Incorporating Experiential Learning and Digital Badging in STEM

Ian Alberts, Natural SciencesCristina Di Meo, Academic AffairsCharles Keller, Natural Sciences

Elainie Lendebol, Academic AffairsHolly Porter-Morgan, Natural Sciences

Ingrid Veras, Natural Sciences

2019 CUNY Experiential Learning Symposium Experiential Education: Engaging Underrepresented Populations

❖ A visual representation of

knowledge and skills students

have developed through

particular learning experiences.

❖ Digital badges can be earned at

LaGuardia and displayed on

ePortfolio and LinkedIn to help

showcase achievements.

BADGES:

● Signal achievement beyond coursework

● Incentivize High Impact Practices

● Motivate engagement and deepen learning

● Help students articulate their learning to external

audiences, including potential employers and

four-year colleges

● Build community and

connections at

the College

What is a Digital Badge?

Badges Earned in STEM

1. Experiential Learning: STEM Co-Curricular Learning

2. Experiential Learning: STEM Undergraduate Research Badge

Experiential Learning: STEM Co-Curricular Events

• Hands-on activities with community & city organizations reinforce general education competencies.

• Experiential Learning is an established High Impact Practice.

• Reflective writing on experience solidifies learning.

• Provides events for First Year Seminar students.

• Increases interest in STEM fields. May help recruitment in STEM and related disciplines.

Our Events and Partners: STEM Co-Curriculars

• Air pollution data collection event (Natural Sciences department)

• Living Dock/Green Roof (Newtown Creek Alliance & Kingsland Wildflowers)

• Riverkeeper Sweep (North Brooklyn Boat Club)

• Newtown Creek Field Day (Newtown Creek Alliance)

• Storm Drain Stenciling (Newtown Creek Alliance)

• Street Trees event (New York City Department of Parks & Recreation)

Earning the Badge

Initial Criteria: Attend two events and write a reflection on one.

Relaxed criteria (beginning Fall I, 2017): Attend one event and write a reflection.

Upon satisfactory review of reflection: Student is issued a badge.

Post Reflection Questions for STEM Co-Curricular Badge 1. Describe how you participated in the Urban Green Roof/Living Dock

event. What did you actually do? 2. How was this event relevant to your studies at LaGCC? Was it related to your major or anything you have learned in any of your classes? How was this event relevant to your life or past experiences outside of college? 3. What did you learn by participating in this event? Why are spaces such as “green roofs” important? 4. Did your participation in this event change the way you think about urban ecosystems? Explain your answer. 5. Please explain why your participation in this event was beneficial to the greater community. Name some challenges you faced during this event and describe how you addressed them.

Science Service Learning BadgeExperiential Learning: STEM Co-Curricular Badge

Goal 1: Develop skills in problem solving, research and analysis.

Goal 2: Integrate and apply knowledge and skills to new settings and complex problems.

Goal 3: Demonstrate knowledge and skills through written and oral communication to both internal and external audiences.

Goal 4: Demonstrate civic knowledge and engagement through involvement with diverse communities and real-world challenges.

Competencies

Core Competency/Ability: Communication Ability

Competencies

Core Competency/Ability: Inquiry and Problem Solving, Integrative Learning

Competencies

Core Competency/Ability: Integrative Learning

Competencies

Core Competency/Ability: Integrative, Global Learning

Goal 1: Develop skills in problem solving, research and analysis.Description Attendance at one off campus event

Evidence Participation

Evaluation Faculty Observation

Goal 2: Integrate and apply knowledge and skills to new settings and complex problems. Description Reflection on one off-campus event

Evidence Completion of reflection prompts

Evaluation Faculty will review reflection responses

Goal 3: Demonstrate knowledge and skills through written and oral communication to both internal and external audiences.

Description Reflection on one off-campus STEM event

Evidence Place reflection in ePortfolio

Evaluation Share reflection with group members

Goal 4: Demonstrate civic knowledge and engagement through involvement with diverse communities and real-world challenges.

Description Provide community service to a non-profit or larger community

Evidence Reflection on participation

Evaluation Share reflection with group members

STEM Co-Curricular Badge: Specific Components

Outcomes, STEM Co-Curriculars

Open Events

Total events organized, Spring I, 2016-Fall I, 2018: 19 (two cancelled due to weather or low participation)

Total attendance: 319 students

Total badges awarded: 41

Integrating Badging Into FYS Courses: Riverkeeper Sweep

Integrating Badging Into FYS Courses:Newtown Creek Field Day

Student Reflections

“These events exceeded my expectations, I didn’t expect to learn so much and to actually be interested in the things I learned.”

“My participation in these events changed the way I think about litter, pollution, sewage and related issues in my community.”

“After attending these events I realize how careless I am to the environment around me.”

“I thinks if more events like these get to more people we can make a change.”

“I can see the importance of this event and how blind some of us are to our actions.”

STEM Co-Curriculars: Lessons Learned

• Overall event participation satisfactory

• Student reflections demonstrate critical thinking

• Events work well with FYS sections

• Roughly 13% of participants write a reflection and claim their badge (not influenced by relaxed criteria)

STEM Co-Curriculars: Challenges

• Increasing student reflections

• Increasing number of students who claim their badge

• Measuring the impact of events

• Summer events unsuccessful (no STEM FYS classes running)

Experiential Learning: STEM Undergraduate Research Badge

Goal 1: Develop skills in

problem solving, research

and analysis.

Goal 2: Integrate and apply

knowledge and skills to new

settings and complex

problems.

Goal 3: Demonstrate knowledge

and skills through written and

oral communication to both

internal and external audiences.

Goal 4: Demonstrate civic

knowledge and engagement

through involvement with

diverse communities and

real-world challenges.

Competencies

Core Competency/Ability: Communication Ability

Competencies

Core Competency/Ability: Inquiry and Problem Solving,

Integrative Learning

Competencies

Core Competency/Ability: Integrative Learning

Competencies

Core Competency/Ability: Integrative, Global Learning

Goal 1: Develop skills in problem solving, research and analysis.

DescriptionParticipation in research under supervision of faculty member for a minimum of one semester or until the assigned project has been complete.

Evidence Data collection on experiments and bi-weekly summary of work

Evaluation Faculty will review summary of work

Goal 2: Integrate and apply knowledge and skills to new settings and complex problems.

Description Application of knowledge and analysis of data

Evidence Completion of reflection questions

Evaluation Faculty will review reflection responses

Goal 3: Demonstrate knowledge and skills through written and oral communication to

both internal and external audiences.

Description Create poster or PowerPoint presentation and present to internal audience

Evidence Letter/email of acceptance for presentation

Evaluation Faculty will review poster or presentation against a rubric

Goal 4: Demonstrate STEM identity through participation in Undergraduate Research.

Description Participation in Undergraduate Research

Evidence Completion of reflection questions

Evaluation Faculty will review reflection responses

Experiential Learning STEM Undergraduate Research Specific Components

Goal 1: Develop skills in problem solving,

research and analysis.

Goal 2: Integrate and apply knowledge

and skills to new settings and complex

problems.

Goal 3: Demonstrate knowledge and

skills through written and oral

communication to both internal and

external audiences.

Goal 4: Demonstrate STEM identity

through participation in Undergraduate

Research.

STEM Undergraduate Research Badge Requirements

• Be involved in a STEM research project at LaGuardia.• Participate in a poster presentation at LaGuardia’s Undergraduate

Research symposium or another in-house professional meeting.• Participate in a poster presentation of the research project outside

LaGuardia - may be within or outside CUNY.• Complete post reflection questions about the experience.

*Students involved in research projects through NIH, CRSP or other grant-funded programs qualified as long as they meet the above requirements.

Post Reflection Questions for STEM Undergraduate Research Badge

Statement of the Issue/Activities: Describe the STEM Research project you worked on.

• Identify the research question.

• Describe the steps you followed during your research.

• What motivated you to do this type of research?

• What is the contribution of your research to the field?

Academic/Applied Learning: Describe the techniques/skills that you have already

learned in previous courses and that helped you with the research project.

• How did you observe/use/apply these course concepts or theories in your project?

• Explain how your research experience deepened your understanding of these course concepts or theories.

Workplace Skills: List the workplace skills you applied in this project that will help you be prepared for your future job(s)

For example, collaborative work; problem solving; oral, writing and digital communication skills. Describe how you applied these

skills in your project.

• Which skills did you improve through this project?

• Name some challenges that you faced during the project and describe how you addressed them.

Using biochemical testing and genomic sequencing methods to identify bacteria isolated from a dollar bill

Jham Valenzuela jham.valenzuela@gmail.com1, Olga Calderón, PhD. ocalderon@lagcc.cuny.edu2 LaGuardia Community College, Long Island City, NY(1,2)

INTRODUCTION

OBJECTIVE

RESULTS

ACKNOWLEDGEMENTS3)

1. Isolation, characterization and identification of

microbes in money

2. Learn molecular methods of microbial

identification

3. Research in the curriculum

4. Comparison of results

obtained traditional vs.

molecular methods and

look for nuances.

1) Eleven samples were correctly identified based on their Gram reactions, and two Gram reaction samples were mistakenly determined. Factors to incorrect identification may be due to: old cultures samples or over decolorization with Ethanol. Six samples matched the genus identification done by molecular methods and seven were misidentified based on their cell arrangement when compared to 16SrRNA results.

2) Microbiological and molecular lab techniques learned throughout the semester enable the isolation, characterization and identification of unknown organisms. Having the skills was imperative during the process of experimentation.

3) This research-based course approach enable class participants to experience research as part of the curriculum, develop and apply their inquiry and analytical skills.

4) Discrepancies between biochemical, Gram tests and DNA sequencing results may be explained by variation that can occur over generations of the unknown rapidly multiplying and acquiring genetic mutations. Cellular arrangement determination of staphylococci and micrococci led to the misidentification of at least five organisms. These factors may have played a role in the misidentification using the Bergey’s manual.

In spite of e few misidentifications, this class proved indispensable for understanding of how structures and enzymes that make microorganisms can vary, and how these variations can affect their virulence. Lab skills learned in this class represent invaluable for students in nursing, medical and STEM related programs, whether they are diagnosing and assessing symptoms in patients and practicing medicine or working in conjunction with health care providers in laboratories to identify microorganisms. In the end this project allowed students to connect to a daily part of their lives – “Money and its close relationship with microbes”, made students aware that exchanging currency is also an exchange of microbes.

REFERENCES

DISCUSSIONMATERIALS & METHODSMoney, specifically physical bills, are constantly being exchanged between people worldwide as currency. Most people don’t consider that microorganisms like bacteria and viruses are also being exchanged, some which have the potential to be pathogenic. In a global world, the exchange of currency and microbes and how far they can travel, are limitless. Our research in the microbiology class in the Fall of 2016, focused on isolating, characterizing and identifying unknown bacteria from our own dollar bills. Using biochemical and molecular methods of microbial isolation and identification we identified thirteen bacterial organisms. DNA sequencing results were uploaded to the microbial NCBI database and organisms were matched with known identified species. Finally we compared biochemical testing with genomic results and identified various reasons for discrepancies between the results.

NAME GRAM REACTION Identification through Biochemical Tests Microorganism Identification through 16SrRNA

Student/sample 1 G+ cocci Micrococcus luteus or S. aureus Micrococcus luteus

Student/sample 2 G+ cocci Staphylococcus epidermidis Kocuria rhizophila

Student/sample 3 G+ cocci Staphylococcus epidermidis Kocuria spp.

Student/sample 4 G- cocci Neisseria mucosa Staphylococcus simulans

Student/sample 5 G+ cocci Lactococcus lactis Staphylococcus epidermidis

Student/sample 6 G+ bacilli Not determined -student dropped Bacillus simplex

Student/sample 7 G+ bacilli Bacillus pasteurii Bacillus thuringiensis

Student/sample 8 G+ bacilli Bacillus spp.

Bacillus licheniformis

Student/sample 9 G+ cocci Micrococcus luteus or Planococcus citreus Micrococcus luteus.

Student/sample 10 G+ cocci Staphylococcus aureus Microccocus luteus

Student/sample 11 G+ cocci Staphylococcus aureus Microccocus luteus

Student/sample 12 G+ cocci Staphylococcus epidermidis Staphylococcus hominis

Student/sample 13 G+ cocci Not determined -student dropped ND

Student/sample 14 G+ cocci Not determined -student dropped Staphylococcus cohnii

Student/sample 15 G- cocci Neisseria cinerea or Neisseria flavescens Microccocus luteus

Student/sample 16 G+ bacilli Micrococcus luteusDermacoccus nishinomiyaensis (aka: Micrococcus

nishinomiyaensis)

Student/sample 17 ND Not determined -student dropped ND

Traditional Methods of Identification• Aseptic techniques

• Staining : Negative – morphology, Gram staining –

cell wall wall composition, Structural staining –

capsular & endospore

• Temperature, pH, Oxygen and special media

requirements

• Biochemical tests

Molecular Methods of Identification• DNA isolation (MOBIO power soil DNA isolation

kit)

• Polymerase chain reaction

• gene amplification primers:

8F: GCGGATCCGCGGCCGCTGCAGAGTTTGATCCTGGCTCAG1492R: GGCTCGAGCGGCCGCCCGGGTTACCTTGTTACGACTT

• Gel Electrophoresis 16SrRNA sequencing

• NCBI – microbe blast

Holt, J.G. Krieg, N.R., Sneath, P.H.A., Staley, J.T., Williams, S.T. (1994). Bergey's Manual of Determinative Bacteriology. Ninth Edition. Lippincott Williams & Wilkins.

Leboffe, M.J., Pierce, B.E., (2012)Microbiology Laboratory Theory & Application, 2nd Edition. Morton Publishing.

Tortora, G. J., Funke, B. R., & Case, C. L. (2015). Microbiology: Mastering Microbiology with e-text: an introduction, books a la carte edition. Benjamin-Cummings.

LaGuardia’s Undergraduate Research Symposium Organizing Committee. Ms. Lhamo Tshering and CLTs for preparing microbiological media and reagents to conduct our experiments. SCB 260.238A&B – Fall 2016 Class for their efforts and contribution of the data for this project.

Future Directions

• Embed co-curriculars in curriculum

• Expand and diversify partnerships

• Strengthen pedagogical elements in First Year Seminar

• Collaborate with non-STEM faculty

Questions? Feedback?

Ideas?