:365-

384.

Kruger, D. H., and T. A. Bickle. 1983. Bacteriophage survival: multiple mechanisms for

avoiding the deoxyribonucleic acid restriction systems of their hosts. Microbiol Rev

47:345-360.

Kummerer, K., and A. Henninger. 2003. Promoting resistance by the emission of

antibiotics from hospitals and households into effluent. Clin Microbiol Infect

9:1203-1214.

Kummerfeldt, C. E. 2014. Raxibacumab: potential role in the treatment of inhalational

anthrax. Infect Drug Resist 7:101-109.

136

Kurekci, C., J. Padmanabha, S. L. Bishop-Hurley, E. Hassan, R. A. Al Jassim, and C.

S. McSweeney. 2013. Antimicrobial activity of essential oils and five terpenoid

compounds against Campylobacter jejuni in pure and mixed culture experiments.

Int J Food Microbiol 166:450-457.

Labrie, S. J., J. E. Samson, and S. Moineau. 2010. Bacteriophage resistance mechanisms.

Nat Rev Microbiol 8:317-327.

Lairson, L. L., B. Henrissat, G. J. Davies, and S. G. Withers. 2008.

Glycosyltransferases: structures, functions, and mechanisms. Annu Rev of Biochem

77:521-555.

Langeveld, W. T., E. J. Veldhuizen, and S. A. Burt. 2014. Synergy between essential oil

components and antibiotics: a review. Crit Rev Microbiol 40:76-94.

Larimer, B. M., and S. L. Deutscher. 2014. Development of a peptide by phage display

for SPECT imaging of resistance-susceptible breast cancer. Am J Nucl Med Mol

Imaging 4:435-447.

LaRocca, T. J., D. J. Holthausen, C. Hsieh, C. Renken, C. A. Mannella, and J. L.

Benach. 2009. The bactericidal effect of a complement-independent antibody is

osmolytic and specific to Borrelia. Proc Natl Acad Sci U S A 106:10752-10757.

Laurenceau, R., G. Pehau-Arnaudet, S. Baconnais, J. Gault, C. Malosse, A.

Dujeancourt, N. Campo, J. Chamot-Rooke, E. Le Cam, J. P. Claverys, and R.

Fronzes. 2013. A type IV pilus mediates DNA binding during natural

transformation in Streptococcus pneumoniae. PLoS Pathog 9:e1003473.

Lee, M. S., B. A. Dougherty, A. C. Madeo, and D. A. Morrison. 1999. Construction and

analysis of a library for random insertional mutagenesis in Streptococcus

pneumoniae: use for recovery of mutants defective in genetic transformation and for

identification of essential genes. Appl Environ Microbiol 65:1883-1890.

Lehane, A. M., H. Korres, and N. K. Verma. 2005. Bacteriophage-encoded

glucosyltransferase GtrII of Shigella flexneri: membrane topology and identification

of critical residues. Biochem J 389:137-143.

Leprohon, P., H. Gingras, S. Ouennane, S. Moineau, and M. Ouellette. 2015. A

genomic approach to understand interactions between Streptococcus pneumoniae

and its bacteriophages. BMC Genomics 16:972.

Li, X., D. Gerlach, X. Du, J. Larsen, M. Stegger, P. Kuhner, A. Peschel, G. Xia, and V.

Winstel. 2015. An accessory wall teichoic acid glycosyltransferase protects

Staphylococcus aureus from the lytic activity of Podoviridae. Sci Rep 5:17219.

Lim, B. N., G. J. Tye, Y. S. Choong, E. B. Ong, A. Ismail, and T. S. Lim. 2014.

Principles and application of antibody libraries for infectious diseases. Biotechnol

Lett 36:2381-2392.

Liu, B., and M. Pop. 2009. ARDB--antibiotic resistance genes database. Nucleic Acids

Res 37:D443-447.

Liu, W., S. L. Dong, F. Xu, X. Q. Wang, T. R. Withers, H. D. Yu, and X. Wang. 2013.

Effect of intracellular expression of antimicrobial peptide LL-37 on growth of

Escherichia coli strain TOP10 under aerobic and anaerobic conditions. Antimicrob

Agents Chemother 57:4707-4716.

Loeffler, J. M., S. Djurkovic, and V. A. Fischetti. 2003. Phage lytic enzyme Cpl-1 as a

novel antimicrobial for pneumococcal bacteremia. Infect Immun 71:6199-6204.

137

Loeffler, J. M., and V. A. Fischetti. 2003. Synergistic lethal effect of a combination of

phage lytic enzymes with different activities on penicillin-sensitive and -resistant

Streptococcus pneumoniae strains. Antimicrob Agents Chemother 47:375-377.

Loeffler, J. M., and V. A. Fischetti. 2006. Lysogeny of Streptococcus pneumoniae with

MM1 phage: improved adherence and other phenotypic changes. Infect Immun

74:4486-4495.

Longas, E., L. Villar, J. M. Lazaro, M. de Vega, and M. Salas. 2008. Phage phi29 and

Nf terminal protein-priming domain specifies the internal template nucleotide to

initiate DNA replication. Proc Natl Acad Sci U S A 105:18290-18295.

Lopez, R., E. Garcia, P. Garcia, C. Ronda, and A. Tomasz. 1982. Choline-containing

bacteriophage receptors in Streptococcus pneumoniae. J Bacteriol 151:1581-1590.

Lopez, R., C. Ronda, A. Tomasz, and A. Portoles. 1977. Properties of "diplophage": a

lipid-containing bacteriophage. J Virol 24:201-210.

Lorian, V., and B. Popoola. 1972. Pneumococci producing beta hemolysis on agar. Appl

Microbiol 24:44-47.

Lowe, T. M., and S. R. Eddy. 1997. tRNAscan-SE: a program for improved detection of

transfer RNA genes in genomic sequence. Nucleic Acids Res 25:955-964.

Lu, L., Z. Ma, T. S. Jokiranta, A. R. Whitney, F. R. DeLeo, and J. R. Zhang. 2008.

Species-specific interaction of Streptococcus pneumoniae with human complement

factor H. J Immunol 181:7138-7146.

Lu, M. J., and U. Henning. 1994. Superinfection exclusion by T-even-type coliphages.

Trends Microbiol 2:137-139.

Lu, M. J., Y. D. Stierhof, and U. Henning. 1993. Location and unusual membrane

topology of the immunity protein of the Escherichia coli phage T4. J Virol

67:4905-4913.

Lu, T. K., and M. S. Koeris. 2011. The next generation of bacteriophage therapy. Curr

Opin Microbiol 14:524-531.

Lupien, A., D. S. Billal, F. Fani, H. Soualhine, G. G. Zhanel, P. Leprohon, and M.

Ouellette. 2013. Genomic characterization of ciprofloxacin resistance in a

laboratory-derived mutant and a clinical isolate of Streptococcus pneumoniae.

Antimicrob Agents Chemother 57:4911-4919.

Luria, S. E., and T. F. Anderson. 1942. The identification and characterization of

bacteriophages with the electron microscope. Proc Natl Acad Sci U S A 28:127-130

121.

Ly-Chatain, M. H. 2014. The factors affecting effectiveness of treatment in phages

therapy. Front Microbiol 5:51.

Madhour, A., P. Maurer, and R. Hakenbeck. 2011. Cell surface proteins in S.

pneumoniae, S. mitis and S. oralis. Iran J Microbiol 3:58-67.

Mahima, A. Rahal, R. Deb, S. K. Latheef, H. Abdul Samad, R. Tiwari, A. K. Verma,

A. Kumar, and K. Dhama. 2012. Immunomodulatory and therapeutic potentials of

herbal, traditional/indigenous and ethnoveterinary medicines. Pak J Biol Sci

15:754-774.

Mahony, J., S. McGrath, G. F. Fitzgerald, and D. van Sinderen. 2008. Identification

and characterization of lactococcal-prophage-carried superinfection exclusion

genes. Appl Environ Microbiol 74:6206-6215.

Mansour, S. C., O. M. Pena, and R. E. Hancock. 2014. Host defense peptides: front-line

immunomodulators. Trends Immunol 35:443-450.

138

Marasco, W. A., and J. Sui. 2007. The growth and potential of human antiviral

monoclonal antibody therapeutics. Nat Biotechnol 25:1421-1434.

Mariano, R., S. Wuchty, M. G. Vizoso-Pinto, R. Hauser, and P. Uetz. 2016. The

interactome of Streptococcus pneumoniae and its bacteriophages show highly

specific patterns of interactions among bacteria and their phages. Sci Rep 6:24597.

Mark, D. F., and C. C. Richardson. 1976. Escherichia coli thioredoxin: a subunit of

bacteriophage T7 DNA polymerase. Proc Natl Acad Sci U S A 73:780-784.

Markine-Goriaynoff, N., L. Gillet, J. L. Van Etten, H. Korres, N. Verma, and A.

Vanderplasschen. 2004. Glycosyltransferases encoded by viruses. J Gen Virol

85:2741-2754.

Marks, L. R., B. A. Davidson, P. R. Knight, and A. P. Hakansson. 2013. Interkingdom

signaling induces Streptococcus pneumoniae biofilm dispersion and transition from

asymptomatic colonization to disease. MBio 4: e00438-13.

Marriott, H. M., T. J. Mitchell, and D. H. Dockrell. 2008. Pneumolysin: a double-edged

sword during the host-pathogen interaction. Curr Mol Med 8:497-509.

Martin, A. C., L. Blanco, P. Garcia, M. Salas, and J. Mendez. 1996. In vitro protein-

primed initiation of pneumococcal phage Cp-1 DNA replication occurs at the third

3' nucleotide of the linear template: a stepwise sliding-back mechanism. J Mol Biol

260:369-377.

Martin, A. C., R. Lopez, and P. Garcia. 1996. Analysis of the complete nucleotide

sequence and functional organization of the genome of Streptococcus pneumoniae

bacteriophage Cp-1. J Virol 70:3678-3687.

Martin, A. C., R. Lopez, and P. Garcia. 1998. Pneumococcal bacteriophage Cp-1

encodes its own protease essential for phage maturation. J Virol 72:3491-3494.

Massidda, O., D. Anderluzzi, L. Friedli, and G. Feger. 1998. Unconventional

organization of the division and cell wall gene cluster of Streptococcus pneumoniae.

Microbiology 144:3069-3078.

Massidda, O., L. Novakova, and W. Vollmer. 2013. From models to pathogens: how

much have we learned about Streptococcus pneumoniae cell division? Environ

Microbiol 15:3133-3157.

Matsuzaki, S., M. Rashel, J. Uchiyama, S. Sakurai, T. Ujihara, M. Kuroda, M.

Ikeuchi, T. Tani, M. Fujieda, H. Wakiguchi, and S. Imai. 2005. Bacteriophage

therapy: a revitalized therapy against bacterial infectious diseases. J Infect

Chemother 11:211-219.

McCann, J. R., and J. W. St Geme, 3rd. 2014. The HMW1C-like glycosyltransferases--

an enzyme family with a sweet tooth for simple sugars. PLoS Pathog 10:e1003977.

McCullers, J. A., A. Karlstrom, A. R. Iverson, J. M. Loeffler, and V. A. Fischetti. 2007. Novel strategy to prevent otitis media caused by colonizing Streptococcus

pneumoniae. PLoS Pathog 3:e28.

McDonnell, M., R. Lain, and A. Tomasz. 1975. "Diplophage": a bacteriophage of

Diplococcus pneumoniae. Virology 63:577-582.

Mejean, V., and J. P. Claverys. 1993. DNA processing during entry in transformation of

Streptococcus pneumoniae. J Biol Chem 268:5594-5599.

Mitchell, A. M., and T. J. Mitchell. 2010. Streptococcus pneumoniae: virulence factors

and variation. Clin Microbiol Infect 16:411-418.

Mitchell, J. 2011. Streptococcus mitis: walking the line between commensalism and

pathogenesis. Mol Oral Microbiol 26:89-98.

139

Mitchell, J., I. R. Siboo, D. Takamatsu, H. F. Chambers, and P. M. Sullam. 2007.

Mechanism of cell surface expression of the Streptococcus mitis platelet binding

proteins PblA and PblB. Mol Microbiol 64:844-857.

Mitchell, T. J. 2000. Virulence factors and the pathogenesis of disease caused by

Streptococcus pneumoniae. Res Microbiol 151:413-419.

Mitchell, T. J. 2003. The pathogenesis of streptococcal infections: from tooth decay to

meningitis. Nat Rev Microbiol 1:219-230.

Moineau, S., E. Durmaz, S. Pandian, and T. R. Klaenhammer. 1993. Differentiation of

two abortive mechanisms by using monoclonal antibodies directed toward

lactococcal bacteriophage capsid proteins. Appl Environ Microbiol 59:208-212.

Molineux, I. J., and D. Panja. 2013. Popping the cork: mechanisms of phage genome

ejection. Nat Rev Microbiol 11:194-204.

Monahan, L. G., I. V. Hajduk, S. P. Blaber, I. G. Charles, and E. J. Harry. 2014.

Coordinating bacterial cell division with nutrient availability: a role for glycolysis.

MBio 5:e00935-00914.

Monk, A. B., C. D. Rees, P. Barrow, S. Hagens, and D. R. Harper. 2010. Bacteriophage

applications: where are we now? Lett Appl Microbiol 51:363-369.

Mook-Kanamori, B. B., M. Geldhoff, T. van der Poll, and D. van de Beek. 2011.

Pathogenesis and pathophysiology of pneumococcal meningitis. Clin Microbiol Rev

24:557-591.

Morales, M., P. Garcia, A. G. de la Campa, J. Linares, C. Ardanuy, and E. Garcia. 2010. Evidence of localized prophage-host recombination in the lytA gene, encoding

the major pneumococcal autolysin. J Bacteriol 192:2624-2632.

Morlot, C., M. Noirclerc-Savoye, A. Zapun, O. Dideberg, and T. Vernet. 2004. The

D,D-carboxypeptidase PBP3 organizes the division process of Streptococcus

pneumoniae. Mol Microbiol 51:1641-1648.

Morris, P., L. J. Marinelli, D. Jacobs-Sera, R. W. Hendrix, and G. F. Hatfull. 2008.

Genomic characterization of mycobacteriophage Giles: evidence for phage

acquisition of host DNA by illegitimate recombination. J Bacteriol 190:2172-2182.

Mortier-Barriere, I., O. Humbert, B. Martin, M. Prudhomme, and J. P. Claverys. 1997. Control of recombination rate during transformation of Streptococcus

pneumoniae: an overview. Microb Drug Resist 3:233-242.

Muschiol, S., M. Balaban, S. Normark, and B. Henriques-Normark. 2015. Uptake of

extracellular DNA: competence induced pili in natural transformation of

Streptococcus pneumoniae. Bioessays 37:426-435.

Mushtaq, N., M. Ezzati, L. Hall, I. Dickson, M. Kirwan, K. M. Png, I. S. Mudway, and

J. Grigg. 2011. Adhesion of Streptococcus pneumoniae to human airway epithelial

cells exposed to urban particulate matter. J Allergy Clin Immunol 127:1236-1242

e1232.

Nahm, M. H., M. B. Oliver, L. Siira, T. Kaijalainen, L. M. Lambertsen, and A.

Virolainen. 2011. A report of Streptococcus pneumoniae serotype 6D in Europe. J

Med Microbiol 60:46-48.

Nakai, T., and S. C. Park. 2002. Bacteriophage therapy of infectious diseases in

aquaculture. Res Microbiol 153:13-18.

Nelson, D., L. Loomis, and V. A. Fischetti. 2001. Prevention and elimination of upper

respiratory colonization of mice by group A streptococci by using a bacteriophage

lytic enzyme. Proc Natl Acad Sci U S A 98:4107-4112.

140

Ng, W. L., K. M. Kazmierczak, and M. E. Winkler. 2004. Defective cell wall synthesis

in Streptococcus pneumoniae R6 depleted for the essential PcsB putative murein

hydrolase or the VicR (YycF) response regulator. Mol Microbiol 53:1161-1175.

Nieto, C., P. Fernandez de Palencia, P. Lopez, and M. Espinosa. 2000. Construction of

a tightly regulated plasmid vector for Streptococcus pneumoniae: controlled

expression of the green fluorescent protein. Plasmid 43:205-213.

Nuding, S., T. Frasch, M. Schaller, E. F. Stange, and L. T. Zabel. 2014. Synergistic

effects of antimicrobial peptides and antibiotics against Clostridium difficile.

Antimicrob Agents Chemother 58:5719-5725.

O'Brien, K. L., L. J. Wolfson, J. P. Watt, E. Henkle, M. Deloria-Knoll, N. McCall, E.

Lee, K. Mulholland, O. S. Levine, and T. Cherian. 2009. Burden of disease

caused by Streptococcus pneumoniae in children younger than 5 years: global

estimates. Lancet 374:893-902.

Ohsaki, Y., M. Tachibana, T. Awaya, M. Kuroki, and Y. Itoh. 2008. Recovery of

susceptibility to penicillin G in clinical isolates of Streptococcus pneumoniae

despite increased accumulation of pbp gene alterations. Int J Antimicrob Agents

32:427-431.

Okorochenkov, S. A., G. A. Zheltukhina, and V. E. Nebol'sin. 2012. Antimicrobial

peptides: mode of action and perspectives of practical application. Biomed Khim

58:131-143.

Oleksiewicz, M. B., G. Nagy, and E. Nagy. 2012. Anti-bacterial monoclonal antibodies:

back to the future? Arch Biochem Biophys 526:124-131.

Otsuka, Y., and T. Yonesaki. 2012. Dmd of bacteriophage T4 functions as an antitoxin

against Escherichia coli LsoA and RnlA toxins. Mol Microbiol 83:669-681.

Oudhuis, G. J., D. C. Bergmans, and A. Verbon. 2011. Probiotics for prevention of

nosocomial infections: efficacy and adverse effects. Curr Opin Crit Care 17:487-

492.

Ouennane, S., P. Leprohon, and S. Moineau. 2015. Diverse virulent pneumophages

infect Streptococcus mitis. PLoS One 10:e0118807.

Pagliero, E., O. Dideberg, T. Vernet, and A. M. Di Guilmi. 2005. The PECACE domain:

a new family of enzymes with potential peptidoglycan cleavage activity in Gram-

positive bacteria. BMC Genomics 6:19.

Pandya, U., C. A. Allen, D. A. Watson, and D. W. Niesel. 2005. Global profiling of

Streptococcus pneumoniae gene expression at different growth temperatures. Gene

360:45-54.

Parisien, A., B. Allain, J. Zhang, R. Mandeville, and C. Q. Lan. 2008. Novel

alternatives to antibiotics: bacteriophages, bacterial cell wall hydrolases, and

antimicrobial peptides. J Appl Microbiol 104:1-13.

Park, I. H., D. G. Pritchard, R. Cartee, A. Brandao, M. C. Brandileone, and M. H.

Nahm. 2007. Discovery of a new capsular serotype (6C) within serogroup 6 of

Streptococcus pneumoniae. J Clin Microbiol 45:1225-1233.

Patel, A., N. Shah, and J. B. Prajapati. 2014. Clinical application of probiotics in the

treatment of Helicobacter pylori infection--a brief review. J Microbiol Immunol

Infect 47:429-437.

Paterson, G. K., and T. J. Mitchell. 2006. The role of Streptococcus pneumoniae sortase

A in colonisation and pathogenesis. Microbes Infect 8:145-153.

141

Paterson, S., T. Vogwill, A. Buckling, R. Benmayor, A. J. Spiers, N. R. Thomson, M.

Quail, F. Smith, D. Walker, B. Libberton, A. Fenton, N. Hall, and M. A.

Brockhurst. 2010. Antagonistic coevolution accelerates molecular evolution.

Nature 464:275-278.

Peitzman, S. J. 1969. Felix d'Herelle and bacteriophage therapy. Trans Stud Coll

Physicians Phila 37:115-123.

Perry, J. A., M. B. Jones, S. N. Peterson, D. G. Cvitkovitch, and C. M. Levesque. 2009.

Peptide alarmone signalling triggers an auto-active bacteriocin necessary for genetic

competence. Mol Microbiol 72:905-917.

Petrenko, V. A., and P. K. Jayanna. 2014. Phage protein-targeted cancer nanomedicines.

FEBS Lett 588:341-349.

Pinho, M. G., M. Kjos, and J. W. Veening. 2013. How to get (a)round: mechanisms

controlling growth and division of coccoid bacteria. Nat Rev Microbiol 11:601-614.

Piotrowski, A., P. Luo, and D. A. Morrison. 2009. Competence for genetic

transformation in Streptococcus pneumoniae: termination of activity of the

alternative sigma factor ComX is independent of proteolysis of ComX and ComW.

J Bacteriol 191:3359-3366.

Plotkowski, M. C., E. Puchelle, G. Beck, J. Jacquot, and C. Hannoun. 1986. Adherence

of type I Streptococcus pneumoniae to tracheal epithelium of mice infected with

influenza A/PR8 virus. Am Rev Respir Dis 134:1040-1044.

Plummer, S. F., I. Garaiova, T. Sarvotham, S. L. Cottrell, S. Le Scouiller, M. A.

Weaver, J. Tang, P. Dee, and J. Hunter. 2005. Effects of probiotics on the

composition of the intestinal microbiota following antibiotic therapy. Int J

Antimicrob Agents 26:69-74.

Prudhomme, M., L. Attaiech, G. Sanchez, B. Martin, and J. P. Claverys. 2006.

Antibiotic stress induces genetic transformability in the human pathogen

Streptococcus pneumoniae. Science 313:89-92.

Rakhuba, D. V., E. I. Kolomiets, E. S. Dey, and G. I. Novik. 2010. Bacteriophage

receptors, mechanisms of phage adsorption and penetration into host cell. Pol J

Microbiol 59:145-155.

Ram, G., J. Chen, K. Kumar, H. F. Ross, C. Ubeda, P. K. Damle, K. D. Lane, J. R.

Penades, G. E. Christie, and R. P. Novick. 2012. Staphylococcal pathogenicity

island interference with helper phage reproduction is a paradigm of molecular

parasitism. Proc Natl Acad Sci U S A 109:16300-16305.

Ramirez, M., E. Severina, and A. Tomasz. 1999. A high incidence of prophage carriage

among natural isolates of Streptococcus pneumoniae. J Bacteriol 181:3618-3625.

Ranjan, S., G. Bakthavathsalam, V. V. Raghavan, and R. K. Sindhu. 2014. Growth of

Streptococcus pneumoniae on Macconkey agar: possibility of impossible? J Clin

Diagn Res 8:DL01.

Rao, F., Y. Qi, E. Murugan, S. Pasunooti, and Q. Ji. 2010. 2',3'-cAMP hydrolysis by

metal-dependent phosphodiesterases containing DHH, EAL, and HD domains is

non-specific: implications for PDE screening. Biochem Biophys Res Commun

398:500-505.

Raskin, D. M., R. Seshadri, S. U. Pukatzki, and J. J. Mekalanos. 2006. Bacterial

genomics and pathogen evolution. Cell 124:703-714.

Ravin, V., L. Raisanen, and T. Alatossava. 2002. A conserved C-terminal region in Gp71

of the small isometric-head phage LL-H and ORF474 of the prolate-head phage

142

JCL1032 is implicated in specificity of adsorption of phage to its host,

Lactobacillus delbrueckii. J Bacteriol 184:2455-2459.

Rayes, N., D. Seehofer, T. Theruvath, M. Mogl, J. M. Langrehr, N. C. Nussler, S.

Bengmark, and P. Neuhaus. 2007. Effect of enteral nutrition and synbiotics on

bacterial infection rates after pylorus-preserving pancreatoduodenectomy: a

randomized, double-blind trial. Ann Surg 246:36-41.

Reinert, R. R. 2009. The antimicrobial resistance profile of Streptococcus pneumoniae.

Clin Microbiol Infect 3:7-11.

Rhoads, D. D., R. D. Wolcott, M. A. Kuskowski, B. M. Wolcott, L. S. Ward, and A.

Sulakvelidze. 2009. Bacteriophage therapy of venous leg ulcers in humans: results

of a phase I safety trial. J Wound Care 18:237-238.

Richards, V. P., S. R. Palmer, P. D. Pavinski Bitar, X. Qin, G. M. Weinstock, S. K.

Highlander, C. D. Town, R. A. Burne, and M. J. Stanhope. 2014.

Phylogenomics and the dynamic genome evolution of the genus Streptococcus.

Genome Biol Evol 6:741-753.

Rigvava, S., I. Tchgkonia, D. Jgenti, T. Dvalidze, J. Carpino, and M. Goderdzishvili. 2013. Comparative analysis of the biological and physical properties of

Enterococcus faecalis bacteriophage vB_EfaS_GEC-EfS_3 and Streptococcus mitis

bacteriophage vB_SmM_GEC-SmitisM_2. Can J Microbiol 59:18-21.

Ring, A., J. N. Weiser, and E. I. Tuomanen. 1998. Pneumococcal trafficking across the

blood-brain barrier. Molecular analysis of a novel bidirectional pathway. J Clin

Invest 102:347-360.

Robbins, J. B., and R. Schneerson. 1983. Planning for a second (23 valent) generation

pneumococcal vaccine with special reference to new developments in our

understanding of the structure and biology of polysaccharides. Bull Eur Physiopath

Respir 19:215-226.

Romero, P., N. J. Croucher, N. L. Hiller, F. Z. Hu, G. D. Ehrlich, S. D. Bentley, E.

Garcia, and T. J. Mitchell. 2009. Comparative genomic analysis of ten

Streptococcus pneumoniae temperate bacteriophages. J Bacteriol 191:4854-4862.

Ronda-Lain, C., R. Lopez, A. Tapia, and A. Tomasz. 1977. Role of the pneumococcal

autolysin (murein hydrolase) in the release of progeny bacteriophage and in the

bacteriophage-induced lysis of the host cells. J Virol 21:366-374.

Ronda, C., J. L. Garcia, and R. Lopez. 1989. Infection of Streptococcus oralis NCTC

11427 by pneumococcal phages. FEMS Microbiol Lett 53:187-192.

Ronda, C., R. Lopez, and E. Garcia. 1981. Isolation and characterization of a new

bacteriophage, Cp-1, infecting Streptococcus pneumoniae. J Virol 40:551-559.

Rousseau, G. M., and S. Moineau. 2009. Evolution of Lactococcus lactis phages within a

cheese factory. App Environ Microbiol 75:5336-5344.

Rukke, H. V., I. K. Hegna, and F. C. Petersen. 2012. Identification of a functional

capsule locus in Streptococcus mitis. Mol Oral Microbiol 27:95-108.

Sabri, M., R. Hauser, M. Ouellette, J. Liu, M. Dehbi, G. Moeck, E. Garcia, B. Titz, P.

Uetz, and S. Moineau. 2011. Genome annotation and intraviral interactome for the

Streptococcus pneumoniae virulent phage Dp-1. J Bacteriol 193:551-562.

Salmond, G. P., and P. C. Fineran. 2015. A century of the phage: past, present and future.

Nat Rev Microbiol 13:777-786.

Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory

manual. Cold Spring Harbor, N.Y: CSH Protoc; 3v p.

143

Samson, J. E., A. H. Magadan, M. Sabri, and S. Moineau. 2013. Revenge of the phages:

defeating bacterial defences. Nat Rev Microbiol 11:675-687.

Samson, J. E., and S. Moineau. 2010. Characterization of Lactococcus lactis phage 949

and comparison with other lactococcal phages. Appl Environ Microbiol 76:6843-

6852.

Schechner, V., E. Temkin, S. Harbarth, Y. Carmeli, and M. J. Schwaber. 2013.

Epidemiological interpretation of studies examining the effect of antibiotic usage on

resistance. Clin Microbiol Rev 26:289-307.

Scheffler, R. J., S. Colmer, H. Tynan, A. L. Demain, and V. P. Gullo. 2013.

Antimicrobials, drug discovery, and genome mining. Appl Microbiol Biotechnol

97:969-978.

Scholtens, P. A., D. A. Goossens, and A. Staiano. 2014. Stool characteristics of infants

receiving short-chain galacto-oligosaccharides and long-chain fructo-

oligosaccharides: a review. World J Gastroenterol 20:13446-13452.

Schroeder, M. R., and D. S. Stephens. 2016. Macrolide Resistance in Streptococcus

pneumoniae. Front Cell Infect Microbiol 6:98.

Schulz zur Wiesch, P., J. Engelstadter, and S. Bonhoeffer. 2010. Compensation of

fitness costs and reversibility of antibiotic resistance mutations. Antimicrob Agents

Chemother 54:2085-2095.

Scott, A. M., J. P. Allison, and J. D. Wolchok. 2012. Monoclonal antibodies in cancer

therapy. Cancer Immun 12:14.

Serwer, P., S. J. Hayes, J. A. Thomas, and S. C. Hardies. 2007. Propagating the missing

bacteriophages: a large bacteriophage in a new class. Virol J 4:21.

Seshasayee, A. S., G. M. Fraser, and N. M. Luscombe. 2010. Comparative genomics of

cyclic-di-GMP signalling in bacteria: post-translational regulation and catalytic

activity. Nucleic Acids Res 38:5970-5981.

Sheppard, C. L., T. G. Harrison, R. Morris, A. Hogan, and R. C. George. 2004.

Autolysin-targeted LightCycler assay including internal process control for

detection of Streptococcus pneumoniae DNA in clinical samples. J Med Microbiol

53:189-195.

Shimizu, K., H. Ogura, T. Asahara, K. Nomoto, M. Morotomi, O. Tasaki, A.

Matsushima, Y. Kuwagata, T. Shimazu, and H. Sugimoto. 2013.

Probiotic/synbiotic therapy for treating critically ill patients from a gut microbiota

perspective. Dig Dis Sci 58:23-32.

Siboo, I. R., B. A. Bensing, and P. M. Sullam. 2003. Genomic organization and molecular

characterization of SM1, a temperate bacteriophage of Streptococcus mitis. J

Bacteriol 185:6968-6975.

Sillankorva, S. M., H. Oliveira, and J. Azeredo. 2012. Bacteriophages and their role in

food safety. Int J Microbiol 2012:863945.

Singer, R. S., M. P. Ward, and G. Maldonado. 2006. Can landscape ecology untangle the

complexity of antibiotic resistance? Nat Rev Microbiol 4:943-952.

Skurnik, M., M. Pajunen, and S. Kiljunen. 2007. Biotechnological challenges of phage

therapy. Biotechnol Lett 29:995-1003.

Slavcev, R. A., and S. Hayes. 2003. Stationary phase-like properties of the bacteriophage

lambda Rex exclusion phenotype. Mol Genet Genomics 269:40-48.

Smeianov, V., K. Scott, and G. Reid. 2000. Activity of cecropin P1 and FA-LL-37 against

urogenital microflora. Microbes Infect 2:773-777.

144

Smith, C. M., S. Sandrini, S. Datta, P. Freestone, S. Shafeeq, P. Radhakrishnan, G.

Williams, S. M. Glenn, O. P. Kuipers, R. A. Hirst, A. J. Easton, P. W. Andrew,

and C. O'Callaghan. 2014. Respiratory syncytial virus increases the virulence of

Streptococcus pneumoniae by binding to penicillin binding protein 1a. A new

paradigm in respiratory infection. Am J Respir Crit Care Med 190:196-207.

Snyder, L. 1995. Phage-exclusion enzymes: a bonanza of biochemical and cell biology

reagents? Mol Microbiol 15:415-420.

Song, J. H., K. S. Ko, J. Y. Lee, J. Y. Baek, W. S. Oh, H. S. Yoon, J. Y. Jeong, and J.

Chun. 2005. Identification of essential genes in Streptococcus pneumoniae by

allelic replacement mutagenesis. Mol Cells 19:365-374.

Sorek, R., V. Kunin, and P. Hugenholtz. 2008. CRISPR--a widespread system that

provides acquired resistance against phages in bacteria and archaea. Nat Rev

Microbiol 6:181-186.

Soualhine, H., V. Brochu, F. Menard, B. Papadopoulou, K. Weiss, M. G. Bergeron, D.

Legare, J. Drummelsmith, and M. Ouellette. 2005. A proteomic analysis of

penicillin resistance in Streptococcus pneumoniae reveals a novel role for PstS, a

subunit of the phosphate ABC transporter. Mol Microbiol 58:1430-1440.

Sperandio, V., J. L. Mellies, W. Nguyen, S. Shin, and J. B. Kaper. 1999. Quorum

sensing controls expression of the type III secretion gene transcription and protein

secretion in enterohemorrhagic and enteropathogenic Escherichia coli. Proc Natl

Acad Sci U S A 96:15196-15201.

Staden, R., K. F. Beal, and J. K. Bonfield. 2000. The Staden package, 1998. Methods

Mol Biol 132:115-130.

Standish, A. J., U. H. Stroeher, and J. C. Paton. 2007. The pneumococcal two-

component signal transduction system RR/HK06 regulates CbpA and PspA by two

distinct mechanisms. J Bacteriol 189:5591-5600.

Stern, A., and R. Sorek. 2011. The phage-host arms race: shaping the evolution of

microbes. Bioessays 33:43-51.

Strauch, E., H. Kaspar, C. Schaudinn, C. Damasko, A. Konietzny, P. Dersch, M.

Skurnik, and B. Appel. 2003. Analysis of enterocoliticin, a phage tail-like

bacteriocin. Adv Exp Med Biol 529:249-251.

Sturino, J. M., and T. R. Klaenhammer. 2006. Engineered bacteriophage-defence

systems in bioprocessing. Nat Rev Microbiol 4:395-404.

Sulakvelidze, A., Z. Alavidze, and J. G. Morris, Jr. 2001. Bacteriophage therapy.

Antimicrob Agents Chemother 45:649-659.

Sun, Y. H., S. Bakshi, R. Chalmers, and C. M. Tang. 2000. Functional genomics of

Neisseria meningitidis pathogenesis. Nat Med 6:1269-1273.

Sundararajan, K., A. Miguel, S. M. Desmarais, E. L. Meier, K. Casey Huang, and E.

D. Goley. 2015. The bacterial tubulin FtsZ requires its intrinsically disordered

linker to direct robust cell wall construction. Nat Commun 6:7281.

Sunderkotter, C., and K. Becker. 2014. Systemic therapy with antibiotics: overview of

important antibiotics in dermatology. Hautarzt 65:113-124.

Syrjänen, R. K., T. M. Kilpi, T. H. Kaijalainen, E. E. Herva, and A. K. Takala. 2001.

Nasopharyngeal carriage of Streptococcus pneumoniae in finnish children younger

than 2 years old. J Infect Dis 184:451-459.

Szklarczyk, D., A. Franceschini, S. Wyder, K. Forslund, D. Heller, J. Huerta-Cepas,

M. Simonovic, A. Roth, A. Santos, K. P. Tsafou, M. Kuhn, P. Bork, L. J.

145

Jensen, and C. von Mering. 2015. STRING v10: protein-protein interaction

networks, integrated over the tree of life. Nucleic Acids Res 43:D447-452.

Sztajer, H., A. Lemme, R. Vilchez, S. Schulz, R. Geffers, C. Y. Yip, C. M. Levesque,

D. G. Cvitkovitch, and I. Wagner-Dobler. 2008. Autoinducer-2-regulated genes

in Streptococcus mutans UA159 and global metabolic effect of the luxS mutation. J

Bacteriology 190:401-415.

Taga, M. E., J. L. Semmelhack, and B. L. Bassler. 2001. The LuxS-dependent

autoinducer AI-2 controls the expression of an ABC transporter that functions in

AI-2 uptake in Salmonella typhimurium. Mol Microbiol 42:777-793.

Talbot, T. R., T. V. Hartert, E. Mitchel, N. B. Halasa, P. G. Arbogast, K. A. Poehling,

W. Schaffner, A. S. Craig, and M. R. Griffin. 2005. Asthma as a risk factor for

invasive pneumococcal disease. N Engl J Med 352:2082-2090.

Tettelin, H., K. E. Nelson, I. T. Paulsen, J. A. Eisen, T. D. Read, S. Peterson, J.

Heidelberg, R. T. DeBoy, D. H. Haft, R. J. Dodson, A. S. Durkin, M. Gwinn, J.

F. Kolonay, W. C. Nelson, J. D. Peterson, L. A. Umayam, O. White, S. L.

Salzberg, M. R. Lewis, D. Radune, E. Holtzapple, H. Khouri, A. M. Wolf, T. R.

Utterback, C. L. Hansen, L. A. McDonald, T. V. Feldblyum, S. Angiuoli, T.

Dickinson, E. K. Hickey, I. E. Holt, B. J. Loftus, F. Yang, H. O. Smith, J. C.

Venter, B. A. Dougherty, D. A. Morrison, S. K. Hollingshead, and C. M.

Fraser. 2001. Complete genome sequence of a virulent isolate of Streptococcus

pneumoniae. Science 293:498-506.

Thanassi, J. A., S. L. Hartman-Neumann, T. J. Dougherty, B. A. Dougherty, and M. J.

Pucci. 2002. Identification of 113 conserved essential genes using a high-

throughput gene disruption system in Streptococcus pneumoniae. Nucleic Acids

Res 30:3152-3162.

Tiraby, J. G., E. Tiraby, and M. S. Fox. 1975. Pneumococcal bacteriophages. Virology

68:566-569.

Tiwari, R., K. Dhama, A. Kumar, A. Rahal, and S. Kapoor. 2014. Bacteriophage

therapy for safeguarding animal and human health: a review. Pak J Biol Sci 17:301-

315.

Tock, M. R., and D. T. Dryden. 2005. The biology of restriction and anti-restriction. Curr

Opin Microbiol 8:466-472.

Tohidkia, M. R., J. Barar, F. Asadi, and Y. Omidi. 2012. Molecular considerations for

development of phage antibody libraries. J Drug Target 20:195-208.

Tomasz, A., J. D. Jamieson, and E. Ottolenghi. 1964. The Fine Structure of Diplococcus

Pneumoniae. J Cell Biol 22:453-467.

Trepel, M., C. A. Stoneham, H. Eleftherohorinou, N. D. Mazarakis, R. Pasqualini, W.

Arap, and A. Hajitou. 2009. A heterotypic bystander effect for tumor cell killing

after adeno-associated virus/phage-mediated, vascular-targeted suicide gene

transfer. Mol Cancer Ther 8:2383-2391.

Tseng, T. T., B. M. Tyler, and J. C. Setubal. 2009. Protein secretion systems in bacterial-

host associations, and their description in the Gene Ontology. BMC Microbiol 9

Suppl 1:S2.

Tunjungputri, R. N., F. M. Mobegi, A. J. Cremers, C. E. van der Gaast-de Jongh, G.

Ferwerda, J. F. Meis, N. Roeleveld, S. D. Bentley, A. S. Pastura, S. A. van

Hijum, A. J. van der Ven, Q. de Mast, A. Zomer, and M. I. de Jonge. 2017.

146

Phage-derived protein induces increased platelet activation and is associated with

mortality in patients with invasive pneumococcal disease. MBio 8:e01984-16.

Twort, F. W. 1915. An investigation on the nature of ultra-microscopic viruses. Lancet

186:1241-1243.

Typas, A., M. Banzhaf, C. A. Gross, and W. Vollmer. 2012. From the regulation of

peptidoglycan synthesis to bacterial growth and morphology. Nat Rev Microbiol

10:123-136.

Uchiyama, S., A. F. Carlin, A. Khosravi, S. Weiman, A. Banerjee, D. Quach, G.

Hightower, T. J. Mitchell, K. S. Doran, and V. Nizet. 2009. The surface-

anchored NanA protein promotes pneumococcal brain endothelial cell invasion. J

Exp Med 206:1845-1852.

Ulevitch, R. J. 2004. Therapeutics targeting the innate immune system. Nat Rev Immunol

4:512-520.

Valentino, M. D., A. M. McGuire, J. W. Rosch, P. J. Bispo, C. Burnham, C. M.

Sanfilippo, R. A. Carter, M. E. Zegans, B. Beall, A. M. Earl, E. I. Tuomanen,

T. W. Morris, W. Haas, and M. S. Gilmore. 2014. Unencapsulated Streptococcus

pneumoniae from conjunctivitis encode variant traits and belong to a distinct

phylogenetic cluster. Nat Commun 5:5411.

van der Poll, T., and S. M. Opal. 2009. Pathogenesis, treatment, and prevention of

pneumococcal pneumonia. Lancet 374:1543-1556.

van Heijenoort, J. 2001. Formation of the glycan chains in the synthesis of bacterial

peptidoglycan. Glycobiology 11:25R-36R.

van Opijnen, T., K. L. Bodi, and A. Camilli. 2009. Tn-seq: high-throughput parallel

sequencing for fitness and genetic interaction studies in microorganisms. Nat

Methods 6:767-772.

Veldhuizen, E. J., V. A. Schneider, H. Agustiandari, A. van Dijk, J. L. Tjeerdsma-van

Bokhoven, F. J. Bikker, and H. P. Haagsman. 2014. Antimicrobial and

immunomodulatory activities of PR-39 derived peptides. PLoS One 9:e95939.

Vidal, J. E., K. E. Howery, H. P. Ludewick, P. Nava, and K. P. Klugman. 2013.

Quorum-sensing systems LuxS/autoinducer 2 and Com regulate Streptococcus

pneumoniae biofilms in a bioreactor with living cultures of human respiratory cells.

Infect Immun 81:1341-1353.

Vieira, A., Y. J. Silva, A. Cunha, N. C. Gomes, H. W. Ackermann, and A. Almeida. 2012. Phage therapy to control multidrug-resistant Pseudomonas aeruginosa skin

infections: in vitro and ex vivo experiments. Eur J Clin Microbiol Infect Dis

31:3241-3249.

Villion, M., and S. Moineau. 2013. Virology: phages hijack a host's defence. Nature

494:433-434.

Vunnam, S., P. Juvvadi, and R. B. Merrifield. 1997. Synthesis and antibacterial action of

cecropin and proline-arginine-rich peptides from pig intestine. J Pept Res 49:59-66.

Walker, C. L., I. Rudan, L. Liu, H. Nair, E. Theodoratou, Z. A. Bhutta, K. L. O'Brien,

H. Campbell, and R. E. Black. 2013. Global burden of childhood pneumonia and

diarrhoea. Lancet 381:1405-1416.

Walkinshaw, M. D., P. Taylor, S. S. Sturrock, C. Atanasiu, T. Berge, R. M.

Henderson, J. M. Edwardson, and D. T. Dryden. 2002. Structure of Ocr from

bacteriophage T7, a protein that mimics B-form DNA. Mol Cell 9:187-194.

147

Wang, I. N., Y. Li, Q. Que, M. Bhattacharya, L. C. Lane, W. G. Chaney, and J. L.

Van Etten. 1993. Evidence for virus-encoded glycosylation specificity. Proc Natl

Acad Sci U S A 90:3840-3844.

Wang, Q., M. Wang, F. Kong, G. L. Gilbert, B. Cao, L. Wang, and L. Feng. 2007.

Development of a DNA microarray to identify the Streptococcus pneumoniae

serotypes contained in the 23-valent pneumococcal polysaccharide vaccine and

closely related serotypes. J Microbiol Methods 68:128-136.

Wang, T., W. C. Hartner, J. W. Gillespie, K. P. Praveen, S. Yang, L. A. Mei, V. A.

Petrenko, and V. P. Torchilin. 2014. Enhanced tumor delivery and antitumor

activity in vivo of liposomal doxorubicin modified with MCF-7-specific phage

fusion protein. Nanomedicine 10:421-430.

Warrener, P., R. Varkey, J. C. Bonnell, A. DiGiandomenico, M. Camara, K. Cook, L.

Peng, J. Zha, P. Chowdury, B. Sellman, and C. K. Stover. 2014. A novel anti-

PcrV antibody providing enhanced protection against Pseudomonas aeruginosa in

multiple animal infection models. Antimicrob Agents Chemother 58:4384-4391.

Watson, D. A., D. M. Musher, J. W. Jacobson, and J. Verhoef. 1993. A brief history of

the pneumococcus in biomedical research: a panoply of scientific discovery. Clin

Infect Dis 17:913-924.

Wegmann, U., M. O'Connell-Motherway, A. Zomer, G. Buist, C. Shearman, C.

Canchaya, M. Ventura, A. Goesmann, M. J. Gasson, O. P. Kuipers, D. van

Sinderen, and J. Kok. 2007. Complete genome sequence of the prototype lactic

acid bacterium Lactococcus lactis subsp. cremoris MG1363. J Bacteriol 189:3256-

3270.

Weiser, J. N., D. Bae, C. Fasching, R. W. Scamurra, A. J. Ratner, and E. N. Janoff. 2003. Antibody-enhanced pneumococcal adherence requires IgA1 protease. Proc

Natl Acad Sci U S A 100:4215-4220.

Wen, Z., Y. Liu, F. Qu, and J. R. Zhang. 2016. Allelic variation of the capsule promoter

diversifies encapsulation and virulence in Streptococcus pneumoniae. Sci Rep

6:30176.

Westwater, C., L. M. Kasman, D. A. Schofield, P. A. Werner, J. W. Dolan, M. G.

Schmidt, and J. S. Norris. 2003. Use of genetically engineered phage to deliver

antimicrobial agents to bacteria: an alternative therapy for treatment of bacterial

infections. Antimicrob Agents Chemother 47:1301-1307.

Whatmore, A. M., A. Efstratiou, A. P. Pickerill, K. Broughton, G. Woodard, D.

Sturgeon, R. George, and C. G. Dowson. 2000. Genetic relationships between

clinical isolates of Streptococcus pneumoniae, Streptococcus oralis, and

Streptococcus mitis: characterization of "Atypical" pneumococci and organisms

allied to S. mitis harboring S. pneumoniae virulence factor-encoding genes. Infect

Immun 68:1374-1382.

Wichman, H. A., J. Millstein, and J. J. Bull. 2005. Adaptive molecular evolution for

13,000 phage generations: a possible arms race. Genetics 170:19-31.

Witzenrath, M., B. Schmeck, J. M. Doehn, T. Tschernig, J. Zahlten, J. M. Loeffler, M.

Zemlin, H. Muller, B. Gutbier, H. Schutte, S. Hippenstiel, V. A. Fischetti, N.

Suttorp, and S. Rosseau. 2009. Systemic use of the endolysin Cpl-1 rescues mice

with fatal pneumococcal pneumonia. Crit Care Med 37:642-649.

Wright, A., C. H. Hawkins, E. E. Anggard, and D. R. Harper. 2009. A controlled

clinical trial of a therapeutic bacteriophage preparation in chronic otitis due to

148

antibiotic-resistant Pseudomonas aeruginosa; a preliminary report of efficacy. Clin

Otolaryngol 34:349-357.

Wright, G. D. 2007. The antibiotic resistome: the nexus of chemical and genetic diversity.

Nat Rev Microbiol 5:175-186.

Wyres, K. L., A. van Tonder, L. M. Lambertsen, R. Hakenbeck, J. Parkhill, S. D.

Bentley, and A. B. Brueggemann. 2013. Evidence of antimicrobial resistance-

conferring genetic elements among pneumococci isolated prior to 1974. BMC

Genomics 14:500.

Xia, G., L. Maier, P. Sanchez-Carballo, M. Li, M. Otto, O. Holst, and A. Peschel. 2010. Glycosylation of wall teichoic acid in Staphylococcus aureus by TarM. J Biol

Chem 285:13405-13415.

Yakunin, A. F., M. Proudfoot, E. Kuznetsova, A. Savchenko, G. Brown, C. H.

Arrowsmith, and A. M. Edwards. 2004. The HD domain of the Escherichia coli

tRNA nucleotidyltransferase has 2',3'-cyclic phosphodiesterase, 2'-nucleotidase, and

phosphatase activities. J Biol Chem 279:36819-36827.

Yao, S., Y. Zhu, and L. Chen. 2013. Advances in targeting cell surface signalling

molecules for immune modulation. Nat Rev Drug Discov 12:130-146.

Yaung, S. J., K. M. Esvelt, and G. M. Church. 2014. CRISPR/Cas9-mediated phage

resistance is not impeded by the DNA modifications of phage T4. PLoS One

9:e98811.

Zahner, D., A. R. Gandhi, H. Yi, and D. S. Stephens. 2011. Mitis group streptococci

express variable pilus islet 2 pili. PLoS One 6:e25124.

Zapun, A., T. Vernet, and M. G. Pinho. 2008. The different shapes of cocci. FEMS

Microbiol Rev 32:345-360.

Zbinden, A., N. Kohler, and G. V. Bloemberg. 2011. recA-based PCR assay for accurate

differentiation of Streptococcus pneumoniae from other viridans streptococci. J Clin

Microbiol 49:523-527.

Zhou, M., J. Boekhorst, C. Francke, and R. J. Siezen. 2008. LocateP: genome-scale

subcellular-location predictor for bacterial proteins. BMC Bioinformatics 9:173.

Zuany-Amorim, C., J. Hastewell, and C. Walker. 2002. Toll-like receptors as potential

therapeutic targets for multiple diseases. Nat Rev Drug Discov 1:797-807.

149

Annexe

Gagner la guerre contre les bactéries résistantes aux antibiotiques

Résumé de la publication

L’émergence de bactéries résistantes et multirésistantes aux antibiotiques est liée à leur

capacité d’acquérir des gènes de résistance par divers moyens ainsi que par la presssion de

sélection provenant d’une sur-utilisation de ces antibiotiques. En conséquence, la résistance

aux antibiotiques est maintenant un problème de santé publique mondial. À l'heure actuelle,

de nombreuses recherches se concentrent sur des alternatives aux antibiotiques. Dans cette

revue, nous soulignons les progrès récents dans la thérapie antibactérienne liés au

développement des agents antibactériens et aux applications potentielles de ces alternatives

thérapeutiques.

Avant-propos

Contributions des auteurs

J’ai réalisé les recherches bibliographiques et j’ai rédigé l’article en collaboration avec le

professeur Sylvain Moineau.

Publication

Siham Ouennane1,2

, and Sylvain Moineau1,2

. Trying to win the war against antibiotic-

resistant bacteria. In preparation for submission.

150

Abstract

Bacteria can acquire antibiotic resistance genes through different means, leading to the

emergence of multi-drug-resistant bacteria and making antibiotic treatment of pathogenic

bacteria less effective. As a consequence, antibiotic-resistant bacteria are a major global

healthcare challenge. Considerable research efforts now focus on other remedies to provide

new alternatives against these resistant bacteria. In this review, we highlight recent

advancements related to the potential applications of these antibacterial alternatives.

Introduction

The discovery of antibiotics revolutionized the history of medicine and our ability to fight

bacterial infections. More than 80 years after the discovery of antibiotics, we can certainly

conclude that they have increased life expectancy. Penicillin was the first natural antibiotic

and it signalled the beginning of the golden age of antibiotics (Scheffler, et al., 2013). This

also paved the way to the identification and characterization of other novel and non-toxic

antibiotics, extensive production of these compounds, and the development of synthetic

antibacterials. Antibiotics were also used as chemical probes to advance our understanding

of bacterial physiology, biochemistry and genetics (Falconer, et al., 2011). Numerous

antibiotics were successfully employed to cure pathogenic bacterial infections, targeting

different bacterial functions such as cell wall biosynthesis, nucleic acid synthesis, protein

biosynthesis and various metabolic pathways.

Regrettably, overconfidence about the ability of antibiotics to eradicate bacterial diseases

and the worldwide use and/or misuse of these antibacterial agents led to the emergence of

resistance among human bacterial pathogens. However, resistant microorganisms were

isolated even before the first clinical use of antibiotics (Wright, 2007). In fact, to survive in

nature, microorganisms have the ability to coexist with others and to overcome variable

environmental and chemical challenges (Wright, 2007, Cowen, 2008). Certainly, resistance

to antimicrobial agents is not a novel phenomenon but the rapid development and

dissemination of antimicrobial resistance, especially among bacterial pathogens is directly

related to abuse and misuse of antimicrobial agents (Schulz zur Wiesch, et al., 2010). A

151

myriad of resistance mechanisms employed by bacteria are known but some are still not yet

fully understood (Davies & Davies, 2010).

Antibiotic resistance, as an adaptive way to survive and persist in the environment

(Andersson & Hughes, 2010), can generally be acquired by two mechanisms: acquisition of

resistance genes and spontaneous mutation (Liu & Pop, 2009). Most antibiotic resistance

genes are believed to be spread by horizontal gene transfer through mobile genetic elements

such as plasmids, integrons and transposons (Fig. A.1). Natural competence, bacterial

transduction and conjugation could also play significant roles. This resistance can be

disseminated between members of the same bacterial species or between genera and species

(Schechner, et al., 2013). On the other hand, acquiring resistance by spontaneous mutation

can affect fitness by decreasing the bacterial growth rate (Andersson & Hughes, 2010,

Schulz zur Wiesch, et al., 2010). But bacteria can also acquire other mutations to

compensate for these fitness mutations. These compensatory mutations improve bacterial

fitness without disturbing antibiotic tolerance (Schulz zur Wiesch, et al., 2010).

152

Figure A. 1 Summary of antibiotic target site and resistance mechanisms in Gram-

positive and Gram-negative bacteria.

A. Antibiotic mechanisms of action. B. Resistance mechanisms used by bacteria

The emergence of antibiotic-resistant strains can be attributed to several factors, including

the use of antibiotics in agriculture, even in the absence of infection, and also in fish farms

to cure disease and promote growth (Allen, et al., 2010). Moreover, antibiotics are released

via patient excreta into municipal sewage systems, mainly in the effluents of hospitals but

also from pharmaceutical plants and in agriculture runoff (Kummerer & Henninger, 2003,

Singer, et al., 2006). As a consequence, antibiotics persist in aquatic and soil environments,

often in sub-inhibitory concentrations, promoting the selection and spread of resistance

(Allen, et al., 2010). Several bacterial pathogens have evolved into “superbugs” which

reduce therapeutic options and extend periods of hospital care for those infected (Davies &

Davies, 2010). Superbugs are classified into two major types: 1) commensal origin where

bacteria acquired antibiotic resistance genes and increased virulence; and 2) environmental

origin which are opportunistic pathogens (Alekshun & Levy, 2006, Wright, 2007).

153

Research to discover new antibiotics is facing a number of issues, ranging from the high

cost to technical barriers to uncover truly novel antibacterial agents.

The above concerns are worldwide in scope and have important economic consequences.

As such, a number of alternatives to antibiotics have been proposed, some of which will be

reviewed here.

1. Bacteriophage therapy

Bacteriophages (or phages) are viruses that infect and eventually lyse only bacterial cells

(Ly-Chatain, 2014). Phages are ubiquitous, representing the most abundant biological

entities on the planet. An estimated 1031

to 1032

phages exist in the biosphere and phage

predation is predicted to destroy approximately half of the Earth’s bacterial population

every 48 hours (Deresinski, 2009). The discovery of bacteriophages is credited

independently to Frederick Twort (in 1915) and Félix d’Hérelle (in 1917) before the

medical application of antibiotics (Parisien, et al., 2008). D’Hérelle was the first to propose

the idea of using phages to treat bacterial infectious diseases in animals and humans, which

was the shining start in the development of phage therapy (Abedon, et al., 2011). The

discovery and efficacy of antibiotics ended most phage-based treatments of human

infections in the West and phages were abandoned as significant therapeutic agents.

However, in Eastern Europe, research into and application of phage therapy was and is still

used to treat several bacterial infectious diseases (Clokie, et al., 2011). The emergence of

resistance to antibiotics has motivated the West to re-evaluate phage therapy. Phage therapy

uses whole-phage products, namely virulent phages that do not harbour genes coding for

virulence factors (Fig A.2). Phages provide several advantages as they are effective against

multidrug-resistant bacterial pathogens and they do not disturb the normal microbial flora

because of high host specificity (Skurnik, et al., 2007, Chan, et al., 2013). They also

replicate at the site of infection and do not affect eukaryotic cells (Matsuzaki, et al., 2005,

Skurnik, et al., 2007). Finally, the cost of isolating new phages is relatively low. Numerous

studies show the success of phages against many pathogenic bacteria for humans and

154

animals, such as the case of a vancomycin-resistant Enterococcus faecium strain in mice

(Biswas, et al., 2002), and for localized and systemic infections caused by Vibrio vulnificus

(Cerveny, et al., 2002).

Figure A. 2 Main strategies of applying bacteriophages in phage

Phage therapy also has some challenges that include poor stability of phage preparations

and the efficient removal of bacterial residues as endotoxins and pyrogens (Lu & Koeris,

2011). Moreover, phage resistance may also become a problem. Bacteria have developed

numerous resistance mechanisms to interfere with phage replication that are directed at

different steps of the lytic cycle (Table A.1). To avoid the mistakes that led to antibiotic

resistance, it is vital to study phage resistance mechanisms and their dissemination before

introducing phage therapy.

155

Table A. 1 Summary of the bacterial anti-phage mechanisms and strategies used by

phage to avoid host resistance. Stage of

lytic

cycle

Bacterial phage resistance Survival

effect

Phage escape resistance Ref

Ad

sorp

tio

n

Modification or loss of phage host

receptor

Mutation in the genes encoding receptor

Bacterial capsule production

Production of protein (ex. protein A) Protein masking receptor to avoid phage

overinfection

Production of extracellular matrix

Ph

ag

e e

xclu

sio

n

Recognition of new receptors Acquisition of mutations in genes

coding for RBP (receptor-binding

proteins) or tail fiber

Burrowing for receptors:

Cleavage of EPS by phage

Hydrolases or lyases Recognition of polysaccharides

(K and O antigens)

(Labrie, et al., 2010) (Samson, et al., 2013)

(Chatterjee &

Rothenberg, 2012) (Ravin, et al., 2002)

(Cornelissen, et al.,

2012) (Baker, et al., 2002)

Ph

ag

e D

NA

eje

cti

on

Superinfection immunity and exclusion

Conformational change at the injection site

Inhibition of phage DNA transfer into the

host cell by Sie systems. Prevention of peptidoglycan

degradation by phage lysozyme

Prophage-encoded repressor protein

Ph

ag

e d

ea

th

Phage encoded regulatory control region as genetic switch (e.g., Some virulent

phages of P335)

(Labrie, et al., 2010) (Lu, et al., 1993)

(Lu & Henning, 1994)

(Mahony, et al., 2008) (Durmaz, et al., 2002)

Gen

om

e r

ep

lica

tio

n

Restriction / modification system

Cleavage of phage DNA Protection of host DNA from restriction

by the methylase activity

CRISPR-Cas systems

Intregation of fragment of phage DNA into CRISPR loci (proto-spacer)

Production of crRNA units to interfere

with foreign DNA by complementarity

Abortive infection: Interference with DNA replication: Synthesis of host protein that:

-decreases bacterial fitness

-inhibits bacterial growth -decreases ATP needed for virion

multiplication

Inhibition of phage protein expression Synthesis of a complementary DNA

Depolarization of membrane to avoid

C

ell

su

icid

e a

nd

no

ph

ag

e r

elea

se

P

ha

ge

dea

th

DNA base modification to evade

restriction Camouflage of restriction site by phage

protein

DNA mimic protein Self-methylation and activation of host

methylase

Addition of hydroxymethyl transferase to all cytosine residues

with/without glycosylation

Acquisition of methyltransferase Inhibition by phage protein

Overcome classical restriction gene product

Active viral block of restriction

enzyme

Acquisition of single-nucleotide mutation:

Protospacer adjacent motif (PAM)

Protospacer sequence Phosphorylation of Cas protein

Phage genome deletion sequence of:

PAM motif

Protospacer region

Synthesis of small phage protein with

anti-CRISPR activity

By-pass by phage mutations

Exchange of a DNA fragment with a resident prophage

Homologous recombination events

Synthesis of phage molecule to interfere with bacterial antitoxin

Phage-encoded pseudo-antotoxin RNA

(Dupuis, et al., 2013)

(Tock & Dryden, 2005)

(Stern & Sorek, 2011) (Walkinshaw, et al.,

2002)

(Yaung, et al., 2014)

(Kruger & Bickle,

1983) (Samson, et al., 2013)

(Domingues, et al.,

2004)

(Deveau, et al., 2008) (Schechner, et al.,

2013)

(Sorek, et al., 2008) (Brouns, et al., 2008)

(Deveau, et al., 2008)

(Samson, et al., 2013)

(Bondy-Denomy, et

al., 2013)

(Blower, et al., 2012)

(Haaber, et al., 2010) (Slavcev & Hayes,

2003)

(Snyder, 1995) (Otsuka & Yonesaki,

2012)

156

infection: Rex exclusion

Toxin-antotoxin systems Activation by phage infection

to neutralize the bacterial toxin

Phage antitoxin against multiple toxins Neutralization of toxin by production of

stable antitoxin

Phage mimics the small RNA antitoxin

(Bidnenko, et al.,

1998) (Labrie, et al., 2010)

(Blower, et al., 2012)

(Guo, et al., 2014)

Tra

nsc

rip

tio

n a

nd

tra

nsl

ati

on

Abortive infection:

Inhibition of RNA transcription Inhibition of phage gene translation

Reduce efficiency of plaquing

Origin-derived PER Inhibit production of phage major capsid

protein

CRISPR-Cas systems

Integration of fragment of phage DNA

Interference with phage nucleic acid

R

ed

uce p

ha

ge r

ep

lica

tio

n /

Ph

age a

nd

cell

dea

th

Acquisition of discrete mutations and all

above

Phage encoded own functional CRISPR-cas systems

Phage-encoded antiphage systems

Acquisition of point mutations or deletions

(Sturino &

Klaenhammer, 2006) (Bull, et al., 1998)

(Goeders & Van

Melderen, 2014)

(Villion & Moineau, 2013)

(Ram, et al., 2012)

(Garneau & Moineau, 2001)

Ass

emb

ly

Abortive infection:

Phage-triggered suicide

Interference with phage DNA packaging

Subunit poisoning

Cell

su

icid

e a

nd

no

ph

age r

ele

ase

Phage mutations and all above.

(Sturino & Klaenhammer, 2006)

Cell

ly

sis

Abortive infection:

Block phage from infecting neighboring

cells

Premature lysis of infected cell

Host-factor elimination

Elimination of host factors essential for

phage replication

Ph

ag

e d

ea

th

Phage mutations and all above.

(Stern & Sorek, 2011)

(Durmaz &

Klaenhammer, 2007)

The possibility of phage resistance has led researchers to explore the use of phage cocktails.

Phage cocktails are mixtures of phages, thereby producing more pharmacologically suitable

preparations to broaden the spectrum of activity of therapeutic phages (Chan & Abedon,

2012, Chan, et al., 2013). Phage cocktails may not only solve the problem of narrow host

range but also avoid problems related to phage resistance. Recently, numerous studies have

reported the effectiveness phage cocktails to control, detect and treat pathogenic bacteria in

both humans and animals (Chan, et al., 2013, Tiwari, et al., 2014). For example, a phage

cocktail containing eight phages belonging to Podoviridae and Myoviridae was used in a

phase I trial to treat patients with venous leg ulcers, targeting a single bacterium in the

wounds (Rhoads, et al., 2009). A phage cocktail containing three phages was tested in mice

157

infected by Klebsiella pneumoniae, which recovered pneumoniae bacteremia and quickly

eliminated the bacteria (Gu, et al., 2012). Others have reported double-blind phase I/II

clinical trials for treatment of chemo-resistant Pseudomonas aeruginosa-associated chronic

otitis and showed effectiveness and safety of the phage cocktail (Wright, et al., 2009).

Others have developed a strategy to fight bacterial infections based on using genetically

engineered phages as a delivery system for bactericidal proteins to target specific bacteria

(Westwater, et al., 2003).

Using combined therapy to treat human bacterial infections represents another strategy to

fight resistant bacteria, and could be implemented using phage or phage cocktails with

antibiotics to eradicate bacteria or by using specific phages targeting specific bacteria for

antibiotic delivery. In three patients in Georgia, phages combined with antibiotics were

tested in wound containing multidrug-resistant Staphylococcus aureus. Clinical

improvement in wounds was observed within 7 days, purulent drainage stopped and

bacteria were eliminated (Jikia, et al., 2005).

Recent interest has been rekindled in the development of clinical uses and

commercialization of phages, and pharmaceutical companies have become more involved

in phage therapy. The Eliava Institute was the first center in the world focused on

bacteriophages, including research, industrial department and manufacturing units. Later,

other companies got involved such as Eli Lilly and medical institutes have emerged

including the Hirszfeld Institute (Sulakvelidze, et al., 2001, Deresinski, 2009).

Other phage applications in human diseases

The phage display technology represents a powerful tool and innovative application for

pharmacology, immunology, cell biology, vaccine development, and isolation of specific

biomarkers for many diseases (Tohidkia, et al., 2012, Bakhshinejad & Sadeghizadeh,

2014). Recently, it was developed to diagnose and treat hepatitis B with the hope of

producing the anti-HBV (hepatitis B virus) vaccines (Bakhshinejad & Sadeghizadeh, 2014).

Furthermore, phages can efficiently deliver drugs and genes to mammalian cells for clinical

purposes as an innovative display phage screening strategy (Bakhshinejad & Sadeghizadeh,

158

2014). Many studies reported the application of a phage display library in the diagnosis

(Deutscher, 2010, Lim, et al., 2014) and potential treatment of a wide range of cancers

through in vitro and in vivo targeted delivery of therapeutic genes (Bakhshinejad &

Sadeghizadeh, 2014) to suppress tumor growth and kill tumor cells (Trepel, et al., 2009). In

nanomedicines, phage protein-mediated delivery of anticancer drugs (Petrenko & Jayanna,

2014, Wang, et al., 2014) has shown promising results compared to common

chemotherapy. Phage display makes probing tumor cells in the human body possible,

which has led to the identification of peptides targeting a specific cancer (Larimer &

Deutscher, 2014), and even peptides for human vasculature (Jung, et al., 2012, Larimer &

Deutscher, 2014). Another approach is in this area of phage fusion proteins targeting breast

cancer cells to deliver siRNA (Bedi, et al., 2011).

Phage applications in industries

Phages have also been investigated in agriculture and aquaculture. The Food and Drug

Administration (FDA) has recognized phages as safe for use in food additives as

antimicrobial biocontrol agents (Tiwari, et al., 2014). A phage preparation was proposed to

be added to animal feed to control Salmonella infection (Sillankorva, et al., 2012). Control

and protection of plants against bacterial infections is possible using phages (Balogh, et al.,

2010). Successful application of phages was obtained in cases of bacterial infections of

apple blossom, tomato, pepper spot and other crops (Monk, et al., 2010). Phage products

have been approved to reduce the risk of foodborne listeriosis (Monk, et al., 2010). They

have been proposed to combat bacterial contamination in yeast industrial processes

(Bertozzi Silva & Sauvageau, 2014). Phages were used as biocontrol agents and lytic

phages were used to detect the presence of pathogenic bacteria such as Mycobacterium

tuberculosis (Henry & Debarbieux, 2012). Phages were tested against many pathogenic

bacteria in aquaculture to prevent and treat infectious diseases, and were found to be

efficient (Nakai & Park, 2002).

159

Phage components as antibacterial agents

Most characterized phages that possess a tail produce lytic enzymes, known as endolysins

that are needed to lyse the cell at the end of the lytic cycle to release new virions

(Matsuzaki, et al., 2005). Phage endolysins belong to the cell wall hydrolase class and they

degrade peptidoglycan bonds, the major component of the bacterial cell wall, even from

outside of the cell (Matsuzaki, et al., 2005, Fischetti, et al., 2006, Parisien, et al., 2008).

Many in vivo and in vitro studies have shown that phage lytic enzymes have the capacity to

rapidly kill bacteria even at low dose (Strauch, et al., 2003, Fischetti, et al., 2006). Lytic

enzymes seem to be very promising and can be used as potential antibacterial agents with a

different mode of action compared to antibiotics targeting cell wall membranes, such as

penicillin. Lytic enzymes are also active against antibiotic-resistant bacteria and, in this

case, the probability of developing resistance against lytic enzymes appears to be very low

(Matsuzaki, et al., 2005, Borysowski, et al., 2006).

2. Immune modulation therapy

The human immune system is designed to fight a wide array of potential pathogens. This

system is our own natural defense, which is divided into two types of immunity to protect

our body from numerous microbes: innate and adaptive immunity. These two mechanisms

play an essential role in the maintenance of health, and in the prevention of and recovery

from disease, but each mechanism has different functions and roles. The immune system

regularly interacts with a massive number of microorganisms including commensals, gut

microbiota, and other microorganisms from the environment, including pathogens

(Mansour, et al., 2014). Although this great system can tolerate and stay passive in contact

with commensal microbial species, contact with a harmful microbe activates a response to

prevent infection and remove this microbe. Hence, the idea to use immune modulation

therapy to combat a myriad of human diseases, including bacterial infections. Immune

modulation is a rational approach exploiting natural host mechanisms to initiate or enhance

protective antimicrobial immunity (Hancock, et al., 2012). Microbes express specific

160

virulence factors that repress immune system responses and increase pathogenicity

(Hancock, et al., 2012). Therefore, depending on the situation, the immune system can

modulate the response through hyperactivation (immunostimulation) or hypoactivation

(immunosuppression) (Mahima, et al., 2012, Yao, et al., 2013). Immunomodulation is

reconstitution therapy to retrieve control of the human body.

Immunomodulatory agents were shown to be useful as a therapeutic strategy (reconstitution

therapy) to compensate a defect in the immune system. These agents limited autoimmune

and inflammation responses and stimulated antitumor immunity (Ulevitch, 2004, Hancock,

et al., 2012). Vaccination is one of the great successes of immune modulation therapy to

prevent infectious diseases. Monoclonal antibodies (mAb) are could be used as

immunomodulation tools, they were approved for clinical application many decades ago for

treatment of various diseases (Jiang, et al., 2011). Much work was done to develop human

therapeutic antibodies to become less immunogenic and more efficient with a longer half-

life in vivo (Jiang, et al., 2011). Today, many monoclonal antibodies (mAb) have been

approved for treatment of inflammatory diseases (Kotsovilis & Andreakos, 2014), cancer

(Scott, et al., 2012) and viral infections (Marasco & Sui, 2007).

The application of mAb as a therapy for bacterial infectious diseases is promising but still

not commonly used. Yet, recent attention has been given to the development of efficient

mAb against bacterial infectious diseases for clinical use and they are gaining momentum

to remove resistant bacteria and/or bacterial toxins. mAbs targeting anthrax were the first to

be approved (due to bioterrorist threats) for use in patients with inhalational anthrax. This

mAb acts by binding to a key antigen of Bacillus anthracis (Fox, 2013). Neutralizing anti-

toxin mAbs have significant potential as they can inhibit the function of bacterial exotoxins

(Oleksiewicz, et al., 2012). Many efforts have also been made to develop mAbs to obstruct

the binding of toxins to their receptors, allowing efficient clearance. Several mAbs

targeting the protective antigen component of the lethal B. anthracis toxin are currently

under investigation (Oleksiewicz, et al., 2012) while Raxibacumab has already been

approved for treatment and prophylaxis in the case of inhalational anthrax (Kummerfeldt,

2014). Similarly, anti-PcrV antibody provides significant protection against the P.

161

aeruginosa type III secretion system (T3SS), which injects bacterial toxins directly into the

cytoplasm of host cells. Anti-PcrV antibody demonstrated excellent efficacy in multiple

animal models against multi-drug resistant P. aeruginosa (Warrener, et al., 2014).

Most mAbs target one specific epitope that block a toxin while mAb cocktails increase

efficiency by overlapping more epitopes (Oleksiewicz, et al., 2012). Interestingly, many

mAb cocktails designed as efficient toxin neutralizers are in clinical trials and seem

promising, such as a mixture of three monoclonal antibodies against Clostridium botulinum

toxin. A cocktail of two mAbs toward Shiga toxin-producing E. coli are in clinical research

trials (Oleksiewicz, et al., 2012). In addition, an approach to use mAbs targeting

components of the outer membrane against bacterial lipopolysaccharide and lipoteichoic

acid is in clinical development (Oleksiewicz, et al., 2012). Monoclonal antibodies targeting

bacterial surface components seems to be an encouraging option since the mAbs bind

directly to surface proteins and act in several different ways, including via bacterial lysis

(LaRocca, et al., 2009, Oleksiewicz, et al., 2012). Similar to phage therapy, interest in

study and development of mAbs has increased and many biotechnology companies are

engaged in this promising area.

Immunomodulation therapy targeting innate immune receptors is another potential

therapeutic alternative. The innate immune system recognises molecular signatures from

microbial cells by way of pattern recognition receptors (PRRs), which directly trigger

immune cells (Kawai & Akira, 2010, Hancock, et al., 2012). The idea of targeting PRRs is

related to their high conservation among different species, which means few variations

among pathogen-associated molecular patterns (PAMs) leading to control and regulation of

the immune system (Akira, et al., 2006). There has been considerable expansion in our

knowledge of Toll-like receptors (TLRs) and NOD-like receptors (NLRs), key families of

PRR receptors regarded as potential therapeutic regulators. They stimulate the immune

system in the same way as microorganisms and play an important role by controlling

bacterial infection (Hancock, et al., 2012).

162

TLRs and NLRs, have the ability to rapidly detect and recognize structural components

belonging to Gram-positive and Gram-negative bacteria (Akira, et al., 2006). Toll-like

receptor family members include 10 transmembrane proteins, each one recognizes and has

a specific response to specific PAMs such as nucleic acids, lipoteichoic acid,

lipopolysaccharide, porins and flagellin (Akira, et al., 2006, Hancock, et al., 2012).

Likewise, NLRs sense and distinguish muropeptides (Chan, et al., 2013), soluble

peptidoglycan structures and other bacterial components, which play a role as messengers

of the presence of antibiotic pointing cell-wall biosynthesis (Boudreau, et al., 2012).

Bacteria can evade the host immune defense system using numerous strategies, including

rapid growth, which does not give enough time to the host to provide good responses,

creating a need for vaccination against these infections. Bacteria can also evade the host

immune defense system through persistence, which makes the immune system weaker

(Kaufmann & Schaible, 2005). Therefore, immunomodulation therapy through TLRs and

NLRs could be used as agonist, antagonist or bacterial vaccines to boost host bacterial

elimination (Chan, et al., 2013). Trials are underway for various applications, such as the

case of a respiratory tract infection caused by bacteria where TLR agonists as bacterial

vaccines have the potential to eliminate existing bacteria and protect against future bacterial

infections (Zuany-Amorim, et al., 2002, Hancock, et al., 2012).

Taken altogether, immunomodulation has two targets: the cell surface receptors and the

intracellular pathways (Ulevitch, 2004). This represents promising new approaches for

selective therapy by targeting proteins or signalling pathways to modulate the innate

immune system in order to treat bacterial infections with limited side effects.

Immunomodulation therapy provides advantages compared to common therapy. First, no

antimicrobial resistance can be developed against this therapy, especially in the absence of

selection pressure against the microbes. Second, this therapy targets the host and not the

invasive microorganisms, making the human body stronger through modulation of

immunity.

163

3. Antimicrobial peptides

Antimicrobial peptides (AMPs) are part of our natural innate immune system. In fact, they

are present in almost every life form, from bacteria to human, and active against a wide

range of pathogenic agents able to kill a broad spectrum of microorganisms (Hancock, et

al., 2012, Okorochenkov, et al., 2012). AMPs are short, positively charged, amphiphilic

peptides, 10 to 50 amino acids long (Hancock & Sahl, 2006).

The mode of action of AMPs requires direct interaction with the bacterial surface. The

positive charge of these peptides and the negative charge of the bacterial cell wall (due to

phosphate groups in LPS of Gram-negative bacteria and lipoteichoic acids of Gram-

positive bacteria) promote attachment, then AMPs promote pore formation leading to

bacterial lysis and killing (Jenssen, et al., 2006, Okorochenkov, et al., 2012). In Gram-

positive bacteria, AMPs often target Lipid II, a membrane-anchored cell-wall precursor that

plays an essential role in cell-wall synthesis, and lead to disruption of cell wall biosynthesis

and pore formation (Hancock & Sahl, 2006). Similarly, in Gram-negative bacteria, after

attachment of AMPs to the outer membrane, these peptides are directed into membrane-

associated structures where they increase the permeability by channel formation and

membrane disorganization, leading to the entry of other peptides arriving at the cytoplasmic

membrane (Jenssen, et al., 2006). Pore formation is not the exclusive mode of action of

antimicrobial peptides, there are other mechanisms targeting a variety of essential cellular

processes including inhibition of spectum formation, cell-wall biosynthesis, inhibition of

enzymatic activity and inhibition of nucleic acids and protein synthesis, binding to DNA

and activation of autolysis (Brogden, 2005, Deutscher, 2010). Many factors also affect

AMPs activity and specificity. The susceptibility of a bacterium to any given AMP is

related to the peptide size, sequence, structure and conformation, hydrophobicity, cationic

and amphiphilic nature (Brogden, 2005).

AMPs are considered to be a very promising alternative to antibiotics (Okorochenkov, et

al., 2012). Much work has been done in the last three decades to identify and study AMPs

164

(Jenssen, et al., 2006). In addition to their antimicrobial properties some have also

immunomodulation activity, making them a promising tool against antibiotic resistant

bacteria (Hancock & Sahl, 2006). Several AMPs are in clinical trials and others are in

discovery, development and preclinical studies (Jenssen, et al., 2006, Okorochenkov, et al.,

2012).

LL-37, a human antimicrobial peptide with 37 amino acids having immunomodulatory

properties, has a broad spectrum activity against many Gram-positive and Gram-negative

bacteria, such as Escherichia coli, Staphylocococcus aureus, Salmonella typhimurium and

P. aeruginosa, Neisseria gonorrhoeae, Klebsiella pneumoniae and group A Streptococcus

(Smeianov, et al., 2000, Bergman, et al., 2005, Bowdish, et al., 2005, Liu, et al., 2013).

The pig-derived antimicrobial peptide PR-39 provided favorable results against several

Gram-positive bacteria such as Bacillus globigii and Enterococcus faecalis and toward

Gram-negative bacteria with as broad an antibacterial spectrum as Pseudomonas (Vunnam,

et al., 1997, Veldhuizen, et al., 2014). Antimicrobial peptides produced by fungi can also

have antibacterial activities against many Gram-positive bacteria including Streptococcus

(Hancock & Sahl, 2006). It is also well-documented that AMPs provide cutaneous defense

mechanisms, even against Staphylococcus aureus (Braff, et al., 2005).

Antimicrobial peptides could be used also as food preservatives. For example, nisin, an

antimicrobial peptide with 34 amino acids produced by Lactococcus lactis, is active against

foodborne pathogens, including resistant bacteria such as methicillin-resistant S. aureus

(Jenssen, et al., 2006). Encapsulation of AMPs can enhance their stability in foods to assure

higher efficiency (Carmona-Ribeiro & de Melo Carrasco, 2014).

Researchers have detected AMP-resistance in bacteria but to a lower frequency. Resistance

mechanisms include reducing negative surface charge by alteration of membrane protein or

by production of proteolytic enzymes to degrade AMPs (Brogden, 2005). Even with a few

reported cases of resistance, the use of AMPs for therapeutic purposes as an antibacterial

alternative is still promising. To ensure the effectiveness of AMPs other parameters should

be taken into consideration, such as the in vivo concentration of these peptides, synergic

effects with other molecules or inactivation by proteases (Braff, et al., 2005, Brogden,

165

2005). Of interest is the development of synthetic AMPs or their optimization by chemical

modification to increase their efficiency, to reduce toxicity, and to increase bioavailability

(Jenssen, et al., 2006, Okorochenkov, et al., 2012). Combined therapy using AMPs and

antibiotics is also attracting. Two AMPs, LL-37 and HBD3 were combined with antibiotics

and showed to act synergistically against Clostridium difficile (Nuding, et al., 2014).

Antimicrobial peptides have shown high efficiency against a wide range of bacteria but

more work is still needed to produce less toxic, more stable AMPs at a lower cost.

4. Probiotics and prebiotics

The intestinal microbiota is a collection of commensal microorganisms, including bacteria,

fungi and protozoa that play an essential role in human health. They also have key roles in

metabolism and food absorption as well as to provide protection from pathogenic agents

(Plummer, et al., 2005, Grimoud, et al., 2010). Probiotics and prebiotics are employed in

food products to reduce pathogenic bacteria and as a strategy to restore and protect the

intestinal microbiota (Grimoud, et al., 2010).

Probiotics are living bacteria widely administered to humans in reasonable quantities to

prevent side effects following antibiotic therapy, which disturbs the ecological balance of

the gut microbiota. Probiotics stimulate the growth of some members of the gut microbiota

and modulate mucosal and systemic immunity (Courvalin, 2006, Kotzampassi &

Giamarellos-Bourboulis, 2012). Determining the direct effect of probiotics on the intestinal

microbiota is difficult due to the relationships between members of the microbiota

(Plummer, et al., 2005). Probiotics use natural competition mechanisms, including

competition for food, adherence to the mucosa and epithelium, inhibition of bacterial

translocation, production of inhibitor compounds such as bacteriocins, and as

immunomodulators to improve the human immune system and maintain the integrity of the

intestinal barrier (Hemarajata & Versalovic, 2013). Probiotics have been shown to provide

relief in the case of gastroenteritis by reducing the duration of symptoms (Kotzampassi &

166

Giamarellos-Bourboulis, 2012). The main bacteria used as probiotics belong to the lactic

acid bacteria group (mostly Lactobacillus sp.) as well as from Bifidobacterium, which are

part of the normal gut microbiota (Kotzampassi & Giamarellos-Bourboulis, 2012). It has

been reported that hosts distinguish probiotics through their pattern recognition receptors,

increasing or supressing activation of downstream pathways of the host immune system

(Bermudez-Brito, et al., 2012). Many studies have highlighted the use of probiotics to

prevent or treat bacterial pathogenic infections, as an alternative or complementary to

antibiotics (Oudhuis, et al., 2011, Amalaradjou & Bhunia, 2012, Kotzampassi &

Giamarellos-Bourboulis, 2012). They can be used for prophylactic treatment against

bacterial respiratory infections, including nosocomial or community acquired pneumonia

(Alexandre, et al., 2014). Probiotics are also used in the treatment of gastrointestinal

infections by reducing infections by Helicobacter pylori, the causative agent of ulcers, and

are reported to decrease bacterial charge and gastritis (Patel, et al., 2014) and to prevent

nosocomial infection (Oudhuis, et al., 2011). A clinical trial using combined probiotics

seems to reduce the incidence of postoperative bacterial among patients undergoing

pancreas resection or liver transplant (Rayes, et al., 2007). Likewise, probiotics could be

used to control foodborne pathogens. Probiotics were demonstrated to reduce various

pathogens, such as Salmonella Enteritidis, the causative agent of foodborne gastroenteritis,

in chicks, and to protect mice from death caused by L. monocytogenes (Amalaradjou &

Bhunia, 2012).

Prebiotics are selectively fermented ingredients and non-digestible food ingredients that

modulate the proliferation of the active gut microbiota (Grimoud, et al., 2010). Research

into the addition of prebiotics increased due to their perceived benefits for human health.

Today, it is recommended to add prebiotics to infant milk to mimic similar functionalities

as human milk by mixing short chain galacto-oligosaccharides and long-chain fructo-

oligosaccharides at a ratio of 9:1 (Scholtens, et al., 2014). A food product containing

prebiotics and probiotics is called a synbiotic (Grimoud, et al., 2010). The use of synbiotics

versus prebiotics and probiotics alone in patients with ulcerative colitis seems to be more

efficient due to the effect of prebiotics in improving the probiotic colonization or

metabolism and in regulating the gut microbiota (Fujimori, et al., 2009, Grimoud, et al.,

167

2010). Synbiotic treatment was also demonstrated to reduce septic complication (Shimizu,

et al., 2013).

Currently, prebiotics, probiotics and synbiotics are promising products to assure

maintenance and restauration of intestinal microbiota. An important consideration for a

probiotic product is the selection of bacteria. It should have no or low resistance to

antibiotics as well as be refractory to the acquisition of antibiotic resistance genes to avoid

dissemination.

5. Other antimicrobial agents

Medicinal Plants

A large number of Earth’s medicinal plants can be thought of as nature’s gifts and they

have been part of traditional medicine practices for thousands of years. Knowledge of these

plants and their uses in the treatment of various diseases or symptoms were preserved for

generations (Dubreuil, 2013). Among others, medicinal plants and plant extracts have been

studied for their immunomodulation properties of the host (Ganju, et al., 2003). Current

work focuses on determining the active components in medicinal plants and studying their

properties with a focus on using them as complementary and/or alternative therapies to treat

diseases, including as antimicrobial agents (Dubreuil, 2013). It has been reported that many

medicinal plants have antibacterial activity, for example, against enterotoxigenic E. coli and

Vibrio cholorae (Ganju, et al., 2003, Dubreuil, 2013). Some varieties and extracts of

Camellia plants were shown to have the ability to eliminate S. aureus, S. pyogenes, S.

epidermidis, P. aeruginosa, K. pneumonia, E. coli, and Serratia marcescens (Bashir, et al.,

2014). The use of medicinal plants as antimicrobial agents is promising and could be an

efficient alternative or combined therapy with antibiotics. To increase safety and efficacy,

more studies are needed to understand the interactions between different active components

in the same plant or from different plants, and also to understand the interactions with

antibiotics and components of the human body.

168

Essential oils

Essential oils are oily aromatic liquids that protect plants from diseases and are considered

to be mixtures of volatile organic molecules that can be extracted from plants by different

methods (Haba, et al., 2014). After the emergence of antimicrobial resistance, many studies

have focused on essential oils, highlighting their antimicrobial properties. Antimicrobial

activity was not always found stable and reproducible due to seasonal composition changes

and the percentage of active components, geographic site and the function of a part from

the same plant (Gomez-Estaca, et al., 2010). Because of their complex composition,

essential oils have many modes of action, such as disturbing the bacterial membrane,

inhibiting enzymes, disrupting metabolic pathways and increasing membrane permeability

(Langeveld, et al., 2014). Many studies reported the effects of essentials oils against

pathogenic bacteria but the tea tree Melaleuca alternifolia and the flowering plant

Backhousia citriodora are particularly interesting as their extracted essential oils are

effective against a wide range of bacteria (Kurekci, et al., 2013). Likewise, essential oils

were reported to have antimicrobial activity against Candida albicans and methicillin-

resistant S. aureus (Haba, et al., 2014). Essential oils are particularly interesting and

efficient for food and fish preservation (Gomez-Estaca, et al., 2010). The absence of

bacterial resistance to these products holds promise for their use in the treatment of

infections and perhaps for their use in combined therapy with antibiotics.

Conclusions

Antibiotic resistance remains an alarming problem worldwide due to the extensive use and

misuse of antibiotics. The urgent need for alternative antimicrobial agents and treatments is

crucial for controlling pathogens in medicine and agriculture. The availability of many

promising alternatives is encouraging but also highlights the needs for more studies to fully

comprehend their mode of action alone or in combination with our current arsenal of

antimicrobial agents. Moreover, additional studies are required to assess their

microbiological and clinical impacts on animal and humans.

169

References

Abedon, S. T., S. J. Kuhl, B. G. Blasdel, and E. M. Kutter. 2011. Phage treatment of human

infections. Bacteriophage 1:66-85.

Akira, S., S. Uematsu, and O. Takeuchi. 2006. Pathogen recognition and innate immunity.

Cell 124:783-801.

Alekshun, M. N., and S. B. Levy. 2006. Commensals upon us. Biochem Pharmacol 71:893-

900.

Alexandre, Y., G. Le Blay, S. Boisrame-Gastrin, F. Le Gall, G. Hery-Arnaud, S. Gouriou,

S. Vallet, and R. Le Berre. 2014. Probiotics: a new way to fight bacterial pulmonary

infections? Med Mal Infect 44:9-17.

Allen, H. K., J. Donato, H. H. Wang, K. A. Cloud-Hansen, J. Davies, and J. Handelsman. 2010. Call of the wild: antibiotic resistance genes in natural environments. Nat Rev

Microbiol 8:251-259.

Amalaradjou, M. A., and A. K. Bhunia. 2012. Modern approaches in probiotics research to

control foodborne pathogens. Adv Food Nutr Res 67:185-239.

Andersson, D. I., and D. Hughes. 2010. Antibiotic resistance and its cost: is it possible to

reverse resistance? Nat Rev Microbiol 8:260-271.

Baker, J. R., S. Dong, and D. G. Pritchard. 2002. The hyaluronan lyase of Streptococcus

pyogenes bacteriophage H4489A. Biochem J 365:317-322.

Bakhshinejad, B., and M. Sadeghizadeh. 2014. Bacteriophages and their applications in the

diagnosis and treatment of hepatitis B virus infection. World J Gastroenterol 20:11671-

11683.

Bakhshinejad, B., and M. Sadeghizadeh. 2014. Bacteriophages as vehicles for gene delivery

into mammalian cells: prospects and problems. Expert Opin Drug Deliv:1-14.

Balogh, B., J. B. Jones, F. B. Iriarte, and M. T. Momol. 2010. Phage therapy for plant

disease control. Curr Pharm Biotechnol 11:48-57.

Bashir, S., B. M. Khan, M. Babar, S. Andleeb, M. Hafeez, S. Ali, and M. F. Khan. 2014.

Assessment of bioautography and spot screening of tlc of green tea (Camellia) plant

extracts as antibacterial and antioxidant agents. Indian J Pharm Sci 76:364-370.

Bedi, D., T. Musacchio, O. A. Fagbohun, J. W. Gillespie, P. Deinnocentes, R. C. Bird, L.

Bookbinder, V. P. Torchilin, and V. A. Petrenko. 2011. Delivery of siRNA into

breast cancer cells via phage fusion protein-targeted liposomes. Nanomedicine 7:315-

323.

Bergman, P., L. Johansson, V. Asp, L. Plant, G. H. Gudmundsson, A. B. Jonsson, and B.

Agerberth. 2005. Neisseria gonorrhoeae downregulates expression of the human

antimicrobial peptide LL-37. Cell Microbiol 7:1009-1017.

Bermudez-Brito, M., J. Plaza-Díaz, S. Muñoz-Quezada, C. Gómez-Llorente, and A. Gil. 2012. Probiotic mechanisms of action. Ann Nutr Metab 61:160-174

Bertozzi Silva, J., and D. Sauvageau. 2014. Bacteriophages as antimicrobial agents against

bacterial contaminants in yeast fermentation processes. Biotechnol Biofuels 7:123.

Bidnenko, E., S. D. Ehrlich, and M. C. Chopin. 1998. Lactococcus lactis phage operon

coding for an endonuclease homologous to RuvC. Mol Microbiol 28:823-834.

Biswas, B., S. Adhya, P. Washart, B. Paul, A. N. Trostel, B. Powell, R. Carlton, and C. R.

Merril. 2002. Bacteriophage therapy rescues mice bacteremic from a clinical isolate of

vancomycin-resistant Enterococcus faecium. Infect Immun 70:204-210.

170

Blower, T. R., T. J. Evans, R. Przybilski, P. C. Fineran, and G. P. Salmond. 2012. Viral

evasion of a bacterial suicide system by RNA-based molecular mimicry enables

infectious altruism. PLoS Genet 8:e1003023.

Blower, T. R., F. L. Short, P. C. Fineran, and G. P. Salmond. 2012. Viral molecular

mimicry circumvents abortive infection and suppresses bacterial suicide to make hosts

permissive for replication. Bacteriophage 2:234-238.

Bondy-Denomy, J., A. Pawluk, K. L. Maxwell, and A. R. Davidson. 2013. Bacteriophage

genes that inactivate the CRISPR/Cas bacterial immune system. Nature 493:429-432.

Borysowski, J., B. Weber-Dabrowska, and A. Gorski. 2006. Bacteriophage endolysins as a

novel class of antibacterial agents. Exp Biol Med 231:366-377.

Boudreau, M. A., J. F. Fisher, and S. Mobashery. 2012. Messenger functions of the bacterial

cell wall-derived muropeptides. Biochemistry 51:2974-2990.

Bowdish, D. M., D. J. Davidson, Y. E. Lau, K. Lee, M. G. Scott, and R. E. Hancock. 2005.

Impact of LL-37 on anti-infective immunity. J Leukoc Biol 77:451-459.

Braff, M. H., A. Bardan, V. Nizet, and R. L. Gallo. 2005. Cutaneous defense mechanisms by

antimicrobial peptides. J Invest Dermatol 125:9-13.

Brogden, K. A. 2005. Antimicrobial peptides: pore formers or metabolic inhibitors in bacteria?

Nat Rev Microbiol 3:238-250.

Brouns, S. J., M. M. Jore, M. Lundgren, E. R. Westra, R. J. Slijkhuis, A. P. Snijders, M.

J. Dickman, K. S. Makarova, E. V. Koonin, and J. van der Oost. 2008. Small

CRISPR RNAs guide antiviral defense in prokaryotes. Science 321:960-964.

Bull, J. J., A. Jacobson, M. R. Badgett, and I. J. Molineux. 1998. Viral escape from

antisense RNA. Mol Microbiol 28:835-846.

Carmona-Ribeiro, A. M., and L. D. de Melo Carrasco. 2014. Novel formulations for

antimicrobial peptides. Int J Mol Sci 15:18040-18083.

Cerveny, K. E., A. DePaola, D. H. Duckworth, and P. A. Gulig. 2002. Phage therapy of

local and systemic disease caused by Vibrio vulnificus in iron-dextran-treated mice.

Infect Immun 70:6251-6262.

Chan, B. K., and S. T. Abedon. 2012. Phage therapy pharmacology phage cocktails. Adv

Appl Microbiol 78:1-23.

Chan, B. K., S. T. Abedon, and C. Loc-Carrillo. 2013. Phage cocktails and the future of

phage therapy. Future Microbiol 8:769-783.

Chatterjee, S., and E. Rothenberg. 2012. Interaction of bacteriophage l with its E. coli

receptor, LamB. Viruses 4:3162-3178.

Clokie, M. R., A. D. Millard, A. V. Letarov, and S. Heaphy. 2011. Phages in nature.

Bacteriophage 1:31-45.

Cornelissen, A., P. J. Ceyssens, V. N. Krylov, J. P. Noben, G. Volckaert, and R. Lavigne. 2012. Identification of EPS-degrading activity within the tail spikes of the novel

Pseudomonas putida phage AF. Virology 434:251-256.

Courvalin, P. 2006. Antibiotic resistance: the pros and cons of probiotics. Dig Liver Dis 38

Suppl 2:S261-265.

Cowen, L. E. 2008. The evolution of fungal drug resistance: modulating the trajectory from

genotype to phenotype. Nat Rev Microbiol 6:187-198.

Davies, J., and D. Davies. 2010. Origins and evolution of antibiotic resistance. Microbiol Mol

Biol Rev 74:417-433.

Deresinski, S. 2009. Bacteriophage therapy: exploiting smaller fleas. Clin Infect Dis 48:1096-

1101.

Deutscher, S. L. 2010. Phage display in molecular imaging and diagnosis of cancer. Chem Rev

110:3196-3211.

171

Deveau, H., R. Barrangou, J. E. Garneau, J. Labonte, C. Fremaux, P. Boyaval, D. A.

Romero, P. Horvath, and S. Moineau. 2008. Phage response to CRISPR-encoded

resistance in Streptococcus thermophilus. J Bacteriol 190:1390-1400.

Domingues, S., A. Chopin, S. D. Ehrlich, and M. C. Chopin. 2004. A phage protein confers

resistance to the lactococcal abortive infection mechanism AbiP. J Bacteriol 186:3278-

3281.

Dubreuil, J. D. 2013. Antibacterial and antidiarrheal activities of plant products against

enterotoxinogenic Escherichia coli. Toxins 5:2009-2041.

Dupuis, M. E., M. Villion, A. H. Magadan, and S. Moineau. 2013. CRISPR-Cas and

restriction-modification systems are compatible and increase phage resistance. Nat

Commun 4:2087.

Durmaz, E., and T. R. Klaenhammer. 2007. Abortive phage resistance mechanism AbiZ

speeds the lysis clock to cause premature lysis of phage-infected Lactococcus lactis. J

Bacteriol 189:1417-1425.

Durmaz, E., S. M. Madsen, H. Israelsen, and T. R. Klaenhammer. 2002. Lactococcus lactis

lytic bacteriophages of the P335 group are inhibited by overexpression of a truncated CI

repressor. J Bacteriol 184:6532-6544.

Falconer, S. B., T. L. Czarny, and E. D. Brown. 2011. Antibiotics as probes of biological

complexity. Nat Chem Biol 7:415-423.

Fischetti, V. A., D. Nelson, and R. Schuch. 2006. Reinventing phage therapy: are the parts

greater than the sum? Nat Biotechnol 24:1508-1511.

Fox, J. L. 2013. Anthrax drug first antibacterial mAb to win approval. Nat Biotechnol 31:8.

Fujimori, S., K. Gudis, K. Mitsui, T. Seo, M. Yonezawa, S. Tanaka, A. Tatsuguchi, and C.

Sakamoto. 2009. A randomized controlled trial on the efficacy of synbiotic versus

probiotic or prebiotic treatment to improve the quality of life in patients with ulcerative

colitis. Nutrition 25:520-525.

Ganju, L., D. Karan, S. Chanda, K. K. Srivastava, R. C. Sawhney, and W. Selvamurthy. 2003. Immunomodulatory effects of agents of plant origin. Biomed Pharmacother

57:296-300.

Garneau, J. E., and S. Moineau. 2001. CRISPR/Cas system and resistance to bacteriophage

infection. In: eLS. John Wiley & Sons, Ltd.

Goeders, N., and L. Van Melderen. 2014. Biodegradable gelatin-chitosan films incorporated

with essential oils as antimicrobial agents for fish preservation. Food Microbiol 27:889-

896.

Gomez-Estaca, J., A. Lopez de Lacey, M. E. Lopez-Caballero, M. C. Gomez-Guillen, and

P. Montero. 2010. Biodegradable gelatin-chitosan films incorporated with essential

oils as antimicrobial agents for fish preservation. Food Microbiol 27:889-896.

Grimoud, J., H. Durand, C. Courtin, P. Monsan, F. Ouarne, V. Theodorou, and C.

Roques. 2010. In vitro screening of probiotic lactic acid bacteria and prebiotic

glucooligosaccharides to select effective synbiotics. Anaerobe 16:493-500.

Gu, J., X. Liu, Y. Li, W. Han, L. Lei, Y. Yang, H. Zhao, Y. Gao, J. Song, R. Lu, C. Sun,

and X. Feng. 2012. A method for generation phage cocktail with great therapeutic

potential. PLoS One 7:e31698.

Guo, Y., C. Quiroga, Q. Chen, M. J. McAnulty, M. J. Benedik, T. K. Wood, and X. Wang. 2014. RalR (a DNase) and RalA (a small RNA) form a type I toxin-antitoxin system in

Escherichia coli. Nucleic Acids Res 42:6448-6462.

Haaber, J., J. E. Samson, S. J. Labrie, V. Campanacci, C. Cambillau, S. Moineau, and K.

Hammer. 2010. Lactococcal abortive infection protein AbiV interacts directly with the

172

phage protein SaV and prevents translation of phage proteins. Appl Environ Microbiol

76:7085-7092.

Haba, E., S. Bouhdid, N. Torrego-Solana, A. M. Marqués, M. J. Espuny, M. J. García-

Celma, and A. Manresa. 2014. Rhamnolipids as emulsifying agents for essential oil

formulations: antimicrobial effect against Candida albicans and methicillin-resistant

Staphylococcus aureus. Int J Pharm 476:134-141.

Hancock, R. E., A. Nijnik, and D. J. Philpott. 2012. Modulating immunity as a therapy for

bacterial infections. Nat Rev Microbiol 10:243-254.

Hancock, R. E., and H. G. Sahl. 2006. Antimicrobial and host-defense peptides as new anti-

infective therapeutic strategies. Nat Biotechnol 24:1551-1557.

Hemarajata, P., and J. Versalovic. 2013. Effects of probiotics on gut microbiota: mechanisms

of intestinal immunomodulation and neuromodulation. Therap Adv Gastroenterol 6:39-

51.

Henry, M., and L. Debarbieux. 2012. Tools from viruses: bacteriophage successes and

beyond. Virology 434:151-161.

Jenssen, H., P. Hamill, and R. E. Hancock. 2006. Peptide antimicrobial agents. Clin

Microbiol Rev 19:491-511.

Jiang, X. R., A. Song, S. Bergelson, T. Arroll, B. Parekh, K. May, S. Chung, R. Strouse, A.

Mire-Sluis, and M. Schenerman. 2011. Advances in the assessment and control of the

effector functions of therapeutic antibodies. Nat Rev Drug Discov 10:101-111.

Jikia, D., N. Chkhaidze, E. Imedashvili, I. Mgaloblishvili, G. Tsitlanadze, R. Katsarava, J.

Glenn Morris, Jr., and A. Sulakvelidze. 2005. The use of a novel biodegradable

preparation capable of the sustained release of bacteriophages and ciprofloxacin, in the

complex treatment of multidrug-resistant Staphylococcus aureus-infected local

radiation injuries caused by exposure to Sr90. Clin Exp Dermatol 30:23-26.

Jung, E., N. K. Lee, S. K. Kang, S. H. Choi, D. Kim, K. Park, K. Choi, Y. J. Choi, and D.

H. Jung. 2012. Identification of tissue-specific targeting peptide. J Comput Aided Mol

Des 26:1267-1275.

Kaufmann, S. H., and U. E. Schaible. 2005. Antigen presentation and recognition in bacterial

infections. Curr Opin Immunol 17:79-87.

Kawai, T., and S. Akira. 2010. The role of pattern-recognition receptors in innate immunity:

update on Toll-like receptors. Nat Immunol 11:373-384.

Kotsovilis, S., and E. Andreakos. 2014. Therapeutic human monoclonal antibodies in

inflammatory diseases. Methods Mol Biol 1060:37-59.

Kotzampassi, K., and E. J. Giamarellos-Bourboulis. 2012. Probiotics for infectious diseases:

more drugs, less dietary supplementation. Int J Antimicrob Agents 40:288-296.

Kruger, D. H., and T. A. Bickle. 1983. Bacteriophage survival: multiple mechanisms for

avoiding the deoxyribonucleic acid restriction systems of their hosts. Microbiol Rev

47:345-360.

Kummerer, K., and A. Henninger. 2003. Promoting resistance by the emission of antibiotics

from hospitals and households into effluent. Clin Microbiol Infect 9:1203-1214.

Kummerfeldt, C. E. 2014. Raxibacumab: potential role in the treatment of inhalational

anthrax. Infect Drug Resist 7:101-109.

Kurekci, C., J. Padmanabha, S. L. Bishop-Hurley, E. Hassan, R. A. Al Jassim, and C. S.

McSweeney. 2013. Antimicrobial activity of essential oils and five terpenoid

compounds against Campylobacter jejuni in pure and mixed culture experiments. Int J

Food Microbiol 166:450-457.

Labrie, S. J., J. E. Samson, and S. Moineau. 2010. Bacteriophage resistance mechanisms.

Nat Rev Microbiol 8:317-327.

173

Langeveld, W. T., E. J. Veldhuizen, and S. A. Burt. 2014. Synergy between essential oil

components and antibiotics: a review. Crit Rev Microbiol 40:76-94.

Larimer, B. M., and S. L. Deutscher. 2014. Development of a peptide by phage display for

SPECT imaging of resistance-susceptible breast cancer. Am J Nucl Med Mol Imaging

4:435-447.

LaRocca, T. J., D. J. Holthausen, C. Hsieh, C. Renken, C. A. Mannella, and J. L. Benach. 2009. The bactericidal effect of a complement-independent antibody is osmolytic and

specific to Borrelia. Proc Natl Acad Sci U S A 106:10752-10757.

Lim, B. N., G. J. Tye, Y. S. Choong, E. B. Ong, A. Ismail, and T. S. Lim. 2014. Principles

and application of antibody libraries for infectious diseases. Biotechnol Lett 36:2381-

2392.

Liu, B., and M. Pop. 2009. ARDB--antibiotic resistance genes database. Nucleic Acids Res

37:D443-447.

Liu, W., S. L. Dong, F. Xu, X. Q. Wang, T. R. Withers, H. D. Yu, and X. Wang. 2013.

Effect of intracellular expression of antimicrobial peptide LL-37 on growth of

Escherichia coli strain TOP10 under aerobic and anaerobic conditions. Antimicrob

Agents Chemother 57:4707-4716.

Lu, M. J., and U. Henning. 1994. Superinfection exclusion by T-even-type coliphages. Trends

Microbiol 2:137-139.

Lu, M. J., Y. D. Stierhof, and U. Henning. 1993. Location and unusual membrane topology

of the immunity protein of the Escherichia coli phage T4. J Virol 67:4905-4913.

Lu, T. K., and M. S. Koeris. 2011. The next generation of bacteriophage therapy. Curr Opin

Microbiol 14:524-531.

Ly-Chatain, M. H. 2014. The factors affecting effectiveness of treatment in phages therapy.

Front Microbiol 5:51.

Mahima, A. Rahal, R. Deb, S. K. Latheef, H. Abdul Samad, R. Tiwari, A. K. Verma, A.

Kumar, and K. Dhama. 2012. Immunomodulatory and therapeutic potentials of

herbal, traditional/indigenous and ethnoveterinary medicines. Pak J Biol Sci 15:754-

774.

Mahony, J., S. McGrath, G. F. Fitzgerald, and D. van Sinderen. 2008. Identification and

characterization of lactococcal-prophage-carried superinfection exclusion genes. Appl

Environ Microbiol 74:6206-6215.

Mansour, S. C., O. M. Pena, and R. E. Hancock. 2014. Host defense peptides: front-line

immunomodulators. Trends Immunol 35:443-450.

Marasco, W. A., and J. Sui. 2007. The growth and potential of human antiviral monoclonal

antibody therapeutics. Nat Biotechnol 25:1421-1434.

Matsuzaki, S., M. Rashel, J. Uchiyama, S. Sakurai, T. Ujihara, M. Kuroda, M. Ikeuchi, T.

Tani, M. Fujieda, H. Wakiguchi, and S. Imai. 2005. Bacteriophage therapy: a

revitalized therapy against bacterial infectious diseases. J Infect Chemother 11:211-219.

Monk, A. B., C. D. Rees, P. Barrow, S. Hagens, and D. R. Harper. 2010. Bacteriophage

applications: where are we now? Lett Appl Microbiol 51:363-369.

Nakai, T., and S. C. Park. 2002. Bacteriophage therapy of infectious diseases in aquaculture.

Res Microbiol 153:13-18.

Nuding, S., T. Frasch, M. Schaller, E. F. Stange, and L. T. Zabel. 2014. Synergistic effects

of antimicrobial peptides and antibiotics against Clostridium difficile. Antimicrob

Agents Chemother 58:5719-5725.

Okorochenkov, S. A., G. A. Zheltukhina, and V. E. Nebol'sin. 2012. Antimicrobial peptides:

mode of action and perspectives of practical application. Biomed Khim 58:131-143.

174

Oleksiewicz, M. B., G. Nagy, and E. Nagy. 2012. Anti-bacterial monoclonal antibodies: back

to the future? Arch Biochem Biophys 526:124-131.

Otsuka, Y., and T. Yonesaki. 2012. Dmd of bacteriophage T4 functions as an antitoxin

against Escherichia coli LsoA and RnlA toxins. Mol Microbiol 83:669-681.

Oudhuis, G. J., D. C. Bergmans, and A. Verbon. 2011. Probiotics for prevention of

nosocomial infections: efficacy and adverse effects. Curr Opin Crit Care 17:487-492.

Parisien, A., B. Allain, J. Zhang, R. Mandeville, and C. Q. Lan. 2008. Novel alternatives to

antibiotics: bacteriophages, bacterial cell wall hydrolases, and antimicrobial peptides. J

Appl Microbiol 104:1-13.

Patel, A., N. Shah, and J. B. Prajapati. 2014. Clinical application of probiotics in the

treatment of Helicobacter pylori infection--a brief review. J Microbiol Immunol Infect

47:429-437.

Petrenko, V. A., and P. K. Jayanna. 2014. Phage protein-targeted cancer nanomedicines.

FEBS Lett 588:341-349.

Plummer, S. F., I. Garaiova, T. Sarvotham, S. L. Cottrell, S. Le Scouiller, M. A. Weaver,

J. Tang, P. Dee, and J. Hunter. 2005. Effects of probiotics on the composition of the

intestinal microbiota following antibiotic therapy. Int J Antimicrob Agents 26:69-74.

Ram, G., J. Chen, K. Kumar, H. F. Ross, C. Ubeda, P. K. Damle, K. D. Lane, J. R.

Penades, G. E. Christie, and R. P. Novick. 2012. Staphylococcal pathogenicity island

interference with helper phage reproduction is a paradigm of molecular parasitism. Proc

Natl Acad Sci U S A 109:16300-16305.

Ravin, V., L. Raisanen, and T. Alatossava. 2002. A conserved C-terminal region in Gp71 of

the small isometric-head phage LL-H and ORF474 of the prolate-head phage JCL1032

is implicated in specificity of adsorption of phage to its host, Lactobacillus delbrueckii.

J Bacteriol 184:2455-2459.

Rayes, N., D. Seehofer, T. Theruvath, M. Mogl, J. M. Langrehr, N. C. Nussler, S.

Bengmark, and P. Neuhaus. 2007. Effect of enteral nutrition and synbiotics on

bacterial infection rates after pylorus-preserving pancreatoduodenectomy: a

randomized, double-blind trial. Ann Surg 246:36-41.

Rhoads, D. D., R. D. Wolcott, M. A. Kuskowski, B. M. Wolcott, L. S. Ward, and A.

Sulakvelidze. 2009. Bacteriophage therapy of venous leg ulcers in humans: results of a

phase I safety trial. J Wound Care 18:237-238.

Samson, J. E., A. H. Magadan, M. Sabri, and S. Moineau. 2013. Revenge of the phages:

defeating bacterial defences. Nat Rev Microbiol 11:675-687.

Schechner, V., E. Temkin, S. Harbarth, Y. Carmeli, and M. J. Schwaber. 2013.

Epidemiological interpretation of studies examining the effect of antibiotic usage on

resistance. Clin Microbiol Rev 26:289-307.

Scheffler, R. J., S. Colmer, H. Tynan, A. L. Demain, and V. P. Gullo. 2013. Antimicrobials,

drug discovery, and genome mining. Appl Microbiol Biotechnol 97:969-978.

Scholtens, P. A., D. A. Goossens, and A. Staiano. 2014. Stool characteristics of infants

receiving short-chain galacto-oligosaccharides and long-chain fructo-oligosaccharides:

a review. World J Gastroenterol 20:13446-13452.

Schulz zur Wiesch, P., J. Engelstadter, and S. Bonhoeffer. 2010. Compensation of fitness

costs and reversibility of antibiotic resistance mutations. Antimicrob Agents Chemother

54:2085-2095.

Scott, A. M., J. P. Allison, and J. D. Wolchok. 2012. Monoclonal antibodies in cancer

therapy. Cancer Immun 12:14.

175

Shimizu, K., H. Ogura, T. Asahara, K. Nomoto, M. Morotomi, O. Tasaki, A. Matsushima,

Y. Kuwagata, T. Shimazu, and H. Sugimoto. 2013. Probiotic/synbiotic therapy for

treating critically ill patients from a gut microbiota perspective. Dig Dis Sci 58:23-32.

Sillankorva, S. M., H. Oliveira, and J. Azeredo. 2012. Bacteriophages and their role in food

safety. Int J Microbiol 2012:863945.

Singer, R. S., M. P. Ward, and G. Maldonado. 2006. Can landscape ecology untangle the

complexity of antibiotic resistance? Nat Rev Microbiol 4:943-952.

Skurnik, M., M. Pajunen, and S. Kiljunen. 2007. Biotechnological challenges of phage

therapy. Biotechnol Lett 29:995-1003.

Slavcev, R. A., and S. Hayes. 2003. Stationary phase-like properties of the bacteriophage

lambda Rex exclusion phenotype. Mol Genet Genomics 269:40-48.

Smeianov, V., K. Scott, and G. Reid. 2000. Activity of cecropin P1 and FA-LL-37 against

urogenital microflora. Microbes Infect 2:773-777.

Snyder, L. 1995 Phage-exclusion enzymes: a bonanza of biochemical and cell biology

reagents? Mol Microbiol 15:415-420.

Sorek, R., V. Kunin, and P. Hugenholtz. 2008. CRISPR--a widespread system that provides

acquired resistance against phages in bacteria and archaea. Nat Rev Microbiol 6:181-

186.

Stern, A., and R. Sorek. 2011. The phage-host arms race: shaping the evolution of microbes.

Bioessays 33:43-51.

Strauch, E., H. Kaspar, C. Schaudinn, C. Damasko, A. Konietzny, P. Dersch, M. Skurnik,

and B. Appel. 2003. Analysis of enterocoliticin, a phage tail-like bacteriocin. Adv Exp

Med Biol 529:249-251.

Sturino, J. M., and T. R. Klaenhammer. 2006. Engineered bacteriophage-defence systems in

bioprocessing. Nat Rev Microbiol 4:395-404.

Sulakvelidze, A., Z. Alavidze, and J. G. Morris, Jr. 2001. Bacteriophage therapy.

Antimicrob Agents Chemother 45:649-659.

Tiwari, R., K. Dhama, A. Kumar, A. Rahal, and S. Kapoor. 2014. Bacteriophage therapy

for safeguarding animal and human health: a review. Pak J Biol Sci 17:301-315.

Tock, M. R., and D. T. Dryden. 2005. The biology of restriction and anti-restriction. Curr

Opin Microbiol 8:466-472.

Tohidkia, M. R., J. Barar, F. Asadi, and Y. Omidi. 2012. Molecular considerations for

development of phage antibody libraries. J Drug Target 20:195-208.

Trepel, M., C. A. Stoneham, H. Eleftherohorinou, N. D. Mazarakis, R. Pasqualini, W.

Arap, and A. Hajitou. 2009. A heterotypic bystander effect for tumor cell killing after

adeno-associated virus/phage-mediated, vascular-targeted suicide gene transfer. Mol

Cancer Ther 8:2383-2391.

Ulevitch, R. J. 2004. Therapeutics targeting the innate immune system. Nat Rev Immunol

4:512-520.

Veldhuizen, E. J., V. A. Schneider, H. Agustiandari, A. van Dijk, J. L. Tjeerdsma-van

Bokhoven, F. J. Bikker, and H. P. Haagsman. 2014. Antimicrobial and

immunomodulatory activities of PR-39 derived peptides. PLoS One 9:e95939.

Villion, M., and S. Moineau. 2013. Virology: phages hijack a host's defence. Nature 494:433-

434.

Vunnam, S., P. Juvvadi, and R. B. Merrifield. 1997. Synthesis and antibacterial action of

cecropin and proline-arginine-rich peptides from pig intestine. J Pept Res 49:59-66.

Walkinshaw, M. D., P. Taylor, S. S. Sturrock, C. Atanasiu, T. Berge, R. M. Henderson, J.

M. Edwardson, and D. T. Dryden. 2002. Structure of Ocr from bacteriophage T7, a

protein that mimics B-form DNA. Mol Cell 9:187-194.

176

Wang, T., W. C. Hartner, J. W. Gillespie, K. P. Praveen, S. Yang, L. A. Mei, V. A.

Petrenko, and V. P. Torchilin. 2014. Enhanced tumor delivery and antitumor activity

in vivo of liposomal doxorubicin modified with MCF-7-specific phage fusion protein.

Nanomedicine 10:421-430.

Warrener, P., R. Varkey, J. C. Bonnell, A. DiGiandomenico, M. Camara, K. Cook, L.

Peng, J. Zha, P. Chowdury, B. Sellman, and C. K. Stover. 2014. A novel anti-PcrV

antibody providing enhanced protection against Pseudomonas aeruginosa in multiple

animal infection models. Antimicrob Agents Chemother 58:4384-4391.

Westwater, C., L. M. Kasman, D. A. Schofield, P. A. Werner, J. W. Dolan, M. G. Schmidt,

and J. S. Norris. 2003. Use of genetically engineered phage to deliver antimicrobial

agents to bacteria: an alternative therapy for treatment of bacterial infections.

Antimicrob Agents Chemother 47:1301-1307.

Wright, A., C. H. Hawkins, E. E. Anggard, and D. R. Harper. 2009. A controlled clinical

trial of a therapeutic bacteriophage preparation in chronic otitis due to antibiotic-

resistant Pseudomonas aeruginosa; a preliminary report of efficacy. Clin Otolaryngol

34:349-357.

Wright, G. D. 2007. The antibiotic resistome: the nexus of chemical and genetic diversity. Nat

Rev Microbiol 5:175-186.

Yao, S., Y. Zhu, and L. Chen. 2013. Advances in targeting cell surface signalling molecules

for immune modulation. Nat Rev Drug Discov 12:130-146.

Yaung, S. J., K. M. Esvelt, and G. M. Church. 2014. CRISPR/Cas9-mediated phage

resistance is not impeded by the DNA modifications of phage T4. PLoS One 9:e98811.

Zuany-Amorim, C., J. Hastewell, and C. Walker. 2002. Toll-like receptors as potential

therapeutic targets for multiple diseases. Nat Rev Drug Discov 1:797-807.