Upload
others
View
2
Download
0
Embed Size (px)
Citation preview
IMMACULATE CONCEPTION CATHOLIC CHURCH
SPARKS, NV
April 15, 2018
IMMACULATE CONCEPTION CATHOLIC CHURCH
MISSION STATEMENT
We, the people of Immaculate Conception Parish, are called to be Holy, and to serve all people faithfully with compassion and respect.
OUR MOTTO
“Diversitas intra Unitatem” “Diversity within Unity”
THE CHURCH
2900 North McCarran Blvd Sparks NV 89431 Parish Office 358-5977 Fax 775-403-2174 Email [email protected] Parish Website icsparks.org Diocesan Website www.renodiocese.org
Office Hours M-F: 8:30 am - 4:00 pm Pastor Fr Philip George Parochial Vicar Fr Ariel Arias Fr Joseph Walsh Liturgical Coordinator Maria Hernandez Office Admin Karen Becerra Custodian Rachel Dixon
RELIGIOUS EDUCATION FOR OUR YOUTH
Elementary Director Dorothy Gonzalez Wednesdays 4:00 - 7:30 pm 358-5989 August - May
Middle/High School Director DeeDee Cenac Mondays 6:00 - 7:30 pm 358-5989 August - May
Confirmation Director Gabriela Woodward Sundays 1:30 - 4:30 pm 358-5989 August - May
SCHEDULE OF MASS
Saturday: 9:00 am (Daily Mass), 5:00 pm (Vigil Mass)
Sunday: 7:30, 9:30, & 11:30 am, 2:00 (Spanish) & 5:00 pm
Weekdays: 9:00 am; Wednesday: 6:00 pm; First Fridays: 6:00 pm
Holy Day Masses: 6:00 pm (Vigil Mass), 9:00 am, 12:10 & 6:00 pm
CELEBRATION OF THE SACRAMENTS
Baptism We welcome all families with young children.
The 1st step for the parents is to attend a class; they are held on the 1st Wednesday of every month at 6:00 pm. When choosing your child’s Godparents, they must be baptized, confirmed, receive communion regularly in the Church, and if married, must be married in the Catholic Church.
Español bautismo las clases se imparten en el primer miércoles de cada mes a las 6:00 horas en la sala. Para obtener más información, por favor llame 358-5977.
Weddings Couples should allow 4-6 months or more for preparation prior to the anticipated wedding date. Call for appointment.
Funerals A representative of the deceased should contact the Parish Office to make arrangements.
Confession Weekdays after Mass; Saturday 3:00-4:30 pm
or by appointment.
CELEBRATIONS
Celebraciones Quinceañeras
Para los arreglos, por favor llame 358-5977
3RD SUNDAY OF EASTER 3
MASS INTENTIONS FOR APRIL 15
Saturday, April 14 9:00 am + June Linssen
5:00 pm + Baker, Wright, Meyers Families
Sunday, April 15 7:30 am Parishioners by our Pastor
9:30 am + Mascarenas, Baca, Bell, Block, and Leary Families
11:30 am + Andres G Trujillo, Jr
2:00 pm + Salvador Garcia
5:00 pm + George Forbush Family
Monday, April 16
9:00 am + Ana Phuong Nguyen
Tuesday, April 17
9:00 am Save the Holy Innocents and Leena & Richard Fernandes
Wednesday, April 18 9:00 am All Souls in Purgatory
6:00 pm + Lopez-Cortez Family
Thursday, April 19 9:00 am + Gene Siroky
Friday, April 20 9:00 am Oscar Baber
Saturday, April 21 9:00 am + Guillermina Munoz
5:00 pm + Howard Meehan
Sunday, April 15Sunday, Ap 157:30303030303030303030303030303030 a a a a a a a a a a a a a a a a a a a a a a a a a a a am Parishioners by our Pastor
9:9:9:9:9:9:9:9:9:9:9:3030303030 a am m m m m m m m m m m m m + + + + + + + + M M M M M M M M M M M M M M M M M Mascarenas, Baca, Bell, Block,anand d d d d d d d d d d d d d d LeLeLeLeLeLeLeLeLeLeLeLeLeary Families
1111111111111111111111:30 amamamamamamamamam + + + + + + + + + + + + + + + + + Andrererererererereres s s s s s s s s s s s s s s s s s G G Trujillo, Jr
2:000000 p p p p p p p p p p p p p p p p p p p p p p p p pm m m m m m m m m + + + + + + + + + + + + + + + Salvlvlvlvlvlvlvlvlvlvlvlvlvlvlvadadadadadadadadadadadadadadadadadoror G G G G G G G G G G G G G G G G Garcia
5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:000000000000000000000000000000 p pm m m m m m m m m m m + + + + + + + + + + + + + + + + + + + G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G Geoeoeoeoeorgrgrge e e e e e e e e e e e e e e e e e e e e e e e e e e e e e FoFoFoFoFoFoFoFoFoForbrbrbrbrbrbrbrbrbrbrbrbrbrbrbrbrbrbrbrbrbrbush Family
MoMoMoMoMoMoMoMoMoMoMoMoMoMoMoMondndndndndndndndndndndndndndndndndndayayayayayayayayayayayayayayayayayayayayayayayayayayayayayayayayay, , , , , , ApApApApApApApApApApApApApApApApApApApriril 16MoMoMondayayayayayayayayayayayayayayayay, ApApApApApApApApApApApApril 16
9:9:9:9:9:9:9:9:9:9:9:9:000000 am m m m m m m m m m m m m m + AnAna a a a a a a a a a a a a a a a a a PhPhPhPhPhPhPhPhPhPhPhPhPhPhPhPhPhPhPhPhuongngngngngngngngngngngngngngngngngngngngng N N N N N N N N N N N N N N N N N N N N N N N N N N N N Nguguguguguguguguguguguguguguguguguguguguguguguguguguguguyeyeyeyeyeyeyen
TuTuTuTuTuesdadadadadadadadadadadadadadadaday,y, April 177Tuesdadadaday, April 1777
9:000000000000000000000000000000000000000000000000000000 a am SaSaSaSaSaSaSaSaSaSaSaSaSaSaSaSaSaSaSaSaSaSaSaSaSaSaSaSaSaveveveveveveveveveveveveveveveveveveveveveveveveveveveveveveve t t t t t t t t t the Hololololololololololy y y y y y y y y y y y y y y y y y y y y y y InInInInInInInInInInInInInInInInInInInInInInInnocentsanananananananananananand d LeLeena & RiRiRiRiRiRichchchchchchchchcharard Fernandes
WeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWeWedndndndndndndndndndndndndndndndndndndndndndndndndndndndndndndndndndndndndndndndndnesesesesesesesesesesesesesesesdadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadaday,y,y,y,y,y,y,y,y,y,y,y,y,y,y,y,y,y,y,y,y,y,y,y,y,y,y,y,y,y,y,y,y,y,y,y,y,y, A A A A A A A A A A A A A A A A A Aprprprprprprprprprprprprprprprprprprprprprprprprprprprprprprprprprililil 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 18WeWeWeWeWednesdaday,y,y,y,y,y,y,y,y,y,y,y, Aprprprprprprprprprprprprprprprprprprilil 1 1 1 1 1 189:9:9:9:9:9:9:00 a a a a a a a a a a a a a a a a a a a a a a a a a a a am AlAlAlAlAlAlAlAlAlAll l l l SoSoSoSoSoSoSoSoSoululululululululululululululs ininininininininininininininininininininininin P P P P P P P P P P P P P P P P P P P P P P P P Purururururururururururururururururururururururgagagagagagagagagagagagagagagagagagagagagagagagatotototototototototototototototototototototototototototototoryryryryryryryryryryryryryryryryryryry
6:6:6:6:6:6:6:6:6:6:6:6:00000000000000000000 p p p p p pm m m m m m m m m m m m m m m m m m m m m + Lopopopopopopopopopezezezezezezezezezezezezezezezezezezezezezezezezezezezezezezezez-CoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCortrtrtrtrtrtrtrtrtrtrtrtrtrtrtrtrtrtrtrtrtrtrtrtrtrtezezezezezezezezezezezezezezezezezezezezezez F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F Famamamamamamamamamamamamamamamamamamamamamamililililililililililililililililililililililililililililililily y y y y y y y y y y y y y y y y
ThThThThThThThThThThThThThThThThThThThThThThThThThThThThThThThururururururururururururururururururururururururururururururururururururururururururursdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdayayayayayayayayayayayayayayay, ApApApApApApApApApApApApApApririririririririririririririril l l l l l l l l l l l l l l l l l l 19191919ThThurururururururursdsdsdsdsdsdsday, ApApApApApApApririril l l l 199:00 a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a am m m m m m m m m m m m m m m m + + + Genenenenenenenenenenenenenenenenenenenene e e e e e e e e e e e e e e e e SiSiSiSiSiSiSiSiSiSiSiSiSiSiSiSiSiSiSiSiSiSiSiSiSiSiSiSiSiSiSiSiSiSiSiSiSiSirorororororororororororororororororororororororororororororororokykykykykykykykykykykykykykykykykykykykykykykykykykykykykykykykykykykykykykykykykykykykyky
FrFrFrFrFrFrFrFrFrFrFrFrFrFrFrFrFrFrFrFrFrFrFrFrFrFridayayayayayayayayayayayayayayayayay, , , Apriririril l l l l l l l 2020202020FrFrFrFrFrFrFridayayayayayayayayayayay, , , , , April 209:9:9:9:9:9:9:9:9:9:9:9:9:9:9:0000000000000000000000000000000000000000000000000000 a a a a a a a a a a a a a a a a a a a a am m m m m m m OsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOscar Baber
Saturday, April 21
SECOND COLLECTION
Next Sunday Mandated by the U.S. Bishops Dear Brothers and Sisters in Christ, Sustaining pastoral work in rural dioceses in the United States is made possible through support of the Catholic Home Missions Appeal. This appeal supports essential pastoral outreach such as evangelization, seminary for-mation, aid to parishes, and lay ministry training. The commitment of the church in rural dioceses across the country Is not without challenge. Many of the parishes in mission dioceses are unable to support their core ministries largely due to long distances, priest short-ages and poverty. I ask that you please support this collection to help build up our Church at home. To learn more about the appeal and those who benefit from it, visit wwwusccb.org/home-missions. Thank you and God bless you. Sincerely yours in Christ Most Reverend Randolph R. Calvo Bishop of Reno
ST TERESA OF CALCUTTA
Between You and God
People are often unreasonable, irrational, and self-centered. Forgive them anyway. If you are kind, people may accuse you of selfish, ulterior motives. Be kind anyway. If you are successful, you will win some
unfaithful friends
and some genuine enemies. Succeed anyway. If you are honest and sincere people may deceive you. Be honest and sincere anyway. What you spend years creating, others could destroy overnight. Create anyway. If you find serenity and happiness, some may be jealous. Be happy anyway. The good you do today, will often be forgotten. Do good anyway. Give the best you have, and it will never be enough. Give your best anyway. In the final analysis, it is between you and God. It was never between you and them anyway.
FAREWELL MELODY
AND THE POBANZ FAMILY
Farewell Potluck Melody, Adam, James, Mary, Catherine, Daniella are moving to Utah this spring. Help us say goodbye on Sunday, May 6th, after the 11:30 Mass, with a Potluck in the Social Hall. Melody has been our Elementary Director of Religious Education for many years, President of the MOMS Group, and a member of the Finance Committee. Her four children are all Altar Servers. Adam has been working hard in the background - filling in for absent teachers, building and manning a booth at the Harvest Festival, and wherever help is needed. RSVP to Dorothy Gonzalez for who’s coming and what you will bring: 815-3595 or [email protected].
YOUR ASSISTANCE PLEASE
Donations needed (tax deductible) With many parish events coming soon, we are in need of paper products (plates, bowls, cups), plastic cutlery & disposable table-cloths to help keep our expenses down. If you are able to help, please drop your dona-tions at the parish office.
4
PARISH SAFETY MINISTRY
Safety is Everybody’s Business Upon the invitation of Fr. Philip and the recommendation of local law enforcement, a small group of parishioners began meeting to help address safety issues facing our beautiful church and parish family. Safety/disaster
issues strike without warning. Being prepared for such unexpected disasters is the objective of the Safety Ministry. Medical emergencies, fire, earthquake, active assailant events and even vehicle safety in the parking lots are just a few of the incidents the Safety Ministry will concentrate on going forward. Ministry members will also make routine surveys of the grounds to identify potential facility related issues that can be mitigated before any identified problem becomes an expensive repair. If you have questions, please contact Roger Pechacek at 951-760-0264 for more information.
Safety Ministry Note The next meeting of the ICSM is scheduled for Monday at 6:30 pm in the hall. The training will include a presentation on Nevada's Good Samaritan Law and a FEMA video entitled "You are the help until help ar-rives." Several "housekeeping" items will be discussed as the Ministry moves forward.
Safety Tip of the Week The beginning of this month has been extremely busy for Immaculate Conception Church. The ICSM thanks everyone who attended Mass or a special event for being safety minded both in the Church and in the parking lot. We do have a couple reminders for those parishioners using the parking lots: à Please remember not to park in the red zones at any time. à Please have a licensed driver in the vehicle when
standing at the yellow marked curbs. There is no parking allowed in the yellow spaces
à When using a handicapped parking space, and you do not have handicapped license plates, please be sure to display your current DMV issued handicapped
à placard in plain sight with nothing on top.
PARISH MINISTRIES
Prayer Groups BLD Charismatic Group Malou Alano 750-4279
Disciples of Jesus & Mary Jeannie Keyes 626-5694; Michele Jenkins 870-2208 Divine Mercy Committee Maria Hernandez 358-5977 Grupo de Oracion Gabriel Vallesteros 354-4748 Lay Carmelites Eileen Dana 882-2071 Prayer and Life Workshop Maria Hernandez 358-5977 Prayer Tree Laurie Jones 331-8311
George Mankowski 673-5975
Social Groups Comité Guadalupano Vicky Camacho 815-5290
Meets 3rd Monday of the month at 6:00 pm in the parlor. Healing Hearts Grief Support Group
Rachelle McCollum- Clapp 626-0696 or 846-8810 MOM’S Group Melody Pobanz 297-6962 Tongan Community Clay Vatikani 223-8816 or [email protected] Youth Group Gabriela Woodward 622-7878
Parish Outreach Groups 12-Step Recovery Ministry Frank Gomez 224-1764 Hospital visits Please call the Parish Office Martha Mary Ministry Call if you are homebound, death in family, senior rides to Mass, home from the hospital, etc. Karol Davis 425-6291; Connie Reid 626-5536 Prison Ministy Chaplain’s Office 328-2976; Maria C Hernandez 359-5674 or 356-9222
Respect Life Committee Toni Berry 356-2111
PARISH ORGANIZATIONS Ladies Guild President Phyllis Basso 358-4549
Meets 2nd Tuesday of the month at 7:00 pm in the social hall. All ladies of the parish are welcome.
Knights of Columbus GK Chris Pennington 313-5524
Meets 2nd Tuesday of the month at 7:00 pm in the faith for-mation bldg.
RCIA
LEARN YOUR FAITH/RCIA: an Invitation for
Conversion & Full Initiation into the Church
If you are someone or do you know someone who . . . àhas expressed an interest in becoming Catholic? à was baptized Catholic as a child, but has not celebrated the Sacraments of Confirmation & Eucharist? à would like to learn more about the Catholic
Faith?
à Everyone is welcome to attend! à Thursdays 7:00 - 8:00 pm - the next session begins
June 7
PARISH MINISTRIES AND ORGANIZATIONS
5 PARISH ACTIVITIES
1. Exodus 2. Revelation 3. Hebrews 4. Esther 5. Proverbs 6. Ruth 7. 1 and 2 Chronicles
CALENDAR OF EVENTS
Monday, April 16 6:00 am-9:45 pm Adoration of the Blessed Sacrament
9:00 am Mass
6:30 pm Prayer Workshop - nursery Safety Ministry - social hall
Tuesday, April 17 6:00 am-9:45 pm Adoration of the Blessed Sacrament
9:00 am Mass
Wednesday, April 18 6:00 am-9:45 pm Adoration of the Blessed Sacrament
9:00 am & 6:00 pm Mass
9:30 am MOMS Group - faith formation bldg. Child care will be provided from 9:00 - 11:00 am
10:00 am & 6:30 pm Prayer Workshop - nursery
Thursday, April 19 6:00 am-6:00 am Adoration of the Blessed Sacrament
9:00 am Mass
7:00 pm Spanish Healing Mass - faith formation bldg. All are welcome.
Misa de Sanación en la edificio de formación de fe.
Todos son bienvenidos.
Friday, April 20 6:00 am-5:00 pm Adoration of the Blessed Sacrament
9:00 am & 6:00 pm Mass
7:00 pm B.L.D. Charismatic Community
Saturday, April 21 9:00 am Daily Mass
5:00 pm Sunday Vigil Mass
Sunday, April 22 7:30, 9:30, 11:30 am Mass
2:00 pm Spanish Mass
5:00 pm Mass
CCD REGISTRATION Returning Students
Registration for the 2018-2019 School Year for returning students only will be ongoing during class time until the end of the current school year. Forms are available at the Faith Formation bldg.
KNIGHTS OF COLUMBUS OUR LADY OF
THE DESERT COUNCIL 12877 Annual $2,000 Scholarship Applications are now available in the gather-ing space under the bulletin board.
MARY’S CLOSET Donations needed
We are accepting donations of small new baby items to help families who choose life but just need a little extra help. Diapers, wipes, formula, bottles, onesies, burp cloths, blankets, and pacifiers can be donated in the bin in the gathering space. The coordinator is Debbie Havey, 232-4973, or
PROJECT RACHEL, A POST-ABORTION
HEALING MINISTRY
During the month of April we rejoice in the Easter sea-son. Jesus died on the cross for our sins so we would have eternal life. Have you been affected by abortion in any way? Are you in need of healing? Do you want to experi-ence the love, mercy and compassion of God? “Lord open my mind, eyes, ears, and heart to your presence in my life.” Find out more about us www.renodiocese.org, click on Ministries, then Agencies. Contact our confiden-tial, nonjudgmental help line 324-4325 to take advantage of valuable resources
BIBLE TRIVIA Test your knowledge
Who, according to tradition, wrote the following Books of the Bible?
Answers in next week’s bulletin.
6 MASS INFORMATION
ADORATION OF
THE BLESSED SACRAMENT Mon - Thu 6:00 am - 9:45 pm
Fri 6:00 am - 5:00 pm Pray for Vocations hour M - F 12:00 pm
1st Thursday 6:00 am - 6:00 am (24 hours) Please sign the sheet each time
you visit with our Lord.
ADORACIÓN DEL SANTÍSIMO Lunes-Jueves 6:00 am - 9:45 pm
Viernes 6:00 am - 5:00 pm orar por vocaciones hora M-F 12:00 pm 1st Jueves 6:00 am - 6:00 am (24 horas)
Por favor firme la hoja cada vez que visite con nuestro Señor
MoMon n - ThThu u 6:6:6:6:6:000000000000000000000000000000000000000000000000 a a a a a a a a a a a a a a a a a a a a a am m -- 9:9:4545 p pmmFrFri i 6:6:00000000000000000000000000000000000000000000000000000000 a a a a am m m m m m m m m m m m m m m m m m m m m m m m m m m ------ 5:5:5:5:5:5:5:5:0000000000000000000000000000000000000000000000 p pmm
f foror V Vocococococatatatatatatatatatatatatatatatatatatatatatatatatatatatatatioioioioioioioioioioioioioioioioioioioioioioioioioioioioioionsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsns h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h hououououououououououououououououououououououououououououououououououououououououououououououououour r r r r r r r r r r r r r r r r r r r r r r r r r r r M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M ---- F F F F 1212:0:0urursdsdayayayayayayayayayayayayayayayayayayayayayayayayayayayayayayay 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:00 0 amamamamamamamamamamamamamamamamamamamamamamamamamamamamamamamamamamam - 6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:00000000000000000000000000000000000000000000000000000000 a a a a a a a a a a a a a a a a a a a a a a a a a a a a a am m m m m m m m m m m m m m m m m m m m m m m m m m m m m m (2(2(2(2(24 4 PlPlPlPlPleaeaeaeasesesese s s s s s s s s s s s s s s s s s s s s s s s sigigigigigigigigigigigigigigigigigigigigigigigigigigigigigign n n n n n n n n n n n n n n n n n n n n n n n n n ththththththththththththththththththththththththththththththe e e e e e e e e e e e e e e e e e e e sheeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeet t t t t t t t t t t t t t t t t t eaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeachchchchchchchchchchchchchchchchchchchchchchchchchchchchchchch t t t t t t t timimimimim
yoyoyoyoyoyoyoyoyoyoyoyoyoyoyoyoyoyoyoyoyoyoyoyoyoyoyoyoyoyoyou u u u u u u u u u u u u u u u u u vivivivivivivivivivivivivivivivivivivivivivivivivivivivivivisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisit t t t t t t t t t t t t t t wiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwith ourururururururururururururururur L L L L L L L L L L L L L L L L L L L L L L L L L Lorororororororororororororororororororororororororord.d.d.d.d.d.d.d.d.d.d.d.d.d.d.d.d.
ADADADADADADADADADADADADADADADORORORORORORORORORORORORORORORORORORORORACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓIÓN N N N N N N N N N N N N N N N N N DEDEL L L L L L L L L L L L L L L SASASASASASASASASASASASASASASASASASASASASASASASASASASASASASANTNTNTNTNTNTNTNTNTNTNTNTNTNTNTNTNTNTNTNTNTNTNTNTNTNTNTNTNTNTNTNTÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSÍSIMLuLuneness-JuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJuJueveveveveveveveveveveveveveveveveveveveveveveveveveveveveveveveveveveseseseseseseseseseseseseseseseseseseseseseseseseses 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:00 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 amamamamamamamamamamamamamamamamamamamamamamamamamamamamam --------- 9:9:9:9:9:9:9:9:9:9:9:9:9:9:9:9:9:9:9:9:9:9:9:9:9:4545454545 p p
ViVierernenenenes s s s s s s s s s s s s s s s s s s s 6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:000000000000000000000000000000000000000000000000000000000000000000 a a a a a am m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m ----------- 5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:5:0000000000 p pmm p poror v vococacacioionenenenes s s s s s s s s hohohohohohohohohohohohohohohohohohohohohorararara M M-F F 1212:0:0JuJueveveses 6 6:0:00 0 amamamam -- 6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:6:000000 a am m (2(24 4 hoho
PoPor r fafavovor r fifirmrmrmrmrmrmrmrmrmrmrmrmrmrmrmrme e e e e e e e e e e e e e e e e e e e e e e lalalalalalalalalalalalalalalalalalalalalalalalalalalalala h h h hojoja a cacadadaeezz qquuee vviisssssiiiittttteeeeeeeeeeeeeeeeeee cccccccccccccccccccccccccccccon nnnnnnnnnnnnnnnnuuuuuuuuuuuuuuuuuuuuuuuuuuuuuueeeeeeeeeeeeeeeeeeeeeeeeeeessssssssssssssssstttttrrrroo SSeeññ
ROSARY Mon - Sat 8:30 am; Wed 5:30 pm;
Español Rosario Miercoles 6:30 pm en la capilla
LITURGICAL MINISTRIES Adoration
Pat Souza 358-7269
Emily Robbins 626-6398
Adult Choir
Andrea Santos 762-8779 Filipino-American Choir
Leo Molino 358-1694
Multicultural Choir
Teresa Bouldin 310-462-8045 Liuaki Tausinga 379-8087
Youth Choir
Lorraine Lee 331-6209
Altar Servers
Chris Pennington 313-5524 or [email protected]
Sandra Pennington 343-2115 or [email protected]
Eucharistic Minister Coordinator
Pat Giannotti 358-3107
Homebound Eucharistic Ministers for parishioners who are homebound or
nursing home and cannot attend Mass. George Mankowski 673-5975 or
Parish Office 358-5977
Lector Coordinator
Debbie Havey 232-4973 [email protected]
Sound/Video Coordinator
Himanshu Patel 425-0940
Usher Coordinator
Dalene Melzer 342-2702
MASS READINGS For the Week of April 16
Monday - Acts 6:8-15; John 6:22-29
Tuesday - Acts 7:51; 8:1a; John 6:30-35
Wednesday - Acts 8:1b-8; John 6:35-40
Thursday - Acts 8:26-40; John 6:44-51
Friday - Acts 9:1-20; John 6:52-59
Saturday - Acts 9:31-42; John 6:60-69
Sunday - Acts 4:8-12; 1 John 3:1-2; John 10:11-18
VOLUNTEERS NEEDED Eucharistic Ministers for the homebound
Volunteers must be retired or semi-retired, in good physical condition, have a valid drivers license, flexible hours, and take the Protect God’s Children program. If you are interested in this graced minis-try, please call the parish office.
THE SERENITY PRAYER God, grant me the serenity to accept the things I cannot
change, courage to change the things I can, and the wisdom to know the difference.
Living one day at a time; enjoying one moment at a time;
accepting hardship as the pathway to peace. Taking, as He did, this sinful world as it is,
not as I would have it. Trusting that He will make all things right if I surrender
to His will; that I may be reasonably happy in this life,
and supremely happy with Him forever in the next.
SSSSSSSSEEEEEEEERRRRRRRRRRRRRRRRRRRRRRRRRRREEEEEEEEEEEENNNNNNNNNIIIIIITTTTTTTTTTYYYYYYYYYYYYYYYYYYYY PPPPPPPPPPPPPPPPPPPRRRRRRRRRRAAAAAAAAAAYYYYYYYYEEEEEEEEEEEEEEEEEEERRRRRRRRRRe e e e e e e e e e seseseseseseseseseseseseseseseseseseseseseseseserererererererererererererererererereninininininininininininininininitytytytytytyty t t t t t t t t to o o o o o o o acacacacacacacacacacacaccecececececeptptptptptptptptptptptptptptptptptptptptptptpt t t t t t t t t t t t t t t t t t t t thehehehehehehehehehehehehehehehehehehehehehehehehe t t t thihiurururagagagagagage e e e toto c chahahahangngngnge e e ththththththththe e ththththththththththththinininininininininingsgsgsgsgsgsgs
wiwiwiwiwiwiwiwiwisdsdsdsdsdsdsdsdsdomomomomomomomomomom t t t t t t t t t to o o o o o o o o knknknknknknknknowowowowowow t t t t t t t thehehehehehehehehehe d d d d d d d d dififififififififfefefefefefefefeferererevivivivivivivivivivivingngngngngngngng o o o o o onenenenenenene d d d d d d d dayayayayay a a a at t t t a a a a titititititimememememe;;;;;;;
yiyiyiyiyiyiyingngngngngngngngng o o o o o o o o o o o onenenenenenenenene m m m m m m momomomomomomomenenenenenenent t t t t t t atatatatatatatatat a a a a a t t t t t t timimimimimimhahahahahahahahahardrdrdrdrdrdrdrdrdrdshshshshshshshshshshshshipipipipipipipipipip a a a a a a a as s s s s s s s s thththththththththththththththththththththththththththththththththththththththththththththe e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e papapapapapapapapapapapapapapapapapapapapapapapapapapapapapapapapapapapapapapapapapapathththththththththwawawawawawawaway y y y y y y totototo H H H H H H H H He e e e e e e e e didididididididididididididid,d,d,d,d,d,d,d,d,d, t t t t t t t thihihihihihihihihihihihihihihihihihihihihihihihihihihihihis s s s s s s s s s s s s s s s s s s s s s s s s s s s s s sisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisinfnfnfnfnfnfnfnfnfnfnfnfnfnfnfnfulululululululululululululululululululululululululululululululululululululululululul w w w w w w w w w w w w w w w w w w w w w w w w worororororldldldldldldldldnononot t asas I I I I I I w w w w w w wouououououououououououououououououououououououououououououououououououououldldldldldldldldldldldldldldldldldldldldldldldldldldldldldldldldldldldldldldldldldldldldldldldldldldldld h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h havave e e e e e e e e e e e e e e e e e e e e e e e e e e e e itititititititititit... w w w w wililililililill l l l l l l l l l mamamamamamamamamamamamamamamamamakekekekekekekekekeke a a a a a allllllllll t t t t t t t t t t t t t t t t t t t t t t t t t t t thihihihihihihihihihihihihihihihihihihihihihihihihihihingngngngngngngngngngngngngngngngngngngngngngs s s s s s s s s s s s s s s s ririririririririririghghghghghghghght t t
totototototototo H H H H H H Hisisisisisisisisis w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w w wililililililililililililililililililill; b b b b b b b b b be e e e e e e e rerererererererererererererereasasasasasasasasasasasasasonononononononononononononononononononononononononababababababababababababababababababababababababababababababababababababababably hapapapapapapapappypypypypypypypypypypypypypypypypypypypypypypypypypypypy i i i i i i i i i in n n n n n thththththhappy withth Him forever i i i i
PRAYERS NEEDED 7
PRAYER LIST
Your prayers are needed for the recovery . . .
Fr Jim Fugle, Sr Mora McGarry, Sr Gertrude, Sirenidi & Sara Becerra, Nina Grotte, Dolly Barter, Bill McMahon, Frediani Fam, Chicago Fam, Corinna Osgood, Londos Fam, Beeson Fam, Kristy Burch-Weinberg, Alfredo Panelli, John Michael Langley, Cleo Hudson, Maureen Flynn, Ma-rie Kiley, Donna Casci, Jodi Kehmeier, Caruso/Kelly Fam,
Bob & Harlyne Caruso, Grayson McClure, Michon Hol-land, Kleckner Fam, Sarah Lopez-Cardwell, Paul Freitag, Guadalupe
Lemus, Lucy Salazar, Michael Lucey, Linda Giddins, Toni Berry, Ray
Redford, Barbara Lydon, Mitzkus Fam, Leathers Fam, Kay Petty, Tammy Henderson, John Marsala, Angie Franco, Hummel Fam, Mary Carter, Michelle Smith, William Griffith, Brenda Thompson, Sylvia Moul, Sariya, Kuykendall Fam, Jose Gastelum, Aaron Mar-tinez, Norma Fulton, Hernandez Fam, Alisa Cerda, Freddy Mercado, Laura Kurtz, Irene LaRocca, Richard Manion, Vincent Vinella, Catali-na Sanchez, Gary Dalton, Jerry Joyce, Norma Fulton, Carol Malone,
Alma Lucero, Pat Masters, Gene St Mary, Jacqulyn Sonnek, Alan Blain Davis, K Fuest, Brian Grace, Barbra Gonzales, Dr John Pescetti, John Carniglia, Darlene Cormier, Michael Lazzarini, Ardith Lance, Angie Pinard, Mayra Fam, Dereck Machabee, Mark Gardiner Fam, Forrest Mitchell Fam, Jami Davis, Zia Sinisi, David Rincon-Lopez, Carter Miranda Ethan James Noin, Joyce Miles, Julia Garcia-Miguel,
Monica Lopez-Barajas, Luz Mendoza, Jodie Coates, Alec Robles-Marines, Gladys Dimaggio
Please call when they recover . . .
MILITARY PRAYER LIST
Navy Coast Guard Max McGuire Mason Misquez
Marines Army Anthony Woodward Zachary Long Hunter DeFabrizio Ryan Long Patrick McGuire Anthony Ross
Air Force Joey Gentry Joshua Cox Trevor Nolan Please pray for their safe return . . .
MASS TIMES WHEN TRAVELING
Traveling? Visit www.masstimes.org
for church locations and worship times anywhere in the world.
For ad info. call 1-800-950-9952 • www.4lpi.com Immaculate Conception Church, Sparks, NV. A 4C 05-1157
DR. CINTIA OROZCO-TEGLIAGeneral Dentist Limited to Children • Hablo Español
775.409.4605 • www.mykidssmilereno.com3150 Vista Blvd, Ste #110 • Sparks, NV
Apple Family Dentistry
Dr. Sophia Dang
Creating Beautiful Smiles
Proudly supports Immaculate Conception Church
and provide care for parishioners.
• Complete General Dental Care for Adults & Children
• Se Habla Español
4818 Sparks BLVD #102, Sparks, NV 89436
775-626-6300
www.PVHcares.com • 356-8323
2405 Pyramid Way • Sparks
Office Hours: M-F 7:30-6 • Sat 9-4 Closed Sunday
COMPASSIONATE PET CARE FOR OVER 30 YEARS
Our Lady of the Desert
Council 12877
Membership Director - Leo Carew 843-1040
Grand Knight - Chris Pennington 313-5524
Join us, & become part of a fraternal organization of Catholic Men;dedicated to serving Christ, our Parish, & our Community!
Pyramid Way Garden Center
3397 Pyramid Way • Sparks
(775) 425-4300
Better Plants. Better Advice. Better Results.
For ad info. call 1-800-950-9952 • www.4lpi.com Immaculate Conception Church, Sparks, NV. A 4C 05-1157
DNS DEVELOPMENTS
Steve Schiwart, President
Home Improvement& Handyman
NV-20171266267
Paulo CirlingDaniel Price
775-359-4969www.anchorconcretenv.com
Established 1971State License #11193
359-1468www.advanceinstallations.com
• General Contractor
• Asbestos, Mold &Lead Removal
1914 Hymer Ave
Sparks, NV 89431
NV Lic. #033627 & #0027501/CA #649749
D-Signs by RosieSPECIALIZE IN
WEDDINGSCustom dresses,
shirts, wedding attireAlterations of all types
775-527-2639
Specialty
Welding Supply
John Kehmeier, Parishioner
www.specialtyweldingsupply.com
750 E. Glendale Ave
356-6988
A V O NLouise Myers - Parishioner
www.youravon.com/lmyers
Los CompadresMexican Food Excelente
775-800-1822www.loscompadresreno.com
1250 Disc Drive • Sparks, NV(775) 359-5800 950 S. Rock Blvd. Sparks, NV
www.goblueteam.com Kitchen & Bath Showroom
What is IMPOSSIBLE withmen is possible with God
Luke 18:27
www.nikosgreekkitchen.com
171 Disc Dr. • Sparks, NV
775-499-5777
El Divine Beauty Salon
429 Pyramid Way
Sparks, NV
Maria Hernandez
By Appointment Only
775-229-0368
ElElEl D D D D D Divivivivivininine e Be
By By By By By By By
CONEY ISLAND BAR* A SPARKS LANDMARK *
Lunches 11am - 2pm, Mon-SatPrivate Banquets from 20-80 People
http://coneyislandbar.net/2644 Prater Way Sparks, NV
(775) 358-6485
Our Mother of Sorrows
Full Service Catholic Cemetery
& Mausoleum
Owned and Operated by the
Roman Catholic Diocese of Reno
Call now for Pre-need information
(775) 323-0133
FuFuFu
Ro
CaCa
FuFuFu
CaCaCaCa
Jake Capdeville
Insurance Agent
9475 Double R’ Blvd Reno
775-852-8880
www.jcapinsurance.com
Each of"ce is independently owned and operatedcell. (775) 691 1111
Agente de bienes y raices
“En América y con América, todo es posible”“In America And With América, Everything Is Possible”
–COMPRE O VENDA SU CASA–
SELECTREAL ESTATE
!"#$%&'()*)+%$,&-.#(
Plan ahead.Do it for your family....
and your peace of mind.
Sparks: (775) 359-2210
/&'0.#(1"#$%&'2.,$(34.,
3773 Baker Lane, Suite 3 • Reno, Nevada • 775-829-8684www.atenciodds.com • [email protected]
Michael Atencio DDS
Sparks Sonsof Italy
meets 4th Tuesday monthly 6pmImmaculate Conception Parish Hall
We welcome new members
747-6518 971-4956
S
Contact Robert Martin to place an ad today!
[email protected] or (800) 950-9952 x5865
David HailEstimator
O: (775) 575-7200 • C: (775) [email protected]
NV Lic. #57963 CA Lic. #846696