University of Veterinary Medicine Hannover

Institute for Microbiology

Institute for Physiological Chemistry

Interaction of Streptococcus suis with

neutrophil extracellular traps (NETs)

THESIS

Submitted in partial fulfilment of the requirements for the degree

DOCTOR OF PHILOSOPHY

(PhD)

awarded by the University of Veterinary Medicine Hannover

by

Nicole de Buhr

Hannover

Hannover, Germany 2015

Supervisor: Prof. Dr. Peter Valentin-Weigand

Supervision Group: Prof. Dr. Peter Valentin-Weigand

Prof. Dr. Christoph Baums

Prof. Dr. Maren von Köckritz-Blickwede

Prof. Dr. Horst Schroten

1st Evaluation: Prof. Dr. Peter Valentin-Weigand

Institute for Microbiology

Department of Infectious Diseases

University of Veterinary Medicine Hannover, Germany

Prof. Dr. Maren von Köckritz-Blickwede

Institute for Physiological Chemistry

Research Center for Emerging Infections and Zoonosis

University of Veterinary Medicine Hannover, Germany

Prof. Dr. Christoph Baums

Institute for Bacteriology and Mycology

Centre for Infectious Diseases

College of Veterinary Medicine

University Leipzig, Germany

Prof. Dr. Horst Schroten

Department of Pediatrics, Pediatric Infectious Diseases

Medical Faculty Mannheim

University Heidelberg, Germany

2nd

Evaluation: Prof. Heiko Herwald, Ph.D.

Department of Clinical Sciences, Division of Infection

Medicine, Biomedical Center (BMC)

Lund University, Sweden

Date of final exam: 02.11.2015

“What we know is a drop,

what we don’t know is an ocean.”

Isacc Newton

Meinen Eltern, Eugen und Oliver

Parts of the thesis have already been published previously at scientific meetings,

conferences or journals:

Oral presentations

de Buhr, N., Neumann, A., Jerjomiceva, N., von Köckritz-Blickwede, M. and Baums, C. G.

“Neutrophil extracellular trap formation in the pathogenesis of Streptococcus suis meningitis“,

Graduate School Day of the University for Veterinary Medicine Hannover, Bad Salzdethfurth 2013

de Buhr, N., Neumann, A., Jerjomiceva, N., Valentin-Weigand, P., von Köckritz-Blickwede, M. and

Baums, C. G. “Nuklease Expression von Streptococcus suis erleichtert das Entkommen aus Neutrophil

extracellular traps (NETs)“, Tagung der DVG-Fachgruppe "Bakteriologie und Mykologie" 2014,

Freisingen 2014

de Buhr, N., von Köckritz-Blickwede, M. and Baums, C. G. “Interaction of Streptococcus suis with

neutrophil extracellular traps”, Seminar on Infection Biology, Centre for Infection Medicine,

University of Veterinary Medicine Hannover, Hannover 2015

de Buhr, N., Tenenbaum, T., Neumann, A., Ishikawa, H., Schroten, H., Valentin-Weigand, P., Baums,

C. G. and von Köckritz-Blickwede, M. “Formation of neutrophil extracellular traps (NETs) in the

Streptococcus suis infected cerebrospinal fluid compartment”, 5th European Veterinary Immunology

Workshop, Vienna 2015

Poster presentations

de Buhr, N., Jerjomiceva, N., von Köckritz-Blickwede, M. and Baums, C. G. “Neutrophil

extracellular trap formation in the pathogenesis of Streptococcus suis meningitis“, Junior Scientist

Zoonoses Meeting, Leipzig 2013

de Buhr, N., Jerjomiceva, N., Valentin-Weigand, P., von Köckritz-Blickwede, M. and Baums, C. G.

“Neutrophil extracellular trap formation in the pathogenesis of Streptococcus suis meningitis“,

National Symposium on Zoonoses Research, Berlin 2013

de Buhr, N., Neumann, A., Tenenbaum, T., Schroten, H., Ishikawa, H., Valentin-Weigand, P., Baums,

C. G., von Köckritz-Blickwede, M. “Neutrophil extracellular trap formation in the pathogenesis of

Streptococcus suis meningitis“, First N-RENNT Symposium on Neuroinfectiology, Hannover 2014

de Buhr, N., Neumann, A., Jerjomiceva, N., Valentin-Weigand, P., von Köckritz-Blickwede, M. and

Baums, C. G. “Identification of a new neutrophil extracellular trap (NET) evasion factor in

Streptococcus suis“, 114th General Meeting of the American Society for Microbiology (ASM), Boston

2014

de Buhr, N., Neumann, A., Valentin-Weigand, P., von Köckritz-Blickwede, M. and Baums, C. G.

“Identification of a neutrophil extracellular trap (NET) evasion factor in Streptococcus suis”, Junior

Scientist Zoonoses Meeting, Hannover 2014

de Buhr, N., Neumann, A., Valentin-Weigand, P., von Köckritz-Blickwede, M. and Baums, C. G.,

“Comparison of two neutrophil extracellular trap (NET) evasion factors in Streptococcus suis”,

Zoonosensymposium 2014 - Joint Conference: German Symposium on Zoonoses Research 2014 and

7th International Conference on Emerging Zoonoses, Berlin 2014

[awarded the poster prize (3rd place)]

de Buhr, N., Tenenbaum, T., Neumann, A., Ishikawa, H., Schroten, H., Valentin-Weigand, P., Baums,

C. G., von Köckritz-Blickwede,

M. “The role of neutrophil extracellular traps (NETs) in the

pathogenesis of Streptococcus suis meningitis”, Graduate School Day of the University for Veterinary

Medicine Hannover, Hannover 2014

de Buhr, N., Tenenbaum, T., Neumann, A., Ishikawa, H., Schroten, H., Valentin-Weigand, P., Baums,

C. G., von Köckritz-Blickwede,

M. “The role of neutrophil extracellular traps (NETs) in the

pathogenesis of Streptococcus suis meningitis”, Second N-RENNT Symposium on Neuroinfectiology,

Hannover 2015

de Buhr, N., Tenenbaum, T., Neumann, A., Ishikawa, H., Schroten, H., Valentin-Weigand, P., Baums,

C. G. and von Köckritz-Blickwede, M.

“Neutrophil extracellular traps (NETs) in the Streptococcus suis-infected cerebrospinal fluid

compartment”, National Symposium on Zoonoses Research, Berlin 2015

Publications [see Chapter 3]

de Buhr, N., Neumann, A., Jerjomiceva, N., von Köckritz-Blickwede, M. and Baums, C. G. (2014):

“Streptococcus suis DNase SsnA contributes to degradation of neutrophil extracellular traps (NETs)

and evasion of NET-mediated antimicrobial activity.”

Microbiology 2014 160: 385–95. DOI 10.1099/mic.0.072199-0 [Editor’s choice]

de Buhr, N., Stehr, M., Neumann, A., Naim, H. Y., Valentin-Weigand, P., von Köckritz-Blickwede,

M. and Baums, C. G. (2015)

“Identification of a novel DNase of Streptococcus suis (EndAsuis) important for neutrophil

extracellular trap degradation during exponential growth.”

Microbiology 161: 838–850. DOI 10.1099/mic.0.000040

Publications (in preparation)

de Buhr, N., Reuner, F., Neumann, A., Stump-Guthier, C., Tenenbaum, T., Schroten, H., Ishikawa,

H., Valentin-Weigand, P., Baums, C. G. and von Köckritz-Blickwede, M.

“Neutrophil extracellular trap formation after transmigration of neutrophils through S. suis infected

human choroid plexus epithelial cell barrier.”

Sponsorship:

This work was funded by a fellowship of the Ministry of Science and Culture of Lower Saxony

(Georg-Christoph-Lichtenberg Scholarship) within the framework of the PhD program ‘EWI-

Zoonosen’ of the Hannover Graduate School for Veterinary Pathobiology, Neuroinfectiology and

Translational Medicine (HGNI). Further this project was financially supported by the Niedersachsen-

Research Network on Neuroinfectiology (N-RENNT) of the Ministry of Science and Culture of Lower

Saxony.

Index

1 General Introduction ........................................................................................................................ 9

1.1 Streptococcus suis ................................................................................................................. 10

1.2 S. suis meningitis ................................................................................................................... 12

1.3 Neutrophil granulocytes ........................................................................................................ 14

1.3.1 Neutrophil extracellular traps ........................................................................................ 16

1.3.2 NET mediated binding and killing of bacteria .............................................................. 20

1.3.3 NET evasion by pathogens ............................................................................................ 23

1.4 Function of nucleases in microorganisms ............................................................................. 23

1.5 Role of brain barriers in bacterial infections ......................................................................... 28

1.5.1 Three brain barriers ....................................................................................................... 28

1.5.2 Cell culture systems of the BCSFB ............................................................................... 30

2 Aims of the study .......................................................................................................................... 32

3 Results ........................................................................................................................................... 34

3.1 SsnA is a NET-evasion factor in the stationary growth ........................................................ 34

3.2 EndAsuis degrades NETs in exponential growth phase ........................................................ 37

3.3 NETs detected in S. suis-infected CSF compartment ............................................................ 39

4 General Discussion ........................................................................................................................ 70

4.1 Investigation of NET evasion factors in S. suis ..................................................................... 70

4.2 NETosis in the S. suis-infected CSF compartment ............................................................... 75

4.3 Concluding remarks .............................................................................................................. 82

5 Summary ....................................................................................................................................... 84

6 Zusammenfassung ......................................................................................................................... 85

7 Literature ....................................................................................................................................... 86

8 Appendix ..................................................................................................................................... 103

Acknowledgment ................................................................................................................................ 104

List of Abbreviations

% percentage

µg microgram 2H2O deuterium oxide

aggNETs aggregated NETs

AMP antimicrobial peptide

BBB blood-brain-barrier

BCSFB blood-cerebrospinalfluid-barrier

BLMB blood-leptomeningeal-barrier

BMEC brain microvascular endothelial cells

C.f.u. colony forming units

C3b complement component 3b

CD cluster of differentiation

CNS central nervous system

CPEC choroid plexus epithelial cells

CR complement receptor

CSF Cerebrospinal fluid

CWS cell wall sorting signal

DAPI 4',6-diamidino-2-phenylindole

DltA D-alanine-poly (phosphoribitol) ligase subunit 1

DNA deoxyribonucleic acid

E. coli Escherichia coli

e.g. latein: exempli gratia (for example)

EF extracellular factor of S. suis

EndA endonuclease A of S. pneumoniae

EndAsuis endonuclease A of S. suis

ERK extracellular signal-regulated kinase

et al. latein: et alii

FBPS fibronectin and fibrinogen binding protein of S. suis

Fc fragment crystallisable

GAS Group A Streptococcus

h Hour

H. influenzae B Haemophilus influenzae B

H2O2 hydrogen peroxide

hBD human β-defensin

HIBCPP human choroid plexus papilloma

IdeS immunoglobulin degrading enzyme

IdeSsuis immunoglobulin M degrading enzyme of S. suis

IFN-γ interferon gamma

Ig immunoglobulin

IL Interleukin

IUPAC International Union of Pure and Applied Chemistry

L Liter

L. monocytogenes Listeria monocytogenes

LIF leukemia inhibitory factor

LPG Lipophosphoglycan

LPS Lipopolysaccharide

MAPK mitogen activated protein kinase

MCP-1 monocyte chemotactic protein-1

MEK mitogen-activated protein kinase

MGP marginal granulocyte pool

min Minute

Ml Milliliter

MMP 9 metalloproteinase 9

MPO Myeloperoxidase

MRP muramidase-released protein

N. meningitidis Neisseria meningitidis

n.s. non significant

NADPH nicotinamide adenine dinucleotide phosphate

NE neutrophil elastase

NETs neutrophil extracellular traps

NucB nuclease from Bacillus licheniformis

OFS opacity factor of S. suis

PAD4 protein arginine deiminase

Pg Pictogram

PgdA Peptidoglycan N-deacetylase of S. suis

pH power of hydrogen

PKC protein kinase C

PMA phorbol-12-myristate-13-acetate

PMN polymorphnuclear leukocytes

ROS reactive oxygen species

RPMI Roswell Park Memorial Institute

S. pneumoniae Streptococcus pneumoniae

S. pyogenes Streptococcus pyogenes

S. suis Streptococcus suis

SAO surface antigen one

SD standard deviation

SEM standard error of the mean

SLY Suilysin of S. suis

SLE systemic lupus erythematosus

SpyCEP S. pyogenes cell-envelope protease

SsnA secreted nuclease A of S. suis

Staph. aureus Staphylococcus aureus

STs sequence types

SVV systemic vasculitis

T Time

TEER transepithelial electrical resistance

TJ tight junction

TLR toll like receptor

TNFα tumor necrosis factor alpha

WT wildtype

ZO zonula occludens

Δ Delta

General Introduction

9

1 General Introduction

Streptococcus (S.) suis is one of the most important pathogens in pigs and an emerging zoonotic agent,

causing meningitis and other pathologies. The pathogenesis of S. suis meningitis and the reaction of

the innate immune system is poorly understood. Nevertheless, infiltrations with high numbers of

neutrophils are typical for lesions induced by S. suis infection [Fig. 1-1, (Beineke et al., 2008)]. It was

demonstrated by in vitro experiments with cell culture models of the blood-cerebrospinal fluid (CSF)-

barrier that S. suis is able to cross this barrier and that neutrophil granulocytes follow S. suis in the

“CSF compartment" (Steinmann et al., 2013). A recently identified defense mechanism of the innate

immune system against different pathogens is the formation of neutrophil extracellular traps (NETs).

NETs are formed by the release of a decondensed chromatin from neutrophils. Histones, antimicrobial

peptides and granule proteins are bound to these web-like structures leading to the killing pathogens

entrapped in these NETs [Fig. 1-2, (Brinkmann, 2004)]. Interestingly, some pathogens are described to

possess DNases as a defense mechanism against NET entrapment and numerous DNases have been

identified in streptococci (Molloy, 2006). Until now, the role of NETs during S. suis infection and in

the CSF compartment has not been studied so far.

This project aimed to investigate the interaction of S. suis and NETs in general and the function of

NETs in the CSF compartment.

Figure ‎1-2 Neutrophil extracellular traps

(NETs) trapping S. suis. Visualization is done

with immunofluorescence microscopy. DNA =

Hoechst (blue), NETs = Alexa Fluor® 488

(green), S. suis = Alexa Fluor® 633 (red)

Figure ‎1-1 Histological finding in the brain of a

intranasally with S. suis serotype 2 strain 10 infected

piglet: Severe diffuse suppurative meningitis. Bar = 10

µm. Reprinted from (Beineke et al., 2008) with

permission from Elsevier.

General Introduction

10

1.1 Streptococcus suis

S. suis is an important porcine pathogen that belongs to the family of Streptococcaceae. It is

characterized as a Gram-positive coccus, growing on sheep blood agar with an alpha hemolysis.

Depending on the differences of the capsule-antigens up to date 35 serotypes are described

(Gottschalk, 2012; Goyette-Desjardins et al., 2014) and of these serotypes 2 and 9 are the most

important in Europe (Wisselink, 2000).

The natural host is the pig and an acute course of a S. suis infection is associated with different clinical

signs like lameness, fever, central nervous system (CNS) dysfunctions or dyspnoea (Straw et al.,

2006). Depending on the possible different localizations of S. suis, the pathological findings of

diseased piglets can vary between meningitis, arthritis, endocarditis or pneumonia (Clifton-Hadley &

Alexander, 1980; Staats et al., 1997). Furthermore, S. suis is a commensal on the mucosa in the upper

respiratory tract, the genital tract and the intestine (Higgins et al., 1990; Robertson & Blackmore,

1989; Swildens et al., 2004). Often different S. suis genotypes are found on tonsils of healthy piglets

(Arends et al., 1984; Baums et al., 2007; Clifton-Hadley & Alexander, 1980). Carrier pigs without

clinical signs play an important role as infection source. The upper respiratory tract and in particular

the tonsils are considered to be the main entry site for S. suis in pigs (Williams et al., 1973).

Horizontal (oronasal) but also vertical transmission (perinatal infection) of S. suis is common (Amass

et al., 1997; Berthelot-Hérault et al., 2001; Robertson & Blackmore, 1989; Staats et al., 1997). S. suis

is also an important zoonotic agent. The risk for a S. suis infection in humans is increased for people

with close contact to pigs, like farmers, butchers or veterinarians (Arends & Zanen, 1988; Lun et al.,

2007). Notably, more than 96 % of cases in humans are meningitis, septicemia or septic shock (Lun et

al., 2007). Streptococcal toxic shock-like syndrome caused by S. suis infection was observed for the

first time in two outbreaks in humans in the Jiangsu Province, China (1998) and the Sichuan Province,

China (2005) (Lun et al., 2007; Tang et al., 2006; Yu et al., 2006). The clinical course is reminiscent

to the streptococcal toxic shock-syndrome caused by infection with group A streptococci (Todd et al.,

1978). Both S. suis outbreaks in China followed local disease outbreaks in pigs (Yu et al., 2006),

which underlines the zoonotic potential. In a review about pig-borne infections, S. suis is considered a

zoonotic pathogen with a high risk for transmission from pigs to humans. This assessment was based

on disease burden, the host specificity of the pathogen and the mortality rate in humans. In comparison

to other bacteria the zoonotic significance of S. suis was estimated to be the highest (Pappas, 2013).

With over 90 % of all worldwide reported clinical S. suis infections in humans, Asia is most affected.

Different authors describe S. suis as an emerging zoonotic agent in Asia (Gottschalk et al., 2010;

Goyette-Desjardins et al., 2014; Lun et al., 2007). Interestingly, in 2014 a new research project

pointed out that an infection route of S. suis over the gastro-intestinal tract is possible. The authors

concluded that S. suis should be considered as a food borne pathogen (Ferrando et al., 2015).

General Introduction

11

Numerous virulence factors and virulence associated factors of S. suis have been investigated in recent

years (Baums & Valentin-Weigand, 2009; Fittipaldi et al., 2012). In the following part only a short

overview about some important factors that mediate host-pathogen interaction is explained.

The polysaccharide capsule is an important virulence factor of S. suis, as demonstrated in animal

experiments. The capsule protects S. suis against phagocytosis (Charland et al., 1998; Smith et al.,

1999) and it is discussed that the capsule is involved in escaping out of neutrophil extracellular traps

(NETs) (Zhao et al., 2015). Though unencapsulated mutants were avirulent in experimental infections,

recent data indicate that unencapsulated S. suis strains leads more often to endocarditis (Lakkitjaroen

et al., 2011). Indications are given that the capsule of S. suis is not enough for full virulence (Vecht et

al., 1991b) and in addition is only slightly immunogenic (Baums & Valentin-Weigand, 2009; Baums

et al., 2009; Martin del Campo Sepúlveda et al., 1996; Wisselink et al., 2001).

Adherence of bacteria to host tissues is beneficial for colonization and infection. Fibronectin-binding

proteins have been identified in different Gram-positive cocci as virulence factors involved in host-

pathogen interaction (Schwarz-Linek et al., 2006). A fibronectin (FN)- and fibrinogen (FGN)-binding

protein of S. suis (FBPS) was identified as a gene upregulated upon iron-restricted conditions in vitro

and by experimental infection of piglets (Smith et al., 2001). FBPS is needed for infection of different

inner organs, but not for colonization of the tonsils (de Greeff, 2002). Further, it is a surface-associated

protein lacking a cell wall sorting signal (CWS) including an LPXTG-motif.

Similar to other streptococci S. suis expresses numerous surface proteins containing a LPXTG-motif.

Some of these are likely involved in adhesion. As an example, SSU1889 is a protein with a CWS and

a proposed function as adhesin and invasin to porcine brain microvascular endothelial cells (BMEC)

(Vanier et al., 2009a). Muramidase-released protein (MRP) (Smith et al., 1992; Vecht et al., 1989,

1991a) and surface antigen one (SAO) (Li et al., 2006) are immunogenic proteins of S. suis with a

CWS following repetitive sequences. The functions of MRP and SAO are not known. The CWS

containing opacity factor of S. suis (OFS) is homologous to the serum opacity factor of Streptococcus

(S.) pyogenes. OFS was demonstrated to be crucial for virulence of serotype 2 in a porcine infection

model (Baums et al., 2006). Overall a total of thirty-tree putative cell wall-anchored proteins with a

LPXTG-motif where identified, but their functions in pathogenesis are not very well understood (Chen

et al., 2007; Wang et al., 2009a).

Together with MRP the extracellular factor (EF, gene: epf), a secreted protein, was identified as a

virulence-associated protein (Vecht et al., 1991a). However, mrp- and epf- deletion mutants were not

attenuated in virulence in experimental infections of piglets (Smith et al., 1996). Both factors are used

as virulence markers in various diagnostic laboratories in Europe, as in Europe S. suis mrp+ epf+

serotype 2 strains are virulent in contrast to mrp- epf- serotype 2 isolates (Smith et al., 1996; Vecht et

al., 1991b).

Many virulent S. suis strains secrete a pore-forming cholesterol-dependent cytotoxin named suilysin

(SLY) (Jacobs et al., 1994). SLY is cytotoxic active against macrophages (Segura & Gottschalk,

General Introduction

12

2002), human BMECs (Charland et al., 2000), porcine BMECs (Vanier et al., 2004) and different

epithelial cells like laryngeal epithelial cells (Norton et al., 1999). However, SLY is not crucial for full

virulence of S. suis serotype 2 strains in piglets as a sly mutant was only slightly attenuated in systemic

infection of piglets (Allen et al., 2001; Lun et al., 2003).

Three further putative virulence factors of S. suis are involved in the innate immunity escape.

Peptidoglycan N-deacetylase (PgdA) is involved in the resistance to phagocytosis and the gene is

highly upregulated after incubation with porcine neutrophils. The presence of PgdA leads to

modifications of the cell wall peptidoglycan and in infection experiments with pigs a pgdA mutant was

attenuated (Fittipaldi et al., 2008a). Further D-alanine-poly (phosphoribitol) ligase subunit 1 (DltA)

protects S. suis against antimicrobial peptides and killing by porcine neutrophils by D-alanylation of

lipoteichoic acid (Fittipaldi et al., 2008b). The detailed function is described in Chapter 1.3.3. A dltA

mutant was attenuated in experimental infections in pigs and mice.

In addition to this two factors the serine protease (SspA) degrades interleukin 8 (IL-8) and therefore

the recruitment of neutrophils is affected (Bonifait & Grenier, 2011; Fittipaldi et al., 2012; Vanier et

al., 2009b).

Furthermore, factors of S. suis can cleave immunoglobulins (Ig). IgA1 protease of S. suis cleaves

human IgA1 and is described as a virulence factor of S. suis (Zhang et al., 2010, 2011). In 2013 Seele

et al. identified a novel host-specific immunoglobulin M-degrading enzyme of S. suis (IdeSsuis). This

protease is a member of the IdeS family as it is homologous to IdeS of S. pyogenes. In contrast to the

other members of this family, IdeSsuis does not cleave IgG but only IgM. Interestingly, IgM of various

other species but pigs is not cleaved by IdeSsuis (Seele et al., 2013). Immunization of weaning piglets

with recombinant IdeSsuis protected them efficient against an infection with S. suis serotype 2 (Seele et

al., 2015).

Nevertheless, until now all of the known and characterized virulence factors are not protecting against

a S. suis infection, when they were used for production of a cross protective vaccine. One reason could

be that the pathogenesis represents a complex process between different pathogen-host-interactions

and more than one factor leads to virulence.

1.2 S. suis meningitis

A tissue layer called meninges surrounds the brain and the spinal cord. These can be infected by some

highly invasive pathogens, which lead to meningitis. In addition, meningitis can result from various

non-infectious causes like cancer (Chamberlain, 2010; Van Horn & Chamberlain, 2012) or toxic

chemicals (Moris & Garcia-Monco, 1999). Viruses are the most common causes of infectious

meningitis, but bacterial meningitis is generally associated with a more severe, very often live-

threatening clinical course. Important bacterial meningitis agents in humans are Neisseria (N.)

meningitides, Streptococcus (S.) pneumoniae, Listeria (L.) monocytogenes, Haemophilus (H.)

influenzae B, Group B streptococci and Escherichia (E.) coli K1 (Hacker & Heesemann, 2000).

General Introduction

13

Bacteria causing haematogenous meningitis must be able (1) to survive in the bloodstream and to

escape from host defense mechanisms and (2) are thought to reach a high level of bacteremia prior to

breaching the blood brain barrier (BBB) or blood cerebrospinal fluid barrier (BCSFB) (Kim, 2003).

Accordingly virulent S. suis strains are able to survive in the bloodstream and reach high bacterial

concentrations (Fittipaldi et al., 2012; Gottschalk, 2012).

In pigs as well as in humans the most important clinical signs associated with a S. suis infection are

CNS disorders due to meningitis. Important clinical signs for bacterial meningitis in pigs are tremor,

paddling movements, convulsions, opisthotonus, tetanic contractions, ataxia and nystagmus (Straw et

al., 2006). In diseased humans, early unspecific symptoms include fever, vomiting, feeling unwell and

headache. Subsequently, specific meningitis symptoms such as stiff neck, dislike of bright lights,

confusion and seizures may develop (van de Beek et al., 2004). In humans the S. suis meningitis could

be purulent or non-purulent and one late effect is deafness (Lütticken et al., 1986).

S. suis serotype 2 is one of the most common causes of meningitis in pigs. Animals at an age from 2 to

22 weeks might be affected (Madsen et al., 2002b; Windsor & Elliott, 1975).

Spreading of S. suis is suggested to be lymphogenously and haematogenously through palatine and

nasopharyngeal tonsils and mandibular lymph nodes (Madsen et al., 2002a). After breaching the

mucosal barriers S. suis is entering the blood stream by crossing the epithelial cell layer (Fittipaldi et

al., 2012). S. suis may enter the CNS as free circulating bacteria or in association with monocytes

(Gottschalk & Segura, 2000). The “Trojan horse” theory postulates that S. suis breaches the BBB or

BCSFB inside monocytes (Williams, 1990; Williams & Blakemore, 1990). Noteworthy, a limited

number of immune cells overcome the blood brain barriers even in healthy individuals. Based on the

“modified” Trojan horse theory S. suis adheres to monocytes as these cells enter the CNS (Gottschalk

& Segura, 2000).

For infection of the brain one of the three blood brain barriers (in detail described in chapter 1.5.1)

must be crossed. S. suis serotype 2 invades porcine BMECs, which form an important part of the BBB

(Vanier et al., 2004). SLY-positive strains were toxic for the porcine BMECs at high bacterial doses.

Furthermore intracellular viable streptococci were detectable 7 h after an antibiotic treatment. The

second barrier in the brain is the BCSFB, which is formed by the choroid plexus epithelia cells

(CPECs) and a fenestrated endothelium. Supernatants of interferon gamma (IFN-γ) stimulated primary

porcine CPECs are able to inhibit growth of S. suis. Accordingly, an active defense role of the choroid

plexus against bacterial meningitis was hypothesized (Adam et al., 2004). However, S. suis may

efficiently invade CPECs and translocate through this barrier as indicated by in vitro results using an

inverted transwell filter system with primary porcine CPECs (Tenenbaum et al., 2009). Similar

observations were made using a human BCSFB model (Schwerk et al., 2012). These findings indicate

that the BCSFB is an important entry gate for S. suis.

After infection of the meninges, the disease may progresses rapidly. Without treatment many diseased

animals must be euthanized or die. Typical pathological findings are congestion, edema and/or

General Introduction

14

purulent exudate in the meninges. A S. suis meningitis is typically characterized by a high influx of

neutrophil granulocytes (neutrophilic meningitis [Figure 1-1]), a choroiditis and hyperaemic

meningeal blood vessels (Reams et al., 1994, 1996). After a disruption of the plexus brush border,

deposition of fibrin and infiltration with inflammatory cells occurs in the CSF (Sanford, 1987; Staats

et al., 1997).

The high number of infiltrating neutrophils is a general feature described for bacterial meningitis

demonstrated in a clinical study with bacterial meningitis. Pathogens detected in this study were for

example N. meningitides or H. influenzae (Straussberg et al., 2003). It was demonstrated in an in vivo

infection of mice with S. pneumoniae that 12 h after infection neutrophils are recruited to the brain to

control bacterial infection. The recruited neutrophils inhibit the growth of the streptococci in

meningitis (Mildner et al., 2008).

1.3 Neutrophil granulocytes

The immune system is divided in the innate and the adaptive part that are working individually and

synergistically. Both systems include components of the humoral immunity and the cell-mediated

immunity. Parts of the innate immune system are: the complement system, acute-phase-proteins,

granulocytes, monocytes, macrophages, dendritic cells and natural killer cells. Neutrophil granulocytes

are one of the main players in the regulation of the innate host defense. As all blood cells, they are

originated from pluripotent hematopoietic stem cells from the bone marrow. They are differentiated

white blood cells similar as eosinophil or basophil granulocytes. Around 90 % of the granulocyte

population is neutrophils. The nucleus of neutrophil granulocytes can vary in the shapes from lobed

into segmented leading to the designation polymorphnuclear leukocytes (PMN) (von Engelhardt,

2015; Janeway et al., 2009). The granulocytes are described as short living cells with a 6-8 h

circulating half-life (Summers et al., 2010). Based on a study with human neutrophils labeled with

2H2O a lifespan of over 5 days was postulated (Pillay et al., 2010), but this was called into question by

other researchers (Tofts et al., 2011). In mammals around one billion granulocytes per liter blood are

produced on one day. After maturation (granulopoiesis) granulocytes are stored extravascularly or

attached to the endothelium of small blood vessels (marginal granulocyte pool = MGP). Under stress

granulocytes are released rapidly out of MGP (e.g. after release of adrenaline). It takes approximately

20 min after infection to release granulocytes out of the MGP. In addition, within a day granulocytes

are released out of the extravascular pool. Upon infection the number of granulocytes in the blood is

increased by release of immature granulocytes (von Engelhardt, 2015; Kolaczkowska & Kubes, 2013).

As a response to invaded microorganisms, cytokines like tumor necrosis factor α (TNFα) or IL-8 are

secreted by tissue macrophages and mast cells. TNFα activates endothelial cells leading to the

extravasation of neutrophils, which is initiated by binding to receptors on the endothelium. IL-8 works

as a chemoattractant and induces migration of neutrophils from the blood to the tissue. The

General Introduction

15

transmigration through an endothelium is named diapedesis. This process leads to the activation of

PMNs including altered expression of surface antigens (Janeway et al., 2009). ICAM1, ICAM2 and

PECAM1 are important molecules of the endothelium of postcapillary venules involved in recruitment

of neutrophils. But for other tissues such as the brain the adhesion molecules on endothelium and

neutrophils are unknown or only speculated on (Kolaczkowska & Kubes, 2013).

As part of the first immune defense, neutrophil granulocytes can send signals to other cells of the

innate immune system by releasing for example TNFα or chemokines leading to activation and

regulation of innate and adaptive immunity (Mantovani et al., 2011). Additionally, neutrophils can

exhibit different antimicrobial mechanisms for elimination of pathogens [Figure 1-3]. The first

mechanism is phagocytosis, described by Paul Ehrlich in 1880, which is characterized by an inclusion

of microorganisms in phagosomes. Intracellular lysosomes fuse with the phagosomes to

phagolysosomes. And afterwards inside the phagolysosome microorganisms are killed through

acidification, reactive oxygen species (ROS) and antibacterial proteins like lysozyme (Nathan, 2006;

Rada & Leto, 2008). For an effective phagocytosis the process of opsonization marks the microbes.

Therefore antibodies or components of the complement system (e.g. C3b) bound on the microbe

surface. This marking is recognized by fragment crystallisable (Fc)-receptors or complement receptor

1 (CR 1) of immune effector cells like neutrophils or monocytes. Sometimes neutrophils can bind

directly on specific surface antigens of bacteria e.g. to lipopolysaccharide (LPS). Pattern recognition

receptors (PRRs) recognize special conserved pathogen associated molecular patterns (PAMPs). An

important group are the toll-like receptors (TLR), for example TLR-9 recognizes unmethylated CpG-

rich sequences or TLR-4 reacts on cell wall components of Gram-positive bacteria (Janeway et al.,

2009, page 4-139). The second antimicrobial mechanism of PMNs is degranulation, which is

characterized by a release of neutrophil granules outward the cell or into phagosomes inside the cell.

The granules contain antimicrobial peptides (AMPs) and proteases e.g. myeloperoxidase (MPO),

lactoferrin and gelatinase or metalloproteinase 9 (MMP 9). Additionally the production of cytokines

mediate the inflammation (Borregaard, 2010; Kolaczkowska & Kubes, 2013). The third mechanism is

the formation of neutrophil extracellular traps (NETs) which is described in detail in the next part

[Chapter 1.3.1]. Further neutrophils are also involved in resolution of inflammation by apoptosis.

Apoptosis is characterized as an active programmed cell death that can occur in all biological cells. To

start apoptosis cysteine-dependent aspartate-specific proteases (caspases) are identified as a main

trigger (Fadeel et al., 1998). The activation of caspases leads to a condensation of nucleus and

cytoplasm, DNA fragmentation and externalization of membrane-associated phosphatidylserine.

Apoptosis of PMNs prevents release of toxic neutrophil contents and is therefore considered to be part

of inflammatory regulation. Surface markers on apoptotic cells lead to clearance by macrophages and

other phagocytes and thus to resolution of inflammation. Taken together neutrophils have versatile

functions in innate immunity.

General Introduction

16

1.3.1 Neutrophil extracellular traps

In 2004 a novel defense mechanism of neutrophils was described: the formation of NETs (Brinkmann,

2004). Upon induction of NET formation, neutrophils release decondensed chromatin as extracellular

fibers. Antimicrobial granule proteins as well as histones are bound to those fibers. NETs entrap and

kill microorganisms (Brinkmann, 2004). The importance of NETs in different host pathogen

interactions has been explored for parasites (Abdallah & Denkers, 2012; Muñoz Caro et al., 2014),

viruses (Narasaraju et al., 2011; Saitoh et al., 2012; Wardini et al., 2010), fungi (Guimarães-Costa et

al., 2012; McCormick et al., 2010; Urban et al., 2006) and mainly for bacteria (reviewed by Lu et al.,

2012). In chapter 1.3.2 the interaction of NETs and bacteria is reviewed in detail and in chapter 1.3.3

the NET evasion mechanisms of bacteria are described.

The release of NETs, also referred as NETosis (Steinberg & Grinstein, 2007), is classically described

as a novel cell death of PMNs besides apoptosis and necrosis. (Fox et al., 2010; Hallett et al., 2008;

Leitch et al., 2008; Mocsai, 2013). The differences between apoptosis, necrosis and NETs were

demonstrated by Fuchs et al. in 2007 and revealed that the nuclei of neutrophils decondensate and the

nuclear envelope disintegrates, allowing the mixing of granule and nuclei components that form

NETs. Finally, the NETs are released as the cell membrane breaks (Fuchs et al., 2007). PMNs that are

Figure ‎1-3 Overview of neutrophil functions

After infection of tissue PMNs are attracted by chemokines to cross cell layers and afterwards to counteract

against pathogens. Mechanisms after migration are 1. Phagocytosis and digestion of microbes, 2. NET formation

to trap and maybe kill pathogens or 3. Apoptosis with the start of inflammation resolution. To regulate the

immune response PMNs release cytokines.

General Introduction

17

activated by Phorbol-12-myristate-13-acetate (PMA) or Staphylococcus (Staph.) aureus or IL-8,

undergo typical features of NETosis and release NETs after two to three hours. By live video

microscopy the process from activation to NETosis was monitored (Fuchs et al., 2007). It was

suggested that this mechanism of NET release by cell lysis is going on after a direct neutrophil

activation by pathogens (Papayannopoulos & Zychlinsky, 2009).

Publications are increasing that describe the cellular mechanisms leading to NETosis. After the

stimulation of receptors on the PMN surface, the PMNs stick flattened to the substrate and a cascade

of reactions is started (Brinkmann & Zychlinsky, 2012). With PMA stimulation NETosis occurs

through activation of protein kinase C (PKC) and NADPH-oxidase (or phagocytic oxidase = PHOX)

leading to generation of ROS (Fuchs et al., 2007; Papayannopoulos et al., 2010). The signaling

cascades involved in PKC and NADPH-oxidase activation include the raf–mitogen-activated protein

kinase (MEK)–extracellular signal-regulated kinase (ERK) pathway (raf-MEK-ERK) (Hakkim et al.,

2011) and the Rac-related C3 botulinum toxin substrate 2 (Rac2) (Lim et al., 2011). In a following

step H2O2 might become a substrate for MPO, an enzyme localized in azurophilic granules. Moreover,

neutrophil elastase (NE) is stored in these granules and both enzymes are mobilized. NE enters the

nucleus after ROS production and degrades the linker 1 histone. This promotes chromatin

decondensation. After binding of MPO to chromatin, the decondensation is initiated. The nuclear

membrane dissolves and the contents of granules, the nucleus and the cytosol mix. As chromatin

decondensation is completed, the cell ruptures and releases NETs into the extracellular space [Fig. 1-

4] (Fuchs et al., 2007; Papayannopoulos et al., 2010). Moreover histone citrullination and chromatin

decondensation by peptidylargine deiminase 4 (PAD4) after TNFα treatment was reported (Wang et

al., 2009b). This is an important step for the nuclear DNA release and at the end the PMN is dead.

This previously described mechanism is oxidant-dependent. Nevertheless, in 2012 Parker et al. tested

different stimuli in presence of inhibitors of oxidant generation (e.g. diphenyleneiodonium chloride =

DPI). As stimuli they used PMA, the calcium ionophore ionomycin, Staph. aureus, E. coli and

Pseudomonas aeruginosa. They were able to demonstrate that NET release after ionomycin incubation

is also possible via an oxidant-independent way. A NET release after ionomycin incubation was

possible in the absence of NADPH-oxidase.

Most publications describe NET release as a form of pathogen-induced active cell death, which gives

PMNs the possibility to fight against microbes beyond their life span. Interestingly, recently NET

formation was explained by three different mechanisms in the literature (Brinkmann, 2004; Fuchs et

al., 2007; Pilsczek et al., 2010; Yousefi et al., 2009): 1. Classical NET release through cell lysis

(NETosis) as described above, 2. NET release by viable cells mediated by vesicular mechanism [see

Chapter 4.2] and 3. NET release by viable cells formed of mitochondrial DNA. Importantly, the ‘vital’

NETosis via vesicular release of nuclear DNA is faster and oxygen independent, but the detailed

cellular mechanisms that lead to NET formation by viable cells or by release of mitochondrial DNA is

still not entirely clear.

General Introduction

18

Figure ‎1-4 Overview of NETosis pathway

Receptor stimulation on neutrophils (A) leads to an adhesion of the neutrophil and the start of the raf-MEK-ERK

pathway (B). Oxygen dependent granule components like NE and MPO becoming mobile and histones are in the

nucleus processed (C). The cytosol and the granule content mixes and at the end the cell membrane ruptures and

NETs are released (D).

However, the hallmark of NET release independent of the above-mentioned three mechanism is the

release of DNA associated with antimicrobial compounds. These antimicrobial components are MPO,

NE, cathelicidin LL-37, histones, proteinase 3, cathepsin, lactoferrin or gelatinase (Brinkmann, 2004;

Papayannopoulos & Zychlinsky, 2009). With those compounds, NETs are able to bind, disarm and

occasionally kill bacteria. Beside its antimicrobial effects, Schauer et al. (2014) described a further

function of NETs in a study about gout. The authors showed that aggregated NETs (aggNETs)

degrade cytokines and chemokines. Thus, aggNETs constitute an anti-inflammatory mechanism

reducing the recruitment and activation of PMNs. These aggNET structures are formed in the presence

of a high neutrophil density. NET structures were detected in human tissue sections of gout patients.

Further, the gout associated monosodium urate crystals induce NETosis and aggNETs. The authors

hypothesized that aggNETs are involved in spontaneous resolution of acute inflammation in patients

with gout.

However, besides a protective effect in the host, recent publications also demonstrate a detrimental

effect for the host when NETs are accumulating and not eliminated by the host. As an example, NETs

are involved in pathologic processes with inflammation where cytotoxic molecules from PMNs or

lysed PMNs are involved. Some studies demonstrated a damage of endothelium and tissue by NETs

(Clark et al., 2007; Marin-Esteban et al., 2012). By Papayannopoulos and colleagues in 2011 it was

suggested that NET formation and the release of NE promotes chromatin decondensation in sputum of

patients with cystic fibrosis, a chronic lung infection and inflammation, by proteolytic processing of

General Introduction

19

histones and is therefore maybe a factor for sputum viscosity and tissue damage. In different

autoimmune diseases for example systemic lupus erythematosus (SLE) and systemic vasculitis (SVV)

the role of NETs has been characterized (Garcia-Romo et al., 2011; Hakkim et al., 2010; Knight &

Kaplan, 2012; Knight et al., 2012; Pieterse & van der Vlag, 2014). Interestingly, from 25 proteins

identified in NET structures by proteomic analysis, 84 % are reported in the literature as autoantigens

in autoimmune diseases, cancer, or other disorders. From these identified proteins, 74 % are described

to be the target of autoantibodies in systemic autoimmune diseases. The most reports are from patients

with SVV, SLE or rheumatoid arthritis. Because cell death was considered as the main source of

autoantibodies, Darrah and Andrade hypothesized that NETs are a link between cell death and

autoimmune diseases. (Darrah & Andrade, 2013). Accordingly, it was demonstrated that an

impairment of NET degradation is associated with autoimmune lupus nephritis: Nuclease-deficient

individuals that are not able to eliminate NETs, have more SLE, as they are unable to regulate the

beneficial versus detrimental effects of NET formation (Hakkim et al., 2010).

Taken together the formation of NETs is an important part of the innate immune defense protecting

the body against invading pathogens. On the other hand, an overproduction or dysregulation can

contribute various pathologies. Therefore, a regulation of NET production and a balance between NET

formation and degradation is needed.

General Introduction

20

1.3.2 NET mediated binding and killing of bacteria

A number of publications demonstrated an entrapment of bacteria by NET structures with

immunofluorescence microscopy, but specific binding partners are not entirely clear. It was published

that nanoparticles stick to NETs through charge interactions (Bartneck et al., 2010), but it seems that

NET binding is not only due to charge (Urban et al., 2009). It was in addition discussed if a special

staining technique for electron microscopic analyses opens a new door to investigate the role of

bacterial fimbriae-mediated adhesion to NETs (Krautgartner & Vitkov, 2008). Nevertheless, for many

bacteria trapping by NETs is described. As mentioned in detail above, the NET structures contain

histones, granule proteases and AMPs which might exhibit antimicrobial effects on trapped pathogens.

A total of 24 neutrophil proteins were identified to be associated with NETs, among those

antimicrobial factors as histones, calprotectin, elastase or myeloperoxidase (Urban et al., 2009). The

direct antimicrobial activity of histones in NETs was demonstrated in the first description of NETs

(Brinkmann, 2004). Whereas some bacteria are able to escape and / or survive in the presence of

NETs, others are killed (Table 1). The possibility for NET escape is independent from the Gram

classification, for example staphylococci and Pseudomonas aeruginosa can survive in presence of

NETs, whereas L. monocytogenes or Shigella flexneri are reduced in bacterial numbers in the presence

of NETs.

NETs are described to have bactericidal activity or a bacteriostatic antimicrobial effect. In case of

bactericidal substances, 99.9 % of the bacteria are killed compared to the inoculum (Noviello et al.,

2003). Bacteriostatic antimicrobial substances inhibit the reproduction of bacteria that leads to a

bacterial growth inhibition. It was discussed that NETs only lead to a bacteriostatic antimicrobial

effect as a result of entrapment and partial killing within NETs (Baums & von Köckritz-Blickwede,

2015).

21

Gen

eral

Int

rodu

ctio

n

Tab

le 1

Bac

teri

al i

nte

ract

ion

des

crib

ed w

ith

PM

Ns

and

/ o

r N

ET

s

Gra

m-n

egat

ive

Sp

ecie

s B

acte

rial

in

tera

ctio

n w

ith

PM

Ns

/ N

ET

s R

efer

ence

N

ET

in

du

ctio

n

NE

T e

ntr

apm

ent

Kil

lin

g w

ith

in N

ET

s (+

) S

urv

ives

wit

hin

NE

Ts

(-)

re

du

ctio

n b

acte

rial

nu

mb

ers

(+/-

)

NE

T

deg

rad

atio

n

Aci

neto

bact

er b

aum

anni

i -

-

(in

pres

ence

of

PM

Ns)

(Kam

osh

ida

et a

l.,

20

15)

Aer

omon

as h

ydro

phil

a

+

-

+

(Bro

gden

et

al.

, 2

01

2, 2

01

4)

Bor

reli

a bu

rgdo

rfer

i S

ensu

S

tric

to

+

+

-?

(M

ente

n-D

edo

yar

t et

al.

, 20

12

)

Bur

khol

deri

a ps

eudo

mal

lei

+

+

+

(R

iyap

a et

al.

, 2

01

2)

Esc

heri

chia

col

i +

+

+

(Gri

nber

g et

al.

, 20

08;

Mar

in-

Est

eban

et

al.,

20

12)

Hae

mop

hilu

s in

flue

nza

+

+

-

(Ju

nea

u e

t al

., 2

011

, 2

01

5a)

Man

nhei

mia

hae

mol

ytic

a +

+

+

(Au

lik

et a

l.,

20

10)

Nei

sser

ia g

onor

rhoe

ae

+

+

(Ju

nea

u e

t al

., 2

015

b)

Nei

sser

ia m

enin

giti

des

+

+

/-

(L

app

ann

et

al.

, 2

01

3)

Por

phyr

omon

as g

ingi

vali

s +

+

+

(Del

bos

c et

al.

, 2

011

; P

alm

er e

t a

l.,

20

12)

Pse

udom

onas

aer

ugin

osa

+

+

stra

in d

epen

dent

(Kam

osh

ida

et a

l.,

20

15;

Kh

atu

a et

al.

, 20

12

; You

ng

et

al.

, 2

011

)

Salm

onel

la t

yphi

mur

ium

+

(Bri

nkm

ann

, 2

00

4)

Shig

ella

fle

xner

i

+

+

(B

rin

kman

n,

20

04

)

Yer

sini

a en

tero

coli

tica

+

+

(C

asut

t-M

eyer

et

al.

, 20

10

)

Yer

sini

a pe

stis

+

-

-

(Cas

utt-

Mey

er e

t a

l., 2

01

0)

Vib

rio

chol

era

+

+

- +

(S

eper

et

al.

, 2

01

3)

22

Gen

eral

Int

rodu

ctio

n

Gra

m-p

osit

ive

Sp

ecie

s B

acte

rial

in

tera

ctio

n

Ref

eren

ce

N

ET

in

du

ctio

n

NE

T e

ntr

apm

ent

Kil

lin

g w

ith

in N

ET

s (+

) S

urv

ives

wit

hin

NE

Ts

(-)

re

du

ctio

n b

acte

rial

nu

mb

ers

(+/-

)

NE

T

deg

rad

atio

n

Bac

illu

s an

thra

cis

+

only

un

enca

psul

ated

+

only

une

ncap

sula

ted

+

(S

zaro

wic

z &

Fri

edla

nde

r,

20

11)

Lis

teri

a m

onoc

ytog

enes

+

+

(R

amo

s-K

ichi

k et

al.

, 2

00

9)

Stap

hylo

cocc

us a

ureu

s

+

- +

(B

eren

ds

et a

l.,

201

0;

Bri

nkm

ann

, 2

00

4)

Gro

up A

Str

epto

cocc

i (G

AS)

-

+

(Bu

chan

an e

t al

., 2

006

; L

auth

et

al.

, 20

09)

Gro

up B

Str

epto

cocc

i +

(Car

lin

et

al.,

20

09

)

Stre

ptoc

occu

s ag

alac

tiae

-

+

(Der

ré-B

ob

illo

t et

al.

, 2

01

3)

Stre

ptoc

occu

s pn

eum

onia

e

-

+

(Bei

ter

et a

l., 2

00

6; M

ido

n e

t a

l.,

20

11;

War

tha

et a

l., 2

007

)

Stre

ptoc

occu

s sa

ngui

nis

- +

(M

orit

a et

al.

, 2

014

)

acid

-fas

t b

acte

ria

Myc

obac

teri

um c

anet

tii

+

+

-

(Ram

os-

Kic

hik

et a

l.,

20

09)

Myc

obat

eriu

m t

uber

culo

sis

+

+

-

(Ram

os-

Kic

hik

et a

l.,

20

09)

Lu

et a

l. 2

012;

ada

pted

and

sup

plem

ente

d

General Introduction

23

1.3.3 NET evasion by pathogens

As some pathogens are able to escape NETs and others are not, it is obvious that microorganisms

produce factors involved in escape mechanisms. Four escape mechanisms are conceivable: 1.

suppression of NET formation, 2. protection against NET-mediated entrapment, 3. degradation of

NETs, 4. protection against antimicrobial activity of NETs. The hypothesis that microbes are able to

suppress the formation of NETs, was initiated by Papayannopoulos & Zychlinsky (2009), who

hypothesized that bacterial catalases consume H2O2 a key factor in formation of NETs. However, this

has not been confirmed with experimental data. The protease SpyCEP of M1T1 Group A

Streptococcus (GAS) reduces the production of NETs. SpyCEP cleaves IL-8, an inducer of NET

formation (Zinkernagel et al., 2008). These findings strengthen the concept that pathogens are able to

suppress NET formation.

As the charge of the surface of pathogens plays a role in the trapping process by NETs (Bartneck et

al., 2010), modification of the bacterial surface charge might be used by pathogens to protect

themselves against entrapment. Different streptococci such as GAS increase the positive surface

charge by D-alanylation of the surface-exposed lipoteichoic acid (Kristian et al., 2005). Wartha and

colleagues (2007) described protection of S. pneumoniae against NET-mediated killing due to D-

alanylation. A similar result for evasion from neutrophil killing due to D-alanylation was found for

Staph. aureus (Kraus et al., 2008) and S. suis (Fittipaldi et al., 2008b). Further a mechanism for

pathogens to protect themselves against the AMP activity inside the NETs is the charge of the cell

envelope (Epand & Vogel, 1999). Furthermore, it was demonstrated that the polysaccharide capsule of

S. pneumoniae reduced the entrapment by NETs (Wartha et al., 2007), which has been proven as a

general protection against phagocytosis.

As the antimicrobial activity of NETs is lost after DNase digestion (Brinkmann, 2004), it was assumed

that DNase production is a benefit for pathogens. Indeed the role of a DNase as NET evasion factor

was first demonstrated for GAS (Buchanan et al., 2006). Table 2 gives an overview about bacterial

DNases as NET evasion factors. For viruses and parasites DNase activity as NET escape mechanism is

not yet described, with the exception of Leishmania infantum (Table 2). Interestingly, a number of

publications have presented data about streptococci and staphylococci. In chapter 1.4 a more detailed

introduction about the function of DNases in streptococci and staphylococci is given. Another way of

pathogens to evade NET-mediated antimicrobial activity is described for GAS. M1 protein protects

GAS by deactivating the human cathelicidin LL-37 (Lauth et al., 2009). Since LL-37 protects NETs

against degradation by bacterial nucleases (Neumann et al., 2014a, b), deactivation of LL-37 by the

M1 protein results in efficient NET degradation by bacterial DNases.

1.4 Function of nucleases in microorganisms

As nucleases of microorganisms have been described to degrade NETs and mediate microbial escape

from NETs, this chapter gives an overview about the classification of nucleases in the enzyme family

General Introduction

24

and their general function. Enzymes have a main function in the metabolism of organisms and they are

classified by IUPAC in 6 groups. The enzyme group with commission number 3 (EC 3) are named as

hydrolases. They are further divided into 13 subclasses depending on the special bounds they can

cleave. In the group of esterases nucleases are classified with the EC-number 3.1.11 to 3.1.31. They

can be divided into exonucleases and endonucleases (McNaught & Wilkinson, 2009). In 1968, Stuart

Linn and Werner Arber isolated two enzymes in E. coli. The first enzyme was able to cleave

unmethylated DNA and the second added a methyl group to DNA (Arber & Linn, 1969; Linn &

Arber, 1968). This findings were one of the landmarks for the discovery of restriction enzymes and ten

years later Werner Arber, Daniel Nathans and Hamilton O. Smith got the Nobel Prize in Physiology or

Medicine "for the discovery of restriction enzymes and their application in molecular genetics"

(Nobelprize.org, 2015). Since this time information on restriction enzymes and the function of endo-

and exonucleases accumulated. An exonuclease (from Ancient Greek éksō, “outer, external”) removes

nucleotides from the end of the DNA molecule. On the other hand an endonuclease (from Ancient

Greek éndon, “within”) cuts DNA in the interior.

Before the identification of NETs occurred, researchers were interested in bacterial nucleases as

factors in genetic transformation (Lacks et al., 1975) or the characterization of enzymatic activity of

bacterial nucleases (Faustoferri et al., 2005). Interestingly new results demonstrated that the main

function of Cas4, a 5’ to 3’ DNA exonuclease, is an antiviral defense mechanism of bacteria (Sorek et

al., 2008; Zhang et al., 2012).

Furthermore, some researchers are working on methods to use DNases as a therapeutic target. For

example NucB, a nuclease from Bacillus licheniformis, was tested for the effect on biofilm forming

microorganisms (Shields et al., 2013). In this study microorganisms were isolated from patients with a

chronic rhinosinusitis and most of them were Staph. aureus or α-haemolytic streptococci. NucB is

small nuclease compared to other nucleases and in the study of Shields et al. (2013) more than 50 % of

the isolated bacteria produced biofilms and a high number produced NucB-sensitive biofilms. Earlier

studies discussed biofilms growing within paranasal sinuses as mayor factors in the pathogenesis of

chronic rhinosinusitis (Foreman et al., 2012). Interestingly, nine of the staphylococci and streptococci

tested in the NucB study are known to produce extracellular nuclease, but after treatment with NucB

the biofilm formation was reduced (Shields et al., 2013).

In the last ten years in different studies nucleases were characterized to be involved in the escape of

pathogens from NETs. DNases of bacteria were explored as factors against the innate immune system.

Remarkable most DNases involved in NET escape were identified in Gram-positive cocci (Table 2).

But also Gram-negative bacteria are able to escape NETs by production of a nuclease (Juneau et al.,

2015b; Seper et al., 2013). EndA of S. pneumoniae is not only involved in NET escape but also in

spreading of the pneumococci from the upper airways to the lungs and from there to the bloodstream

(Beiter et al., 2006).

General Introduction

25

Many bacteria such as GAS produce more than one DNase. Sumby et al. (2005) discussed possible

reasons. Firstly, different DNases may be produced at different growth phases and function therefore

at different phases of infection. Secondly, in close correlation to point one, it is conceivable that

different DNases might show differences in the biochemical conditions for optimal activity, e.g. pH or

ion concentrations. This might be important for invasive bacteria as they are exposed to different body

fluids or tissues. Thirdly, if one DNase is inactivated by the host, e.g. by antibodies, another DNase

might still work and contribute to bacterial survival.

To counteract the innate immune system, bacterial DNases are not only degrading NETs.

Unmethylated CpG-rich bacterial DNA is recognized by TLR-9. The degradation of bacterial DNA by

Sda1 suppresses the TLR-9 innate immune response and macrophage bactericidal activity (Uchiyama

et al., 2012). This constitutes an additional novel innate immune evasion mechanism.

Taken together DNases of microorganisms, especially of bacteria, may exhibit a wide spectrum of

multiple different functions in metabolism and host immune evasion.

26

Gen

eral

Int

rodu

ctio

n

Tab

le 2

DN

ases

in

mic

roor

gan

ism

s

Sp

ecie

s D

Nas

e L

ocat

ion

/ d

etec

tion

N

ET

deg

rad

atio

n

Oth

er f

un

ctio

n

Ref

eren

ce

Par

asit

e

Lei

shm

ani

a i

nfa

ntu

m

3'N

T/N

U

mem

bra

ne-a

ncho

red

ye

s

(Gui

mar

aes-

Cos

ta e

t a

l., 2

014)

Gra

m-n

egat

ive

bac

teri

a

Aer

om

on

as h

ydro

phil

a

? ?

yes

(B

rogd

en e

t a

l., 2

012)

Vib

rio

ch

ole

rae

Xd

s ex

trac

ellu

lar

(sup

erna

tant

) ye

s

(Blo

kesc

h &

Sch

ool

nik,

20

08;

Sep

er e

t al

., 2

013)

Vib

rio

ch

ole

rae

Dns

ex

trac

ellu

lar

nuc

leas

e ye

s

(Blo

kesc

h &

Sch

ooln

ik,

2008

; S

eper

et

al.

, 201

3)

Nei

sser

ia g

onor

rho

eae

Nuc

ye

s

(Jun

eau

et a

l., 2

015b

)

G

ram

-pos

itiv

e b

acte

ria

Sta

phyl

oco

ccu

s au

reu

s N

uc

extr

acel

lula

r (s

uper

nata

nt)

yes

(B

eren

ds

et a

l., 2

010)

Str

epto

cocc

us

aga

lact

iae

GB

S06

61

(Nuc

A)

tran

smem

bra

ne d

om

ain

(s

uper

nata

nt)

yes

(D

erré

-Bob

illo

t et

al.

, 201

3)

Str

epto

cocc

us d

ysga

lact

iae

sub

sp. e

qu

isim

ilis

(ea

rlie

r S

trep

toco

ccus

eq

uis

imil

is)

SD

C

cell

wal

l-an

cho

red

, (s

uper

nata

nt)

not

inve

stig

ated

(Wo

lino

wsk

a et

al.

, 199

1)

Str

epto

cocc

us

mu

tan

s S

mn

A (

Sm

x)

no

t in

vest

igat

ed

(F

aust

ofe

rri

et a

l., 2

005)

Str

epto

cocc

us p

neu

mon

iae

End

A

mem

bran

e-b

ou

nd,

surf

ace

loca

ted

ye

s

DN

A u

pta

ke d

urin

g tr

ansf

orm

atio

n; p

rom

ote

bac

teri

al s

prea

ding

(Bei

ter

et a

l., 2

006;

Ber

gé e

t al

., 2

013;

L

acks

& N

eub

erge

r, 1

975;

Mid

on

et a

l.,

201

1;

Mo

on e

t a

l., 2

011;

Zhu

et

al.

, 2

013)

27

Gen

eral

Int

rodu

ctio

n

Sp

ecie

s D

Nas

e L

ocat

ion

/ d

etec

tion

N

ET

deg

rad

atio

n

Oth

er f

un

ctio

n

Ref

eren

ce

Gra

m-p

osit

ive

bac

teri

a

Str

epto

cocc

us p

yog

enes

(M

1T

1)

Sda

1

(sup

erna

tant

) ye

s

viru

lenc

e fa

ctor

in

mic

e;

pro

vide

s sw

itch

to

inva

sive

G

AS

; p

reve

nt T

LR

9-

dep

ende

nt r

ecog

niti

on;

(Azi

z et

al.

, 200

4; B

ucha

nan

et a

l.,

200

6; U

chiy

ama

et a

l., 2

012;

Wal

ker

et

al.

, 200

7)

Stre

pto

cocc

us

pyo

gen

es

(M1

) S

pn

A

cell

wal

l-lo

cate

d (s

uper

nata

nt)

yes

(C

hang

et

al.

, 201

1; H

aseg

awa

et a

l.,

201

0)

Str

epto

cocc

us p

yog

enes

(M

6)

Spd

1 o

r M

F2

, su

per

nata

nt

not

inve

stig

ated

(Bro

udy,

20

02)

Stre

pto

cocc

us

pyo

gen

es

(M1

) S

pd3,

Sd

aD

2,

Spd

ex

trac

ellu

lar

no

t in

vest

igat

ed

enha

nce

evas

ion

of

the

inna

te i

mm

une

resp

onse

, m

ajor

DN

ase

is S

daD

2

(Su

mb

y et

al.

, 200

5)

Str

epto

cocc

us s

ang

uin

is

SW

AN

ce

ll w

all-

anch

ore

d

not

inve

stig

ated

p

rote

ctio

n ag

ain

st N

ET

ki

llin

g

(Mo

rita

et

al.

, 201

4)

Str

epto

cocc

us s

an

guin

is

Do

n (D

Nas

e on

e)

exon

ucle

ase

not

inve

stig

ated

R

epai

r of

DN

A d

amag

e (L

indl

er &

Mac

rina

, 198

7)

Str

epto

cocc

us s

uis

S

snA

ce

ll w

all-

loca

ted,

(s

uper

nata

nt)

not

inve

stig

ated

S

. sui

s va

ccin

e ca

ndid

ate

in

mic

e (F

ont

aine

et

al.

, 200

4; G

ómez

-Gas

cón

et

al.

, 201

4)

General Introduction

28

1.5 Role of brain barriers in bacterial infections

Around the brain and the spinal cord the subarachnoid space (outer CSF space) is located and the

ventricular system is a set of four ventricles (inner CSF space) in the brain. Both spaces are connected

and filled with CSF that represents a fluid protection of the brain. The dura mater and the arachnoid

mater on the skull site and the pia mater and glia limitans on the brain site cover the subarachnoid

space [Fig. 1-5].

1.5.1 Three brain barriers

Three brain barriers are formed to protect the brain against harmful substances and pathogens: 1.

blood-leptomeningeal barrier (BLMB), 2. BBB and 3. BCSFB [Fig. 1-5]. These barriers also regulate

the access of immune cells into the CNS. This is the reason why the brain is described as an immune-

privileged site (Nickel et al., 2004; Shechter et al., 2013). The immune response against pathogens in

the CNS is different to the response in other organs. As a high influx of extracellular fluid or immune

cells leads to an inflammatory swelling and increased pressure, the body regulates the entrance of

immune cells to the CNS strictly. Therefore, the CNS is better described as a site of “selective and

modified immune reactivity” (Ransohoff et al., 2003).

The BLMB is localized at the surface of the brain and the spinal cord. This barrier is formed by

endothelial cells of the leptomeningeal microvessels and these cells are connected with tight junctions

(TJs) (Engelhardt & Ransohoff, 2012; Shechter et al., 2013). The second barrier is the BBB formed by

the glia limitans perivascularis and tightly connected endothelia cells of the microvessels in the CNS

parenchyma. One important function of this barrier is the regulation of moving agents from the blood

to the CNS (Lossinsky & Shivers, 2004; Shechter et al., 2013).

Furthermore, the BBB and the BLMB are classified due to the endothelial cell formation as true

barriers. In contrast to these true barriers, the third barrier is called an educational gate which allows

immunosurveillance of the CSF (Shechter et al., 2013). This is the BCSFB, which is located in the

ventricles. From the pia mater, blood capillaries extend like villi into the ventricles. This barrier is also

called choroid plexus and is formed by an endothelium of the fenestrated blood vessels without TJs

and by a single-layer of ependymal cells (specialized cuboidal epithelial cells), with microvilli on the

apical surface. These epithelial cells are connected by TJs. Important TJ proteins are occludin (which

is involved in neutrophil transmigration (Huber, 2000)), claudins or ZO-1, ZO-2 and ZO-3 (Matter &

Balda, 2003, 2007). The CSF is produced by the ependymal cells of the choroid plexus (Nickel et al.,

2004; Shechter et al., 2013). As high numbers of leukocytes and especially neutrophils in the CSF

compartment characterizes bacterial meningitis, these cells must cross at least one of the three brain

barriers. Different histopathological analyses were able to demonstrate that the BCSFB can be a main

entry site for pathogens in case of bacterial meningitis. This was observed for E. coli (Zelmer et al.,

2008), N. meningitidis (Guarner et al., 2004; Pron et al., 1997) and S. suis (Madsen et al., 2002b;

Sanford, 1987; Williams & Blakemore, 1990).

General Introduction

29

Figure ‎1-5 Overview about the three brain barriers

Three brain barriers are formed in mammals and are located at different sites in the brain. The blood brain barrier

(BBB) and the blood leptomenigeal barrier (BLMB) are true barriers as the endothelium (5) is connected by TJs

(2). In contrast the blood cerebrospinal fluid barrier (BCSFB) is characterized by an epithelium (7) with TJs (2)

but a fenestrated endothelium (8). 1 CSF, 2 TJs, 3 Glia limitans with astrocytes, 4 blood, 5 endothelial cell, 6

endothelial basement membrane, 7 epithelial cell, 8 choroidal endothelia cell

General Introduction

30

1.5.2 Cell culture systems of the BCSFB

To understand the importance and function of the BCSFB, different cell culture systems have been

established (Redzic, 2013). The first description of a functional human BCSFB model was published

in 2012 (Schwerk et al., 2012). This model bases on a human choroid plexus papilloma cell line

(HIBCPP) and is characterized by high transepithelial electrical resistance (TEER), formation of TJs

and expression of junctional proteins. It was used to study transmigration of this barrier by S. suis and

N. meningitides. Furthermore, transmigration of neutrophil granulocytes through this barrier after

infection was demonstrated (Steinmann et al., 2013) [Fig. 1-6].

In addition to the HIBCPP a human choroid plexus carcinoma cell line (CPC-2) has been tested.

However, these cells show irregular staining of TJ proteins indicating reduced barrier function

(Redzic, 2013). Further, a commercially human choroid plexus epithelium primary culture (ScienCell

laboratories, Carlsbad, CA, USA) is available. However up to now, these cell line was only used in

studies without interest on the barrier features and some questions are unresolved like the origin of the

cell line (Redzic, 2013). Taken together the best established human choroid plexus cell culture system

is the BCSFB model published by Schwerk et al. in 2012. The HIBCPP cells have also been used in

an inverted system. The inverted orientation is an important modification, which mimics the in vivo

situation as infectious agents and immune cells might be applied to the basolateral (blood side).

Bacteria and immune cells may breach the barrier and enter the apical side, which represents the “CSF

compartment” with regard to the orientation of the plexus epithelial cells.

In addition to the models of the human BCSFB, there are also porcine BCSFB models. Until now

infection and transmigration studies were conducted only with primary porcine choroid plexus cells

(Adam et al., 2004; Tenenbaum et al., 2009; Wewer et al., 2011), but in 2012 a novel porcine in vitro

model of the BCSFB with a porcine choroid plexus epithelial cell line (PCP-R) was published

(Schroten et al., 2012). This new model is associated with strong barrier functions such as high TEER

and low permeability of macromolecules.

The BCSFB models were used to answer questions dealing with bacteria and neutrophils or

monocytes. In the human model of the BCSFB invasion of S. suis as well as N. meningitides was

reported to be possible only from the physiologically relevant basolateral side (Schwerk et al., 2012).

Also in a porcine model of the BCSFB the same polar invasion of S. suis was demonstrated

(Tenenbaum et al., 2009). The neutrophil transmigration following infection of the cell layer was

visualized via three-dimensional Apotome®-imaging and electron microscopy (Tenenbaum et al.,

2013; Wewer et al., 2011). After an infection with N. meningitidis a paracellular as well as a

transcellular transmigration of neutrophils through a HIBCPP cell layer was observed (Steinmann et

al., 2013). Furthermore, after a S. suis infection of the porcine blood-CSF barrier model a transcellular

migration of neutrophils was detected (Wewer et al., 2011).

General Introduction

31

The function of the BCSFB is lost in an in vitro model after S. suis infection, but until now the

mechanisms for the barrier breakdown are not found (Tenenbaum et al., 2005). The described in vitro

models might also be used to explore the role of cytokines in the CSF compartment. For example

IFN-γ and TNFα are detected in CSF of patients with meningitis and are key mediators for

proinflammation (Glimåker et al., 1994; Kornelisse et al., 1997). Growth of S. suis was significantly

reduced in the presence of IFN-γ stimulated porcine CPEC and TNFα enhanced this effect (Adam et

al., 2004). The function of PMN’s after transmigration through a model of IL-1 stimulated mouse

brain epithelium has been studied. The transmigrated neutrophils were found to be neurotoxic after

transmigration of this barrier, based on experiments with cultured neurons and released NETs (Allen

et al., 2012). Nevertheless, up to now no study has been published that focused on the interaction

between S. suis or in general bacteria and neutrophil granulocytes after a transmigration through the

BCSFB in this model and if for example NET formation is possible.

Figure ‎1-6 Overview of the in vivo BCSFB [A] and the inverted in vitro model [B]

A. BCSFB, B inverted cell culture system of the BSCFB established by Schwerk et al. 2012

1 blood [A] / blood compartment [B], 2 CSF [A] / CSF compartment [B], 3 choroidal endothelium,

4 epithelial cells [A] / HIBCCP [B], 5 TJs, 6 filter membrane of insert, 7 S. suis, 8 neutrophil

Aims of the study

32

2 Aims of the study

To date, nothing is known about the S. suis interaction with NETs and the role of NETs in an S. suis

infection. As DNases have been described to be important NET evasion factors in streptococci and

staphylococci, the first aim of the present study was to investigate putative DNase candidates of S. suis

and their role in the interaction with NETs in vitro [Chapter 3.1 and 3.2]. Loss-of-function-mutations

were used to reveal the function of the known DNase SsnA (Fontaine et al., 2004) but also of a novel

DNase identified during this work. Furthermore, comparative investigations included a double mutant

to identify possible synergistic effects of both DNases [Chapter 3.2].

As S. suis infects piglets and humans, tests were conducted with neutrophils from both species. This

experimental design offered the chance to identify differences in the two hosts [Chapter 3.1].

After the characterization of the function of both DNases in interaction with NETs in vitro, the second

part of the present study focused on the detection of NETs in the S. suis-infected CSF compartment.

For in vitro studies, a cell culture system of the choroid plexus was adapted from an established

protocol (Schwerk et al., 2012) to address two topics, a) NETosis in the S. suis-infected CSF

compartment and b) examination of the functions of SsnA and EndAsuis in the CSF compartment in

vitro. In addition, CSF drawn from S. suis-infected piglets was analyzed to screen for DNase activity

as well as NET formation in vivo [Chapter 3.3]. The aims of the study are illustrated in figure 2-1.

Aims of the study

33

Figure ‎2-1 Illustration of the aims of the study

[A] Does S. suis induce NETs? [B] Is S. suis entrapped and killed in NETs or able to evade by degrading NETs

with one or more DNases? [C] What is the function of S. suis DNase in the CSF compartment? [D] Are NETs

formed in the CSF compartment?

Results

34

3 Results

3.1 SsnA is a NET-evasion factor in the stationary growth

Streptococcus suis DNase SsnA contributes to

degradation of neutrophil extracellular traps (NETs) and

evasion of NET-mediated antimicrobial activity

Nicole de Buhr1, Ariane Neumann

2, Natalja Jerjomiceva

2, Maren von Köckritz-Blickwede

2

and Christoph G. Baums1

Results

35

Editor’s Choice

Microbiology 2014 160: 385–95. DOI 10.1099/mic.0.072199-0

Streptococcus suis DNase SsnA contributes to degradation of neutrophil extracellular traps (NETs)

and evasion of NET-mediated antimicrobial activity

Nicole de Buhr1, Ariane Neumann

2, Natalja Jerjomiceva

2, Maren von Köckritz-Blickwede

2 and

Christoph G. Baums1

1Institute for Microbiology, Centre for Infection Medicine, University of Veterinary Medicine

Hannover, Hannover, Germany

2Department of Physiological Chemistry, Centre for Infection Medicine, University of Veterinary

Medicine Hannover, Hannover, Germany

These authors contributed equally to this paper.

Corresponding author: Christoph G. Baums, Email: Christoph.baums@gmx.de

Contribution of Nicole de Buhr to this work:

Nicole de Buhr conducted mutagenesis of S. suis, the genotyping assays and most of the phenotyping

assays including the immunofluorescence analysis. She carried out generation, expression and

functional analysis of the recombinant protein. All DNase assays were done by Nicole de Buhr.

Furthermore, she analyzed the data, conducted statistical analysis, designed the figures and

participated in experimental design and drafting the manuscript.

Results

36

ABSTRACT

Streptococcus suis is an important cause of different pathologies in pigs and humans, most importantly

fibrinosuppurative meningitis. Tissue infected with this pathogen is substantially infiltrated with

neutrophils, but the function of neutrophil extracellular traps (NETs) - a more recently discovered

antimicrobial strategy of neutrophils - in host defense against Strep. suis has not been investigated.

The objective of this work was to investigate the interaction of Strep. suis with NETs in vitro. Strep.

suis induced NET formation in porcine neutrophils and was entrapped but not killed by those NETs.

As the amount of NETs decreased over time, we hypothesized that a known extracellular DNase of

Strep. suis degrades NETs. Though this nuclease was originally designated Strep. suis-secreted

nuclease A (SsnA), this work demonstrated surface association in accordance with an LPXTG cell

wall anchor motif and partial release into the supernatant. Confirming our hypothesis, an isogenic

ssnA mutant was significantly attenuated in NET degradation and in protection against the

antimicrobial activity of NETs as determined in assays with phorbol myristate acetate (PMA)-

stimulated human neutrophils. Though assays with PMA- stimulated porcine neutrophils suggested

that SsnA also degrades porcine NETs, phenotypic differences between wt and the isogenic ssnA

mutant were less distinct. As SsnA expression was crucial for neither growth in vitro nor for survival

in porcine or human blood, the results indicated that SsnA is the first specific NET evasion factor to be

identified in Strep. suis.

Abbreviations:

MAP, murein-associated protein; NET, neutrophil extra- cellular trap; PMA, phorbol myristate

acetate; SsnA, Strep. suis secreted nuclease A.

Results

37

3.2 EndAsuis degrades NETs in exponential growth phase

Identification of a novel DNase of Streptococcus suis

(EndAsuis) important for neutrophil extracellular trap

degradation during exponential growth

Nicole de Buhr1, Matthias Stehr

1,2, Ariane Neumann

3, Hassan Y. Naim

3, Peter Valentin-

Weigand1, Maren von Köckritz-Blickwede

3 and Christoph G. Baums

1,4

Results

38

Microbiology 161: 838–850. DOI 10.1099/mic.0.000040

Identification of a novel DNase of Streptococcus suis (EndAsuis) important for neutrophil

extracellular trap degradation during exponential growth

Nicole de Buhr1, Matthias Stehr

1,2, Ariane Neumann

3, Hassan Y. Naim

3, Peter Valentin-Weigand

1,

Maren von Köckritz-Blickwede3 and Christoph G. Baums

1,4

1Institute for Microbiology, Centre for Infection Medicine, University of Veterinary Medicine

Hannover, Hannover, Germany

2LIONEX Diagnostics and Therapeutics GmbH, Braunschweig, Germany

3Department of Physiological Chemistry, Centre for Infection Medicine, University of Veterinary

Medicine Hannover, Hannover, Germany

4Institute for Bacteriology and Mycology, Centre for Infectious Diseases, College of Veterinary

Medicine, University of Leipzig, Leipzig, Germany

These authors contributed equally to this paper.

Corresponding author: Christoph G. Baums, Email: christoph.baums@vetmed.unileipzig.de

Contribution of Nicole de Buhr to this work:

Nicole de Buhr conducted mutagenesis of S. suis, the genotyping assays and most of the phenotyping

assays including the immunofluorescence analysis. She carried out generation, expression, purification

and functional analysis of the recombinant proteins. All DNase assays were done by Nicole de Buhr.

In addition she supported the implementation of the 3D modeling part. Furthermore, she analyzed the

data, conducted statistical analysis, drafted the figures and participated in experimental design and

drafting the manuscript.

Results

39

3.3 NETs detected in S. suis-infected CSF compartment

Neutrophil extracellular trap formation after transmigration of

neutrophils through Streptococcus suis infected human

choroid plexus epithelial cell barrier

Nicole de Buhr1, Friederike Reuner

2, Ariane Neumann

2, Carolin Stump-Guthier

3, Tobias

Tenenbaum3, Horst Schroten

3, Hiroshi Ishikawa

4, Peter Valentin-Weigand

1, Christoph G.

Baums1,5 and Maren von Köckritz-Blickwede

2

Results

40

In preparation

Neutrophil extracellular trap formation after transmigration of neutrophils through S. suis infected

human choroid plexus epithelial cell barrier

Nicole de Buhr1, Friederike Reuner

2, Ariane Neumann

2, Carolin Stump-Guthier

3, Tobias Tenenbaum

3,

Horst Schroten3, Hiroshi Ishikawa

4, Peter Valentin-Weigand

1, Christoph G. Baums

1,5 and Maren von

Köckritz-Blickwede2,6

1Institute for Microbiology, Centre for Infection Medicine, University of Veterinary Medicine

Hannover, Hannover, Germany

2Department of Physiological Chemistry, Centre for Infection Medicine, University of Veterinary

Medicine Hannover, Hannover, Germany

3Department of Pediatrics, Pediatric Infectious Diseases, Medical Faculty Mannheim, Heidelberg

University, Mannheim, Germany

4Department of NDU Life Sciences, School of Life Dentistry at Tokyo, The Nippon Dental University,

Chiyoda-ku, Tokyo, Japan;

5Institute for Bacteriology and Mycology, Centre for Infectious Diseases, College of Veterinary

Medicine, University Leipzig, Germany

6Research Center for Emerging Infections and Zoonosis (RIZ), University of Veterinary Medicine

Hannover, Germany

These authors contributed equally to this paper.

Corresponding author: Maren von Köckritz-Blickwede

Email: maren.von.koeckritz-blickwede@tiho-hannover.de

Contribution of Nicole de Buhr to this work:

Nicole de Buhr conducted the cell culture experiments including the immunofluorescence analysis,

RNA preparation and RT-PCR. All DNase assays were done by Nicole de Buhr. Furthermore, she

analyzed the data, conducted statistical analysis, drafted the figures and participated in experimental

design and drafting the manuscript.

Results

41

ABSTRACT

Streptococcus (S.) suis is the most important meningitis causing pathogen in pigs and also an emerging

zoonotic agent. Neutrophil extracellular traps (NETs) have been identified as host defense mechanism

against different pathogens. Here, in in vivo experiments NETs could be detected in the cerebrospinal

fluid (CSF) of piglets infected with S. suis. Thus, to study NETosis and NET-degradation after

consecutive transmigration of S. suis and neutrophils through the human choroid plexus epithelial cell

barrier, a previously described inverse in vitro model of the human blood-CSF barrier was used. Using

confocal immunofluorescence microscopy NETosis and respective entrapment of streptococci in

NETs was recorded in the lower compartment after transmigration of neutrophils through S. suis-

infected human choroid plexus epithelial cell barrier. Comparative analysis of S. suis wildtype and

different S. suis nuclease mutants did not reveal differences in NET-formation or bacterial survival.

However, expression of antimicrobial peptide LL-37, which has been previously been shown to

stabilize NETs increased after transmigration of neutrophils through the choroid plexus epithelial cell

barrier, suggesting that LL-37 might protect NETs against bacterial DNase degradation in the lower

(“CSF”) compartment. In conclusion, neutrophils form NETs and entrap S. suis after breaching the

infected choroid plexus epithelium.

Non-standard abbreviations: cerebrospinal fluid (CSF), human choroid plexus papilloma cells

(HIBCPP), neutrophil extracellular trap (NET), phorbol-myristate-acetate (PMA), Todd Hewitt broth

(THB)

Results

42

INTRODUCTION

Streptococcus (S.) suis is worldwide one of the major porcine pathogens and characterized by a high

diversity of serotypes (Gottschalk, 2012). Furthermore, it is also a very important zoonotic pathogen.

Serotype 2 is most frequently isolated from morbid animals and humans (Staats et al., 1997;

Wisselink, 2000; Wei et al., 2009). Central nervous system (CNS) disorders due to meningitis are

frequently observed in S. suis-infected piglets and humans (Straw et al., 2006; Lun et al., 2007). S.

suis meningitis is characterized by a high number of neutrophil granulocytes in the cerebrospinal fluid

(CSF) (Williams and Blakemore, 1990; Lun et al., 2007; Beineke et al., 2008). In general neutrophils

are part of the innate immune system and can act antimicrobial by several defence mechanisms like

phagocytosis, apoptosis and NETosis after breaching a cell barrier and infiltrating infected tissue

(Steinberg and Grinstein, 2007; Mocsai, 2013). NETosis is a term used for the formation of neutrophil

extracellular traps (NETs) identified in 2004 as extracellular release of nuclear DNA and associated

antimicrobial compounds (Brinkmann, 2004; Fuchs et al., 2007). However, many pathogens produce

DNases to escape from the antimicrobial effects of NETs. Earlier we showed that S. suis is able to

induce NETs and can also be trapped by NETs (de Buhr et al., 2014). The S. suis secreted nuclease A

(SsnA) is a NET-evasion factor protecting against the antimicrobial activity of NETs (de Buhr et al.,

2014). Furthermore, endonuclease A of S. suis (EndAsuis) is an additional NET-degrading DNase

active in the exponential growth phase (de Buhr et al., 2015). The function of both DNases differs,

since they are active at different pH and ion concentrations (de Buhr et al., 2015).

During the pathogenesis of S. suis meningitis streptococci and neutrophils meet in the CSF

compartment after crossing the blood-CSF barrier (BCSFB) (Williams and Blakemore, 1990; Lun et

al., 2007; Beineke et al., 2008). In an inverted transwell filter system with primary porcine choroid

plexus epithelial cells the invasion and translocation of S. suis from the “blood” to the “CSF

compartment” was analysed and the relevance of the BCSFB as an entry gate for S. suis into the CNS

was indicated (Tenenbaum et al., 2009). Furthermore, an inverse model of the human BCSFB using a

human choroid plexus papilloma (HIBCPP) cell line on transwell filters with constant barrier function

was established by Schwerk et al. (2012). Neutrophils were shown to efficiently cross this barrier from

the upper “blood” to the lower “CSF”-side after an infection with S. suis or N. meningitides

(Steinmann et al., 2013). However, until now, nothing is known about the formation of NETs in CSF.

In this study we first analyzed CSF samples of piglets infected with S. suis to investigate NETosis in

the fluid CSF compartment in vivo. Furthermore, an in vitro BCSFB model was used to study the

formation of NETs and activity of S. suis nucleases after transmigration of neutrophils through S. suis-

infected human choroid plexus epithelial cells.

Results

43

RESULTS

Fig. 1: Immunofluorescence microscopy of NETs and DNase activity is detectable in the S. suis-

infected CSF compartment CSF of infected piglets in vivo and SsnA is active in porcine CSF.

Piglets were infected intranasally with S. suis and the CSF was analysed by cytospin. A. The CSFs of

four piglets (9780, 9807, 9884, 9899) with central nervous system disorders were stained after

cytospin. In all animals NET structures with fibres were detected (blue = DNA [DAPI], green =

Results

44

histone 1). B. CSF samples of uninfected and S. suis wt infected piglets were analyzed for DNase

activity by addition of eukaryotic DNA to the CSF samples and subsequent incubation at 37°C for 22

h. In the PBS control and the uninfected animals no DNase activity was detectable. The 7 infected

animals are divided in two groups. Group 1 (9780, 9807, 9884) was characterized by CNS disorders,

suppurative meningitis, altered CSF with pleocytosis and re-isolation of S. suis in CSF. Group 2

(9725, 9881, 9898, 9971) was characterized by no signs of central nervous system dysfunction or CSF

alterations. C. DNase activity of the indicated S. suis strains in the presence of CSF from healthy

piglets spiked with eukaryotic DNA. After 4 h incubation only SsnA dependent DNA degradation was

detectable (ctr = control). D. Inhibition of DNase activity in CSF of meningitis piglet 9884 and a CSF

sample pre-incubated with S. suis wildtype by incubation with an antiserum against rSsnA prior to

incubation with eukaryotic DNA. CSF pre incubated with the double mutant was used as negative

control for DNA degradation. DNA was visualized by 1% agarose gel electrophoresis.

Results

45

Fig. 2: Modified inverse blood cerebrospinal fluid barrier model for monitoring NETosis in the

„CSF compartment”.

A. An inverted system with human choroid plexus papilloma cells (HIBCPP) grown on filters was

used to form a blood compartment and a CSF compartment. The latter contained cover slips for

immunofluorescence microscopy. Two hours after addition of streptococci to the upper compartment

the liquid in this part was removed and neutrophil granulocytes in fresh medium were added to this

“blood” compartment. Four hours after addition of neutrophils NET-formation was monitored in the

“CSF compartment” after cytospin. B. TEER analysis 2 and 6 h after infection with S. suis. As

depicted in A neutrophils were added 2 h after infection. The percentage to the baseline was calculated

based to the TEER before infection (442 ± 35 Ω cm2). No significant differences were detectable

comparing wells infected with the different indicated S. suis strains. (one way ANOVA, Tukey’s test,

SEM, n=5) and the TEER was stable in the experiment. C. DNase activity was determined in the

supernatants of the „CSF compartments” at the end of experiment. For this supernatants were

incubated with eukaryotic DNA for 4 h at 37°C and DNA was visualized by 1% agarose gel

electrophoresis.

Results

46

Fig. 3. After breaching the infected choroid plexus epithelium in vitro human neutrophils form

NETs entrapping S. suis.

A. Immunofluorescence microscopy analysis of NETosis in the „CSF compartment” 6 h post

infection. Transmigrated neutrophils and bacteria in the „CSF compartment” were centrifuged down

Results

47

on coverslips and stained (NETs = green, Hoechst [DNA] = blue, S. suis = red). Entrapped S. suis are

marked with white arrows. Representative pictures of NET-formation are shown. B-C. Per sample 13

pictures were taken at predefined positions (Fig. S2) and analyzed regarding the number of neutrophils

and the NET-releasing neutrophils. B. A significant difference in the number of neutrophils was found

between bacterial infected filters and the control filters (P = 0.0004, ANOVA, Tukey’s test). C.

Further a significant difference was found in the percentage of activated neutrophils. Using ANOVA,

Dunnett’s multiple comparison test (P= 0.0389) a significant difference was between endAsuis and

uninfected control. D – F By PicoGreen analysis of NET-associated DNA in the „CSF compartment”

revealed only a difference between bacterial infected and uninfected filters. G The percentage of NET-

associated DNA to total DNA was calculated. No significant differences were observed.

All graphs show the mean ± SEM of 5 independent experiments, except the filter “wt without PMN”

in D-F, which was tested four times. A-C are one experiment series and D-F are a second experiment

series. * p < 0.05, ** p < 0.005, *** p < 0.0005, **** p < 0.0001 by ANOVA (B) or t-Test (C)

Results

48

Fig. 4: Bacterial transmigration and survival in the „CSF compartment” is SsnA and EndAsuis

independent in the presence and absence of neutrophils.

The bacterial number of the indicated S. suis strains in the „CSF compartment” was determined at 2 h

and 6 h post infection of the choroid plexus epithelium in vitro. The assay was performed without

neutrophils (A) and after addition of neutrophils to the upper (“blood”) compartment 2 hours post

infection (B). Differences in the specific bacterial content in the „CSF compartment” were not

recorded in both assays comparing the indicated S. suis strains at 2 or 6 hour post infection. All data

are shown as mean ± SD of four (A) or five (c) independent experiments in duplicates each. Statistical

differences were analyzed by one-way ANOVA using Tukey’s adjustment.

Results

49

Fig. 5: LL-37 immunofluorescence signal in HIBCPPs after transmigration of neutrophils.

Immunofluorescence microscopy was conducted to detect LL-37 in HIBCPP and / or transmigrating

neutrophils. A. Detection of LL-37 in filters 6 h post infection with S. suis wildtype and subsequent

addition of neutrophils in the upper (“blood”) compartment to initiate transmigration (wt + PMN) in

comparison to S. suis-infected filters not exposed to neutrophils (wt – PMN). In filters stimulated for 6

h with TNF α for PMN transmigration a LL-37 signal was also detectable (TNFα + PMN). White

squares highlight the area of magnification. The isotype control (control) was negative for LL-37

signal. (blue = DNA [Hoechst], green = LL-37, grey = phalloidin). B. Analysis of LL-37 localization

with PMNs by MPO co-staining. Results for the filters infected with the double mutant

10ΔssnAΔendAsuis (ΔΔ) including transmigrating PMNs (ΔΔ + PMN) are shown. (blue = DNA

Results

50

[Hoechst], green = LL-37, red = MPO, grey = phalloidin). All pictures show examples of

representative pictures. In A only overlays presented.

Fig. 6: LL-37 expression analysis in transmigrating neutrophils and HIBCPPs after infection

with S. suis.

A-C qRT-PCR was conducted with oligonucleotide primers listed in Table S1. Gapdh expression was

used as reference (housekeeping gene). A. Relative transcript levels of transmigrated neutrophils were

compared by calculation of ΔΔCT based to non-transmigrated neutrophils incubated in the „CSF

compartment”. B. Relative transcript levels of non-transmigrated neutrophils were compared by

calculation of ΔΔCT based to non-stimulated neutrophils incubated in 1% FBS cell culture medium. C

Relative transcript levels of the wildtype infected or TNFα stimulated HIBCPP cells and

transmigrating neutrophils (HIBCPP + wt + PMN or HIBCPP + TNFα + PMN) were compared. As

after 40 cycles no signal for the control (HIBCPP + PMN non-transmigrated in „CSF compartment”)

was measured, calculation of ΔΔCT was impossible. Therefore the determined CT values are presented.

Data in A and B are presented as means ± SD of ΔΔCT to control of three independent experiments

with technical duplicates. No significant statistical differences were found analyzed by paired one-way

Student’s t-Test. Data in C presented as single values of three independent experiments with 3

technical independent runs each.

Results

51

Formation of NETs in the CSF of S. suis-infected piglets.

As a first step, we screened CSF of piglets infected experimentally with S. suis serotype 2 (strain 10)

for NET-formation immediately after collection of the samples. Therefore, cells in CSF were

transferred to glass cover slides by cytospin and NETs were visualized by immunofluorescence

microscopy with NET-specific antibodies against histone-DNA-complexes. In all four piglets with

CNS dysfunctions like tremor, opisthotonus or convulsions and histologically confirmed meningitis,

NET structures were detected (Fig. 1A). These four piglets exhibited pleocytosis in the CSF with

leukocyte numbers ranging from 5.4 x 105 /ml to 1.2 x 10

8 /ml. S. suis serotype 2 was isolated in pure

culture from the CSF of these piglets. The CSF sampling method did not induce NET-like structures

as determined by control experiments (Fig. S1). Thus, detection of NETs in CSF samples of S. suis-

infected piglets suggests occurrence of NETosis by granulocytes infiltrating the CSF compartment in

the course of a S. suis meningitis.

Degradation of eukaryotic DNA in the CSF of S. suis-infected piglets.

S. suis has been shown to express at least two DNases involved in NET-degradation (de Buhr et al.,

2014; de Buhr et al., 2015). Thus, as a next step, we analyzed CSF samples of S. suis-infected piglets

for DNase activity to determine if DNase activity is detectable in this infected compartment in vivo.

Interestingly, high DNase activity was detectable in CSF samples of S. suis-infected animals with

meningitis, whereas moderate activity in infected animals with no detectable lesions was seen, and

almost no activity was found in uninfected animals (Fig. 1B).

As DNase activity in meningitis lesions might be of pathogen and/or host origin, we performed

experiments to investigate S. suis nucleases activity in CSF. First, we analyzed if S. suis wildtype and

DNase mutants lead to degradation of DNA in CSF of healthy piglets. As shown in Fig. 1C, S. suis

wildtype and 10ΔendAsuis but not 10ΔssnA incubated in CSF of healthy piglets spiked with

eukaryotic DNA degraded this DNA indicating that the bacterial nuclease SsnA is expressed and

active in CSF. Furthermore, pre-incubation of a meningitis CSF sample (No. 9884) with an antiserum

directed against rSsnA led to a prominent inhibition of DNase activity compared to the respective

control treated with the pre-immune serum (Fig. 1D). In conclusion, SsnA-specific DNase activity is

detectable in S. suis-infected CSF.

Usage of a human BCSFB model to study NETosis in the “CSF compartment”.

We wanted to study NETosis in CSF in more detail. For this a previously described inverse model of a

human BCSFB (Ishiwata et al., 2005; Schwerk et al., 2012) was adapted to investigate NETosis and

NET-degradation after transmigration of streptococci and neutrophils through this barrier. The

protocol was modified to ensure a functional epithelial barrier in the absence of antibiotics. An

important modification was the exchange of the fluid in the upper (“blood”) compartment after two

hours of bacterial infection and prior to addition of neutrophils (Fig. 2A). This step was conducted to

Results

52

prevent lytic effects through suilysin accumulation (Norton et al., 1999; Charland et al., 2000). To

monitor functionality of the choroid plexus epithelial barrier, the transepithelial electrical resistance

(TEER) was recorded at different time points. As shown in Fig. 2B, the percentage baseline TEER

referring to the start value changed only slightly over time and significant differences in TEER were

not recorded between infected and uninfected filters during the course of experiments. Furthermore,

dextran flux measurements confirmed that the modifications of the model did not lead to a reduced

barrier function (data not shown).

After evaluation of the modified inverse model, we investigated if SsnA and EndAsuis dependent

DNase activity is detectable in the lower „CSF compartment” after transmigration of streptococci.

Supernatants of the lower „CSF compartment” infected with S. suis wildtype and S. suis ΔendAsuis

exhibited distinct degradation of DNA in contrast to the compartments infected with S. suis ΔssnA or

S. suis ΔendAsuis ΔssnA and the mock control (Fig. 2C).

Neutrophils form NETs after transmigration through the infected choroid plexus epithelium in

vitro. Immunofluorescence microscopy and a PicoGreen assay were conducted to investigate NETosis

in the lower compartment of the inverse trans-well system. Importantly, we confirmed that neutrophils

formed NETs in the S. suis-infected lower (“CSF”) compartment in this modified model and

streptococci were trapped in these NETs (Fig. 3A). For quantification of NETosis per sample, a total

of 13 pictures were made with a blind target method (Fig. S2). A significantly higher number of

neutrophils were found in infected compartments compared to the uninfected controls (Fig. 3B). This

indicated a functional epithelial barrier, which is inducing transmigration of neutrophils upon infection

with S. suis. Significant differences in the number of neutrophils were not found between the different

infected groups (Fig. 3B). Furthermore, differences in the percentage of NET-releasing cells were not

recorded between wildtype and S. suis DNase mutants (Fig. 3C) (de Buhr et al., 2014; de Buhr et al.,

2015). To confirm these results, the amount of double stranded DNA was quantified in the lower

(“CSF”) compartment by PicoGreen assay in five independent experiments. The DNA was quantified

in three fractions: intracellular components, NET-associated components and free components. In all

analyzed fractions a distinct difference in the amount of DNA was detectable between infected and

uninfected samples (Fig. 3D-F). Importantly, the percentage of NET-associated DNA to the total DNA

amount was nearly the same in the filters infected with the different strains: The wildtype and double

mutant infected compartments had mean values for the NET-associated DNA of showing 47% and

51%, respectively, and no significant differences (Fig. 3G). In conclusion, no differences were

recorded in the percentage of NET-releasing neutrophils and the NET-associated DNA after

transmigration of neutrophils through the choroid plexus epithelium infected with wildtype or the

different DNase mutants. These results suggest that neither SsnA nor EndAsuis are efficiently

degrading NETs in the „CSF compartment”.

Results

53

Bacterial transmigration into and survival in the lower „CSF compartment” is independent of

SsnA and EndAsuis .

Determination of bacterial load in the lower „CSF compartment” after 2 and 6 hours revealed

comparable values for the wildtype and the DNase mutants in the experiment without neutrophils (Fig.

4A) and after transmigration of neutrophils (Fig. 4B). In addition, at the end of the experiment the

CFU in the lower „CSF compartment” was nearly the same with or without the addition of neutrophils

(Fig. 4). These results suggest that the DNase mutants are neither attenuated in transmigration through

the choroid plexus epithelium nor in survival (and growth) in the lower „CSF compartment”.

LL-37 expression in human choroid plexus epithelial cells and transmigrating neutrophils.

The host antimicrobial peptide LL-37 has recently been shown to stabilize NETs against bacterial

nuclease degradation (Neumann et al., 2014). Furthermore, it was demonstrated that choroid plexus

epithelial cells in rats produce the rat-homologue of LL-37 (rCRAMP) after S. pneumoniae infection

and that LL-37 is detectable in CSF and serum samples from patients with acute meningitis

(Brandenburg et al., 2008). Therefore, we hypothesized that LL-37 might protect NETs against

degradation by the S. suis DNases in the described BCSFB model. Immunofluorescence microscopy

using an anti-LL-37 antibody revealed a strong LL-37 signal associated with the transmigrating

neutrophils (Fig. 5A): Co-staining of LL-37 and myeloperoxidase (MPO) demonstrated that LL-37 is

located in close proximity to MPO-containing neutrophils (Fig. 5B). By real time PCR experiments we

analyzed the transcript expression of LL-37 in the transmigrated neutrophils as well as the cell layer.

LL-37 transcript expression was not significantly changed in neutrophils after transmigration upon

infection with S. suis wt or TNFα stimulation (Fig. 6A). No change of LL-37 transcript expression was

also observed in non-transmigrated neutrophils infected with S. suis wt or stimulated with TNFα (Fig.

6B). Besides neutrophils, it is also known that epithelial cells produce LL-37 as a chemo-attractant for

neutrophils after bacterial invasion (Zanetti, 2005). Thus, we additionally analysed LL-37 transcript

expression in HIBCPPs cells. As seen in Fig. 6C, HIBCPPs infected with S. suis wt or stimulated with

TNFα and transmigrated neutrophils show a clear CT value indicating transcript expression of LL-37.

It is reasonable to assume that this signal derived from HIBCPPs itself, but it cannot be excluded that

this signal partially derives - despite washing the filters- from nesting neutrophils on the plexus

epithelial cell layer. In contrast in the HIBCPP cells with non-transmigrated neutrophils, directly

added to the „CSF compartment”, no CT value was measured after 40 cycles (Fig. 6C). In summary

these data indicate that transmigration of neutrophils through the S. suis-infected choroid plexus

epithelium results in higher expression of LL-37.

Results

54

DISCUSSION

Our data show for the first time that NETs are formed in the CSF compartment of infected S. suis

piglets (Fig. 1A). Until now, only little is known about NET-formation in body fluids with continued

fluxes like CSF or blood. Interestingly, in septic blood of mice, NET-formation was detectable in vivo

in the vasculature under flow conditions upon TLR-4-mediated activation of platelets that interact with

neutrophils (Clark et al., 2007). Next to the circulation in blood vessels and the lymphatic system, the

cerebrospinal fluid compartment is described as the third circulation (Cushing, 1914; Cushing, 1925),

but CSF exhibits only a pulsatile movement and a bulk flow is not detectable as seen in the blood

(Yamada, 2014; de Lahunta et al., 2015). This study includes to the best of our knowledge for the first

time in vivo data depicting NETs in CSF drawn from animals with bacterial meningitis (Fig. 1A).

Furthermore, we screened CSF samples of S. suis-infected piglets for DNase activity. Importantly,

CSF from S. suis-infected piglets exhibited a strong DNase activity (Fig. 1B). As S. suis DNases SsnA

and EndAsuis were shown to degrade NETs induced by PMA (de Buhr et al., 2014; de Buhr et al.,

2015), we analysed the activity of both DNases in CSF. In accordance with loss of DNA degradation

in S. suis ΔssnA incubated with CSF spiked with DNA, SsnA dependent DNase activity was also

detected in the CSF of a S. suis-infected piglet (Fig. 1D). Nevertheless, the overall function of SsnA

for the pathogenesis of S. suis meningitis is not well understood. Here we additionally found that S.

suis grows independent of SsnA in the CSF (Fig. S3). However, we cannot exclude that besides SsnA

also EndAsuis or host nucleases are present and contributing to the phenotype. It is known, that host

DNases are found in the CSF in meningitis patients (Kovacs, 1954)

The choroid plexus is described as an entry gate for immune cells to the CNS (Wilson et al., 2010;

Meeker et al., 2012) and histopathological examinations of experimentally infected piglets suggest the

BCSFB as an entry gate for S. suis (Sanford, 1987; Williams and Blakemore, 1990; Madsen et al.,

2002). Here, we were interested whether neutrophils form NETs after transmigration through this

barrier infected with S. suis. Thus, we investigated NETosis in a S. suis-infected CSF compartment

using a modified inverse model of human BCSFB (Schwerk et al., 2012). The model described by

Schwerk et al. (2012) was modified removing the medium including non-transmigrated bacteria prior

to addition of neutrophils. This modification was necessary for the establishment of a protocol without

antibiotics. Furthermore, removal of the liquid in the upper compartment ensures that neutrophils

interact mainly with streptococci after breaching the activated choroid plexus epithelial barrier.

Importantly, NETs with fibres were detectable in all S. suis-infected „CSF compartments” of the

BCSFB model and trapped bacteria were found inside these structures (Fig. 3A). Control experiments

revealed that neutrophils incubated in 1% FBS medium alone do not exhibit increased NETosis level

(Fig. S4). Thus, our results indicate that plexus epithelial cells and/or bacteria induce formation of

NETs in our model. S. suis has already previously been shown by us to induce NETs (de Buhr et al.,

2015). Furthermore, HIBCPP might release IL-8 and TNFα during PMN transmigration and after

Results

55

infection, which are both well known as NET-inducers (Brinkmann, 2004; Steinmann et al., 2013).

Surprisingly, the NET-releasing cells and the percentage of NET-associated DNA in the „CSF

compartment” did not significantly differ between cells infected with S. suis wildtype and the different

nuclease mutants (Fig. 3), Despite the fact that a S. suis-mediated DNase activity in the used 1% FBS

cell culture medium was detectable (Fig. S5). Furthermore, the quantitative recovery of streptococci

from the „CSF compartment” was independent of the strain and the presence or absence of neutrophils

(Fig. 4). This is in contrast to our previous results, showing SsnA-mediated evasion of antimicrobial

NET activity by its degradation (de Buhr et al., 2014). Thus, we hypothesize that the NETs in the

„CSF compartment” are somehow protected against degradation by streptococcal nuclease.

Recently, the antimicrobial peptide LL-37 was identified as a NET stabilizing factor preventing the

degradation of NETs by bacterial nucleases (Neumann et al., 2014). Interestingly, we were able to

detect LL-37 positive neutrophils nesting on the plexus epithelial barrier during the in vitro

experiments (Fig. 5). Thus, it may be hypothesized, that LL-37 is highly produced by the

transmigrating neutrophils or released by plexus epithelial cells. This might contribute to stabilization

of NETs against S. suis nuclease. In good correlation to this hypothesis, increased transcript

expression of epithelial cell barrier after transmigration of neutrophils was detected (Fig. 6). One

important function of LL-37 in the S. suis-infected CSF compartment might be the protection of NETs

against bacterial degradation. Such an overexpression of LL-37 might explain the described lack of

phenotype of the DNase mutants in interaction with NETs in the lower compartment.

Besides LL-37, also other antimicrobial peptides like β-defensins are described to induce formation of

NETs and/or to stabilize NETs against bacterial nucleases (Neumann, et al., 2014; Neumann et al.,

2014). β -defensins are also expressed by the choroid plexus and may also contribute to the phenotype

shown here (Nakayama et al., 1999; Kraemer et al., 2011; Williams et al., 2012).

In conclusion, we demonstrated for the first time the formation of NETs in neutrophils following S.

suis through the choroid plexus epithelium in vitro. This “NETosis” in the „CSF compartment” was

associated with entrapment of streptococci and in accordance with NET structures detected in the CSF

of piglets with S. suis meningitis in vivo. Interestingly, SsnA activity in CSF was detectable, but

attenuation of the isogenic ssnA mutant in survival in the “CSF compartment” was not recorded in the

presence of NETs in the in vitro model.

Besides their antimicrobial effect NETs have been shown to also exhibit detrimental effects when

released upon infections, especially when the host is not able to eliminate NETs by its own nucleases

(Hakkim et al., 2010). As an example, neurotoxic effects for NETs are described (Allen et al., 2012).

Further, in the course of sepsis the injury of endothelium and tissues by platelet TLR-4 activated NETs

was demonstrated (Clark et al., 2007). However, our study shows for the first time that NETs are

formed in CSF upon infection and provides evidence for the formation of NETs by neutrophils

breaching the choroid plexus epithelium when encountering S. suis in the CSF compartment. Still,

Results

56

future studies are needed to evaluate the overall role of NET-formation in the CSF for bacterial

survival and/or immobilization and finally its contribution to the pathogenesis of meningitis in vivo.

METHODS

Bacterial strains and growth conditions.

S. suis strain 10 is a virulent serotype 2 strain that has been used by different groups for mutagenesis

and experimental infections of pigs (Smith et al., 1999; Baums et al., 2006; Baums et al., 2009;

Baums and Valentin-Weigand, 2009). In addition to the wildtype, three knock out mutants were used:

S. suis strain 10ssnA (de Buhr et al., 2014), strain 10endAsuis and strain 10endAsuisssnA (de

Buhr et al., 2015), designated as ssnA, endAsuis and endAsuisssnA or in the figures of this

paper, respectively. Streptococci were grown on Columbia agar plates with 6% sheep blood or in

BactoTM

Todd Hewitt broth (THB).

Animal experiments.

The analyzed samples (cerebrospinal fluid) drawn from experimentally infected piglets immediately

after euthanasia were collected within a study conducted for other reasons (Seele et al., 2015). The

protocol for this animal experiment was approved by the Committee on Animal Experiments of the

Lower Saxonian State Office for Consumer Protection and Food Safety (Niedersächsisches Landesamt

für Verbraucherschutz und Lebensmittelsicherheit [LAVES]; permit no. 33.14-42502-04-12/0965).

This study was conducted in strict accordance with the principles outlined in the EU Directive

2010/63/EU (http://ec.europa.eu/environment/ chemicals/lab animals/legislation en.htm) and the

German Animal Protection Law (Tierschutzgesetz).

Purification of porcine neutrophils.

In our institute the blood collection from healthy piglets is registered at the Lower Saxonian State

Office for Consumer Protection and Food Safety (Niedersächsisches Landesamt für

Verbraucherschutz und

Lebensmittelsicherheit) under no. 33.9-42502-05-11A137, and was performed in line with the

recommendations of the German Society for Laboratory Animal Science (Gesellschaft für

Versuchstierkunde) and the German Veterinary Association for the Protection of Animals

(Tierärztliche Vereinigung für Tierschutz e.V.) (http://www.gv-solas.de). Purification of porcine

neutrophils was conducted from heparinized blood as previously described with Ficoll Hypaque 1077

(Biochrom) and hypotonic lysis of erythrocytes (Benga et al., 2008).

Results

57

Purification of human neutrophils.

Neutrophils were isolated from fresh blood of healthy donors with the PolymorphPrep system (Axis

Shield) as previously described (Köckritz-Blickwede et al., 2010) and resuspended in RPMI 1640

(without phenolred, PAA).

DNase activity in CSF.

The DNase activities of CSF from healthy and diseased pigs were tested by mixing 1 µg calf thymus

DNA (Sigma) as substrate and 30 µl of CSF. This suspension was incubated for 22 h at 37°C. Visual

examination of DNA was conducted after 1 % agarose gel electrophoresis and staining of DNA with

Roti®Safe (Gelstain ready-to-use, Roth).

Nuclease assay with calf thymus DNA in CSF.

Bacterial nuclease activity leading to degradation of eukaryotic DNA in CSF was determined using

calf thymus DNA as substrate. Therefore, 2 µg calf thymus DNA (Sigma) was added to 35µl CSF of

healthy piglets and mixed with 35 µl of a bacteria suspension. This suspension was made of bacteria

grown to an OD600nm of 0.6, centrifuged (2600 x g, 5 minutes), washed twice with PBS and adjusted to

an OD600nm of 1.0 with PBS. Samples were incubated for 4 h at 37°C. Visual examination of DNA was

conducted as described before.

DNase activity inhibition in CSF with an antiserum against rSsnA.

The inhibition of DNase activity in 35 µl CSF of piglet 9884 was conducted by a 1 h pre incubation on

a rotator with 3.5 µl polyclonal rabbit serum raised against rSsnA (Gómez-Gascón et al., 2012). As

control CSF was incubated with rabbit pre-immune serum. Furthermore, CSF samples inoculated with

S. suis wt or 10endAsuisssnA to monitor bacterial growth (see below) were used as control. All

samples were supplemented with 1 µg calf thymus DNA (Sigma) after the pre-incubation. This

suspension was incubated for 24 h at 37°C. Visual examination of DNA was conducted as described

above.

Determination of bacterial growth in CSF of piglets.

To analyze bacterial growth in CSF, bacteria from overnight cultures were pelleted via centrifugation

(2600 x g, 5 min) and washed twice with PBS. Bacteria were adjusted to OD600 0.2 and 10 µl of this

suspension were incubated in 1 ml CSF of healthy piglets at 37°C. The CFU was determined by

plating on blood agar plates.

Results

58

Cell culture.

We used a model of the BCSFB with human choroid plexus papilloma cells (HIBCPP), described and

characterized previously with modifications (Ishiwata et al., 2005; Schwerk et al., 2012). HIBCPP

were cultured in DMEM/HAM’s F12 1:1 (Invitrogen) supplemented with 100 µg/ml streptomycin,

100 U/ml penicillin, 4 mM L-glutamin, 5 µg/ml insulin and 15 % of heat inactivated fetal calf serum.

Cells were seeded with a density of 8 x 104 / filter and cultured for two days at 37°C and 8% CO2 on

flipped over trans-well filter inserts (pore diameter 3.0 μm, pore density 2.0 × 106 pores per cm

2,

growth area 0.33 cm2, Greiner Bio-one) in a medium-flooded 12-well plate. The filters were turned

into a 24-well plate and the cells were cultured for three further days. After reaching a transepithelial

electrical resistance (TEER) of 200Ω x cm², measured with volt-ohm meter using the Millicell-ERS

system (Millipore), the filters were washed in DMEM/F12 1:1 without phenolred (Invitrogen) and

antibiotics but containing 5 µg/ml insulin and 1% heat inactivated fetal calf serum (1% FBS media)

and cultured for up to two additional days before infection. At the day of infection the TEER was

between 330Ω x cm², and 530Ω x cm²,

and filters were put into fresh 1 % FBS media.

Determination of the specific bacterial load and DNase activity in the „CSF compartment” of the

BCSFB model.

For the establishment of a stable cell culture system after infection with bacteria the TEER was

measured at different time points. In addition paracellular permeability was measured with dextran-

TexasRed (MW 3000, Sigma) as previously described (Steinmann et al., 2013). The CFU in the lower

compartment was determined by plating dilutions on blood agar plates at different time points. For the

assessment of nuclease activity 2 µg calf thymus DNA (Sigma) was added to 50 µl supernatants and

incubated for 4 h at 37°C. Visual examination was conducted as described above.

Nuclease activity in cell culture medium.

To determine nuclease activity in the cell culture medium 2 µg calf thymus DNA (Sigma) was added

to 35 µl 1% FBS cell culture medium mixed with 35 µl of bacteria suspension. This suspension was

made of bacteria grown to an OD600nm of 0.6 and used as described previously. Samples were

incubated for 4 h at 37°C. Visual examination was conducted as described above.

NET induction in cell culture medium.

The NET induction of freshly isolated human neutrophils in presence of 1 % FBS cell culture medium

or RPMI was verified as previously described (de Buhr et al., 2014). Briefly, neutrophils were seeded

on poly-L-lysine-coated coverslips (12 mm, 1.5 thickness, neuVitro) and stimulated with 25 nM PMA

for 4 h at 37°C and 5 % CO2. As control neutrophils were incubated without PMA. Afterwards

samples were fixed with 4 % paraformaldehyde and NET-formation was visualized as described

below.

Results

59

Cell culture infection and transmigration assay.

For infection of the HIBCPP cell culture all filters were put into 1 ml fresh 1 % FBS medium and

infected with S. suis wt or one of the three mutants (MOI = 10) in 500µl 1 % FBS medium in the

blood (upper) compartment for 2 h at 37°C and 8 % CO2. Then, the blood compartment was emptied

and refilled with 500 µl 1 % FBS medium containing pure human neutrophils (MOI = 4) or only

medium and the plate was incubated for further 4 h. As indicated at different time points the CFU was

determined in the lower compartment and TEER was measured. For additional immunofluorescence

assays, poly-L-lysine coated glass coverslips (12 mm, 1.5 thickness, neuVitro) were inserted before

the infection into the lower compartment and the plate was centrifuged (250 x g, 8 min) at the end of

experiment. The supernatant from the CSF (lower) compartment was collected and the coverslips were

fixed with 4 % paraformaldehyde for later NET staining as described below. Furthermore, the

complete CSF compartment was harvested and the content was directly used for DNase activity tests

or immediately put into liquid nitrogen and stored at -80°C for later analysis. To distinguish between

NET / cell released, NET bound and intracellular components (Pico Green assay) the content of the

CSF compartment was centrifuged (500 x g, 10 min) and the supernatant was used untreated (released

components). The pellet was resuspended in 125µl HBSS and mixed with micrococcal nuclease (0.5

U/ml, Worthington) and incubated for 10 min at 37°C. The reaction was stopped with 5 mM EDTA

(pH = 8) and the sample again centrifuged (500 x g, 5 min). The supernatant was used in the assays

(NET bound components) and the pellet was resuspended in 125 µl HBSS and used in the subsequent

Picogreen assay (intracellular components). At the end of the experiment the filters were fixed 10 min

in 4% paraformaldehyde and washed in PBS three times.

Immunofluorescence in vivo and in vitro of NETs.

For the co-staining of NETs and bacteria (cell culture) a previously described protocol was used (de

Buhr et al., 2015). Briefly, samples were permeabilized and blocked. Then, the samples were

incubated with a mouse monoclonal-antibody against DNA/histone 1 (1:5000 in PBS containing 1 %

BSA and 0.05 % Tween-20¸ MAB3864, Millipore) for 1 h to visualize the NETs and a rabbit anti-S.

suis antibody (1:500) (Beineke et al., 2008). The secondary staining was performed using a goat anti-

rabbit Alexa 633-conjugated antibody (1: 500; Invitrogen) or a goat anti-mouse Alexa 488-conjugated

antibody (1: 500; Invitrogen). After washing, all coverslips were embedded in ProLong® Gold antifade

reagent with DAPI (Invitrogen). For the NET staining, in vivo CSF samples were stained with a

monoclonal antibody against histone H2A-H2B-DNA complex as previously described (Berends et

al., 2010). Briefly, after blocking and permeabilization, neutrophils were incubated over night at 4°C

with a mouse monoclonal antibody against DNA/histone 1 (1:5000 in PBS containing 2% BSA, 0.2%

Triton X-100; MAB3864, Millipore). An Alexa 488-conjugated goat anti-mouse antibody (diluted

1:1000 in PBS containing 2 % BSA, 0.2 % Triton X-100; Thermo Scientific) was used as secondary

Results

60

antibody.

Samples were recorded using a Leica TCS SP5 confocal inverted-base fluorescence microscope with a

HCX PL APO 40× 0.75-1.25 oil immersion objective. Settings were adjusted with control preparations

using an isotype control antibody. For each sample in the cell culture assay, 13 randomly selected

images per independent experiment were acquired and used for quantification of the neutrophil

number and the induced neutrophils (Fig. S2). For each sample in the in vivo detection of NETs in

CSF all slides were screened completely for NET-releasing neutrophils.

Pico Green assay.

For quantification of NETs a spectrofluorometric method was conducted using the Quant-iTTM

Picogreen® dsDNA kit (Invitrogen) as previously described (von Köckritz-Blickwede et al., 2010).

Filter immunostaining of LL-37.

After washing the filters the membrane was removed and stained for LL-37. In general, the filters

were stained in 250 µl and washed in 500 µl liquid floating. The filters were blocked and

permeabilized for 60 min in PBS containing 10% goat serum and 0.5% TritonX-100. Incubation of

antibodies was conducted in PBS containing 2% BSA. The filters were incubated with a polyclonal

rabbit-anti-LL-37 antibody (1:300, Richard Gallo) or a polyclonal mouse-anti-LL-37 antibody (1:50,

Hycult biotech) combined with a polyclonal rabbit anti-MPO antibody (1:300, Dako) as indicated for

1 h at room temperature. After washing steps as secondary antibody AlexaFluor 488 goat anti-rabbit

(1:1000, Invitrogen), AlexaFluor 488 goat anti-mouse (1:500, Molecular Probes) and AlexaFluor 633

goat anti-rabbit (1:500, Invitrogen) was used as indicated. Together with the secondary antibodies a

staining of the cytoskeleton with phalloidin Alexa 546 (1:100, Invitrogen) and the DNA with Hoechst

(1:250000, Invitrogen) was conducted for 45 min at room temperature. After staining, the filters were

washed and embedded in ProLong Gold antifade without DAPI (Invitrogen). Samples were recorded

as described above.

In vivo detection of NETs in CSF.

Experimental infected piglets showing clinical signs of meningitis or healthy piglets as control were

anesthetized with 2 mg azaperon (Stresnil; Janssen, Neuss, Germany)/kg intramuscularly and 10 mg

ketamine-hydrochloride (Ursotamin; Serumwerk, Bernburg, Germany)/kg intramuscularly. CSF

samples were drawn by puncture of the subarachnoidal space (lumbosacral or occipital) with a 21 G x

2'' 0,8 x 50 mm needle (FINE-JECT®, Henke Sass Wolf)) and collection in a 5 ml syringe (Norm-

Ject, Henke Sass Wolf). Immediately after harvest the cells were counted by using trypan blue and a

Neubauer chamber. The cells were seeded with an adjusted cell number of 2 x 105 cells / 100 µl on

poly-L-lysine-coated (0.01% solution for 20 min; Sigma Aldrich) coverslips (8 mm; Thermo

Scientific) in a 48 well plate (Nunc, Thermo Scientific) or in case of low cell numbers in a 96 well

Results

61

plate with glass bottom (Falcon, MatTek Corporation). If needed cells were diluted in Hank’s

Balanced Salt Solution (HBSS) without calcium and magnesium (GIBCO®). After seeding, the plate

was centrifuged at room temperature for 5 min (370 x g) followed by a fixation with 4 %

paraformaldehyde (PFA).

Real-time PCR from reverse transcribed RNA extracted from neutrophils and HIBCPPs.

RNA was extracted from neutrophils and HIBCPPs with the RNeasy Micro Kit (Quiagen) as described

in the user’s manual. For the neutrophil RNA preparation three samples were pooled per experiment.

Real-time PCR of reverse transcribed RNA (qRT-PCR) was designed to analyze expression of ll-37

gene and the housekeeping gene gapdh. The respective primers are listed in Table S1. The qRT-PCR

was conducted as previously described (Willenborg et al., 2011) with the following modified program:

initial denaturation at 95 °C for 20 min and at least 45 cycles of denaturation at 95 °C for 25 s,

annealing at 55 °C for 30 s, and amplification at 72 °C for 20 s. Products were verified by melting

curve analysis and 1.5% agarose gel electrophoresis. Data were normalized to a non-regulated

housekeeping gene (gapdh). The relative CT values were determined for expression of the ll-37

gene. CT is the cycle number at the chosen amplification threshold, CT=CT gene (ll-37 – CT Reference (gapdh)

and CT=CT sample -CT Calibrator. The fold change in expression (2-CT

) was calculated as the read-

out parameter. In case of the PMNs the calibrator was non-transmigrated neutrophils with contact to

the cell layer. For the analysis of the HIBCPPs the calibrator is a cell layer with 4 h contact to non-

transmigrated neutrophils in the ”CSF compartment”.

Statistical analysis.

Data were analyzed by using Excel 2010 (Microsoft) and GraphPad Prism 5.0 (GraphPad Software).

Normal distribution of data was verified by Kolmogorov Smirnov normality test (GraphPad software)

prior to statistical analysis. Differences between two groups were analyzed by using a one-tailed

paired Student’s t-test in case of normal distributed data. Analysis of more than one group was

conducted by one-way ANOVA using Dunnett’s or Tukey’s multiple comparison test. Probabilities

lower than 0.05 were considered significant, lower or equal than 0.1 as statistically noticeable.

ACKNOWLEDGEMENTS

Both senior authors (Maren von Köckritz-Blickwede and Christoph G. Baums) contributed equally to

this work. We thank H. Smith (DLO-Lelystad, Netherlands) for S. suis strain 10. We thank Kristin

Laarmann (University of Veterinary Medicine Hannover, Germany) for her technical assistance and

Tina Basler (University of Veterinary Medicine Hannover, Germany) for supporting qRT-PCR

analysis. We also acknowledge Lydia Gómez-Gascón and Immaculada Luque (both Universidad de

Results

62

Córdoba, Spain) for providing the rabbit serum against SsnA. We thank Richard Gallo (University of

California San Diego, USA) for providing the rabbit serum against LL-37.

Nicole de Buhr was funded by a fellowship of the Ministry of Science and Culture of Lower Saxony

(Georg-Christoph-Lichtenberg Scholarship) within the framework of the PhD program "EWI-

Zoonosen" of the Hannover Graduate School for Veterinary Pathobiology, Neuroinfectiology, and

Translational Medicine (HGNI). Ariane Neumann was funded by a fellowship of the Akademie für

Tiergesundheit (AfT) and a fellowship from the PhD-program "Animal and Zoonotic Infections" of

the HGNI. This project was supported by the Niedersachsen-Research Network on Neuroinfectiology

(N-RENNT) of the Ministry of Science and Culture of Lower Saxony.

REFERENCES

Allen, C., Thornton, P., Denes, A., McColl, B.W., Pierozynski, A., Monestier, M., et al. (2012) Neutrophil

Cerebrovascular Transmigration Triggers Rapid Neurotoxicity through Release of Proteases Associated with

Decondensed DNA. J Immunol 189: 381–392.

Baums, C.G., Kaim, U., Fulde, M., Ramachandran, G., Goethe, R., and Valentin-Weigand, P. (2006)

Identification of a Novel Virulence Determinant with Serum Opacification Activity in Streptococcus suis. Infect

Immun 74: 6154–6162.

Baums, C.G., Kock, C., Beineke, A., Bennecke, K., Goethe, R., Schroder, C., et al. (2009) Streptococcus suis

Bacterin and Subunit Vaccine Immunogenicities and Protective Efficacies against Serotypes 2 and 9. Clin

Vaccine Immunol 16: 200–208.

Baums, C.G., and Valentin-Weigand, P. (2009) Surface-associated and secreted factors of Streptococcus suis

in epidemiology, pathogenesis and vaccine development. Anim Heal Res Rev 10: 65–83.

Beineke, A., Bennecke, K., Neis, C., Schröder, C., Waldmann, K.-H., Baumgärtner, W., et al. (2008)

Comparative evaluation of virulence and pathology of Streptococcus suis serotypes 2 and 9 in experimentally

infected growers. Vet Microbiol 128: 423–430.

Benga, L., Fulde, M., Neis, C., Goethe, R., and Valentin-Weigand, P. (2008) Polysaccharide capsule and

suilysin contribute to extracellular survival of Streptococcus suis co-cultivated with primary porcine phagocytes.

Vet Microbiol 132: 211–219.

Berends, E.T.M., Horswill, A.R., Haste, N.M., Monestier, M., Nizet, V., and von Köckritz-Blickwede, M.

(2010) Nuclease Expression by Staphylococcus aureus Facilitates Escape from Neutrophil Extracellular Traps. J

Innate Immun 2: 576–586.

Brandenburg, L.-O., Varoga, D., Nicolaeva, N., Leib, S.L., Wilms, H., Podschun, R., et al. (2008) Role of

Glial Cells in the Functional Expression of LL-37/Rat Cathelin-Related Antimicrobial Peptide in Meningitis. J

Neuropathol Exp Neurol 67: 1041–1054.

Brinkmann, V. (2004) Neutrophil Extracellular Traps Kill Bacteria. Science (80- ) 303: 1532–1535.

Charland, N., Nizet, V., Rubens, C.E., Kim, K.S., Lacouture, S., and Gottschalk, M. (2000) Streptococcus suis

Serotype 2 Interactions with Human Brain Microvascular Endothelial Cells. Infect Immun 68: 637–643.

Clark, S.R., Ma, A.C., Tavener, S. a, McDonald, B., Goodarzi, Z., Kelly, M.M., et al. (2007) Platelet TLR4

activates neutrophil extracellular traps to ensnare bacteria in septic blood. Nat Med 13: 463–469.

Cushing, H. (1914) Studies on the Cerebro-Spinal Fluid : I. Introduction. J Med Res 31: 1–19.

Cushing, H. (1925) Cameron Lectures. Lancet 206: 956–962.

de Buhr, N., Neumann, A., Jerjomiceva, N., von Köckritz-Blickwede, M. , and Baums, C.G. (2014)

Streptococcus suis DNase SsnA contributes to degradation of neutrophil extracellular traps (NETs) and evasion

of NET-mediated antimicrobial activity. Microbiology 160: 385–395.

de Buhr, N., Stehr, M., Neumann, A., Naim, H.Y., Valentin-Weigand, P., von Köckritz-Blickwede, M., and

Baums, C.G. (2015) Identification of a novel DNase of Streptococcus suis (EndAsuis) important for neutrophil

extracellular trap degradation during exponential growth. Microbiology 161: 838–850.

Results

63

Fuchs, T.A., Abed, U., Goosmann, C., Hurwitz, R., Schulze, I., Wahn, V., et al. (2007) Novel cell death

program leads to neutrophil extracellular traps. J Cell Biol 176: 231–241.

Gómez-Gascón, L., Luque, I., Olaya-Abril, A., Jiménez-Munguía, I., Orbegozo-Medina, R.A., Peralbo, E.,

et al. (2012) Exploring the pan-surfome of Streptococcus suis: Looking for common protein antigens. J

Proteomics 75: 5654–5666.

Gottschalk, M. (2012) Streptococcosis. In Diseases of swine. Wiley-Blackwell, pp. 841– 855. Edited by J. J.

Zimmerman, L. A. Kar.

Hakkim, A., Furnrohr, B.G., Amann, K., Laube, B., Abed, U.A., Brinkmann, V., et al. (2010) Impairment

of neutrophil extracellular trap degradation is associated with lupus nephritis. Proc Natl Acad Sci 107: 9813–

9818.

Ishiwata, I., Ishiwata, C., Ishiwata, E., Sato, Y., Kiguchi, K., Tachibana, T., et al. (2005) Establishment and

characterization of a human malignant choroids plexus papilloma cell line (HIBCPP). Hum cell Off J Hum Cell

Res Soc 18: 67–72.

Kovacs, E. (1954) Nucleases in the cerebrospinal fluid. II. Desoxyribonuclease in health and disease. J Pediatr

45: 569–74.

Kraemer, B.F., Campbell, R. a., Schwertz, H., Cody, M.J., Franks, Z., Tolley, N.D., et al. (2011) Novel

Anti-bacterial Activities of β-defensin 1 in Human Platelets: Suppression of Pathogen Growth and Signaling of

Neutrophil Extracellular Trap Formation. PLoS Pathog 7: e1002355.

Lahunta, A. de, Glass, E., and Kent, M. (2015) Veterinary neuroanatomy and clinical neurology. Fourth Edi.,

Elsevier Saunders, St. Louis, MO.

Lun, Z.-R., Wang, Q.-P., Chen, X.-G., Li, A.-X., and Zhu, X.-Q. (2007) Streptococcus suis: an emerging

zoonotic pathogen. Lancet Infect Dis 7: 201–209.

Madsen, L.W., Svensmark, B., Elvestad, K., Aalbaek, B., and Jensen, H.E. (2002) Streptococcus suis

Serotype 2 Infection in Pigs: New Diagnostic and Pathogenetic Aspects. J Comp Pathol 126: 57–65.

Meeker, R.B., Williams, K., Killebrew, D. a., and Hudson, L.C. (2012) Cell trafficking through the choroid

plexus. Cell Adh Migr 6: 390–396.

Mocsai, A. (2013) Diverse novel functions of neutrophils in immunity, inflammation, and beyond. J Exp Med

210: 1283–1299.

Nakayama, K., Okamura, N., Arai, H., Sekizawa, K., and Sasaki, H. (1999) Expression of human β-

defensin-1 in the choroid plexus. Ann Neurol 45: 685–685.

Neumann, A., Völlger, L., Berends, E.T.M., Molhoek, E.M., Stapels, D.A.C., Midon, M., et al. (2014) Novel

Role of the Antimicrobial Peptide LL-37 in the Protection of Neutrophil Extracellular Traps against Degradation

by Bacterial Nucleases. J Innate Immun 6: 860–868.

Neumann, A., Berends, E.T.M., Nerlich, A., Molhoek, E.M., Gallo, R.L., Meerloo, T., et al. (2014) The

antimicrobial peptide LL-37 facilitates the formation of neutrophil extracellular traps. Biochem J 464: 3–11.

Norton, P.M., Rolph, C., Ward, P.N., Bentley, R.W., and Leigh, J.A. (1999) Epithelial invasion and cell lysis

by virulent strains of Streptococcus suis is enhanced by the presence of suilysin. FEMS Immunol Med Microbiol

26: 25–35.

Sanford, S.E. (1987) Gross and histopathological findings in unusual lesions caused by Streptococcus suis in

pigs. II. Central nervous system lesions. Can J Vet Res 51: 486–489.

Schwerk, C., Papandreou, T., Schuhmann, D., Nickol, L., Borkowski, J., Steinmann, U., et al. (2012) Polar

invasion and translocation of neisseria meningitidis and streptococcus suis in a novel human model of the blood-

cerebrospinal fluid barrier. PLoS One 7: e30069.

Seele, J., Hillermann, L.-M., Beineke, A., Seitz, M., Pawel-Rammingen, U. von, Valentin-Weigand, P., and

Baums, C.G. (2015) The immunoglobulin M-degrading enzyme of Streptococcus suis, IdeSsuis, is a highly

protective antigen against serotype 2. Vaccine 33: 2207–2212.

Smith, H.E., Damman, M., Velde, J. Van Der, Wagenaar, F., Wisselink, H.J., Stockhofe-Zurwieden, N.,

and Smits, M.A. (1999) Identification and characterization of the cps locus of Streptococcus suis serotype 2:

The capsule protects against phagocytosis and is an important virulence factor. Infect Immun 67: 1750–1756.

Staats, J.J., Feder, I., Okwumabua, O., and Chengappa, M.M. (1997) Streptococcus suis: Past and present.

Vet Res Commun 21: 381–407.

Steinberg, B.E., and Grinstein, S. (2007) Unconventional roles of the NADPH oxidase: signaling, ion

homeostasis, and cell death. Sci STKE 2007: pe11.

Results

64

Steinmann, U., Borkowski, J., Wolburg, H., Schröppel, B., Findeisen, P., Weiss, C., et al. (2013) ALT

Transmigration of polymorphnuclear neutrophils and monocytes through the human blood-cerebrospinal fluid

barrier after bacterial infection in vitro. J Neuroinflammation 10: 31.

Straw, B.E., Zimmermann, J.J., D’Allaire, S., and Taylor, D.J. (2006) Diseases of swine. 9th ed., Wiley-

Blackwell, Ames Iowa.

Tenenbaum, T., Papandreou, T., Gellrich, D., Friedrichs, U., Seibt, A., Adam, R., et al. (2009) Polar

bacterial invasion and translocation of Streptococcus suis across the blood-cerebrospinal fluid barrier in vitro.

Cell Microbiol 11: 323–336.

von Köckritz-Blickwede, M., Chow, O., Ghochani, M., and Nizet, V. (2010) Visualization and functional

evaluation of phagocyte extracellular traps. Methods Microbiol 37: 139–160.

Wei, Z., Li, R., Zhang, A., He, H., Hua, Y., Xia, J., et al. (2009) Characterization of Streptococcus suis

isolates from the diseased pigs in China between 2003 and 2007. Vet Microbiol 137: 196–201.

Williams, A.E., and Blakemore, W.F. (1990) Pathogenesis of Meningitis Caused by Streptococcus suis Type 2.

J Infect Dis 162: 474–481.

Williams, W.M., Castellani, R.J., Weinberg, A., Perry, G., and Smith, M. a. (2012) Do β-Defensins and

Other Antimicrobial Peptides Play a Role in Neuroimmune Function and Neurodegeneration? Sci World J 2012:

1–11.

Wilson, E.H., Weninger, W., and Hunter, C. a (2010) Science in medicine Trafficking of immune cells in the

central nervous system. J Clin Invest 120: 1368–1379.

Wisselink, H.J., Smith, H.E., Stockhofe-Zurwieden, N., Peperkamp, K., and Vecht, U. (2000) Distribution

of capsular types and production of muramidase-released protein (MRP) and extracellular factor (EF) of

Streptococcus suis strains isolated from diseased pigs in seven European countries. Vet Microbiol 74: 237–248.

Yamada, S. (2014) Cerebrospinal fluid physiology: visualization of cerebrospinal fluid dynamics using the

magnetic resonance imaging Time-Spatial Inversion Pulse method. Croat Med J 55: 337–346.

Zanetti, M. (2005) The role of cathelicidins in the innate host defenses of mammals. Curr Issues Mol Biol 7:

179–196.

Results

65

SUPPLEMENTARY MATERIAL

Supplementary Table S1 Oligonucleotide primers used in qRT-PCR

Fig. S1: CSF sampeling does not induce NETosis.

The influence on NET-induction by the CSF sampling method in the animal experiment was imitated

with an in vitro sampeling of blood derived porcine neutrophils. This experiment was conducted to

exclude, that the sampling method of CSF induce NETosis. Firstly neutrophils were adjusted in CSF

of healthy piglets to 2 x 105 cells/ ml. Secondly the neutrophils were seeded on glasslips directly or

after drawing up into a syringe with two different needles used in the animal experiment. The

activation of neutrophils was analysed by immunofluorescence microscopy. In two independent

experiments per sample 4 coverslips were analysed with 3 pictures each. In total per run 12 pictures

were analysed. 12 to 18 % of the neutrophils were NET releasing in all sampling methods. The results

of A and B were generated from two independent experiments.

Gene Primer sequence (5´-3´) forward Primer sequence (5´-3´) reverse Amplicon

length (bp)

gapdh GGTCATCCATGACAACTTTGG CCAAATTCGTTGTCATACCAGG 471

ll-37 TGGTTGAGGGTCACTGTCCCC GCCCAGGTCCTCAGCTACAAG 260

A

B

Results

66

Fig. S2: Target-method and sample pictures.

The black circle with the red dots represents a coverslip and the spots where pictures were generated

by the target-method to get representative pictures per one coverslip. For each coverslip 13 pictures

were made spread over the full size of the coverslip. One example result of 13 pictures demonstrates

the wide range of neutrophils and the area of NETs or the NET releasing neutrophils.

Results

67

Fig. S3: The isogenic S. suis mutants 10ΔssnA, 10ΔendAsuis and 10ΔendAsuisΔssnA are not

attenuated in growth in porcine CSF in vitro.

To determine if the growth of S. suis in CSF is influenced by the mutations, growth experiments were

conducted. The specific bacterial contents (CFU/µl) were determined at the indicated time points. All

strains show similar growth behavior. All data are shown as mean ± SD of four independent

experiments.

Results

68

Fig. S4: NET formation in presence of 1% FBS cell culture medium is possible.

As a control, that neutrophils could be activated and release NETs in presence of the cell culture

medium (DMEM/F12 1:1 without phenolred, Invitrogen) containing 1% FBS, human neutrophils were

stimulated with PMA in presence of different media. Compared to RPMI and cell culture media

without FBS the neutrophils were activated in a same amount after 4h of PMA stimulation. In addition

in the absence of PMA the number of activated neutrophils was low (Fig. S3 A, B). The NET

B

C D

A

Results

69

formation in presence of 1% FBS cell culture medium was quantified by immunofluorescence

microscopy in comparison to RPMI and 0% FBS cell culture medium. In all three media a PMA

stimulation was conducted and compared to an unstimulated group. Per experiment 2 coverslips with 3

pictures each were analysed. A and B showing the results of two independent experiments and the

legend in A also applies to B. C and D are representative pictures of neutrophils incubated in 1% FBS

cell culture medium without PMA stimulation (C) and with PMA stimulation (D).

Fig. S5: Bacterial associated DNase activity is detectable in cell culture medium.

DNase activity of whole washed bacteria harvested at exponential growth phase (OD600nm of 0.6) in

presence of 1% FBS cell culture medium (DMEM/F12 1:1 without phenolred, Invitrogen). The

indicated S. suis strains were analysed by 1 % agarose gel electrophoresis after incubation of calf

thymus DNA for 4 h at 37°C. Bacteria were adjusted to the same OD in PBS and then mixed with the

medium. In all DNase assays, controls (ctr) were incubated with PBS. Panels show representative

examples of two independent experiments that all gave similar results.

General Discussion

70

4 General Discussion

S. suis can infect piglets as well as humans and the infection is often accompanied with CNS

disorders: severe meningitis is a typical diagnosed pathology. The S. suis meningitis is characterized

by a high number of neutrophils and pleocytosis is regarded as an indication for bacterial infection of

the CSF (Deisenhammer et al., 2006). In an acute bacterial meningitis up to 20000 cells per microliter

could be found and most of them are granulocytes (Dörner, 2001). Nevertheless, these high numbers

of neutrophils in the CNS together with the whole immune system are not always able to cope with the

infection and an antibiotic treatment is usually required. As neutrophils are described to undergo

different mechanisms to fight against pathogens, the question arises how S. suis is able to survive in

the presence of all these host defense mechanisms. As mentioned in the introduction the capsule

protects against phagocytosis (Charland et al., 1998; Smith et al., 1999) and lipoteichoic acid D-

alanylation helps the bacteria to evade neutrophil killing (Fittipaldi et al., 2008b). The survival of S.

suis in the CSF is not only influenced by factors of the pathogen but is also determined by the host.

Noteworthy, the opsonic and bactericidal activity of neutrophils is described to be suboptimal in the

CSF and phagocytosis seems to be inefficient (Tunkel & Scheld, 1993). However, besides

phagocytosis an additional fundamental innate immune defense mechanism of neutrophils has been

discovered, namely the formation of NETs. NETs are extracellular trap-like fibers of DNA and

histones which are able to entrap and occasionally kill various pathogens (Brinkmann, 2004; Fuchs et

al., 2007). Some pathogens were identified to degrade NETs by DNases and thus escape from NETs.

Especially in streptococci, numerous DNases have been identified and their role in degradation of

NETs was demonstrated [Chapter 1, Table 2]. Here, in the first two parts of the study S. suis DNases

were identified and their role in evasion of NETs analyzed [Chapter 3.1 and 3.2]. Comparing isogenic

mutants to the respective wildtype strain, the interaction of S. suis nucleases and NETs was

investigated. Further, the conditions for activity were defined [Chapter 3.1 and 3.2]. After the geno-

and phenotypical characterization of the isogenic mutants, this thesis focused on host-pathogen

interaction in the CSF compartment. Thus, general features of DNases as well as the role of the

DNases in this particular compartment were investigated [Chapter 3.3].

4.1 Investigation of NET evasion factors in S. suis

Two candidates of S. suis DNases were analyzed in the present study [Chapter 3.1 and 3.2]. The first

DNase SsnA was already previously described in the literature to exhibit magnesium and calcium

dependent activity (Fontaine et al., 2004). The second DNase analyzed in this study was identified

through functional analysis of an isogenic mutant in this study [Chapter 3.2]. This DNase, designated

EndAsuis, shows high homology to EndA of S. pneumoniae (Beiter et al., 2006). The functions of

DNases were tested first individually with respective isogenic constructed mutants and secondly by

construction of a double mutant to unravel possible synergistic effects [Chapter 3.1 and 3.2]. Both

General Discussion

71

DNases were able to degrade eukaryotic and bacterial DNA as well as NETs. However importantly,

both DNases are active under different and specific conditions and a synergistic effect was not

detectable. Thus, the respective growth dependent activity as well as biochemical conditions with

different pH and ion concentrations were analyzed. Interestingly, SsnA is upregulated and more active

in the stationary growth phase, whereas EndAsuis activity was only detectable in the exponential

growth phase. In addition, only SsnA is released and active in the supernatant. Depending on the ions

and pH value, differences in activity were recorded. The optimal condition for SsnA is in the presence

of 1.5 mM calcium and 1.5 mM magnesium at neutral pH. Conversely, EndAsuis is active in the

presence of just 1.5 mM magnesium at an acidic pH and is a membrane-bound DNase. The activity of

both DNases under different growth and biochemical conditions might be beneficial for S. suis, as this

invasive pathogen is confronted with different conditions in the course of infection in the different

body compartments. S. suis enters different environmental conditions upon breaching different barriers

of the host, as outlined in figure 4-1. One possible infection route of S. suis is from the upper

respiratory tract through the blood to the CNS (Gottschalk & Segura, 2000). Accordingly, expression

of the capsule is thought to be regulated dependent on the environmental conditions during the

infection. It was discussed that S. suis downregulates capsule expression at the beginning of an

infection and therefore the adhesion on epithelial cells is increased. After entering the bloodstream S.

suis upregulates capsule expression and the capsule protects effectively against phagocytosis

(Gottschalk & Segura, 2000). Regarding the nuclease activity, it may also be hypothesized that the

different nucleases might act at different sites of the body to evade the host innate immune defense

against the infection. As an example, the in vivo function of EndA of S. pneumoniae was demonstrated

in murine lung tissue after intranasal infection. Thus, the authors suggested, that EndA promotes the

bacterial spreading from local sites to the lung and from there to the bloodstream by degrading NETs

(Beiter et al., 2006). Interestingly, in this present work [Chapter 3.2] it was demonstrated that

EndAsuis is also able to efficiently degrade NETs. The findings about the biochemical conditions and

growth phase for activity of EndAsuis leads to the hypothesis that EndAsuis is involved in the early

part of S. suis infection in the upper respiratory tract. The upper respiratory tract is described as a

possible entry for S. suis in the course of an infection. As mentioned above, the downregulation of

capsule for enhanced adhesion to the epithelium, the low pH (< 7.0) of the nasal mucus and the airway

surface liquid of the upper respiratory tract may constitute conditions for good EndAsuis-mediated

NET escape. As the investigation of the respiratory tract was not part of this study, further studies are

needed to confirm this hypothesis. In addition, only little is known about how S. suis interacts with the

epithelial cell layer of the upper respiratory tract and invades the host during the course of an

infection.

General Discussion

72

Figure ‎4-1 Comparison of pH values of different human and porcine environments encountered by S. suis

The upper respiratory tract is covered in the nose with nasal mucus and then with an airway surface liquid. S.

suis is thought to cross the mucosal barrier, enter the bloodstream, proliferate in the blood and breach the blood-

CSF barrier in the pathogenesis of S. suis meningitis. a(Beule, 2010),

b(Bodem et al., 1983),

c (Moini, 2015),

d(Andrews et al., 1994),

e(Kandel et al., 2000),

f(Heinritzi & Schillinger, 1996).

After crossing the barriers of the upper respiratory tract, S. suis enters the blood and is exposed to

different environmental conditions in the course of tissue invasion. The nuclease deletion mutants

survived with similar efficiency compared to the wildtype in the blood of humans and piglets

(additional unpublished Figure 4-2). Therefore, it can be assumed that both investigated DNases play

no or only a subordinate role during bacteremia. However, Clark and colleagues first published the

detection of NETs in blood. This formation was detected in the course of sepsis after an infection with

E. coli (Clark et al., 2007) and S. suis can also lead to sepsis. Furthermore, circulation and replication

inside the blood is one-step in the pathogenesis of meningitis. Nevertheless, if NETs are involved in

the host defense against S. suis bacteremia is not known. Nevertheless, S. suis is able to cross the brain

barriers and to survive and replicate further in the CSF. In accordance with the pH in CSF, we were

only able to demonstrate an SsnA-dependent degradation in the presence of porcine CSF [Chapter

3.3]. However, as mentioned above this is maybe a reason why it is a benefit for S. suis to express at

least two different DNases. It can be hypothesized that S. suis is well equipped in different body

compartments with two DNases active under different conditions, which are both able to degrade

NETs.

General Discussion

73

In addition to NET degradation, an SsnA-mediated protection against neutrophil and NET-mediated

antimicrobial activity was demonstrated [Chapter 3.1]. This mediated protection was not observed for

EndAsuis.

As DNases are not only involved in degradation of NETs, both DNases that were investigated might

exhibit additional functions. For example Sda1 of S. pyogenes M1T1 was identified to degrade

bacterial DNA and to alter TLR-9-mediated recognition of S. pyogenes by immune cells (Uchiyama et

al., 2012). In the present study it was also shown that both S. suis DNases are able to degrade bacterial

DNA and therefore might play a role in modulating TLR-9 recognition. However, it was demonstrated

for nuclease A of Streptococcus agalactiae, that the availability of DNase does not automatically

negatively affect TLR-9-mediated activation of neutrophils (Derré-Bobillot et al., 2013). Possible

reasons for this are the fact that maybe additional cofactors are needed, or that the degradation of

bacterial DNA was not efficient enough. Currently, we can only speculate if SsnA or EndAsuis are

able to influence the TLR-9 dependent recognition of S. suis as further experiments need to be

conducted.

Figure ‎4-2 Expression of the two extracellular nucleases SsnA and EndAsuis by S. suis is not crucial for

survival in porcine and human blood.

Survival factors of S. suis wt and mutants in human (a) and porcine (b) blood ex vivo (freshly drawn heparinized

blood). C.f.u. was determined at t = 0 min, t = 60 min and t = 120 min. No significant differences between

survival factors of S. suis wt and mutants from stationary growth phase were observed. All data are shown as

mean ± SEM of three independent experiments; one-way ANOVA, Tukey’s multiple comparison test.

General Discussion

74

Multilocus sequence typing (MLST) analysis revealed that S. suis serotype 2 strains might belong to

different clonal complexes (King et al., 2002). The DNase activity in S. suis serotype 2 was

investigated in different sequence types (STs) by Haas and colleagues. Three major STs were part of

that study: ST 1, ST 25 and ST 28 (Haas et al., 2014). S. suis P1/7 used in the present study is ST 1.

The ST 25, which exhibits moderate virulence in mice, showed no DNase activity. Conversely, the

highly virulent (in mice and humans) ST 1 and the non-virulent (in mice) ST 28 showed DNase

activity (Fittipaldi et al., 2011; Haas et al., 2014). A comparative analysis of ssnA gene in the three

tested STs identified the loss of a 14 bp region in ST 25 resulting in an inactive truncated protein.

Furthermore, a mutant (M2D) derived from a bank of mutants was DNase-deficient and less virulent

in an amoeba model. By using a plasmid rescue procedure, it was found that the mutation was in the

ssnA gene. Macrophages stimulated with this mutant showed a decreased secretion of pro-

inflammatory cytokines and MMP9 in comparison to the wildtype. Therefore, DNase activity seems to

be beneficial for S. suis in the course of an infection, but not necessary since ST 25 shows moderate

virulence in the absence of DNase activity. It was hypothesized that SsnA may contribute to the

virulence of S. suis by increasing the inflammatory response (Haas et al., 2014). The results from

Chapter 3.1 demonstrated that SsnA is a NET evasion factor and protects against the antimicrobial

activity of NETs. Nevertheless, it can be speculated that SsnA is involved in other parts of the host-

pathogen interaction.

Induction of NETs by S. suis was for the first time demonstrated within the study described in Chapter

3.1 of this thesis (de Buhr et al., 2014). After this NET induction by three different S. suis strains was

also demonstrated by Zhao et al. 2015. They claimed that the capsule structure of S. suis serotype 2

strains plays a role in escaping NETs and the NET-associated killing. They based this statement on

experiments with an isogenic capsule mutant compared to different virulent strains with a capsule. A

non-phagocytic killing as well as a phagocytosis killing was significantly higher in the capsule mutant

compared to the wildtype strains. Furthermore, they showed that a significantly higher number of the

capsule mutant was trapped in NETs (Zhao et al., 2015). However, the authors did not prove if an

indirect effect of the capsule deletion could an explanation for these phenotypes. For example, the

expression and activity of SsnA or EndAsuis might be influenced. Therefore, further experiments

investigating DNase activity in the capsule mutant and the wildtype strains are crucial. Analysis of

gene regulation of ssnA and endAsuis in the mutant compared to the wildtype strains would also be

important. Furthermore, a determination of the c.f.u. in a classical NET-killing assay as described in

chapter 3.1 and 3.2 was not conducted. This assay is crucial for conclusions drawn on NET-killing or

NET-mediated antimicrobial activity. As these experiments are missing, it appears unjustified to state

that the capsule is a NET evading factor. However, it was demonstrated that the capsule of S.

pneumoniae protects against NET trapping in accordance with the study by Zhao and colleagues.

However, in contrast to the hypothesis of Zhao and colleagues, it was experimentally clearly

General Discussion

75

demonstrated that the pneumococcal capsule is not required for resistance to NET-mediated killing

(Wartha et al., 2007).

Additional to investigate whether the capsule of S. suis is a NET evading factor and required for

resistance to NET-mediated killing, in this thesis two factors involved in the host-pathogen interaction

have been identified. Taken together, the present study demonstrats that S. suis features at least two

DNases (SsnA and EndAsuis) active under different conditions. Considering CSF, only SsnA activity

was detectable. Further, both DNases degrade NETs, but only SsnA is active in the supernatant and

required for resistance to NET-mediated killing. This differential activity of the two nucleases could

be a benefit for S. suis and help to spread in the host during the course of an infection.

4.2 NETosis in the S. suis-infected CSF compartment In the third part of the study NETosis was studied in a model of the S. suis-infected CSF compartment.

To investigate the in vitro situation in the CSF compartment a modified model of the BCSFB was

used. Using cell culture models to identify host cell–pathogen interaction is a reproducible and valid

method, which helps to reduce numbers of experimental infected animals. This model facilitated the

analysis of the formation of NETs and the function of both S. suis DNases in a S. suis-infected CSF

compartment in more detail. Furthermore, experiments were designed without externally added NET

inducers to read out NETosis in neutrophils entering the infected CSF compartment. The roles of the

two DNases were investigated in an environment comprised by choroid plexus epithelium similar to

the CSF compartment of the host. Importantly, this study demonstrated NETosis in neutrophils

following S. suis through the choroid plexus epithelium for the first time [Chapter 3.3]. This NETosis

might be determined by induced cytokines and chemokines levels. The release of pro-inflammatory

cytokines and chemokines from human BMEC is induced after S. suis serotype 2 infection: IL-6, IL-8

and MCP-1 are released from BMEC after S. suis infection, whereas human umbilical vein endothelial

cells (HUVEC) were not affected by S. suis (Vadeboncoeur et al., 2003). Another group analyzed the

release of pro-inflammatory cytokines and chemokines of the porcine CPEC after S. suis infection in

an in vitro model (Schwerk et al., 2011). In this analyses Leukemia inhibitory factor (LIF), TNFα, IL-

6 and IL-8 were identified to be induced during the course of an S. suis infection. TNFα and IL-8 are

known as NET inducers (Brinkmann, 2004; Fuchs et al., 2007; Gupta et al., 2010; Keshari et al.,

2012), whereas nothing is known about LIF which was identified by microarray analyses of S. suis

infected porcine CPEC cells as highly upregulated. Interestingly, LIF is known to activate the Janus

kinase/signal transducer which is an activator of transcription (JAK/STAT) and the mitogen activated

protein kinase (MAPK) cascade (Suman et al., 2013). Furthermore the raf-MEK-ERK pathway, as

part of the MAPK cascade, is described to be involved in the NET release after IL-8 activation

(Hakkim et al., 2011). Therefore, LIF might also be involved in NET induction in the CSF

compartment, but further studies are needed to confirm this hypothesis. During the course of a CSF

b)

General Discussion

76

compartment infection, the changing conditions in cytokine and chemokine profiles might play a

decisive factor regarding NET induction.

As demonstrated in Chapter 3.1 and 3.2 both DNases are able to degrade NETs. SsnA is crucial for

bacterial survival during NETosis in vitro. Nevertheless in the cell culture experiments, neither

differences in the amount of NETs nor in bacterial loads were detectable when comparing wildtype

and mutant infected CSF compartments. One explanation could be that factors produced by the

transmigrated neutrophils or from the choroid plexus epithelium protect NETs against bacterial

DNases. Possible candidates are AMPs known as effector molecules of the innate immune system and

located in granules of phagocytes and on epithelial surfaces (Ganz, 2003; Zasloff, 2002). Recently, the

cathelicidin peptide LL-37 was described to induce NETs and protect them against degradation by

bacterial nucleases (Neumann et al., 2014a, b). LL-37 is stored as a pre-pro-peptide in the granula of

neutrophils and in other cells of the innate immune system (Agerberth et al., 1995; Cowland et al.,

1995; Guaní-Guerra et al., 2010; Di Nardo et al., 2003). Additionally, LL-37 is produced by other host

cells for example in epithelial cells of the urinary and respiratory tract, the choroid plexus epithelial

cells, colon enterocytes and keratinocytes (Bals et al., 1998; Brandenburg et al., 2008; Frohm et al.,

1997; Kim et al., 2003; Zasloff, 2006). After the enzymatic cleavage of the inactive propetide by

elastase or other proteases, a cathelin part and the C-terminal AMP LL-37, which is the active peptide,

is formed [Fig. 4-3].

During inflammation LL-37 is described to be induced in epithelial cells of the skin and the lung

(Frohm et al., 1997; Mendez-Samperio et al., 2008). Further, LL-37 activity was significantly higher

in CSF of patients with bacterial meningitis compared to the serum samples and CSF samples of

healthy patients or patients with virus infected CSF (Brandenburg et al., 2008). In the same study rat

cathelin-releated AMP was detected in choroid plexus, glia and ependymal cells by

immunohistochemistry in a meningitis model with infant rats. As discussed in Chapter 3.3, one role of

Figure ‎4-3 Structure and cleavage of LL-37

The location of the LL-37 gene on the human genome (chromosome 3) and the structure with protease cleavage

site between the conserved (signal & cathelin part) and variable domain (AMP) is illustrated.

General Discussion

77

LL-37 in the S. suis infected CSF compartment could be a protection of NETs against bacterial

DNases. LL-37 protects NETs against degradation by bacterial nuclease (Neumann et al., 2014b).

Immunofluorescence microscopy and realtime PCR analyses of the HIBCPP cells gave indications

that S. suis infection followed by neutrophil transmigration increased the LL-37 signal on protein and

mRNA level. Nevertheless, if the neutrophils and / or the HIBCPP cells produce LL-37 was not

clearly differentiated. Despite washing the filters with the HIBCPP cells, neutrophils are nesting on the

filter and might be responsible for the respective signal. Neumann and colleagues demonstrated further

that human β-defensin 3 (hBD-3), besides LL-37, protects host DNA against degradation by Staph.

aureus nuclease (Neumann et al., 2014b). These findings underline a possible neuroimmune function

of AMPs in the CNS. In a review in 2012 it was already discussed that β-defensins and other AMPs

are involved in neuroimmune function and neurodegeneration (Williams et al., 2012). Interestingly,

human β-defensin 1 and 2 (hBD-1 and hBD-2) are expressed in cells of the choroid plexus epithelium

and other cells of the brain in the course of inflammation (Hao et al., 2001; Nakayama et al., 1999). It

was suggested that hBD-1 is secreted into the CSF. Furthermore, Kraemer et al. showed that hBD-1 is

a NET inducer (Kraemer et al., 2011).

In another study, the bactericidal activity of porcine neutrophils was tested after PMA stimulation in

the supernatant in vitro. Porcine cathelicidin myeloid antimicrobial peptide 36 (PMAP-36) and

lactotransferrin were identified by mass spectrometry. However, in these supernatants only a non-

pathogenic E.coli K-12 strain was reduced in number. Other swine pathogens like S. suis were not

efficiently killed. The authors discussed that this is possibly due to the absence of neutrophils in this

experiment. (Scapinello et al., 2011).

Importantly, NETs with fibers were detected in CSF from piglets with a S. suis meningitis, but only at

a low level. The time point chosen for NET detection is crucial as the formation and degradation is a

flowing process. A suitable fixation in tissue and/ or body fluids and an intravital documentation needs

special techniques like the multiphoton microscopy. Numerous publications present data on NETosis

in vitro. For the understanding of the physiological and pathophysiological relevance of NETs in vivo

studies need to be conducted. An intravital record of NETs in atherosclerosis was described using two-

photon microscopy. NETs were visualized in this study after an intravenous injection of propidium

iodide, a viable cell impermeable DNA-binding dye, in monocyte-depleted Lysmegfp/egfp

Apoe-/-

mice

(Doring et al., 2012; Megens et al., 2012). In another study an in vivo documentation and

characterization of NETs was conducted using multiphoton microscopy in a mouse model (Tanaka et

al., 2014). Taking the two studies, an intravital NET detection was successful inside the carotid

bifurcation and in hepatic sinusoids of the liver, postcapillary venules of the cecum and pulmonary

capillaries of the lung. In the literature, data are also available about in vivo NET determination during

infection. The first in vivo detection was published in 2004 after analysis of tissue sections from

experimental shigellosis in rabbits and spontaneous appendicitis in humans by immunofluorescence

microscopy (Brinkmann, 2004). Furthermore, in vivo staining of NETs from mouse skin biopsies was

General Discussion

78

achieved after an infection with an sda1 deletion mutant of S. pyogenes M1, but not after infection

with the wildtype (Buchanan et al., 2006). After infection with S. pneumoniae a NET detection in

murine pneumococcal pneumoniae was successful (Beiter et al., 2006). Another study investigated

NETs and Staph. aureus nucleases and identified the presence of NETs decorated with AMPs in

Staph. aureus-infected lungs (Berends et al., 2010). In all aforementioned publications, NET detection

was possible, but NET fibers as found in in vitro experiments have not been demonstrated.

Yipp et al. made a groundbreaking study on the in vivo relevance of NETs in 2012. The authors

showed live imaging techniques of NET formation and revealed that neutrophils, after an acute

infection, induced NET release, are viable and are able to phagocytose and crawl. It was discussed that

a population of neutrophils in the early stage of infection retain the ability to multitask (Yipp et al.,

2012). Based on this and some other publications one year later, Yipp and Kubes discussed how vital

NETosis is. They named the two different mechanisms that lead to NETs the ‘suicidal’ and the ‘vital’

NETosis. The ‘suicidal’ NETosis is a synonym for the lytic NET release described in the introduction

[Chapter 1.3.1]. The ‘vital’ NETosis is in contrast characterized by the rapid release of NETs and the

possibility for the PMNs afterwards to phagocyte or degranulate (Yipp et al., 2012). A study by Clark

et al. (2007) showed that after LPS-stimulation, TLR-4-activated platelets induced NETs and after this

NET release the PMNs remain intact because the SYTOX Green access to the PMNs was restricted.

Independent of the study by Clark et al. a fast NET release was identified in an additional further

study. This NET release was TLR-2 and complement receptor 3 (CR 3) dependent. It was described as

a rapid (5-60 min) NET release by a vesicular mechanism. In contrast to the described lytic pathway,

the plasma membrane was not disrupted. Prior to NET release, the multilobular nucleus first became

quickly rounded and condensed. This process is followed by a degradation of the nuclear envelope and

after this only chromatin is visible in the cell center. Vesicles containing DNA concentrate near the

plasma membrane and then the NET release occurs. This mechanism is oxidant-independent, which is

in contrast to NET release by the cell lysis mechanism. Interestingly, this rapid NET release was

demonstrated after an induction by S. aureus and supernatants of overnight cultures containing factors

like Panton-Valentine leukocidin (Pilsczek et al., 2010; Yipp & Kubes, 2013; Yipp et al., 2012). In

addition a third mechanism of NET release is only poorly understood and described in one study as a

NET release by mitochondrial DNA (Yousefi et al., 2009). A schematic diagram illustrating cell lysis

(‘suicidal’) and vesicular (‘vital’) mechanism is given in Figure 4-4. No further distinctions were

made, for the in vitro as well as in vivo NETs detected in Chapter 3.3 in the CSF compartments. NET

inducers in the S. suis-infected CSF compartment could be the bacteria or interleukins and therefore

stimuli for ‘suicidal’ and ‘vital’ NETosis are present. The NET induction by S. suis was demonstrated

in Chapter 3.1 and 3.2 in vitro. Additionally, IL-8 is well described as a NET inducer (Brinkmann,

2004) and in two studies IL-8 was identified as a marker for an acute bacterial meningitis (Ostergaard

et al., 1996; Pinto Junior et al., 2011). In both studies, IL-8 was measured in patients with and without

bacterial meningitis and the values were compared to control groups higher. In the study by

General Discussion

79

Ostergaard et al., the mean IL-8 concentration was between 6-10 µg/l in septic meningitis. In aseptic

meningitis the IL-8 concentration was around 1.7 µg/l and in non-meningitis patients 0.03 µg/l.

Human neutrophils stimulated with 10 µg/l IL-8 for 30 minutes released the same amount of NETs as

neutrophils stimulated with 25 nm PMA in vitro (Gupta et al., 2005).

Figure ‎4-4 Steps in formation of NETs: ‘suicidal’ and ‘vital’ NETosis

a - e The ‘suicidal’ NETosis starts after a stimulation by e.g. PMA or IL-8. At the end of the oxygen dependent

protein kinase C (PKC) – raf-MEK-ERK pathway hydrogen peroxide is present (b). An oxygen independent

pathway via PAD4 is also possible (c). In both pathways the cytosol and the content of the nucleus mixes

together and after 3-4 h the outer membrane ruptures and a NET release into the extracellular space occurs. f - j

The ‘vital’ NETosis has been described to be rapid (5-60 min). It can be induced by a platelet TLR-4 activation

after interaction with CD11a on neutrophils or over complement receptor 3 (CR 3) and TLR-2 for Gram-positive

bacteria. The nucleus becomes rounded and decondensed (g) Vesicles with DNA are formed (h-i) and via

nuclear budding NETs are released (j). The outer membrane is intact at the end and an intact anuclear neutrophil

remains after NET release. MPO and NE are localized in the NETs structures.

General Discussion

80

Prior to this work, only little was known about NETs from porcine neutrophils, but here we have

proven the release of NETs by porcine neutrophils in Chapter 3.1. To compare our results with human

cells, we stimulated the porcine PMNs with the well-known stimulator PMA. Nevertheless, in our

hands different concentrations of PMA led only to NET release from a few porcine PMNs compared

to human PMNs. However as demonstrated in other animals, PMA is not always the best NET inducer

(Muñoz Caro et al., 2014; Silva et al., 2014). The reasons why neutrophils of different species might

be good or poorly stimulated by PMA are not clear. The present study includes in vivo detection of

NETs with NET fibers in S. suis-infected CSF of piglets, although DNase activity was detectable in

this compartment [Chapter 3.3]. An in vivo detection of NETs after infection of the CSF, which is a

fluid body compartment, was never described before. It is known from some studies that NETs are

also formed during the course of sepsis under fluid conditions in the blood (Clark et al., 2007).

A further interesting aspect is that the CSF compartment is part of an immune-privileged site in the

body (Shechter et al., 2013). The entry of immune cells to this site is strictly regulated by the three

brain barriers, and the function of neutrophils after crossing a barrier like the BCSFB is still poorly

understood. Taken together, the detection of NETs with fibers in vivo demonstrates that in general

porcine neutrophils can produce NETs in the immune-privileged CSF compartment during the course

of a S. suis infection. However, the mechanism leading to NET formation in this special compartment

was not investigated. Interestingly, blood derived neutrophils in the presence of CSF from healthy

piglets are blocked from forming in NETs [Fig. 4-5]. One explanation could be that components in the

CSF of healthy piglets suppress NET formation in general, because NETs are described to be toxic

and especially neurotoxic (Allen et al., 2012). The injury of endothelium and tissues was moreover

demonstrated by platelet TLR-4 activated NETs in the course of sepsis (Clark et al., 2007), and it was

suggested that epithelial cell damage is due to NET-bound proteases (Marin-Esteban et al., 2012). The

brain barriers might protect the CNS against these detrimental effects in the absence of infection

(Engelhardt & Coisne, 2011) by a limited entrance of immune cells. The few numbers of PMNs in

CSF of healthy animals are maybe guardians under control. However, one can only speculate if

transmigration of neutrophils through the BCSFB triggers the cells to form an extracellular trap. A

further aspect in the course of an infection of the CSF compartment is that the barriers break down and

infiltration occurs. In addition, chemokines and cytokines increase in the course of infection and some

are known as NET inducers. On the other hand factors that might block NET release in CSF of healthy

piglets are unknown. However, it is known that human immunodeficiency Virus-1 (HIV) blocks NET

release over CD 209 on dendritic cells. This leads to an IL-10 release and suggests suppression of the

NET release by certain interleukins (Saitoh et al., 2012). Interestingly in one study about cytokines in

CSF of humans, IL-10 was measured. The IL-10 value is around 10 pg/ml in CSF of healthy humans

(Peterson et al., 2015). Furthermore it was noted that IL-10 limits inflammation in the brain (Strle et

al., 2001). Therefore, it can be hypothesized, that IL-10 blocks NETosis in CSF of healthy individuals.

General Discussion

81

Taken together the published data lead to the hypothesis that the levels of different interleukins can

modulate neutrophils in the CSF compartment. Specific interleukins such as IL-10 might block NET

release in the uninfected CSF compartment and others such as IL-8 might induce NET release in the

course of septic meningitis. The amount of cytokines in the CSF compartment inducing NET could be

determined with analyses of cell culture used in chapter 3.3 as well as with CSF of S. suis infected

piglets. The established cell culture model could be used to understand the detailed function of the

detected NETs in the CSF compartment and the relevance for the host-pathogen interaction in the

course of CNS infections. One possible experiment to clarify this open question could be a

combination of cell culture with live cell immunofluorescence imaging in the CSF compartment. With

this combination, the time kinetics and interaction of neutrophils and S. suis in the CSF compartment

could be investigated after crossing the BCSFB. As such documentation is impossible in vivo, the

model established in this thesis allows questions about the specific host cell-pathogen interaction in

the infected CSF compartment to be answered. However, in vivo experiments are needed to clarify the

function and the role of both DNases in pathogenesis.

Figure ‎4-5 CSF of healthy piglets blocks NET release

The NET releasing cells of porcine blood derived neutrophils were determined by immunofluorescence

microscopy in presence of RPMI or CSF of healthy piglets. A stimulation was conducted with PMA, S. suis

wildtype (WT) or S. suis endAsuisssnA (ΔΔ) as indicated. A significant difference in NET releasing cells was

identified in RPMI by stimulation with PMA after 1 and 3 h (Fig. 6-3 a) and after stimulation with bacteria

comparing WT and mutant after 3 h (Fig. 6-3 b). In presence of CSF the percentage of NET releasing cells was

lower than in RPMI incubated samples and independent of the stimulus. All data are shown as mean ± SD of 3

independent experiments. Per experiment 2 coverslips with 3 pictures each were analysed. Statistical differences

were analysed by one-way paired Student’s t-Test (* p < 0.05, ** p < 0.005).

General Discussion

82

4.3 Concluding remarks

In this study the interaction of S. suis with NETs was investigated. S. suis induces NETs in porcine

and human neutrophils and expresses at least two DNases characterized in this study: SsnA and

EndAsuis [Chapter 3.1 and 3.2]. Both DNases degrade NETs, but only SsnA is active in the

supernatant and is crucial for a resistance against antimicrobial activity of NETs under the chosen

experimental conditions [Chapter 3.1]. The two characterized S. suis DNases are active under different

pH and ion conditions [Chapter 3.2]. The differences in DNase specific activity under variable

conditions might be important for this pathogen in order to cope with different environmental

conditions in the course of an infection. S. suis expresses SsnA and EndAsuis in the exponential

growth phase and mainly SsnA in the stationary growth phase.

EndAsuis functions similar to EndA of S. pneumoniae and the activity depends on the active center

(DRGH-motif). An analysis of rEndAsuis_H165G rescued through imidazol treatment and a 3D

structure modeling of EndAsuis demonstrated that the high amino acid identity and homology between

EndAsuis and EndA leads to structural similarity and similar functions [Chapter 3.2].

Expression of SsnA and EndAsuis is not crucial for growth in human and porcine blood as well as in

the CSF [Chapter 3.3 and 4.1]. Importantly, SsnA is released and active in the CSF during S. suis

infection of the meninges in piglets [Chapter 3.3].

Interestingly, NET formation with fibers occurs in S. suis-infected CSF compartments despite nuclease

activity [Chapter 3.3]. Accordingly, neutrophils form NETs after breaching the S. suis infected

BCSFB barrier in vitro. These NETs were shown to trap S. suis. Therefore, it was hypothesized that

NET formation functions as a host-defense mechanism against S. suis [Chapter 3.3].

The NET stabilizing factor LL-37 was visualized in close proximity to MPO-containing neutrophils

nesting on HIBCPP cells, which represent the BCSFB in the in vitro model. Realtime PCR analysis

showed an increase of LL-37 transcript expression in S. suis-infected HIBCPP cells compared to

uninfected cells [Chapter 3.3]. Thus, it is hypothesized that LL-37, produced by the CPECs and/ or the

transmigrating neutrophils, protect NETs in the S. suis-infected CSF compartment against S. suis

DNases.

Taken together this study revealed phenotypes of S. suis elicited by the expression of two DNases.

Degradation of NETs and protection against the antimicrobial activity of NETs are important SsnA-

mediated phenotypes involved in the interaction with human and porcine neutrophils. NETs are

formed in the S. suis infected CSF compartment and these NETs are able to trap bacteria. The role of

these NETs in protective immunity needs further investigation. The final concluding remarks are

illustrated in figure 4-6 and summarize the main findings of this project.

General Discussion

83

Figure ‎4-6 Illustration of the concluding remarks

[A] SsnA and EndAsuis are expressed by S. suis [B]. Distributing via the blood S. suis reaches the CSF by

crossing the choroid plexus [C]. In porcine CSF a SsnA activity was detectable. Further in vivo analysis

demonstrated NET formation in the S. suis infected CSF compartment of piglets in presence of DNase

activity [D]. Using an in vitro model of the BCSFB NET formation was detectable in the S. suis infected CSF

compartment, but both DNases do not lead to a benefit for the invading bacteria. However, in vitro

experiments with human and porcine neutrophils demonstrated a NET induction by S. suis, an entrapment of

S. suis and a degradation of NETs and eukaryotic DNA by SsnA as well as EndAsuis [F]. Green scissors =

EndAsuis, pink scissors = SsnA; D. BCSFB, E inverted cell culture system of the BSCFB: 1 blood [D] /

blood compartment [E], 2 CSF [D] / CSF compartment [E], 3 choroidal endothelium, 4 epithelial cells [D] /

human choroid plexus papilloma cells [E], 5 TJs, 6 filter membrane of insert, 7 S. suis, 8 neutrophil

granulocyte

Summary

84

5 Summary

Nicole de Buhr

Interaction of Streptococcus suis with neutrophil extracellular traps (NETs)

Streptococcus (S.) suis causes as infectious agent suppurative meningitis in humans and piglets, which

is characterized by a pleocytosis in the cerebrospinal fluid (CSF). In neutrophils, a novel fundamental

innate immune defense mechanism against different pathogens has been identified: the formation of

neutrophil extracellular traps (NETs). NETs are formed by neutrophils following extracellular ejection

of DNA in combination with antimicrobial molecules and bind, disarm and kill pathogens. Different

pathogens express NET evasion factors like DNases. NETs might play different roles in diseases and

the mechanisms leading to NET release are only poorly understood.

In this study, the interaction of S. suis and NETs was investigated using immunofluorescence

microscopy. Especially the function of two DNases was investigated. Phenotypic analysis was

conducted using in frame deletion mutants, which were investigated comparatively to the wildtype

under various conditions. Important phenotypes in the pathogen-host interaction were identified. In the

first part of this thesis [Chapter 3.1] it was demonstrated for the first time that S. suis induces NETs, is

entrapped in NETs and degrades NETs. Furthermore, this work revealed that the known secreted

nuclease A (SsnA) is involved in NET degradation and that this nuclease protects S. suis against the

antimicrobial activity of NETs. The second part [Chapter 3.2] includes the identification of a novel

endonuclease A of S. suis (EndAsuis), which is involved in NET degradation during the exponential

growth phase. EndAsuis was shown to require Mg2+

for activity whereas SsnA needed Mg2+

and Ca2+

.

In the third part [Chapter 3.3] NET formation in the S. suis-infected CSF compartment was examined.

In an inverse transwell model, human neutrophils followed S. suis by transmigration through the

epithelium formed by choroid plexus papilloma cells in the lower compartment, which represents the

CSF-compartment. Importantly, NETs were detected in the CSF compartment by immunofluorescence

microscopy and biochemical determination of dsDNA. Furthermore, it was visualized that streptococci

were entrapped in NETs. However, the number of detectable NETs and the bacterial survival did not

depend on the expression of the bacterial nucleases SsnA and EndAsuis. The detected induction of the

NET protecting factor LL-37 might explain this result. These in vitro results were corroborated by the

detection of NETs in CSF samples of S. suis infected piglets.

In conclusion, the results suggest that NET formation and degradation might play a role in the

pathogenesis of S. suis meningitis.

Zusammenfassung

85

6 Zusammenfassung

Nicole de Buhr

Interaktion von Streptococcus suis mit neutrophilen extrazellulären Netzen (NETs)

Streptococcus (S.) suis führt als Infektionserreger beim Schwein und Menschen zu eitrigen

Meningitiden, die mit einer Pleozytose im Liquor cerebrospinalis (CSF) einhergehen. In neutrophilen

Granulozyten wurde kürzlich ein grundlegender Abwehrmechanismus des angeboren Immunsystems

gegen verschiedene Pathogene entdeckt: die Formation von neutrophilen extrazellulären Netzen

(NETs). NETs werden von Neutrophilen durch den Ausstoß von DNA in Kombination mit

antimikrobiellen Molekülen gebildet und sind in der Lage Erreger zu binden, zu entschärfen und zu

töten. Verschiedene Erreger besitzen NETs Evasionsfaktoren wie DNasen. NETs spielen vermutlich

auch in verschiedenen Erkrankungen eine Rolle und die Mechanismen welche zur Freisetzung von

NETs führen sind bisher nur schlecht verstanden.

In dieser Studie wurde die Interaktion von S. suis und NETs mit unterschiedlichen, vor allem

immunfluoreszenzmikroskopischen Methoden untersucht. Dabei wurde insbesondere die Rolle und

Bedeutung von zwei DNasen beleuchtet. Durch eine phänotypische Analyse entsprechender in frame

Deletionsmutanten und des Wildtyps konnten wichtige Phänotypen in der Erreger-Wirt Interaktion

charakterisiert werden. Im ersten Teil dieser These [Kapitel 3.1] konnte zum ersten Mal gezeigt

werden, dass S. suis NETs induziert, in ihnen eingefangen wird und diese NETs degradiert. Die

sekretierte Nuklease A (SsnA) ist an der NETs Degradation beteiligt ist und schützt S. suis gegen

antimikrobielle Aktivitäten der NETs. Der zweite Teil der Arbeit [Kapitel 3.2] beinhaltet die

Identifikation einer neuen Endonuklease A von S. suis (EndAsuis), die an der NETs Degradation

währende der exponentiellen Wachstumsphase beteiligt ist. EndAsuis benötigt Mg2+

für die Aktivität

wohingegen SsnA Mg2+

und Ca2+

benötigt. Im dritten Teil der Arbeit [Kapitel 3.3] wurde die

Formation von NETs im S. suis-infizierten CSF untersucht. In einem inversen Transwell Modell

folgten humane neutrophile Granulozyten S. suis durch ein Epithel von Choroid Plexus Papilloma

Zellen in ein unteres Kompartiment, das dem CSF-Raum entspricht. In diesem Kompartiment konnten

NETs mittels Immunfluoreszenzmikroskopie und der Bestimmung von dsDNA nachgewiesen werden.

Ferner gelang der Nachweis, dass diese NETs S. suis einfangen. Die Anzahl der detektierbaren Netze

und das bakterielle Überleben waren unabhängig von der Expression der bakteriellen Nukleasen SsnA

und EndAsuis. Die beobachtete Induktion des NETs schützenden Faktors LL-37 könnte dieses

Ergebnis erklären. Diese in vitro Ergebnisse werden durch die Detektion von NETs in CSF Proben

von S. suis infizierten Tieren untermauert. Insgesamt sprechen die Ergebnisse für eine Bedeutung der

Bildung und Degradation von NETs in der Pathogenese der S. suis Meningitis.

Literature

86

7 Literature

Abdallah, D. S. A. & Denkers, E. Y. (2012). Neutrophils cast extracellular traps in response to protozoan

parasites. Front Immunol 3, 1–6.

Adam, R. a, Tenenbaum, T., Valentin-Weigand, P., Laryea, M., Schwahn, B., Angelow, S., Galla, H.-J.,

Daubener, W. & Schroten, H. (2004). Porcine Choroid Plexus Epithelial Cells Induce Streptococcus suis

Bacteriostasis In Vitro. Infect Immun 72, 3084–3087.

Agerberth, B., Gunne, H., Odeberg, J., Kogner, P., Boman, H. G. & Gudmundsson, G. H. (1995). FALL-

39, a putative human peptide antibiotic, is cysteine-free and expressed in bone marrow and testis. Proc

Natl Acad Sci 92, 195–199.

Allen, A. G., Bolitho, S., Lindsay, H., Khan, S., Bryant, C., Norton, P., Ward, P., Leigh, J., Morgan, J. &

other authors. (2001). Generation and Characterization of a Defined Mutant of Streptococcus suis

Lacking Suilysin. Infect Immun 69, 2732–2735.

Allen, C., Thornton, P., Denes, A., McColl, B. W., Pierozynski, A., Monestier, M., Pinteaux, E., Rothwell,

N. J. & Allan, S. M. (2012). Neutrophil Cerebrovascular Transmigration Triggers Rapid Neurotoxicity

through Release of Proteases Associated with Decondensed DNA. J Immunol 189, 381–392.

Amass, S. F., Sanmiguel, P. & Clark, L. K. (1997). Demonstration of vertical transmission of Streptococcus

suis in swine by genomic fingerprinting. J Clin Microbiol 35, 1595–1596.

Andrews, R. J., Bringas, J. R. & Alonzo, G. (1994). Cerebrospinal Fluid pH and PCO2 Rapidly Follow

Arterial Blood pH and PCO2 with Changes in Ventilation. Neurosurgery 34, 466–470.

Arber, W. & Linn, S. (1969). DNA Modification and Restriction. Annu Rev Biochem 38, 467–500.

Arends, J. P. & Zanen, H. C. (1988). Meningitis caused by Streptococcus suis in humans. Rev Infect Dis 10,

131–137.

Arends, J. P., Hartwig, N., Rudolphy, M. & Zanen, H. C. (1984). Carrier rate of Streptococcus suis capsular

type 2 in palatine tonsils of slaughtered pigs. J Clin Microbiol 20, 945–947.

Aulik, N. a., Hellenbrand, K. M., Klos, H. & Czuprynski, C. J. (2010). Mannheimia haemolytica and Its

Leukotoxin Cause Neutrophil Extracellular Trap Formation by Bovine Neutrophils. Infect Immun 78,

4454–4466.

Aziz, R. K., Ismail, S. a, Park, H.-W. & Kotb, M. (2004). Post-proteomic identification of a novel phage-

encoded streptodornase, Sda1, in invasive M1T1 Streptococcus pyogenes. Mol Microbiol 54, 184–197.

Bals, R., Wang, X., Zasloff, M. & Wilson, J. M. (1998). The peptide antibiotic LL-37/hCAP-18 is expressed in

epithelia of the human lung where it has broad antimicrobial activity at the airway surface. Proc Natl Acad

Sci 95, 9541–9546.

Bartneck, M., Keul, H. a., Zwadlo-Klarwasser, G. & Groll, J. (2010). Phagocytosis Independent

Extracellular Nanoparticle Clearance by Human Immune Cells. Nano Lett 10, 59–63.

Baums, C. G., Kaim, U., Fulde, M., Ramachandran, G., Goethe, R. & Valentin-Weigand, P. (2006). Identification of a Novel Virulence Determinant with Serum Opacification Activity in Streptococcus suis.

Infect Immun 74, 6154–6162.

Baums, C. G., Verkuhlen, G. J., Rehm, T., Silva, L. M. G., Beyerbach, M., Pohlmeyer, K. & Valentin-

Weigand, P. (2007). Prevalence of Streptococcus suis Genotypes in Wild Boars of Northwestern

Germany. Appl Environ Microbiol 73, 711–717.

Literature

87

Baums, C. G. & von Köckritz-Blickwede, M. (2015). Novel role of DNA in neutrophil extracellular traps.

Trends Microbiol 23, 330–331.

Baums, C. G. & Valentin-Weigand, P. (2009). Surface-associated and secreted factors of Streptococcus suis in

epidemiology, pathogenesis and vaccine development. Anim Heal Res Rev 10, 65–83. Cambridge

University Press.

Baums, C. G., Kock, C., Beineke, A., Bennecke, K., Goethe, R., Schroder, C., Waldmann, K.-H. &

Valentin-Weigand, P. (2009). Streptococcus suis Bacterin and Subunit Vaccine Immunogenicities and

Protective Efficacies against Serotypes 2 and 9. Clin Vaccine Immunol 16, 200–208.

Beineke, A., Bennecke, K., Neis, C., Schröder, C., Waldmann, K.-H., Baumgärtner, W., Valentin-

Weigand, P. & Baums, C. G. (2008). Comparative evaluation of virulence and pathology of

Streptococcus suis serotypes 2 and 9 in experimentally infected growers. Vet Microbiol 128, 423–430.

Beiter, K., Wartha, F., Albiger, B., Normark, S., Zychlinsky, A. & Henriques-Normark, B. (2006). An

Endonuclease Allows Streptococcus pneumoniae to Escape from Neutrophil Extracellular Traps. Curr Biol

16, 401–407.

Berends, E. T. M., Horswill, A. R., Haste, N. M., Monestier, M., Nizet, V. & von Köckritz-Blickwede, M. (2010). Nuclease Expression by Staphylococcus aureus Facilitates Escape from Neutrophil Extracellular

Traps. J Innate Immun 2, 576–586. S. Karger AG.

Bergé, M. J., Kamgoué, A., Martin, B., Polard, P., Campo, N. & Claverys, J.-P. (2013). Midcell

Recruitment of the DNA Uptake and Virulence Nuclease, EndA, for Pneumococcal Transformation. PLoS

Pathog 9, e1003596 (G. Dunny, Ed.).

Berthelot-Hérault, F., Gottschalk, M., Labbé, A., Cariolet, R. & Kobisch, M. (2001). Experimental airborne

transmission of Streptococcus suis capsular type 2 in pigs. Vet Microbiol 82, 69–80.

Beule, A. G. (2010). Physiology and pathophysiology of respiratory mucosa of the nose and the paranasal

sinuses. Laryngorhinootologie 89 S 01, S15–S34.

Blokesch, M. & Schoolnik, G. K. (2008). The Extracellular Nuclease Dns and Its Role in Natural

Transformation of Vibrio cholerae. J Bacteriol 190, 7232–7240.

Bodem, C. R., Lampton, L. M., Miller, D. P., Tarka, E. F. & Everett, E. D. (1983). Endobronchial pH.

Relevance of aminoglycoside activity in gram-negative bacillary pneumonia. Am Rev Respir Dis 127, 39–

41.

Bonifait, L. & Grenier, D. (2011). The SspA subtilisin-like protease of Streptococcus suis triggers a pro-

inflammatory response in macrophages through a non-proteolytic mechanism. BMC Microbiol 11, 47.

BioMed Central Ltd.

Borregaard, N. (2010). Neutrophils, from Marrow to Microbes. Immunity 33, 657–670. Elsevier Inc.

Brandenburg, L.-O., Varoga, D., Nicolaeva, N., Leib, S. L., Wilms, H., Podschun, R., Wruck, C. J.,

Schröder, J.-M., Pufe, T. & Lucius, R. (2008). Role of Glial Cells in the Functional Expression of LL-

37/Rat Cathelin-Related Antimicrobial Peptide in Meningitis. J Neuropathol Exp Neurol 67, 1041–1054.

Brinkmann, V. (2004). Neutrophil Extracellular Traps Kill Bacteria. Science (80- ) 303, 1532–1535.

Brinkmann, V. & Zychlinsky, A. (2012). Neutrophil extracellular traps: Is immunity the second function of

chromatin? J Cell Biol 198, 773–783.

Literature

88

Brogden, G., von Köckritz-Blickwede, M., Adamek, M., Reuner, F., Jung-Schroers, V., Naim, H. Y. &

Steinhagen, D. (2012). β-Glucan protects neutrophil extracellular traps against degradation by Aeromonas

hydrophila in carp (Cyprinus carpio). Fish Shellfish Immunol 33, 1060–1064.

Brogden, G., Krimmling, T., Adamek, M., Naim, H. Y., Steinhagen, D. & Von Köckritz-Blickwede, M. (2014). The effect of β-glucan on formation and functionality of neutrophil extracellular traps in carp

(Cyprinus carpio L.). Dev Comp Immunol 44, 280–285.

Broudy, T. B. (2002). The In Vitro Interaction of Streptococcus pyogenes with Human Pharyngeal Cells

Induces a Phage-Encoded Extracellular DNase. Infect Immun 70, 2805–2811.

Buchanan, J. T., Simpson, A. J., Aziz, R. K., Liu, G. Y., Kristian, S. a, Kotb, M., Feramisco, J. & Nizet, V. (2006). DNase Expression Allows the Pathogen Group A Streptococcus to Escape Killing in Neutrophil

Extracellular Traps. Curr Biol 16, 396–400.

Carlin, A. F., Uchiyama, S., Chang, Y.-C., Lewis, A. L., Nizet, V. & Varki, A. (2009). Molecular mimicry of

host sialylated glycans allows a bacterial pathogen to engage neutrophil Siglec-9 and dampen the innate

immune response. Blood 113, 3333–3336.

Casutt-Meyer, S., Renzi, F., Schmaler, M., Jann, N. J., Amstutz, M. & Cornelis, G. R. (2010). Oligomeric

Coiled-Coil Adhesin YadA Is a Double-Edged Sword. PLoS One 5, e15159 (S. Bereswill, Ed.).

Chamberlain, M. C. (2010). Neoplastic Meningitis. In Neuro-Oncology Blue Books Neurol Ser, pp. 333–351.

Edited by J. Rees & P. Y. Wen. Saunders Elsevier; ISBN: 978-0750675161.

Chang, A., Khemlani, A., Kang, H. & Proft, T. (2011). Functional analysis of Streptococcus pyogenes

nuclease A (SpnA), a novel group A streptococcal virulence factor. Mol Microbiol 79, 1629–1642.

Charland, N., Nizet, V., Rubens, C. E., Kim, K. S., Lacouture, S. & Gottschalk, M. (2000). Streptococcus

suis Serotype 2 Interactions with Human Brain Microvascular Endothelial Cells. Infect Immun 68, 637–

643.

Charland, N., Harel, J., Kobisch, M., Lacasse, S. & Gottschalk, M. (1998). Streptococcus suis serotype 2

mutants deficient in capsular expression. Microbiology 144, 325–332.

Chen, C., Tang, J., Dong, W., Wang, C., Feng, Y., Wang, J., Zheng, F., Pan, X., Liu, D. & other authors.

(2007). A Glimpse of Streptococcal Toxic Shock Syndrome from Comparative Genomics of S. suis 2

Chinese Isolates. PLoS One 2, e315 (R. Valdivia, Ed.).

Clark, S. R., Ma, A. C., Tavener, S. A., McDonald, B., Goodarzi, Z., Kelly, M. M., Patel, K. D.,

Chakrabarti, S., McAvoy, E. & other authors. (2007). Platelet TLR4 activates neutrophil extracellular

traps to ensnare bacteria in septic blood. Nat Med 13, 463–469. Nature Publishing Group.

Clifton-Hadley, F. & Alexander, T. (1980). The carrier site and carrier rate of Streptococcus suis type II in

pigs. Vet Rec 107, 40–41. BMJ Publishing Group Limited.

Cowland, J. B., Johnsen, A. H. & Borregaard, N. (1995). hCAP-18, a cathelin/pro-bactenecin-like protein of

human neutrophil specific granules. FEBS Lett 368, 173–176.

Darrah, E. & Andrade, F. (2013). NETs: the missing link between cell death and systemic autoimmune

diseases? Front Immunol 3, 1–18.

de Buhr, N., Neumann, A., Jerjomiceva, N., von Köckritz-Blickwede, M. & Baums, C. G. (2014). Streptococcus suis DNase SsnA contributes to degradation of neutrophil extracellular traps (NETs) and

evasion of NET-mediated antimicrobial activity. Microbiology 160, 385–395.

Literature

89

De Greeff, A., Buys, H., Verhaar, R., Dijkstra, J., Van Alphen, L. & Smith, H. E. (2002). Contribution of

fibronectin-binding protein to pathogenesis of Streptococcus suis serotype 2. Infect Immun 70, 1319–1325.

Deisenhammer, F., Bartos, A., Egg, R., Gilhus, N. E., Giovannoni, G., Rauer, S. & Sellebjerg, F. (2006). Guidelines on routine cerebrospinal fluid analysis. Report from an EFNS task force. Eur J Neurol 13, 913–

922.

Delbosc, S., Alsac, J.-M., Journe, C., Louedec, L., Castier, Y., Bonnaure-Mallet, M., Ruimy, R., Rossignol,

P., Bouchard, P. & other authors. (2011). Porphyromonas gingivalis Participates in Pathogenesis of

Human Abdominal Aortic Aneurysm by Neutrophil Activation. Proof of Concept in Rats. PLoS One 6,

e18679 (P. H. Reitsma, Ed.).

Derré-Bobillot, A., Cortes-Perez, N. G., Yamamoto, Y., Kharrat, P., Couvé, E., Da Cunha, V., Decker, P.,

Boissier, M., Escartin, F. & other authors. (2013). Nuclease A (Gbs0661), an extracellular nuclease of

Streptococcus agalactiae , attacks the neutrophil extracellular traps and is needed for full virulence. Mol

Microbiol 89, 518–531.

Di Nardo, A., Vitiello, A. & Gallo, R. L. (2003). Cutting Edge: Mast Cell Antimicrobial Activity Is Mediated

by Expression of Cathelicidin Antimicrobial Peptide. J Immunol 170, 2274–2278.

Doring, Y., Manthey, H. D., Drechsler, M., Lievens, D., Megens, R. T. a, Soehnlein, O., Busch, M., Manca,

M., Koenen, R. R. & other authors. (2012). Auto-Antigenic Protein-DNA Complexes Stimulate

Plasmacytoid Dendritic Cells to Promote Atherosclerosis. Circulation 125, 1673–1683.

Dörner, K. (2001). Klinische Chemie und Hämatologie, Forth Edit. Stuttgart, Germany: Thieme Verlag; ISBN:

3-13-129714-X

Engelhardt, B. & Coisne, C. (2011). Fluids and barriers of the CNS establish immune privilege by confining

immune surveillance to a two-walled castle moat surrounding the CNS castle. Fluids Barriers CNS 8, 4.

BioMed Central Ltd.

Engelhardt, B. & Ransohoff, R. M. (2012). Capture, crawl, cross: the T cell code to breach the blood–brain

barriers. Trends Immunol 33, 579–589. Elsevier Ltd.

Epand, R. M. & Vogel, H. J. (1999). Diversity of antimicrobial peptides and their mechanisms of action.

Biochim Biophys Acta - Biomembr 1462, 11–28.

Fadeel, B., Ahlin, A., Henter, J. I., Orrenius, S. & Hampton, M. B. (1998). Involvement of caspases in

neutrophil apoptosis: regulation by reactive oxygen species. Blood 92, 4808–4818.

Faustoferri, R. C., Hahn, K., Weiss, K. & Quivey, R. G. (2005). Smx Nuclease Is the Major, Low-pH-

Inducible Apurinic/Apyrimidinic Endonuclease in Streptococcus mutans. J Bacteriol 187, 2705–2714.

Ferrando, M., de Greeff, A., van Rooijen, W., Smith, H. & Schultsz, C. (2015). Host-pathogen interaction at

the intestinal mucosa correlates with zoonotic potential of Streptococcus suis. J Infect Dis 212, 95–105.

Fittipaldi, N., Sekizaki, T., Takamatsu, D., de la Cruz Domínguez-Punaro, M., Harel, J., Bui, N. K.,

Vollmer, W. & Gottschalk, M. (2008a). Significant contribution of the pgdA gene to the virulence of

Streptococcus suis. Mol Microbiol 70, 1120–1135.

Fittipaldi, N., Sekizaki, T., Takamatsu, D., Harel, J., Dominguez-Punaro, M. d. l. C., Von Aulock, S.,

Draing, C., Marois, C., Kobisch, M. & Gottschalk, M. (2008b). D-Alanylation of Lipoteichoic Acid

Contributes to the Virulence of Streptococcus suis. Infect Immun 76, 3587–3594.

Fittipaldi, N., Xu, J., Lacouture, S., Tharavichitkul, P., Osaki, M., Sekizaki, T., Takamatsu, D. &

Gottschalk, M. (2011). Lineage and virulence of Streptococcus suis serotype 2 isolates from North

America. Emerg Infect Dis 17, 2239–2244.

Literature

90

Fittipaldi, N., Segura, M., Grenier, D. & Gottschalk, M. (2012). Virulence factors involved in the

pathogenesis of the infection caused by the swine pathogen and zoonotic agent Streptococcus suis. Future

Microbiol 7, 259–279.

Fontaine, M. C., Perez-Casal, J. & Willson, P. J. (2004). Investigation of a Novel DNase of Streptococcus

suis Serotype 2. Infect Immun 72, 774–781.

Foreman, A., Boase, S., Psaltis, A. & Wormald, P.-J. (2012). Role of Bacterial and Fungal Biofilms in

Chronic Rhinosinusitis. Curr Allergy Asthma Rep 12, 127–135.

Fox, S., Leitch, A. E., Duffin, R., Haslett, C. & Rossi, A. G. (2010). Neutrophil apoptosis: Relevance to the

innate immune response and inflammatory disease. J Innate Immun 2, 216–227.

Frohm, M., Agerberth, B., Ahangari, G., Stahle-Backdahl, M., Liden, S., Wigzell, H. & Gudmundsson, G.

H. (1997). The Expression of the Gene Coding for the Antibacterial Peptide LL-37 Is Induced in Human

Keratinocytes during Inflammatory Disorders. J Biol Chem 272, 15258–15263.

Fuchs, T. A., Abed, U., Goosmann, C., Hurwitz, R., Schulze, I., Wahn, V., Weinrauch, Y., Brinkmann, V.

& Zychlinsky, A. (2007). Novel cell death program leads to neutrophil extracellular traps. J Cell Biol 176,

231–241.

Ganz, T. (2003). Defensins: antimicrobial peptides of innate immunity. Nat Rev Immunol 3, 710–720.

Garcia-Romo, G. S., Caielli, S., Vega, B., Connolly, J., Allantaz, F., Xu, Z., Punaro, M., Baisch, J.,

Guiducci, C. & other authors. (2011). Netting Neutrophils Are Major Inducers of Type I IFN Production

in Pediatric Systemic Lupus Erythematosus. Sci Transl Med 3, 73ra20–73ra20.

Glimåker, M., Olcén, P. & Andersson, B. (1994). Interferon-gamma in cerebrospinal fluid from patients with

viral and bacterial meningitis. Scand J Infect Dis 26, 141–147.

Gómez-Gascón, L., Cardoso-Toset, F., Amarilla, P. S., Tarradas, C., Carrasco, L., Olaya-Abril, A.,

Jiménez-Munguía, I., Rodríguez-Ortega, M. J. & Luque, I. (2014). A new recombinant SsnA protein

combined with aluminum hydroxide protects mouse against Streptococcus suis. Vaccine 32, 6992–6999.

Elsevier Ltd.

Gottschalk, M. (2012). Streptococcosis. In Dis swine, pp. 841– 855. Edited by J. J. Zimmerman, L. A. Kar.

Wiley-Blackwell; ISBN: 081381703X.

Gottschalk, M. & Segura, M. (2000). The pathogenesis of the meningitis caused by Streptococcus suis: the

unresolved questions. Vet Microbiol 76, 259–272.

Gottschalk, M., Xu, J., Calzas, C. & Segura, M. (2010). Streptococcus suis : a new emerging or an old

neglected zoonotic pathogen? Future Microbiol 5, 371–391.

Goyette-Desjardins, G., Auger, J.-P., Xu, J., Segura, M. & Gottschalk, M. (2014). Streptococcus suis, an

important pig pathogen and emerging zoonotic agent—an update on the worldwide distribution based on

serotyping and sequence typing. Emerg Microbes Infect 3, e45.

Grinberg, N., Elazar, S., Rosenshine, I. & Shpigel, N. Y. (2008). β-Hydroxybutyrate Abrogates Formation of

Bovine Neutrophil Extracellular Traps and Bactericidal Activity against Mammary Pathogenic Escherichia

coli. Infect Immun 76, 2802–2807.

Guaní-Guerra, E., Santos-Mendoza, T., Lugo-Reyes, S. O. & Terán, L. M. (2010). Antimicrobial peptides:

General overview and clinical implications in human health and disease. Clin Immunol 135, 1–11. Elsevier

Inc.

Literature

91

Guarner, J., Greer, P. W., Whitney, A., Shieh, W.-J., Fischer, M., White, E. H., Carlone, G. M., Stephens,

D. S., Popovic, T. & Zaki, S. R. (2004). Pathogenesis and Diagnosis of Human Meningococcal Disease

Using Immunohistochemical and PCR Assays. Am J Clin Pathol 122, 754–764.

Guimaraes-Costa, A. B., DeSouza-Vieira, T. S., Paletta-Silva, R., Freitas-Mesquita, A. L., Meyer-

Fernandes, J. R. & Saraiva, E. M. (2014). 3’-Nucleotidase/Nuclease Activity Allows Leishmania

Parasites To Escape Killing by Neutrophil Extracellular Traps. Infect Immun 82, 1732–1740.

Guimarães-Costa, A. B., Nascimento, M. T. C., Wardini, A. B., Pinto-da-Silva, L. H. & Saraiva, E. M. (2012). ETosis: A Microbicidal Mechanism beyond Cell Death. J Parasitol Res 2012, 1–11.

Gupta, A. K., Hasler, P., Holzgreve, W., Gebhardt, S. & Hahn, S. (2005). Induction of Neutrophil

Extracellular DNA Lattices by Placental Microparticles and IL-8 and Their Presence in Preeclampsia. Hum

Immunol 66, 1146–1154.

Gupta, A. K., Joshi, M. B., Philippova, M., Erne, P., Hasler, P., Hahn, S. & Resink, T. J. (2010). Activated

endothelial cells induce neutrophil extracellular traps and are susceptible to NETosis-mediated cell death.

FEBS Lett 584, 3193–3197. Federation of European Biochemical Societies.

Haas, B., Bonifait, L., Vaillancourt, K., Charette, S. J., Gottschalk, M. & Grenier, D. (2014). Characterization of DNase activity and gene in Streptococcus suis and evidence for a role as virulence

factor. BMC Res Notes 7, 424.

Hacker, J. & Heesemann, J. (2000). Molekulare Infektionsbiologie. Springer Spektrum; ISBN: 978-3-642-

39456-0.

Hakkim, A., Furnrohr, B. G., Amann, K., Laube, B., Abed, U. A., Brinkmann, V., Herrmann, M., Voll, R.

E. & Zychlinsky, A. (2010). Impairment of neutrophil extracellular trap degradation is associated with

lupus nephritis. Proc Natl Acad Sci 107, 9813–9818.

Hakkim, A., Fuchs, T. A., Martinez, N. E., Hess, S., Prinz, H., Zychlinsky, A. & Waldmann, H. (2011). Activation of the Raf-MEK-ERK pathway is required for neutrophil extracellular trap formation. Nat

Chem Biol 7, 75–77. Nature Publishing Group, a division of Macmillan Publishers Limited.

Hallett, J. M., Leitch, A. E., Riley, N. a., Duffin, R., Haslett, C. & Rossi, A. G. (2008). Novel

pharmacological strategies for driving inflammatory cell apoptosis and enhancing the resolution of

inflammation. Trends Pharmacol Sci 29, 250–257.

Hao, H.-N., Zhao, J., Lotoczky, G., Grever, W. E. & Lyman, W. D. (2001). Induction of human β-defensin-2

expression in human astrocytes by lipopolysaccharide and cytokines. J Neurochem 77, 1027–1035.

Hasegawa, T., Minami, M., Okamoto, A., Tatsuno, I., Isaka, M. & Ohta, M. (2010). Characterization of a

virulence-associated and cell-wall-located DNase of Streptococcus pyogenes. Microbiology 156, 184–90.

Heinritzi, K. & Schillinger, S. (1996). The cerebrospinal fluid from healthy pigs and pigs with central nervous

system diseases. Tierarztl Prax 24, 359–367.

Higgins, R., Gottschalk, M., Mittal, K. R. & Beaudoin, M. (1990). Streptococcus suis infection in swine. A

sixteen month study. Can J Vet Res 54, 170–173.

Huber, D., Balda, M. S. & Matter, K. (2000). Occludin Modulates Transepithelial Migration of Neutrophils. J

Biol Chem 275, 5773–5778.

Jacobs, A. a C., Loeffen, P. L. W., Van den Berg, A. J. G. & Storm, P. K. (1994). Identification, purification,

and characterization of a thiol-activated hemolysin (suilysin) of Streptococcus suis. Infect Immun 62,

1742–1748.

Literature

92

Janeway, C., Murphy, K., Traver, P. & Walport, M. (2009). Immunologie, 7. edn. Spektrum Akademischer

Verlag, Heidelberg; ISBN: 978-3-662-44228-9.

Juneau, R. a., Pang, B., Weimer, K. E. D., Armbruster, C. E. & Swords, W. E. (2011). Nontypeable

Haemophilus influenzae Initiates Formation of Neutrophil Extracellular Traps. Infect Immun 79, 431–438.

Juneau, R. A., Pang, B., Armbruster, C. E., Murrah, K. A., Perez, A. C. & Swords, W. E. (2015a). Peroxiredoxin-Glutaredoxin and Catalase Promote Resistance of Nontypeable Haemophilus influenzae 86-

028NP to Oxidants and Survival within Neutrophil Extracellular Traps. Infect Immun 83, 239–246 (B. A.

McCormick, Ed.).

Juneau, R. A., Stevens, J. S., Apicella, M. A. & Criss, A. K. (2015b). A Thermonuclease of Neisseria

gonorrhoeae Enhances Bacterial Escape From Killing by Neutrophil Extracellular Traps. J Infect Dis 212,

316–324.

Kamoshida, G., Kikuchi-Ueda, T., Tansho-Nagakawa, S., Nakano, R., Nakano, A., Kikuchi, H., Ubagai, T.

& Ono, Y. (2015). Acinetobacter baumannii escape from neutrophil extracellular traps (NETs). J Infect

Chemother 21, 43–49. Elsevier Ltd.

Kandel, E. R., Schwartz, J. H. & Jessell, T. (2000). Principles of Neural Science, fourth Edi. Mcgraw-Hill

Publ.Comp; ISBN: 978-0838577011.

Keshari, R. S., Jyoti, A., Dubey, M., Kothari, N., Kohli, M., Bogra, J., Barthwal, M. K. & Dikshit, M. (2012). Cytokines Induced Neutrophil Extracellular Traps Formation: Implication for the Inflammatory

Disease Condition. PLoS One 7, e48111 (C. Benarafa, Ed.).

Khatua, B., Bhattacharya, K. & Mandal, C. (2012). Sialoglycoproteins adsorbed by Pseudomonas aeruginosa

facilitate their survival by impeding neutrophil extracellular trap through siglec-9. J Leukoc Biol 91, 641–

655.

Kim, K. S. (2003). Neurological diseases: Pathogenesis of bacterial meningitis: from bacteraemia to neuronal

injury. Nat Rev Neurosci 4, 376–385.

Kim, S. T., Cha, H. E., Kim, D. Y., Han, G. C., Chung, Y.-S., Young, J. L., Hwang, Y. J. & Lee, H.-M. (2003). Antimicrobial Peptide LL-37 is Upregulated in Chronic Nasal Inflammatory Disease. Acta

Otolaryngol 123, 81–85.

King, S. J., Leigh, J. a., Heath, P. J., Luque, I., Tarradas, C., Dowson, C. G. & Whatmore, A. M. (2002). Development of a Multilocus Sequence Typing Scheme for the Pig Pathogen Streptococcus suis:

Identification of Virulent Clones and Potential Capsular Serotype Exchange. J Clin Microbiol 40, 3671–

3680.

Knight, J. S. & Kaplan, M. J. (2012). Lupus neutrophils: ‘NET’ gain in understanding lupus pathogenesis.

Curr Opin Rheumatol 24, 441–450.

Knight, J. S., Carmona-Rivera, C. & Kaplan, M. J. (2012). Proteins derived from neutrophil extracellular

traps may serve as self-antigens and mediate organ damage in autoimmune diseases. Front Immunol 3, 1–

12.

Kolaczkowska, E. & Kubes, P. (2013). Neutrophil recruitment and function in health and inflammation. Nat

Rev Immunol 13, 159–175. Nature Publishing Group.

Kornelisse, R. F., Hack, C. E., Savelkoul, H. F. J., Van der Pouw Kraan, T. C. T. M., Hop, W. C. J., Van

Mierlo, G., Suur, M. H., Neijens, H. J. & De Groot, R. (1997). Intrathecal production of interleukin-12

and gamma interferon in patients with bacterial meningitis. Infect Immun 65, 877–881.

Literature

93

Kraemer, B. F., Campbell, R. a., Schwertz, H., Cody, M. J., Franks, Z., Tolley, N. D., Kahr, W. H. a,

Lindemann, S., Seizer, P. & other authors. (2011). Novel Anti-bacterial Activities of β-defensin 1 in

Human Platelets: Suppression of Pathogen Growth and Signaling of Neutrophil Extracellular Trap

Formation. PLoS Pathog 7, e1002355 (F. R. DeLeo, Ed.).

Kraus, D., Herbert, S., Kristian, S. a, Khosravi, A., Nizet, V., Götz, F. & Peschel, A. (2008). The GraRS

regulatory system controls Staphylococcus aureus susceptibility to antimicrobial host defenses. BMC

Microbiol 8, 85.

Krautgartner, W. D. & Vitkov, L. (2008). Visualization of neutrophil extracellular traps in TEM. Micron 39,

367–372.

Kristian, S. a, Datta, V., Weidenmaier, C., Kansal, R., Fedtke, I., Peschel, A., Gallo, R. L. & Nizet, V. (2005). D-Alanylation of Teichoic Acids Promotes Group A Streptococcus Antimicrobial Peptide

Resistance, Neutrophil Survival, and Epithelial Cell Invasion. J Bacteriol 187, 6719–6725.

Lacks, S. & Neuberger, M. (1975). Membrane location of a deoxyribonuclease implicated in the genetic

transformation of Diplococcus pneumoniae. J Bacteriol 124, 1321–9.

Lacks, S., Greenberg, B. & Neuberger, M. (1975). Identification of a Deoxyribonuclease Implicated in

Genetic Transformation of Diplococcus pneumoniae. J Bacteriol 123, 222–232.

Lakkitjaroen, N., Takamatsu, D., Okura, M., Sato, M., Osaki, M. & Sekizaki, T. (2011). Loss of capsule

among Streptococcus suis isolates from porcine endocarditis and its biological significance. J Med

Microbiol 60, 1669–1676.

Lappann, M., Danhof, S., Guenther, F., Olivares-Florez, S., Mordhorst, I. L. & Vogel, U. (2013). In vitro

resistance mechanisms of Neisseria meningitidis against neutrophil extracellular traps. Mol Microbiol 89,

433–449.

Lauth, X., von Köckritz-Blickwede, M., McNamara, C. W., Myskowski, S., Zinkernagel, A. S., Beall, B.,

Ghosh, P., Gallo, R. L. & Nizet, V. (2009). M1 Protein Allows Group A Streptococcal Survival in

Phagocyte Extracellular Traps through Cathelicidin Inhibition. J Innate Immun 1, 202–214.

Leitch, a E., Duffin, R., Haslett, C. & Rossi, a G. (2008). ‘Relevance of granulocyte apoptosis to resolution of

inflammation at the respiratory mucosa’. Mucosal Immunol 1, 350–363.

Li, Y., Martinez, G., Gottschalk, M., Lacouture, S., Willson, P., Dubreuil, J. D., Jacques, M. & Harel, J. (2006). Identification of a Surface Protein of Streptococcus suis and Evaluation of Its Immunogenic and

Protective Capacity in Pigs. Infect Immun 74, 305–312.

Lim, M. B. H., Kuiper, J. W. P., Katchky, A., Goldberg, H. & Glogauer, M. (2011). Rac2 is required for the

formation of neutrophil extracellular traps. J Leukoc Biol 90, 771–776.

Lindler, L. E. & Macrina, F. L. (1987). Molecular cloning and characterization of a Streptococcus sanguis

DNase necessary for repair of DNA damage induced by UV light and methyl methanesulfonate. J

Bacteriol 169, 3199–3208.

Linn, S. & Arber, W. (1968). Host specificity of DNA produced by Escherichia coli, X. In vitro restriction of

phage fd replicative form. Proc Natl Acad Sci 59, 1300–1306.

Lossinsky, A. S. & Shivers, R. R. (2004). Structural pathways for macromolecular and cellular transport across

the blood-brain barrier during inflammatory conditions. Review. Histol Histopathol 19, 535–564.

Lu, T., Kobayashi, S. D., Quinn, M. T. & DeLeo, F. R. (2012). A NET Outcome. Front Immunol 3, 365.

Literature

94

Lun, S., Perez-Casal, J., Connor, W. & Willson, P. . (2003). Role of suilysin in pathogenesis of Streptococcus

suis capsular serotype 2. Microb Pathog 34, 27–37.

Lun, Z.-R., Wang, Q.-P., Chen, X.-G., Li, A.-X. & Zhu, X.-Q. (2007). Streptococcus suis: an emerging

zoonotic pathogen. Lancet Infect Dis 7, 201–209.

Lütticken, R., Temme, N., Hahn, G. & Bartelheimer, E. W. (1986). Meningitis caused by Streptococcus suis:

case report and review of the literature. Infection 14, 181–185.

Madsen, L. W., Bak, H., Nielsen, B., Jensen, H. E., Aalbæk, B. & Riising, H. J. (2002a). Bacterial

colonization and invasion in pigs experimentally exposed to Streptococcus suis serotype 2 in aerosol. J Vet

Med Ser B 49, 211–215.

Madsen, L. W., Svensmark, B., Elvestad, K., Aalbaek, B. & Jensen, H. E. (2002b). Streptococcus suis

Serotype 2 Infection in Pigs: New Diagnostic and Pathogenetic Aspects. J Comp Pathol 126, 57–65.

Mantovani, A., Cassatella, M. a, Costantini, C. & Jaillon, S. (2011). Neutrophils in the activation and

regulation of innate and adaptive immunity. Nat Rev Immunol 11, 519–531. Nature Publishing Group.

Marin-Esteban, V., Turbica, I., Dufour, G., Semiramoth, N., Gleizes, A., Gorges, R., Beau, I., Servin, A.

L., Lievin-Le Moal, V. & other authors. (2012). Afa/Dr Diffusely Adhering Escherichia coli Strain

C1845 Induces Neutrophil Extracellular Traps That Kill Bacteria and Damage Human Enterocyte-Like

Cells. Infect Immun 80, 1891–1899.

Martin del Campo Sepúlveda, E., Altman, E., Kobisch, M., D’Allaire, S. & Gottschalk, M. (1996). Detection of antibodies against Streptococcus suis capsular type 2 using a purified capsular polysaccharide

antigen-based indirect ELISA. Vet Microbiol 52, 113–125.

Matter, K. & Balda, M. S. (2003). Signalling to and from tight junctions. Nat Rev Mol Cell Biol 4, 225–237.

Matter, K. & Balda, M. S. (2007). Epithelial tight junctions, gene expression and nucleo-junctional interplay. J

Cell Sci 120, 1505–1511.

McCormick, A., Heesemann, L., Wagener, J., Marcos, V., Hartl, D., Loeffler, J., Heesemann, J. & Ebel, F. (2010). NETs formed by human neutrophils inhibit growth of the pathogenic mold Aspergillus fumigatus.

Microbes Infect 12, 928–936.

McNaught, A. D. & Wilkinson, A. (2009). IUPAC Compendium of Chemical Terminology, 2nd ed. (t. (M. Nič,

J. Jirát, B. Košata, A. Jenkins & A. McNaught, Eds.). Research Triagle Park, NC: IUPAC; ISBN: 0-

9678550-9-8.

Megens, R. T. a, Vijayan, S., Lievens, D., Döring, Y., van Zandvoort, M. a M. J., Grommes, J., Weber, C.

& Soehnlein, O. (2012). Presence of luminal neutrophil extracellular traps in atherosclerosis. Thromb

Haemost 107, 597–598.

Mendez-Samperio, P., Miranda, E. & Trejo, A. (2008). Expression and Secretion of Cathelicidin LL-37 in

Human Epithelial Cells after Infection by Mycobacterium bovis Bacillus Calmette-Guerin. Clin Vaccine

Immunol 15, 1450–1455.

Menten-Dedoyart, C., Faccinetto, C., Golovchenko, M., Dupiereux, I., Van Lerberghe, P.-B., Dubois, S.,

Desmet, C., Elmoualij, B., Baron, F. & other authors. (2012). Neutrophil Extracellular Traps Entrap

and Kill Borrelia burgdorferi Sensu Stricto Spirochetes and Are Not Affected by Ixodes ricinus Tick

Saliva. J Immunol 189, 5393–5401.

Midon, M., Schafer, P., Pingoud, A., Ghosh, M., Moon, A. F., Cuneo, M. J., London, R. E. & Meiss, G. (2011). Mutational and biochemical analysis of the DNA-entry nuclease EndA from Streptococcus

pneumoniae. Nucleic Acids Res 39, 623–634.

Literature

95

Mildner, A., Djukic, M., Garbe, D., Wellmer, A., Kuziel, W. a, Mack, M., Nau, R. & Prinz, M. (2008). Ly-

6G+CCR2- Myeloid Cells Rather Than Ly-6ChighCCR2+ Monocytes Are Required for the Control of

Bacterial Infection in the Central Nervous System. J Immunol 181, 2713–2722.

Mocsai, A. (2013). Diverse novel functions of neutrophils in immunity, inflammation, and beyond. J Exp Med

210, 1283–1299.

Moini, J. (2015). Anatomy and Physiology for Health Professionals, second. Burlington, MA: Jones and Bartlett

Publishers, Inc; ISBN: 978-1284036947.

Molloy, S. (2006). Escaping the net. Nat Rev Microbiol 4, 242–243.

Moon, A. F., Midon, M., Meiss, G., Pingoud, A., London, R. E. & Pedersen, L. C. (2011). Structural insights

into catalytic and substrate binding mechanisms of the strategic EndA nuclease from Streptococcus

pneumoniae. Nucleic Acids Res 39, 2943–2953.

Moris, G. & Garcia-Monco, J. C. (1999). The Challenge of Drug-Induced Aseptic Meningitis. Arch Intern

Med 159, 1185.

Morita, C., Sumioka, R., Nakata, M., Okahashi, N., Wada, S., Yamashiro, T., Hayashi, M., Hamada, S.,

Sumitomo, T. & Kawabata, S. (2014). Cell Wall-Anchored Nuclease of Streptococcus sanguinis

Contributes to Escape from Neutrophil Extracellular Trap-Mediated Bacteriocidal Activity. PLoS One 9,

e103125 (T. Matsumoto, Ed.).

Muñoz Caro, T., Hermosilla, C., Silva, L. M. R., Cortes, H. & Taubert, A. (2014). Neutrophil Extracellular

Traps as Innate Immune Reaction against the Emerging Apicomplexan Parasite Besnoitia besnoiti. PLoS

One 9, e91415 (B. Kaltenboeck, Ed.).

Nakayama, K., Okamura, N., Arai, H., Sekizawa, K. & Sasaki, H. (1999). Expression of human β-defensin-1

in the choroid plexus. Ann Neurol 45, 685–685.

Narasaraju, T., Yang, E., Samy, R. P., Ng, H. H., Poh, W. P., Liew, A.-A., Phoon, M. C., van Rooijen, N. &

Chow, V. T. (2011). Excessive Neutrophils and Neutrophil Extracellular Traps Contribute to Acute Lung

Injury of Influenza Pneumonitis. Am J Pathol 179, 199–210.

Nathan, C. (2006). Neutrophils and immunity: challenges and opportunities. Nat Rev Immunol 6, 173–182.

Neumann, A., Berends, E. T. M., Nerlich, A., Molhoek, E. M., Gallo, R. L., Meerloo, T., Nizet, V., Naim,

H. Y. & von Köckritz-Blickwede, M. (2014a). The antimicrobial peptide LL-37 facilitates the formation

of neutrophil extracellular traps. Biochem J 464, 3–11.

Neumann, A., Völlger, L., Berends, E. T. M., Molhoek, E. M., Stapels, D. A. C., Midon, M., Friães, A.,

Pingoud, A., Rooijakkers, S. H. M. & other authors. (2014b). Novel Role of the Antimicrobial Peptide

LL-37 in the Protection of Neutrophil Extracellular Traps against Degradation by Bacterial Nucleases. J

Innate Immun 6, 860–868.

Nickel, R., Schummer, A. & Seiferle, E. (2004). Lehrbuch der Anatomie der Haustiere, 3rd edn. Stuttgart,

Germany: Parey Verlag; ISBN: 3-8304-4150-9.

Nobelprize.org. (2015). The Nobel Prize in Physiology or Medicine 1978. Nobel Media

http://www.nobelprize.org/nobel_prizes/medicine/laureates/1978/ (26.08.2015).

Norton, P. M., Rolph, C., Ward, P. N., Bentley, R. W. & Leigh, J. A. (1999). Epithelial invasion and cell

lysis by virulent strains of Streptococcus suis is enhanced by the presence of suilysin. FEMS Immunol Med

Microbiol 26, 25–35.

Literature

96

Noviello, S., Ianniello, F., Leone, S. & Esposito, S. (2003). Comparative activity of garenoxacin and other

agents by susceptibility and time-kill testing against Staphylococcus aureus, Streptococcus pyogenes and

respiratory pathogens. J Antimicrob Chemother 52, 869–872.

Ostergaard, C., Benfield, T. L., Sellebjerg, F., Kronborg, G., Lohse, N. & Lundgren, J. D. (1996). Interleukin-8 in cerebrospinal fluid from patients with septic and aseptic meningitis. Eur J Clin Microbiol

Infect Dis 15, 166–169.

Palmer, L. J., Chapple, I. L. C., Wright, H. J., Roberts, A. & Cooper, P. R. (2012). Extracellular

deoxyribonuclease production by periodontal bacteria. J Periodontal Res 47, 439–445.

Papayannopoulos, V. & Zychlinsky, A. (2009). NETs: a new strategy for using old weapons. Trends Immunol

30, 513–521.

Papayannopoulos, V., Metzler, K. D., Hakkim, A. & Zychlinsky, A. (2010). Neutrophil elastase and

myeloperoxidase regulate the formation of neutrophil extracellular traps. J Cell Biol 191, 677–691.

Pappas, G. (2013). Socio-economic, industrial and cultural parameters of pig-borne infections. Clin Microbiol

Infect 19, 605–610. European Society of Clinical Microbiology and Infectious Diseases.

Peterson, D., Brenu, E. W., Gottschalk, G., Ramos, S., Nguyen, T., Staines, D. & Marshall-Gradisnik, S. (2015). Cytokines in the Cerebrospinal Fluids of Patients with Chronic Fatigue Syndrome/Myalgic

Encephalomyelitis. Mediators Inflamm 2015, 1–4.

Pieterse, E. & van der Vlag, J. (2014). Breaking Immunological Tolerance in Systemic Lupus Erythematosus.

Front Immunol 5, 1–8.

Pillay, J., den Braber, I., Vrisekoop, N., Kwast, L. M., de Boer, R. J., Borghans, J. A. M., Tesselaar, K. &

Koenderman, L. (2010). In vivo labeling with 2H2O reveals a human neutrophil lifespan of 5.4 days.

Blood 116, 625–627.

Pilsczek, F. H., Salina, D., Poon, K. K. H., Fahey, C., Yipp, B. G., Sibley, C. D., Robbins, S. M., Green, F.

H. Y., Surette, M. G. & other authors. (2010). A Novel Mechanism of Rapid Nuclear Neutrophil

Extracellular Trap Formation in Response to Staphylococcus aureus. J Immunol 185, 7413–7425.

Pinto Junior, V. L. L., Rebelo, M. C., Gomes, R. N., de Assis, E. F., Castro-Faria-Neto, H. C. & Bóia, M.

N. (2011). IL-6 and IL-8 in cerebrospinal fluid from patients with aseptic meningitis and bacterial

meningitis: their potential role as a marker for differential diagnosis. Brazilian J Infect Dis 15, 156–158.

Elsevier.

Pron, B., Taha, M. K., Rambaud, C., Fournet, J. C., Pattey, N., Monnet, J. P., Musilek, M., Beretti, J. L. &

Nassif, X. (1997). Interaction of Neisseria maningitidis with the components of the blood-brain barrier

correlates with an increased expression of PilC. J Infect Dis 176, 1285–1292.

Rada, B. & Leto, T. (2008). Oxidative innate immune defenses by Nox/Duox Family NADPH oxidases.

Contrib Microbiol 15, 164–187.

Ramos-Kichik, V., Mondragón-Flores, R., Mondragón-Castelán, M., Gonzalez-Pozos, S., Muñiz-

Hernandez, S., Rojas-Espinosa, O., Chacón-Salinas, R., Estrada-Parra, S. & Estrada-García, I. (2009). Neutrophil extracellular traps are induced by Mycobacterium tuberculosis. Tuberculosis 89, 29–37.

Ransohoff, R. M., Kivisäkk, P. & Kidd, G. (2003). Three or more routes for leukocyte migration into the

central nervous system. Nat Rev Immunol 3, 569–581.

Reams, R. Y., Glickman, L. T., Harrington, D. D., Thacker, H. L. & Bowersock, T. L. (1994). Streptococcus suis infection in swine: a retrospective study of 256 cases. Part II. Clinical signs, gross and

microscopic lesions, and coexisting microorganisms. J Vet Diagn Invest 6, 326–334.

Literature

97

Reams, R. Y., Harrington, D. D., Glickman, L. T., Thacker, H. L. & Bowersock, T. L. (1996). Multiple

serotypes and strains of Streptococcus suis in naturally infected swine herds. J Vet Diagn Invest 8, 119–

121.

Redzic, Z. B. (2013). Studies on the human choroid plexus in vitro. Fluids Barriers CNS 10, 10. BioMed

Central Ltd.

Riyapa, D., Buddhisa, S., Korbsrisate, S., Cuccui, J., Wren, B. W., Stevens, M. P., Ato, M. &

Lertmemongkolchai, G. (2012). Neutrophil extracellular traps exhibit antibacterial activity against

Burkholderia pseudomallei and are influenced by bacterial and host factors. Infect Immun 80, 3921–3929.

Robertson, I. D. & Blackmore, D. K. (1989). Prevalence of Streptococcus suis types 1 and 2 in domestic pigs

in Australia and New Zealand. Vet Rec 124, 391–394.

Saitoh, T., Komano, J., Saitoh, Y., Misawa, T., Takahama, M., Kozaki, T., Uehata, T., Iwasaki, H., Omori,

H. & other authors. (2012). Neutrophil Extracellular Traps Mediate a Host Defense Response to Human

Immunodeficiency Virus-1. Cell Host Microbe. Elsevier Inc.

Sanford, S. E. (1987). Gross and histopathological findings in unusual lesions caused by Streptococcus suis in

pigs. II. Central nervous system lesions. Can J Vet Res 51, 486–489.

Scapinello, S., Brooks, A. S., MacInnes, J. I., Hammermueller, J., Clark, M. E. & Caswell, J. L. (2011). Bactericidal activity of porcine neutrophil secretions. Vet Immunol Immunopathol 139, 113–118. Elsevier

B.V.

Schroten, M., Hanisch, F. G., Quednau, N., Stump, C., Riebe, R., Lenk, M., Wolburg, H., Tenenbaum, T.

& Schwerk, C. (2012). A novel porcine in vitro model of the blood-cerebrospinal fluid barrier with strong

barrier function. PLoS One 7.

Schwarz-Linek, U., Höök, M. & Potts, J. R. (2006). Fibronectin-binding proteins of Gram-positive cocci.

Microbes Infect.

Schwerk, C., Adam, R., Borkowski, J., Schneider, H., Klenk, M., Zink, S., Quednau, N., Schmidt, N.,

Stump, C. & other authors. (2011). In vitro transcriptome analysis of porcine choroid plexus epithelial

cells in response to Streptococcus suis: Release of pro-inflammatory cytokines and chemokines. Microbes

Infect 13, 953–962.

Schwerk, C., Papandreou, T., Schuhmann, D., Nickol, L., Borkowski, J., Steinmann, U., Quednau, N.,

Stump, C., Weiss, C. & other authors. (2012). Polar invasion and translocation of neisseria meningitidis

and Streptococcus suis in a novel human model of the blood-cerebrospinal fluid barrier. PLoS One 7,

e30069.

Seele, J., Singpiel, A., Spoerry, C., Pawel-Rammingen, U. Von, Valentin-Weigand, P. & Baums, C. G. (2013). Identification of a Novel Host-Specific IgM Protease in Streptococcus suis. J Bacteriol 195, 930–

940.

Seele, J., Hillermann, L.-M., Beineke, A., Seitz, M., von Pawel-Rammingen, U., Valentin-Weigand, P. &

Baums, C. G. (2015). The immunoglobulin M-degrading enzyme of Streptococcus suis, IdeSsuis, is a

highly protective antigen against serotype 2. Vaccine 33, 2207–2212. Elsevier Ltd.

Segura, M. & Gottschalk, M. (2002). Streptococcus suis interactions with the murine macrophage cell line

J774: Adhesion and cytotoxicity. Infect Immun 70, 4312–4322.

Seper, A., Hosseinzadeh, A., Gorkiewicz, G., Lichtenegger, S., Roier, S., Leitner, D. R., Röhm, M.,

Grutsch, A., Reidl, J. & other authors. (2013). Vibrio cholerae Evades Neutrophil Extracellular Traps

by the Activity of Two Extracellular Nucleases. PLoS Pathog 9, e1003614.

Literature

98

Shechter, R., London, A. & Schwartz, M. (2013). Orchestrated leukocyte recruitment to immune-privileged

sites: absolute barriers versus educational gates. Nat Rev Immunol 13, 206–18. Nature Publishing Group.

Shields, R. C., Mokhtar, N., Ford, M., Hall, M. J., Burgess, J. G., ElBadawey, M. R. & Jakubovics, N. S. (2013). Efficacy of a Marine Bacterial Nuclease against Biofilm Forming Microorganisms Isolated from

Chronic Rhinosinusitis. PLoS One 8.

Silva, L. M. R., Muñoz Caro, T., Gerstberger, R., Vila-Viçosa, M. J. M., Cortes, H. C. E., Hermosilla, C. &

Taubert, A. (2014). The apicomplexan parasite Eimeria arloingi induces caprine neutrophil extracellular

traps. Parasitol Res 113, 2797–2807.

Smith, H. E., Buijs, H., de Vries, R., Wisselink, H. J., Stockhofe-Zurwieden, N. & Smits, M. a. (2001). Environmentally regulated genes of Streptococcus suis: Identification by the use of iron-restricted

conditions in vitro and by experimental infection of piglets. Microbiology 147, 271–280.

Smith, H. E., Vecht, U., Gielkens, A. L. J. & Smits, M. a. (1992). Cloning and nucleotide sequence of the

gene encoding the 136-kilodalton surface protein (muramidase-released protein) of Streptococcus suis type

2. Infect Immun 60, 2361–2367.

Smith, H. E., Vecht, U., Wisselink, H. J., Stockhofe-Zurwieden, N., Biermann, Y. & Smits, M. a. (1996). Mutants of Streptococcus suis types 1 and 2 impaired in expression of muramidase-released protein and

extracellular protein induce disease in newborn germfree pigs. Infect Immun 64, 4409–4412.

Smith, H. E., Damman, M., Van Der Velde, J., Wagenaar, F., Wisselink, H. J., Stockhofe-Zurwieden, N. &

Smits, M. A. (1999). Identification and characterization of the cps locus of Streptococcus suis serotype 2:

The capsule protects against phagocytosis and is an important virulence factor. Infect Immun 67, 1750–

1756.

Sorek, R., Kunin, V. & Hugenholtz, P. (2008). CRISPR — a widespread system that provides acquired

resistance against phages in bacteria and archaea. Nat Rev Microbiol 6, 181–186. Nature Publishing

Group.

Staats, J. J., Feder, I., Okwumabua, O. & Chengappa, M. M. (1997). Streptococcus suis: Past and present.

Vet Res Commun 21, 381–407.

Steinberg, B. E. & Grinstein, S. (2007). Unconventional roles of the NADPH oxidase: signaling, ion

homeostasis, and cell death. Sci STKE 2007, pe11.

Steinmann, U., Borkowski, J., Wolburg, H., Schröppel, B., Findeisen, P., Weiss, C., Ishikawa, H.,

Schwerk, C., Schroten, H. & Tenenbaum, T. (2013). Transmigration of polymorphnuclear neutrophils

and monocytes through the human blood-cerebrospinal fluid barrier after bacterial infection in vitro. J

Neuroinflammation 10, 31.

Straussberg, R., Harel, L., Nussinovitch, M. & Amir, J. (2003). Absolute neutrophil count in aseptic and

bacterial meningitis related to time of lumbar puncture. Pediatr Neurol 28, 365–369.

Straw, B. E., Zimmermann, J. J., D’Allaire, S. & Taylor, D. J. (2006). Diseases of swine, 9th edn. Ames

Iowa: Wiley-Blackwell; ISBN: 081381703X.

Strle, K., Zhou, J. H., Shen, W. H., Broussard, S. R., Johnson, R. W., Freund, G. G., Dantzer, R. & Kelley,

K. W. (2001). Interleukin-10 in the brain. Crit Rev Immunol 21, 427–449.

Suman, P., Malhotra, S. S. & Gupta, S. K. (2013). LIF-STAT signaling and trophoblast biology. JAK-STAT 2,

e25155.

Sumby, P., Barbian, K. D., Gardner, D. J., Whitney, A. R., Welty, D. M., Long, R. D., Bailey, J. R.,

Parnell, M. J., Hoe, N. P. & other authors. (2005). Extracellular deoxyribonuclease made by group A

Literature

99

Streptococcus assists pathogenesis by enhancing evasion of the innate immune response. Proc Natl Acad

Sci U S A 102, 1679–1684.

S Summers, C., Rankin, S. M., Condliffe, A. M., Singh, N., Peters, a. M. & Chilvers, E. R. (2010). Neutrophil kinetics in health and disease. Trends Immunol 31, 318–324.

Swildens, B., Stockhofe-Zurwieden, N., Van Der Meulen, J., Wisselink, H. J., Nielen, M. & Niewold, T. a. (2004). Intestinal translocation of Streptococcus suis type 2 EF + in pigs. Vet Microbiol 103, 29–33.

Szarowicz, S. E. & Friedlander, A. (2011). Bacillus anthracis Stimulates the Formation of Neutrophil

Extracellular Traps. Mol Biol Cell 22, 4705–4705.

Tanaka, K., Koike, Y., Shimura, T., Okigami, M., Ide, S., Toiyama, Y., Okugawa, Y., Inoue, Y., Araki, T.

& other authors. (2014). In Vivo Characterization of Neutrophil Extracellular Traps in Various Organs of

a Murine Sepsis Model. PLoS One 9, e111888 (M. van Zandvoort, Ed.).

Tang, J., Wang, C., Feng, Y., Yang, W., Song, H., Chen, Z., Yu, H., Pan, X., Zhou, X. & other authors.

(2006). Streptococcal Toxic Shock Syndrome Caused by Streptococcus suis Serotype 2. PLoS Med 3,

e151.

Tenenbaum, T., Adam, R., Eggelnpöhler, I., Matalon, D., Seibt, A., Novotny, G. E. K., Galla, H. J. &

Schroten, H. (2005). Strain-dependent disruption of blood-cerebrospinal fluid barrier by Streptoccocus

suis in vitro. FEMS Immunol Med Microbiol 44, 25–34.

Tenenbaum, T., Papandreou, T., Gellrich, D., Friedrichs, U., Seibt, A., Adam, R., Wewer, C., Galla, H. J.,

Schwerk, C. & Schroten, H. (2009). Polar bacterial invasion and translocation of Streptococcus suis

across the blood-cerebrospinal fluid barrier in vitro. Cell Microbiol 11, 323–336.

Tenenbaum, T., Steinmann, U., Friedrich, C., Berger, J., Schwerk, C. & Schroten, H. (2013). Culture

models to study leukocyte trafficking across the choroid plexus. Fluids Barriers CNS 10, 1.

Todd, J., Fishaut, M., Kapral, F. & Welch, T. (1978). Toxic-shock syndrome associated with phage-group-I

Staphylococci. Lancet 2, 1116–1118.

Tofts, P. S., Chevassut, T., Cutajar, M., Dowell, N. G. & Peters, A. M. (2011). Doubts concerning the

recently reported human neutrophil lifespan of 5.4 days. Blood 117, 6050–6052.

Tunkel, A. & Scheld, W. (1993). Pathogenesis and pathophysiology of bacterial meningitis. Clin Microbiol Rev

6, 118–136.

Uchiyama, S., Andreoni, F., Schuepbach, R. a, Nizet, V. & Zinkernagel, A. S. (2012). Dnase Sda1 allows

invasive M1T1 group a streptococcus to prevent TLR9-dependent recognition. PLoS Pathog 8, e1002736.

Urban, C. F., Ermert, D., Schmid, M., Abu-Abed, U., Goosmann, C., Nacken, W., Brinkmann, V.,

Jungblut, P. R. & Zychlinsky, A. (2009). Neutrophil extracellular traps contain calprotectin, a cytosolic

protein complex involved in host defense against Candida albicans. PLoS Pathog 5, e1000639.

Urban, C. F., Reichard, U., Brinkmann, V. & Zychlinsky, A. (2006). Neutrophil extracellular traps capture

and kill Candida albicans and hyphal forms. Cell Microbiol 8, 668–676.

Vadeboncoeur, N., Segura, M., Al-Numani, D., Vanier, G. & Gottschalk, M. (2003). Pro-inflammatory

cytokine and chemokine release by human brain microvascular endothelial cells stimulated by

Streptococcus suis serotype 2. FEMS Immunol Med Microbiol 35, 49–58.

Van de Beek, D., de Gans, J., Spanjaard, L., Weisfelt, M., Reitsma, J. B. & Vermeulen, M. (2004). Clinical

Features and Prognostic Factors in Adults with Bacterial Meningitis. N Engl J Med 351, 1849–1859.

Literature

100

Van Horn, A. & Chamberlain, M. C. (2012). Neoplastic Meningitis. J Support Oncol 10, 45–53.

Vanier, G., Vanier, G., Segura, M., Segura, M., Friedl, P., Friedl, P., Lacouture, S., Lacouture, S.,

Gottschalk, M. & Gottschalk, M. (2004). Invasion of Porcine Brain Microvascular Endothelial Cells by

Streptococcus suis Serotype 2. Infect Immun 72, 1441–1449.

Vanier, G., Fittipaldi, N., Slater, J. D., Domínguez-Punaro, M. D. L. C., Rycroft, A. N., Segura, M.,

Maskell, D. J. & Gottschalk, M. (2009a). New putative virulence factors of Streptococcus suis involved

in invasion of porcine brain microvascular endothelial cells. Microb Pathog 46, 13–20.

Vanier, G., Segura, M., Lecours, M.-P., Grenier, D. & Gottschalk, M. (2009b). Porcine brain microvascular

endothelial cell-derived interleukin-8 is first induced and then degraded by Streptococcus suis. Microb

Pathog 46, 135–143. Elsevier Ltd.

Vecht, U., Arends, J. P., van der Molen, E. J. & van Leengoed, L. A. (1989). Differences in virulence

between two strains of Streptococcus suis type II after experimentally induced infection of newborn germ-

free pigs. Am J Vet Res 50, 1037–1043.

Vecht, U., Wisselink, H. J., Jellema, M. L. & Smith, H. E. (1991a). Identification of two proteins associated

with virulence of Streptococcus suis type 2. Infect Immun 59, 3156–3162.

Vecht, U., Wisselink, H. J., Van Dijk, J. E. & Smith, H. E. (1991b). Virulence of Streptococcus suis type 2

strains in newborn germfree pigs depends on phenotype. Infect Immun 60, 550–556.

Von Engelhardt, W. (2015). Physiologie der Haustiere, 4. edn. Stuttgart, Germany: Enke Verlag; ISBN:

3830412592.

Walker, M. J., Hollands, A., Sanderson-Smith, M. L., Cole, J. N., Kirk, J. K., Henningham, A., McArthur,

J. D., Dinkla, K., Aziz, R. K. & other authors. (2007). DNase Sda1 provides selection pressure for a

switch to invasive group A streptococcal infection. Nat Med 13, 981–985.

Wang, C., Li, M., Feng, Y., Zheng, F., Dong, Y., Pan, X., Cheng, G., Dong, R., Hu, D. & other authors.

(2009a). The involvement of sortase A in high virulence of STSS-causing Streptococcus suis serotype 2.

Arch Microbiol 191, 23–33.

Wang, Y., Li, M., Stadler, S., Correll, S., Li, P., Wang, D., Hayama, R., Leonelli, L., Han, H. & other

authors. (2009b). Histone hypercitrullination mediates chromatin decondensation and neutrophil

extracellular trap formation. J Cell Biol 184, 205–213.

Wardini, A. B., Guimarães-Costa, A. B., Nascimento, M. T. C., Nadaes, N. R., Danelli, M. G. M., Mazur,

C., Benjamin, C. F., Saraiva, E. M. & Pinto-da-Silva, L. H. (2010). Characterization of neutrophil

extracellular traps in cats naturally infected with feline leukemia virus. J Gen Virol 91, 259–264.

Wartha, F., Beiter, K., Albiger, B., Fernebro, J., Zychlinsky, A., Normark, S. & Henriques-Normark, B. (2007). Capsule and d-alanylated lipoteichoic acids protect Streptococcus pneumoniae against neutrophil

extracellular traps. Cell Microbiol 9, 1162–1171.

Literature

101

Wewer, C., Seibt, A., Wolburg, H., Greune, L., Schmidt, M. A., Berger, J., Galla, H.-J., Quitsch, U.,

Schwerk, C. & other authors. (2011). Transcellular migration of neutrophil granulocytes through the

blood-cerebrospinal fluid barrier after infection with Streptococcus suis. J Neuroinflammation 8, 51.

BioMed Central Ltd.

Williams, a E. (1990). Relationship between intracellular survival in macrophages and pathogenicity of

Streptococcus suis type 2 isolates. Microb Pathog 8, 189–196.

Williams, A. E. & Blakemore, W. F. (1990). Pathogenesis of Meningitis Caused by Streptococcus suis Type 2.

J Infect Dis 162, 474–481.

Williams, D. M., Lawson, G. H. & Rowland, A. C. (1973). Streptococcal infection in piglets: the palatine

tonsils as portals of entry for Streptococcus suis. Res Vet Sci 15, 352–362.

Williams, W. M., Castellani, R. J., Weinberg, A., Perry, G. & Smith, M. a. (2012). Do β-Defensins and

Other Antimicrobial Peptides Play a Role in Neuroimmune Function and Neurodegeneration? Sci World J

2012, 1–11.

Windsor, R. S. & Elliott, S. D. (1975). Streptococcal infection in young pigs. IV. An outbreak of streptococcal

meningitis in weaned pigs. J Hyg (Lond) 75, 69–78.

Wisselink, H. (2000). Distribution of capsular types and production of muramidase-released protein (MRP) and

extracellular factor (EF) of Streptococcus suis strains isolated from diseased pigs in seven European

countries. Vet Microbiol 74, 237–248.

Wisselink, H. J., Vecht, U., Smith, H. E. & Stockhofe-Zurwieden, N. (2001). Protection of pigs against

challenge with virulent Streptococcus suis serotype 2 strains by a muramidase-released protein and

extracellular factor vaccine. Vet Rec 148, 473–477.

Wolinowska, R., Cegłowski, P., Kok, J. & Venema, G. (1991). Isolation, sequence and expression in

Escherichia coli, Bacillus subtilis and Lactococcus lactis of the DNase (streptodornase)-encoding gene

from Streptococcus equisimilis H46A. Gene 106, 115–119.

Yipp, B. G. & Kubes, P. (2013). NETosis: how vital is it? Blood 122, 2784–94.

Yipp, B. G., Petri, B., Salina, D., Jenne, C. N., Scott, B. N. V, Zbytnuik, L. D., Pittman, K., Asaduzzaman,

M., Wu, K. & other authors. (2012). Infection-induced NETosis is a dynamic process involving

neutrophil multitasking in vivo. Nat Med 18, 1386–1393.

Young, R. L., Malcolm, K. C., Kret, J. E., Caceres, S. M., Poch, K. R., Nichols, D. P., Taylor-Cousar, J. L.,

Saavedra, M. T., Randell, S. H. & other authors. (2011). Neutrophil extracellular trap (NET)-mediated

killing of pseudomonas aeruginosa: Evidence of acquired resistance within the CF airway, independent of

CFTR. PLoS One 6.

Yousefi, S., Mihalache, C., Kozlowski, E., Schmid, I. & Simon, H. U. (2009). Viable neutrophils release

mitochondrial DNA to form neutrophil extracellular traps. Cell Death Differ 16, 1438–1444. Nature

Publishing Group.

Yu, H., Jing, H., Chen, Z., Zheng, H., Zhu, X., Wang, H., Wang, S., Liu, L., Zu, R. & other authors.

(2006). Human Streptococcus suis outbreak, Sichuan, China. Emerg Infect Dis 12, 914–920.

Zasloff, M. (2002). Antimicrobial peptides of multicellular organisms. Nature 415, 389–395.

Zasloff, M. (2006). Defending the epithelium. Nat Med 12, 607–8. Nature Publishing Group.

Literature

102

Zelmer, A., Bowen, M., Jokilammi, A., Finne, J., Luzio, J. P. & Taylor, P. W. (2008). Differential

expression of the polysialyl capsule during blood-to-brain transit of neuropathogenic Escherichia coli K1.

Microbiology 154, 2522–2532.

Zhang, A., Mu, X., Chen, B., Liu, C., Han, L., Chen, H. & Jin, M. (2010). Identification and characterization

of IgA1 protease from Streptococcus suis. Vet Microbiol 140, 171–175.

Zhang, A., Mu, X., Chen, B., Han, L., Chen, H. & Jin, M. (2011). IgA1 protease contributes to the virulence

of Streptococcus suis. Vet Microbiol 148, 436–439. Elsevier B.V.

Zhang, J., Kasciukovic, T. & White, M. F. (2012). The CRISPR Associated Protein Cas4 Is a 5′ to 3′ DNA

Exonuclease with an Iron-Sulfur Cluster. PLoS One 7, e47232 (M. G. Marinus, Ed.).

Zhao, J., Pan, S., Lin, L., Fu, L., Yang, C., Xu, Z., Wei, Y., Jin, M. & Zhang, A. (2015). Streptococcus suis

serotype 2 strains can induce the formation of neutrophil extracellular traps and evade trapping. FEMS

Microbiol Lett 362, fnv022–fnv022.

Zhu, L., Kuang, Z., Wilson, B. a & Lau, G. W. (2013). Competence-independent activity of pneumococcal

enda mediates degradation of extracellular DNA and nets and is important for virulence. PLoS One 8,

e70363.

Zinkernagel, A. S., Timmer, A. M., Pence, M. A., Locke, J. B., Buchanan, J. T., Turner, C. E., Mishalian,

I., Sriskandan, S., Hanski, E. & Nizet, V. (2008). The IL-8 Protease SpyCEP/ScpC of Group A

Streptococcus Promotes Resistance to Neutrophil Killing. Cell Host Microbe 4, 170–178.

Appendix

103

8 Appendix

List of figures and tables (except Chapter 3)

Figure 1-1 Histological finding in the brain of a intranasally with S. suis serotype 2 strain 10 infected

piglet ...................................................................................................................................... 9

Figure 1-2 Neutrophil extracellular traps (NETs) trapping S. suis. ......................................................... 9

Figure 1-3 Overview of neutrophil functions ........................................................................................ 16

Figure 1-4 Overview of NETosis pathway ............................................................................................ 18

Figure 1-5 Overview about the three brain barriers .............................................................................. 29

Figure 1-6 Overview of the in vivo BCSFB [A] and the inverted in vitro model [B] ........................... 31

Figure 2-1 Illustration of the aims of the study ..................................................................................... 33

Figure 4-1 Comparison of pH values of different human and porcine environments encountered by S.

suis ....................................................................................................................................... 72

Figure 4-2 Expression of the two extracellular nucleases SsnA and EndAsuis by S. suis is not crucial

for survival in porcine and human blood. ............................................................................ 73

Figure 4-3 Structure and cleavage of LL-37 ......................................................................................... 76

Figure 4-4 Steps in formation of NETs: ‘suicidal’ and ‘vital’ NETosis ............................................... 79

Figure 4-5 CSF of healthy piglets blocks NET release ......................................................................... 81

Figure 4-6 Illustration of the concluding remarks ................................................................................. 83

Table 1 Bacterial interaction described with PMNs and/ or NETs ....................................................... 21

Table 2 DNases in microorganisms ....................................................................................................... 26

Acknowledgment

104

Acknowledgment

First of all I would like to thank my supervisors Prof. Dr. Christoph G. Baums and Prof. Dr.

Maren von Köckritz-Blickwede for giving me the opportunity to work on an extremely

interesting and very exciting project. The combination of both experts on the one hand for S.

suis and on the other hand for NETs was the best I could ever dream of. All rising questions

were discussed and solved together. Thank you Christoph for the directly support in Hannover

and the remote support from Leipzig. Thank you Maren, that you always had an open ear and

our fruitful discussions via email at night. This combination was a key factor for the success

of this awesome project.

I would particularly like to thank Prof. Dr. Peter Valentin-Weigand for giving me the

opportunity to perform my PhD study at the Institute for Microbiology, for his constructive

discussions and the relaxed working atmosphere.

Further, I would like to thank the external member of my supervisory group Prof. Dr. Horst

Schroten (Department of Pediatrics, Pediatric Infectious Diseases, Medical Faculty

Mannheim, Heidelberg University) for his interest in my work and the helpful comments and

suggestions. Furthermore, I want to thank him for the fruitful cooperation with his lab in

Mannheim. A special thank goes to the very helpful email and telephone help of Carolin

Stump-Guthier for answering all questions around the cell culture system.

I would like to thank Prof. Dr. Hassan Y. Naim for his interest in my project and giving me

the opportunity to perform parts of my study at the Department of Physiological Chemistry.

A special thank goes to the members of the “Streptoconga” office at the Institute of

Microbiology: Daniela Willms, Tina Basler and Jana Seele. Daniela you are the best good

mood propagator! Thank you for all jokes we made together, for all wise sayings of you, the

unforgettable discussions about the serious things in the lab and everyday life. Tina you are

the best telephone joker for all lab questions! I thank you a lot for all your helpful comments,

ideas, answers and discussions about lab and life. Jana you are the good soul of the

Streptoconga’s! Thank you very much for a wonderful time, I was lucky to have you as my

office neighbor and colleague. All discussions about science were fruitful and helpful

independent of the question.

Furthermore, I would like to especially thank Nantaporn Ruangkiattikul, Kristin Laarmann

and Matthias Stehr. Bo you are the best Thai teacher: ท ำวนัน้ีใหดี้ท่ีสุด (Tum one nee hai dee tee

sud). Thank you very much for numerous burst of laughter I got and the training of my sixth

sense. Kristin thank you for all your helping hands in the lab and especially for conducting the

RRRR in the cell culture. Every time when I was searching for help, you were there. Matthias

thank you for all the philosophical and scientific discussions and your always-helpful nature.

You are the Master of the ÄKTA and you helped me lot to get one key element in the second

manuscript: the purified rEndAsuis_H165G. Unforgotten is our discovery of the 90-degree

language and the first word: BALIMALAM.

Acknowledgment

105

Many thanks go to the present and former members of the Institute of Microbiology for the

excellent working atmosphere and the helping hands and discussions: Ketema Merga Abdissa,

Yenehiwot Berhanu Weldearegay, Elke Eckelt, Marcus Fulde, Anika Glenz, Ralph Goethe,

Katrin Hail, Charlotte Heede, Lena-Maria Hillermann, Nina Janze, Anna Koczula, Aline

Kostka, Jochen Meens, Andreas Nerlich, Dennis Päglow, Silke Schiewe, Anja Schulze,

Maren Seitz, Anna Seydel, Kira van Vorst and Jörg Willenborg.

Antonio Eramo and Werner Scharnhorst thank you very much for all your help in the lab

everyday life. Furthermore, I would like to thank Claudia Otto and Jörg Henstorf for

preparing the media and autoclaving lab stuff.

I also want to give thanks to Sabine Baumert and Jörg Merkel for their organization and

technical support.

Particularly I would like to thank two members of the Department of Physiological

Chemistry: Ariane Neumann and Friederike Reuner. Ariane thank you a lot for your helping

hands in my project, your helpful comments and the time we spend together in the lab. For

answering all questions at the microscope, in the lab and in all general things. Your help

strongly supported my work. Rike thank you very much for organizing everything in the

Department of Physiological Chemistry in searching for blood donors, blood collection,

evaluation of experiments, ordering of lab stuff and always be there for answering questions.

In addition, I would like to thank all blood donors of the Department of Physiological

Chemistry, without you this work would not have been impossible! Thank you very much for

all your blood! And I thank Graham Brogden for the proofreading.

Also, I would like to thank Prof. Dr. Andreas Beineke (Department of Pathology, University

of Veterinary Medicine Hannover) for histopathological examination of porcine samples and

Prof. Dr. Karl-Heinz Waldmann for collaboration as well as Klaus Schlotter and colleagues

for drawing blood samples from pigs (Clinic of Swine and Small Ruminants, Forensic

Medicine and Ambulatory Service, University of Veterinary Medicine Hannover).

Furthermore I have to thank the Ministry of Science and Culture of Lower Saxony for

financial support of my work with a Georg-Christoph-Lichtenberg Scholarship within the

framework of the PhD program ‘EWI-Zoonosen’ of the Hannover Graduate School for

Veterinary Pathobiology, Neuroinfectiology and Translational Medicine (HGNI) the

Niedersachsen-Research Network on Neuroinfectiology (N-RENNT).

Finally and most importantly I want to thank the center of my life: my family and friends. I

thank especially my parents, that they were always there, giving me advice and supporting me

and encouraging me when I was feeling sad. I would also like to thank Eugen for his love,

every time believing in me, calming me down, joking with me and always being on my side.

Moreover, I thank my unforgotten brother Oliver somewhere in the sky as a twinkling star. I

dedicate this work to you!

BALIMALAM