Annals of Microbiology, 59 (3) 587-592 (2009)

Immune response of peripheral blood mononuclear cells to avian pathogenic Escherichia coli

Hassan H. MUSA1,2, Sheng L. WU1, Chun H. ZHU1, Jun ZHU1, Guo Q. ZHU1*

1College of Veterinary Medicine, Yangzhou University, Yangzhou, 225009, China2Faculty of Veterinary Science, University of Nyala, Nyala, 155, Sudan

Received 6 April 2009 / Accepted 10 July 2009

Abstract - The exposure of chicken peripheral blood mononuclear cells (PBMCs) to pathogen can induce a rapid change in both pro-inflammatory and anti-inflammatory cytokine gene expression. Chicken PBMCs were infected with avian pathogenic Escherichia coli (APEC) and the isogenic fimH mutants of APEC, PBMCs immune response was determined by semi-quantitative RT-PCR. The results demonstrated that PBMCs were expressed TLR1/6/10, TLR3, TLR4, TLR5 and TLR7. APEC and non pathogenic E. coli strains were significantly (P < 0.05) increased the expression of IL-1β, IL-8, IL-18 and TGF-β4 cytokines compared to the isogenic fimH mutants. In addition, the opsonized avian pathogenic E. coli strains were significantly (P < 0.05) increased the expression of cytokines com-pared to the non-opsonized strains, whereas the opsonized avian non-pathogenic E. coli strain was significantly (P < 0.05) decreased the expression of cytokines compared to the non-opsonized strain. PBMCs are important in APEC infection, the increase in cytokines expression may play important role in the regulation of immune response.

Key words: cytokines; PBMCs; Escherichia coli; chickens.

INTRODUCTION

Avian pathogenic Escherichia coli (APEC) infections are responsi-ble for significant economic losses in the poultry industry world-wide. Serotypes O1, O2 and O78, are commonly implicated in avian colibacillosis, and most are elaborate type 1 fimbriae (Orskov and Orskow, 1992; La Ragione and Woodword, 2002), which characterized by their ability to bind D-mannose and thus bind to many types of eukaryotic cells and various inflamma-tory cells (Hornick et al., 1991). Binding is conferred by the adhesin FimH a minor component of the fimbriae (Krogfelt et al., 1990). Lymphocytes are an important part of the adap-tive immunity against infections (Gronlund et al., 2006), they produce cytokines which stimulate antibody production, induce local inflammation and enhance the phagocytic and microbicidal activities of macrophage (Abbas and Lichtman, 2003). Peripheral blood mononuclear cells (PBMCs) act as the main effectors via the functional regulation of cytokines such as interleukins and interferon-γ. The important role of PBMCs is well established, and has been demonstrated in experimental models (Kim et al., 2008). Recognition of potential pathogenic microbes by the immune system is the function of a class of cellular receptors known as the pattern recognition receptors (PRRs), which include Toll-like receptors (TLRs) (Igbal et al., 2005; Harris et al., 2006). Toll-

like receptors are a family of germline-encoded innate immune receptors that recognize pathogen-associated molecular pat-terns, such as bacterial flagellin, LPS and lipopeptides induce signaling through TLR5, TLR4 and TLR1/2/6, respectively (Akira et al., 2006). Double strand RNA stimulates TLR3 (Alexopoulou et al., 2001), and single stranded viruses stimulates TLR7 (Heil et al., 2004). The ability of TLRs to recognize a broad spectrum of microbial molecules enables the host to detect the presence of pathogens rapidly, before a more widespread infection occurs (Harris et al., 2006). Escherichia coli is recognized by several TLRs, including TLRs 2, 4, 5, and 11, and likely TLR9 (Andersen-Nissen et al., 2007). In human and mice eleven TLRs have been identified with each member recognizing and responding to dif-ferent microbial components (Kogut et al., 2005a). In chicken TLR 1/6/10, TLR2 type 1, TLR2 type2, TLR3, TLR4, TLR5 and TLR7 were similarly identified (Fukui et al., 2003; Igbal et al., 2005; Kogut et al., 2005a). Heterophils expressed IL-18, IL-1β, IL-6, IL-8 and TGF-β4 upon stimulation that is initiated by recep-tor-mediated phagocytosis (Kogut et al., 2005b; Swaggerty et al., 2004). In vitro and in vivo studies have shown that APEC adheres to tracheal and pharyngeal cells, whereas their FimH mutants are unable to adhere to the cells (Marc et al., 1998). Mellata et al. (2003) indicated that type1 fimbriae can protect bacteria against the bactericidal effect of phagocytes. Kaiser et al. (2006) dem-onstrate that exposure of chicken PBMC to Salmonella enteri-tidis can induce a rapid change in both pro-inflammatory (IL-6, CXCLi2) and anti-inflammatory (TGF-β4) cytokine gene expres-

* Corresponding Author. E-mails: hassan_hm30@yahoo.com; yzgqzhu@yzu.edu.cn

588 H.H. MUSA et al.

sion. In this study we determined the expression of cytokines in peripheral blood mononuclear cells (PBMCs) after infection with wild type APEC and their isogenics fimH mutants. Understanding the distribution patterns of chicken TLR will enable more defined interpretation of immune induction and the host-pathogen rela-tionships that define infectious disease biology in the chicken. In addition, PBMCs functional efficiency and cytokines production may be useful biomarkers for development of immunocompetent chickens.

MATERIALS AND METHODS

Experimental animals. Green shell egg fowl chicks were obtained on the day-of-hatch from the hatchery of Poultry Institute, Chinese Academy of Agricultural Sciences, Yangzhou, China and placed in floor pens. Birds were provided supplemental heat, water and a balanced, unmedicated chick based ration ad libitum.

Bacterial strains and growth condition. The avian pathogenic Escherichia coli (APEC) strains serotype (O78:K89, O1:K89 and O2:K89) and non-APEC strain serotype (O24:K89) were used as a prototypes of E. coli type 1 fimbriae. Their isogenic FimH mutants (O78:K89ΔfimH, O1:K89 ΔfimH, O2:K89ΔfimH and O24:K89ΔfimH) were constructed by λ Red-mediated recombina-tion system (He et al., 2008). Expressed FimH from wild types and non expressed from mutants were confirmed by the ability of agglutination reaction with both guinea pig erythrocytes and yeast cells. All strains were grown in LB broth at 37 °C for 48 h to allow a high level of expression of type 1 fimbriae.

Opsonization of bacteria. The APEC bacteria were opsonized as previously described (Mellata et al., 2003). Briefly, APEC (109 CFU/ml) were suspended in 25% hyper-immune serum from adult chickens immunized against inactivated APEC solution, incubated at 37 °C for 30 min, washed twice with HBSS and used immediately.

Peripheral blood mononuclear cells isolation. Avian periph-eral blood mononuclear cells (PBMCs) were isolated from the peripheral blood of two day-old chickens following an established protocol (Kaiser et al., 2006). Briefly blood from chickens was collected in tube containing disodium ethylenediaminetetraacetic acid (EDTA) and mixed thoroughly. The blood and EDTA was diluted 1.5:1 with RPMI-1640 media containing 1% methylcel-lulose (Sigma-Aldrich, USA) and centrifuged at 1000 rpm for 15 min. The serum and buffy coat layers were retained and suspended in an equal volume of Ca2+, Mg2+ free Hanks bal-anced salt solution (HBSS). This suspension was layered over a discontinuous Histo-paque 1077 gradient (Sigma-Aldrich).The gradient was then centrifuged at 2000 rpm for 45 min. After centrifugation, the interfaces and band containing the PBMCs was collected into a new tube and washed twice in HBSS and resus-pended in fresh RPMI 1640 media. Cell viability was determined by trypan blue exclusion, and the purity of the cell was assessed by microscopic examination of Wright-Giemsa Stain smears. The cell concentration was adjusted to 1 x 107 cells of PBMCs/ml and stored on ice until used.

Bacterial infection of peripheral blood mononuclear cells. The PBMCs (1 x 107 cells/ml) suspended in RPMI-1640 medium without antibiotics served as control to establish basal cytokine levels. PBMCs were infected with opsonized and non opsonized

bacteria strains (wild type 1 fimbriae and isogenic fimH mutant) at a multiplicity of infection (MOI) of 100 per cell in 1.5 ml Eppendorf tube at 37 °C for 1 h.

Primers. Chicken TLRs primers used for semi-quantitative RT-PCR were designed by Kogut et al. (2005a), while TLR5 and cytokines primers were designed based on their gene sequence in gene bank (Tables 1 and 2).

RNA extraction and semi-quantitative RT-PCR analysis. The untreated PBMCs and treated PBMCs were pelleted by centrifugation at 8000 x g for 2 min. Total RNA was extracted in the presence of buffer containing β-mercaptoethanol and guanidine using RNAiso plus kit (Takara Biotechnology Dalian, Co. LTD, China) following manufacturer’s instructions eluted with 40 μl RNase-free water. Total RNA was measured using a Nano Drop ND-1000 Spectrophotometer (Nano Drop Technologies, Wilmington, USA) and a purity (A260/A280) of > 1.8 was used. Two hundred and fifty ng of total RNA from each sample was transcribed into cDNA using the Takara reverse transcription kit (Takara Biotechnology Dalian, Co. LTD) according to manufac-turer’s instructions. Briefly, oligo dT Primer (50 μM) was used to reverse transcribe 250 ng/μg of respective RNA in the presence of dNTPs mixture (10 mM each), 5X PrimeScriptTM buffer, RNase Inhibitor (40 U/μl) and PrimeScriptTM RTase (200 U/μl) at 42 °C for 60 min following inactivation at 95 °C for 5 min, all RNA preparations were standardized by RT-PCR for β-actin. Polymerase chain reactions (PCR) were performed with the primers indicated in Table 1 and Table 2. Briefly, cDNA (2 μl) was reacted with 250 mM dNTPs, 1X reaction buffer (Takara Biotechnology Dalian, Co. LTD), forward and reverse primers (5 pM) and 0.4 units Taq polymerase in a 25 μl final reaction volume. PCR conditions were as follows, 1 cycle of 94 °C for 4 min, followed by 30 cycles at 94 °C for 1 min, 55 °C for 1 min and 72 °C for 1 min, followed by 1 cycle at 72 °C for 10 min. Each PCR product (7 μl) was electrophoresed on a 2% agarose gel (Gene Tech. Shanghai Company limited) in 1X TBE buffer at 60 V for 45 min and visualized with ethidium bromide under UV light (BIORAD).

Statistical analysis. Semi-quantitative analysis for cytokines was performed by image Quant TL (Amersham Biosciences, USA). Data was presented as mean and standard error of mean, differences between wild type and their isogenic fimH mutants and between opsonized and non-opsonized strains were deter-mined by student t-test, P < 0.05 was considered to be signifi-cant, analysis was performed by SAS.

RESULTS

Cytokine expression in PBMCsChickens PBMCs were expressed TLR1/6/10, TLR3, TLR4, TLR5 and TLR7 mRNA (Fig. 1). The level of cytokines expression was significantly increased upon stimulation with avian pathogenic and non-pathogenic E coli.

IL-1β expression following stimulation IL-1β acts in many cells as an inflammatory mediator, the stimu-lation of PBMCs with APEC and fimH mutant of APEC increased quantitatively IL-1β expression compared to non-stimulated con-trol PBMCs. The wild type of APEC O1:K89 and O2:K89 strains increased significantly (P < 0.05) the expression of IL-1β com-pared to the isogenic fimH mutants (Fig. 2A). The opsonized

Ann. Microbiol., 59 (3), 587-592 (2009) 589

APEC O2:K89 and O78:K89 strains were significantly (P < 0.05) expressed higher IL-1β whiles the opsonized non-pathogenic E. coli O24:K89 strain was significantly (P < 0.05) expressed lower IL-1β. Similarly the opsonized O1:K89, O2:K89 and O78:K89 mutant strains were significantly (P < 0.05) expressed higher IL-1β, while the opsonized O24:K89 mutant strain was signifi-cantly (P < 0.05) expressed lower IL-1β (Fig. 2B).

IL-8 expression following stimulationIL-8 is a chemokine involved in the recruitment of PBMCs to the site of infection. In this study all wild type and the isogenics fimH mutants strains were increased IL-8 expression compared

to the control. Only O2:K89 strain was found significantly (P < 0.05) expressed higher IL-8 compared to fimH mutant strain (Fig. 3A). Similarly, IL-8 expression was significantly (P < 0.05) increased when PBMCs was infected with opsonized APEC (wild and mutant) strains compared to non-opsonized strains, while in non-pathogenic (wild and mutant) strain the opsonization signifi-cantly (P < 0.05) decreased IL-8 expression (Fig. 3B).

IL-18 expression following stimulation IL-18 is critical in initiating an inflammatory response and involved in determining resistance or susceptibility to bacterial infection. The wild type APEC O1:K89, O2:K89 and O78:K89 strains signifi-

TABLE 1 - Sequence of TLR primers used in semi-quantitative RT-PCR

Primer* Sequence Accession numberTLR1/6/10 F 5 CGGAAAGCCTATCATTGTCA 3 BQ484541/BU471924TLR1/6/10 R 5 TTTGTCTGCGTCCACTGC3 BQ484541/BU471924TLR2 Type1 F 5 TTAAAAGGGTGTGCCAGGAG3 AB050005TLR2 Type1 R 5 GTCCAAACCCATGAAAGAGC3 AB050005TLR2 Type2 F 5 AGGCACTTGAGATGGAGCAC3 AB046533TLR2 Type2 R 5 CCTGTTATGGGCCAGGTTTA3 AB046533TLR3 F 5 CCACTCTGGAAGAAAATGAGC3 BI066273

TLR3 R 5 TCATTCTCACCGCTTTTCAG3 BI066273TLR4 F 5 AGTCTGAAATTGCTGAGCTCAAAT3 AY064697TLR4 R 5 GCGACGTTAAGCCATGGAAG 3 AY064697TLR5 F 5 CCACATCTGACTTCTGCCTTT 3 AJ626848TLR5 R 5 CAGCTAGGGTTACATTGGTTTC 3 AJ626848TLR7 F 5 GCCTCAAGGAAGTCCCCAGA 3 AJ632302TLR7 R 5 AAGAAACATTGCATGGATTACGG3 AJ632302β-actin F 5 TGCTGTGTTCCCATCATCG 3 L08165β-actin R 5 TTGGTGACAATACCGTGTTCA 3 L08165

* F, refer to forward; R, refer to reverse.

TABLE 2 - Sequence of interleukins primers used in semi-quantitative RT-PCR

Primer* Sequence Accession numberIL-1 β F 5 GTG GCA CTG GGC ATC AAG GG 3 AJ245728IL-1 β R 5 CAG GGA GGT GCA GAT GAA C 3 AJ245728IL-8 F 5 GCC CTC CTC CTG GTT TCA 3 AJ009800IL-8 R 5 TGC TGG CAT GTA TAA AGA AGA GAG 3 AJ009800

IL-18 F 5 CCA TGC ACA TAA TAC TGA G 3 AJ416937IL-18 R 5 AGT CGA TTG CTA CAG AAA G 3 AJ416937TGF-β4 F 5 AAG GAT CTG CAG TGG AAG TGG A 3 M31160TGF-β4 F 5 CAT TCC GGC CCA CGT AGT AA 3 M31160

* F, refer to forward; R, refer to reverse.

FIG. 1 - TLRs mRNA expression in chicken peripheral blood mononuclear cells (PBMCs). Lane 1: DL2000 Marker, lane 2: Beta actin, lane 3: TLR1/6/10, lane 4: TLR2 type 1, lane 5: TLR2 type 2, lane 6: TLR3, lane 7: TLR4, lane 8: TLR5, lane 9: TLR7.

590 H.H. MUSA et al.

cantly (P < 0.05) expressed higher IL-18 compared to the isogen-ic fimH mutants (Fig. 4A).The opsonized APEC O1:K89, O2:K89 and O78:K89 wild strains and the opsonized APEC O2:K89 and O78:K89 mutant strains significantly (P < 0.05) expressed higher IL-18 compared to non opsonized strains, whereas the opsonized non pathogenic (wild and mutant) O24:K89 strain significantly (P < 0.05) expressed lower IL-18 (Fig. 4B).

TGF-β4 expression following stimulationThe wild type pathogenic and non-pathogenic strains were sig-nificantly (P < 0.05) increased the expression of TGF-4 compared to the isogenics fimH mutant strains (Fig. 5A). The opsonized APEC (wild and mutant) O1:K89 and O2:K89 strains and non-pathogenic (wild and mutant) O24:K89 strains were significantly (P < 0.05) expressed lower TGF-β4 compared to non-opsonized

FIG. 3 - IL-8 mRNA expression in chicken peripheral blood mononuclear cells (PBMCs) stimulated with avian pathogenic Escherichia coli and avian non pathogenic E. coli and their isogenic fimH mutants. A: compared the relative ratio of IL-8/beta actin (%) between control PBMCs, APEC and isogenic fimH mutants. B: compared the relative ratio of IL-8/beta actin (%) between opsonized and non-opsonized strains.

FIG. 4 - IL-18 mRNA expression in chicken peripheral blood mononuclear cells (PBMCs) stimulated with avian pathogenic Escherichia coli and avian non pathogenic E. coli and their isogenic fimH mutants. A: compared the relative ratio of IL-18/beta actin (%) between control PBMCs, APEC and isogenic fimH mutants. B: compared the relative ratio of IL-18/beta actin (%) between opsonized and non-opsonized strains.

FIG. 2 - IL-1β mRNA expression in chicken peripheral blood mononuclear cells (PBMCs) stimulated with avian pathogenic Escherichia coli and avian non pathogenic E. coli and their isogenic fimH mutants. A: compared the relative ratio of IL-1β/beta actin (%) between control PBMCs, APEC and isogenic fimH mutants. B: compared the relative ratio of IL-1β/beta actin (%) between opsonized and non-opsonized strains

Ann. Microbiol., 59 (3), 587-592 (2009) 591

strains. The opsonized pathogenic (wild and mutant) O78:K89 strain expressed significantly (P < 0.05) higher TGF-β4 compared to non-opsonized strains (Fig. 5B).

DISCUSSION

The interacting cellular and molecular pathways of inflam-mation and immunity were evolved to protect the host from pathogens (Kogut, 2000). Both inflammatory responses and specific immune responses to invasive microbes are controlled by a complex network of cytokines (Fresno et al., 1997). As regulators of the initiation and maintenance of host defenses, cytokines ultimately determine the type of response generated and the effector mechanisms generated to mediate resistance (Kogut, 2000). In this study APEC strains and their isogenic fimH mutants were used to stimulate the immune response of PBMCs. The highly pathogenic E. coli have virulence factors that cannot be found in commensal strains or strains with lower pathogenc-ity. Pourbakhsh et al. (1997) demonstrated that expression of F1 fimbriae lead to rapid bacterial killing by chicken macrophages in the in vitro assay. Most studies examine the cellular expression of TLRs on immune cells have focused on neutrophils, monocytes and dendritic cells, but there is little evidence of TLRs being expressed on lymphocytes (Dasari et al., 2005). Our results showed that PBMCs was expressed TLR1/6/10, TLR3, TLR4, TLR5 and TLR7. Iqbal et al. (2005) reported that the peripheral blood monocyte-derived macrophages expressed considerable levels of TLR4 and TLR1/6/10, moderate levels of TLR2 type2, low but detectable levels of TLR5 and TLR7 and TLR3 or TLR2 type1 mes-sage. The patterns of chicken TLRs mRNA expression in immune cell subsets are broadly similar to those detected in mammalian species (Zarember and Godowski, 2002). Activation of the TLR signal transduction pathway leads to the induction of numerous genes that function in host defence, including those for inflam-matory cytokines, chemokines, antigen presenting molecules and costimulatory molecules (Harris et al., 2006). FimH through specific ligand-receptor interactions can trigger various responses in cells involved in host defenses such as mac-rophage, lymphocytes B and neutrophils (Arne et al., 2000). In the present study the expression of IL-1β, IL-8, IL-18 and TGF-β4 were significantly (P < 0.05) increased in response to wild type and fimH mutant of avian pathogenic E. coli. The production of chemokines stimulates migration of lymphocytes to the site of inflammation and switches initial immune reactions to the antigen-

specific mechanisms of the cellular immune response (Moser et al., 2004). Kogut et al. (2005a) reported that the bacterial TLR agonists (peptidoglycan, lipopolysaccharide and flagellin) induced up-regulation of IL-1β, IL-6 and IL-8 mRNA when compared to the non-stimulated controls. Avian Influenza Virus infection to PBMCs from chickens induced nearly 20-fold IL-1 β, whereas, from ducks IL-1 β was strongly suppressed (Adams et al., 2008). In addition, Swaggerty et al. (2004) indicated that heterophils from Salmonella enteritidis-resistant chickens had significantly higher levels of IL-6, IL-8 and IL-18 mRNA expression, and lower level of TGF-β4 upon treatment with all agonists compared to heterophils from SE-susceptible lines. In neonatal chickens, an IL-8-like chemokine is involved in heterophils recruitment to the site of infection in neonatal chickens following an intraperitoneal challenge with SE (Kaiser et al., 2000). Therefore, the increase in IL-1β, IL-8 and IL-18 expression by immune cells is associated with increased resistance to extraintestinal pathogen infections in neonatal chickens (Swaggerty et al., 2004). In the present study the opsonized pathogenic strains stimulated significantly (P < 0.05) higher cytokines expression compared to non-opsonized. In contrast, the opsonized non-pathogenic strain decreased the level of cytokines expression. Mellata et al. (2003) indicated that the opsonized APEC was highly associated with heterophills when compared with non-opsonized bacteria. Heterophils exposed to opsonized and non-opsonized SE enhance both the innate and acquired immune response, by the increased transcription of both pro-inflammatory and Th 1 cytokine genes (Kogut et al., 2005b). The expression of IL-8 and IL-18 cytokines was significantly higher in the opsonized SE compared to non-opsonized SE (Swaggerty et al., 2004). The susceptibility of E. coli isolates to phagocytosis by PBMCs in the absence of opsonins correlated with the degree of F1 fimbriation (Poubakhsh et al., 1997). Mellata et al. (2003) noted that in the absence of type 1 fimbriae bacteria was poorly associ-ated with macrophages and opsonization had little effect on it. In conclusion, our finding demonstrated that PBMCs are expressed Toll-like receptors, and after activation with pathogen increased significantly the levels IL-1β, IL-8, IL-18 and TGF-β4 expression. Therefore, PBMCs are important in APEC infection, and the increase in cytokines may play important role in the regulation of immune response.

AcknowledgementsThis study was supported by grants from China Postdoctoral Science Foundation (No. 20070420201), the Chinese National Science Foundation Grant (No. 30571374 and No. 30771603),

FIG. 5 - TGF-β4 mRNA expression in chicken peripheral blood mononuclear cells (PBMCs) stimulated with avian pathogenic Escherichia coli and avian non pathogenic E. coli and their isogenic fimH mutants. A: compared the relative ratio of TGF-β4/beta actin (%) between control PBMCs, APEC and isogenic fimH mutants. B: compared the relative ratio of TGF-β4/beta actin (%) between opsonized and non-opsonized strains.

592 H.H. MUSA et al.

the Chinese National Science Grant 863 projects (No. 2007AA10Z357), Jiangsu High Education Key Basic Science Foundation (08KJA230002) and Ministry of Agriculture of the People’s Republic of China (Grant No. 200803020).

REFERENCES

Abbas A.K., Lichtman A.H. (2003). Immunity to microbes. In: Melley J., Ed., Cellular and Molecular Immunology. Elsevier Science, Philadelphia, pp. 345-366.

Adams S.C., Xing Z., Cardona C.J. (2008). Differing cytokine expression profiles in chicken and duck mononuclear cells in response to a duck-origin Avian Influenza Virus. FASEB J., 22: lb561.

Akira S., Uematsu S., Takeuchi O. (2006). Pathogen recognition and innate immunity. Cell, 124: 783-801.

Alexopoulou L., Czopik A., Medzhitov R., Flavell R.A. (2001). Recognition of double-stranded RNA and activation of NFkB by Toll-like receptor 3. Nature, 413: 732-738.

Andersen-Nissen E., Hawn T.R., Smith K.D., Nachman A., Lampano A.E., Uematsu S., Akira S., Aderem A. (2007). Cutting edge: TLR5 -/- mice are more susceptible to Escherichia coli urinary tract infection. Immunology, 178: 4717-4720.

Arne P., Marc D., Bree A., Schouler C., Dho-Moulin M. (2000). Increased tracheal colonization in chickens without impairing pathogenic properties of avian pathogenic Escherichia coli MT78 with a fimH deletion. Avian Dis., 44: 343-355.

Dasari P., Nicholson I.C., Hodge G., Dandie G.W., Zola H. (2005). Expression of toll-like receptors on B lymphocytes. Cellul. Immunol., 236: 140-145.

Fresno M., Kopf M., Rivas L. (1997). Cytokine and infectious dis-eases. Immunol. Today, 18: 56-58.

Fukui A., Inoue N., Matsumoto M., Nomura M., Yamada K., Matsuda Y. (2003). Molecular cloning and functional charac-terization of chicken Toll like receptors. J. Biol. Chem., 276: 143-149.

Gronlund U., Johannisson A., Persson W.K. (2006). Changes in blood and milk lymphocyte sub-populations during acute and chronic phases of Staphylococcus aureus induced bovine mastitis. Res. Vet. Sci., 80: 147-154.

Harris G., Kuoless R., Chen W. (2006). Role of Toll-like recep-tors in health and diseases of gastrointestinal tract. World Gastrointestinal, 12: 2149-2160.

He S.F., Yuan Z.W., Zhu G.Q. (2008). Construction and characteri-zation of type1 fimbriae fimH deletion mutant from avian path-ogenic Escherichia coli. Acta Microbiologica Sinica, 48: 1-5.

Heil F., Hemmi H., Hochrein H., Ampenberger F., Kirschning C., Akira S. (2004). Species-specific recognition of single-stranded RNA via Toll-like receptor 7 and 8. Science, 303: 1526-1529.

Hornick D.B., Allen B.L., Horn M.A., Clegg S. (1991). Fimbrial types among respiratory isolates belonging to the family Enterobacteriaceae. Clin. Microbiol., 29: 1795-1800.

Iqbal M., Philbin V.J., Smith A.L. (2005). Expression patterns of chicken Toll-like receptor mRNA in tissues, immune cell subsets and cell lines. Vet. Immunol. Immunopath., 104: 117-127.

Kaiser P., Rothwell L., Galyovl E.E., Barrow P.A., Burnside J., Wigley P. (2000). Differential cytokine expression in avian cells in response to invasion by Salmonella typhimu-rium, Salmonella enteritidis and Salmonella gallinarum. Microbiology, 146: 3217-3226.

Kaiser M.G., Cheeseman J.H., Kaiser P., Lamont S.J. (2006). Cytokine expression in chicken peripheral blood mononuclear cells after in vitro exposure to Salmonella enterica serovar Enteritidis. Poultry Sci., 85: 1907-1911

Kim W.K., Cho H.J., Ryu S.I., Hwang H.R., Kim D.H., Ryu H.Y., Chung J.W., Kim T.Y., Park B. C., Bae K. H., Ko Y., Lee S.C. (2008). Comparative proteomic analysis of peripheral blood mononuclear cells from atopic dermatitis patients and healthy donors. BMB Reports, 41: 597-603.

Kogut M.H. (2000). Cytokines and prevention of infectious dis-eases in poultry: a review. Avian Pathol., 29: 395-404.

Kogut M.H., Rothwell L., Kaiser P. (2005a). IFN gam priming of chicken heterophils upregulates the expression of proinflam-matory and Th1 cytokine mRNA following receptor-mediated phagocytosis of Salmonella enterica serovar Enteritidis. J. Interferon Cytokine Res., 25: 73-81.

Kogut M.H., Iqbal M., He H., Philbin V., Kaiser P., Smith A. (2005b). Expression and function of Toll-like receptors in chicken heterophils. Dev. Comp. Immunol., 29: 791-807.

Krogfelt K.A., Bergmans H., Klemm P. (1990). Direct evidence that the FimH protein is the mannose-specific adhesin of Escherichia coli type 1 fimbriae. Infect. Immun., 58: 1995-1998.

La Ragione R.M., Woodward M.J. (2002). Virulence factors of Escherichia coli serotypes associated with avian colisepticae-mia. Res. Vet. Sci., 73: 27-35.

Marc D., Arne P., Bree A., Dho-Moulin M. (1998). Colonization ability and pathogenic properties of a fim_mutant of an avian strain of Escherichia coli. Res. Microbiol., 149: 473-485.

Mellata M., Dho-Moulin M., Dozois C.M., Curtiss R., Lehoux B., Fairbrother J.M. (2003). Role of avian pathogenic Escherichia coli virulence factors in bacterial interaction with chicken het-erophils and macrophages. Infect. Immun., 71: 494-503.

Moser B., Wolf M., Walz A., Loetscher P. (2004). Chemokines: mul-tiple levels of leukocyte migration control. Trends Immunol., 25: 75-84.

Orskov F., Orskov I. (1992). Escherichia coli serotyping and dis-ease in man and animals. Can. J. Microbiol., 38: 699-704.

Pourbakhsh S.A., Boulianne M., Martineau-Doize B., Dozois C.M., Desautels C., Fairbrother J.M. (1997). Dynamics of Escherichia coli infection in experimentally inoculated chick-ens. Avian Dis., 41: 221-233.

Swaggerty C.L., Kogut M.H., Ferro P.J., Rothwell L., Pevzner I.Y., Kaiser P. (2004). Differential cytokine mRNA expression in heterophils isolated from Salmonella-resistant and -suscepti-ble chickens. Immunology, 113: 139-148.

Zarember K.A., Godowski P.J. (2002). Tissue expression of human Toll-like receptors and differential regulation of Toll-like receptor mRNAs in leukocytes in response to microbes, their products, and cytokines. J. Immunol., 168: 554-561.