Upload
phamnga
View
244
Download
1
Embed Size (px)
Citation preview
Indian Journal of Biotechnology
Vol 8, April 2009, pp 207-213
STS marker based tracking of slow rusting Lr34 gene in Indian wheat genotypes
Priyamvada1, Ratan Tiwari*
1, M S Saharan
1, R Chatrath
1, Priyanka Siwach
2 and B Mishra
1
1Directorate of Wheat Research, Karnal 132 001, India 2Department of Bio and Nanotechnology, Guru Jambheshwar University, Hisar 125 004, India
Received 17 October 2007; revised 22 September 2008; accepted 28 November 2008
Bi-allelic STS marker was used to confirm the presence of adult plant durable rust resistance gene Lr34 in advance
generation breeding lines. These lines were scored for leaf rust three times at an equal interval and the area under disease
progress curve (AUDPC) was calculated. The lower AUDPC values of Lr34 positive lines confirmed their slow rusting
nature. In the absence of direct selection method, the breeders are selecting Lr34 gene carrying lines unintentionally as they
showed better resistance. Lines possessing Lr34, an ‘undefeated gene’, should be used in breeding programme in order to
have a broad-spectrum durable leaf rust resistance.
Keywords: AUDPC, leaf rust, Lr34 gene, Puccinia triticina
Introduction The resistance of wheat (Triticum aestivum L.)
cultivars to leaf rust, caused by Puccinia triticina
Erikss1, was traditionally based on the genes effective
throughout the developmental cycle of the plant.
Many of these resistances were overcome by new leaf
rust pathotypes. The need for durable resistance has
been recently emphasized as wheat cultivars
possessing durable leaf-rust resistance genes
worldwide have characteristics of adult plant
resistance. Several genes that confer resistance to
virulent pathotypes at adult plant stage (APR) are
Lrl12, Lr13, Lr22a, Lr22b2,3
, Lr344 and Lr35
5.
Leaf tip necrosis (Ltn), a morphological trait,
showed linkage with Lr34 and Yr18 and was
suggested to be utilized, in some environments, as a
morphological marker to identify wheat lines carrying
these genes6. Although adult plant resistance gene
Lr34 may not provide adequate resistance under high
disease pressure when it is present alone7-9
, it could
contribute to achieve acceptable levels of resistance in
combination with other slow rusting genes10,11
.
Adult plant resistance gene Lr34 has been reported
in many lines of Indian origin12-14
on the basis of Leaf
tip necrosis and area under disease progress curve
(AUDPC) scores. The combination of Lr34 with other
genes, such as Lr12 and/or Lr13, provides durable
leaf rust resistance globally15
and, therefore, not so
surprisingly, several attempts were going on to tag
Lr34 with molecular markers. The presence of Lr34
on 7D genome of wheat was known since long, but its
exact location has remained a challenge. DNA
markers are more accurate for determining the
presence of gene than the phenotypic response of the
plant to infection. Earlier works in the 7DS
chromosomal region demonstrated the close genetic
linkage of Lr34 with SSR (XGwm130, XGwm295 &
XGwm1220) and EST (cdo475, bf473324 &
be493812) markers16-18
.
Despite major efforts to identify a molecular
marker closely linked to Lr34/Yr18, there were no
diagnostic markers for universal application across
diverse wheat backgrounds. Bossolini et al19
utilized
the knowledge accrued from colinearity of rice
chromosome 6S and the Lr34/Yr18 region of wheat
chromosome 7D to develop a marker specific to the
chromosomal region of Lr34. The SWM10
microsatellite was found closest to Lr34 and was
identified to have the small allele in three independent
sources of Lr34, namely ‘Frontana’, ‘Chinese Spring’
and ‘Forno’, as well in some other genotypes
containing Lr3419
. In 2006, Lagudah20
got success in
conversion of the RFLP to a codominant sequence
tagged site (csLV34), revealing bi-allelic locus in
which 79 bp insertion in an intron sequence was with
cultivars that lacked Lr34/Yr18.
_________
*Author for correspondence:
Tel: 91-184-2267495; Fax: 91-184-2267390
E-mail: [email protected]
INDIAN J BIOTECHNOL, APRIL 2009
208
The present investigation was undertaken to
confirm the presence of Lr34 with STS (csLV34)
marker in advanced generation breeding lines and in
early generations (F1, F2) breeding lines so that these
genotype lines possessing durable rust resistance gene
can be used in further breeding programme.
Materials and Methods
The Experimental Material
The Experimental material included 82 advance
generation breeding lines (Table 1) and 70 early
generation breeding lines (F1, F2s) involving
crosses with genetic stocks possessing rust resistance
Table 1—Parentage and origin details of advance generation lines
No. Genotype Pedigree Origin
1 C 306 REGENT 1974/3*CHZ//*2C591/3/P19/C281 CCSHAU, Hisar
2 CBW 14 PRINIAA/WEAVER//STAR DWR, Karnal
3 CBW 16 KEA/TOW//LIRA DWR, Karnal
4 DBW 17 CMH 79A. 95/3*CNO 79//RAJ 3777 DWR, Karnal
5 DBW 22 NW 1012/WR 368 DWR, Karnal
6 DL 788-2 K 7537//HD 2160 MUT// HD2278/DL 896-2 IARI, N. Delhi
7 GW 322 PBW 173/GW 196 SDAU, Vijapur
8 GW 366 DL 802-3/GW 322 SDAU, Vijapur
9 HD 2189 HD 1963/HD 1931 IARI, N. Delhi
10 HD 2687 CPAN 2009/HD 2329 IARI, N. Delhi
11 HD 2733 ATTILA/3/TUI/CARC//CHEN/CHTO/4/ATTILA IARI, N. Delhi
12 HD 2781 BOW/C 306//C 591/HW 2004 IARI, N. Delhi
13 HD 2824 PTO/CNO 79/PRL/GAA//HD 1951 IARI, N. Delhi
14 HD 2833 PBW 226/HW 1042//HD 2285 IARI, N. Delhi
15 HD 2888 C 306/T.SPHAEROCOCCUM//HW 2004 IARI, N. Delhi
16 HD 2930 CNO 79/PRL//CHIL/3/HD 2329/CPAN 2068 IARI, N. Delhi
17 HD 2932 KAUZ/STAR//HD 2643 IARI, N. Delhi
18 HD 2937 TRAP#1/BOW//PFAU/MILAN IARI, N. Delhi
19 HI 1500 HW 2002*2/STREMPALLI/PNC 5 IARI, RRS, Indore
20 HI 1531 HI 1182/CPAN 1990 IARI, RRS, Indore
21 HI 1539 HI 1391/HI 1394 IARI, RRS, Indore
22 HI 1544 HINDI 62/BOBWHITE/CPAN 2099 IARI, RRS, Indore
23 HPW 251 WW 24/LEHMI P2-UI49 HPKV, Palampur
24 HS 240 AU/KAL/BB/3/WOP/PAVON IARI, RS, Shimla
25 HS 277 KAVKAZ/CIGUENA IARI, RS, Shimla
26 HS 295 CQT/AZ/IA/555/PJN S ’/PEL 1276.69 IARI, RS, Shimla
27 HS 375 BB/G 11/CJ 71/3/TA EST//KAL/BB IARI, RS, Shimla
28 HS 420 KAJ 3302//CMH 73A-497/3*CNO 79 IARI, RS, Shimla
29 HS 461 R 37/GHL 121//KAL/BB/3/JUP/MUS/4/W 3633 IARI, RS, Shimla
30 HUW 234 HUW 12*2/CPAN 1666//HUW 12 BHU, Varanasi
31 HUW 468 CPAN 1962/TONI//LIRA “S”/PRLS” BHU, Varanasi
32 HUW 598 WH 581/HUW 395//RAJ 3765 BHU, Varanasi
33 HW 2004 C 306*7//TR 380-14#7/3 AG 14 IARI, RS, Wellington
34 HW 2044 PBW 226*5//SUNSTAR*6/C 80-1 IARI, RS, Wellington
35 HW 2045 HD 2402*6/SUNTAR*6/C-80-1 IARI, RS, Wellington
36 HW 5021 MACS 2496*1//MC 10 IARI, RS, Wellington
37 HW 5044 LOK 1// WH 542 IARI, RS, Wellington
38 K 0307 K 8321/UP 2003 CSAUA&T, Kanpur
39 K 0402 HP 1731/UP 2425 CSAUA&T, Kanpur
40 K 8027 HD 1969/K 852//K 852 CSAUA&T, Kanpur
41 K 9107 K 8101/K 68 CSAUA&T, Kanpur
42 KHARCHIA 65 KHARCHIA LOCAL/EG 953 RAU, Durgapura
43 KRL 119 PBW 255/KRL 1-4 CSSRI, Karnal
44 KRL 19 PBW 255/KRL 1-4 CSSRI, Karnal
45 LOK 1 S 308/S 331 Lok Bharti Institute, Sansora
46 LOK 45 CPAN 3066/K.SONA “S”/LOK 1/CNO 79/CPAN
2081/J 24/SS-1063/CPAN 1907/CC 493//HD 2385
Lok Bharti Institute,
Sansora
Contd.—
PRIYAMVADA et al: Lr34 GENE IN INDIAN WHEAT
209
(FLW lines developed at Flowerdale, Shimla) with
elite lines/varieties (Table 2). The seed material of the
above mentioned lines were procured from the
Germplasm unit of the Directorate of Wheat
Research, Karnal.
DNA Extraction and Molecular Marker Analysis
Genomic DNA of all lines was extracted from fresh
leaves, grounded in liquid nitrogen by CTAB
method21
. Sampling of DNA was based on selection
of 6 random plants from each F2 bulk. The reported
DNA marker csLV3420
with primer sequence forward
(5′GTTGGTTAAGACTGGTGATGG3′) and reverse
(5′TGCTTGCTATTGCTGAATAGT3′) was got
synthesized from M/s Bangalore Genie Pvt. Ltd. and
utilized to know the presence of Lr34 gene in selected
wheat genotypes through DNA amplification.
Polymerase chain reaction (PCR) was performed in
25 µL of 10× PCR buffer, 2.0 mL of dNTPs (2.5 mM
each dNTPs) and 1 mL each of forward and reverse
primers (100 pmol/mL) and 100 ng of DNA in a PTC-
200 thermal cycler (MJ Research) with primer
annealing temperature of 55°C. Products of STS
primers used were fractionated on 2.5% high
resolution agarose (Bangalore Genei) with 1× TAE
buffer and visualized by ethidium bromide staining.
Results
Of 82 advance lines screened for the presence of
Lr34 gene, 16 lines namely GW 366, HD 2189, HS
277, HUW 468, HUW 598, K 0402, K 9107, NW (S)
2-4, PBW 573, PBW 574, PBW 575, RAJ 3765,
Table 1—Parentage and origin details of advance generation lines—Contd.
No. Genotype Pedigree Origin
47 MACS 6145 C 306+ Lr 28 ARI, Pune
48 MP 3211 SKAUZ/2/FCT JNKVV, Jabalpur
49 MP 4010 ANGOSTURA 88 Gwalior
50 NI 5439 REMP 80/3* NP 710 MPKV, Niphad
51 NIAW 34 CNO 79/PRL “S” MPKV, Niphad
52 NIAW 917 GW 244/BOB WHITE MPKV, Niphad
53 NW (S) 2-4 NS 732/NER//KAUZ NDUA&T, Faizabad
54 NW 2036 BOW/CROW/BUC/PVN NDUA&T, Faizabad
55 NW 3069 ATTILA*2/KT/BAGE NDUA&T, Faizabad
56 PBW 175 HD 2160/WG 1025 PAU, Ludhiana
57 PBW 343 ND/VG 9144//KAL/BB/3/YCO “S”/4/VEE# 5 “S” PAU, Ludhiana
58 PBW 373 ND/VG 9144//KAL/BB/3/YACO “S”/4 VEE 5 “S” PAU, Ludhiana
59 PBW 396 CNO 67/MFD//MON “S”/3/SERI PAU, Ludhiana
60 PBW 502 W 485/PBW 343//RAJ 1482 PAU, Ludhiana
61 PBW 550 WH 594/RAJ 3856// W 485 PAU, Ludhiana
62 PBW 568 W 485/PBW 343//HD 2160 PAU, Ludhiana
63 PBW 573 WH 594/RAJ 3814 PAU, Ludhiana
64 PBW 574 HD 2643//CS/Ae.sq. PAU, Ludhiana
65 PBW 575 PBW 343/HUW 235 PAU, Ludhiana
66 PBW 579 W 7554/PBW 427 PAU, Ludhiana
67 RAJ 3765 HD 2402/VL 639 PAU, Ludhiana
68 RAJ 4037 DL 788-2/RAJ 3717 RAU, Durgapura
69 RAJ 4083 PBW 343/UP 2442//WR 258/UP 2425 RAU, Durgapura
70 RAJ 4101 RAJ 3765/DL 775-2 RAU, Durgapura
71 SONALIKA 1154.388/AN/3/YT 54/N 10B/LR 64 IARI, N. Delhi
72 UP 2425 HD 2320/UP 2263 GBPUAT, Pantnagar
73 VL 616 SKA/CPAN 1507 VPKAS, Almora
74 VL 738 NS 12.07/LIRA “S”//VEE “S” VPKAS, Almora
75 VV 804 CPAN 3018/CPAN 3004//PBW 65 VPKAS, Almora
76 VL 829 IBWSN 149/CPAN 2009 VPKAS, Almora
77 VL 882 CPAN 3031/PMF/MAYA/YACO VPKAS, Almora
78 VL 892 WH 542/PBW 226 VPKAS, Almora
79 WH 1021 NYOT 95/SONAK CCSHAU, Hisar
80 WH 1022 WH 283 /UP 2338 CCSHAU, Hisar
81 WH 147 E 4870/C 303//5339/PV 18 CCSHAU, Hisar
82 WH 542 JUPATECO/BLUE/JAY//URES CCSHAU, Hisar
INDIAN J BIOTECHNOL, APRIL 2009
210
UP 2425, VL 616 and VL 882 showed the presence
of 150 bp fragment specific to Lr34 and rest of the
lines showed 229 bp fragment (non Lr34
carrying allele). Approximately 20% lines carry Lr34
gene, thus expected to have durable and slow
rust resistance. AUDPC data for leaf rust of
all the entries were recorded. The AUDPC data
of the lines positive for the presence of Lr34
gene at molecular level are presented in Table 3.
The popular cultivar being grown by the farmers
for more than a decade, namely, C306, HUW234,
Kharchia 65 and WH147, showed AUDPC
value of more than 1000. Of 16 entries confirmed to
have Lr34 with marker, 12 entries showed the
AUDPC value of less than 200, which indicates the
slow rusting association with the presence of
Lr34 gene.
Tracking Lr34 Gene in Segregating Population
Several hundred crosses (single, three way or top
classes) are attempted at Directorate of Wheat
Research (DWR), Karnal every season for germplasm
enrichment and enhancement of several target
oriented breeding programmes. The F1 and F2
populations developed in one such programme from
such crosses were tested to observe the distribution of
Lr34 gene in the population. A total of 29 F1 crosses
Table 2—Parentage and origin of lines involved in breeding population
No. Genotype Pedigree Origin
1 FLW 2 PBW 343/Blue Boy-II Flowerdale, Shimla
2 FLW 3 UP 2338/Chine 84-40022 Flowerdale, Shimla
3 FLW 6 HI 1633/HP 1776 Flowerdale, Shimla
4 FLW 8 HI 1077/Lr 9 Flowerdale, Shimla
5 FLW 9 HUW 234/Lr 19 Flowerdale, Shimla
6 CBW 14 PRINIAA/WEAVER//STAR DWR, Karnal
7 CBW 16 KEA/TOW//LIRA DWR, Karnal
8 DBW 20 PBW 373/WH 542 DWR, Karnal
9 DBW 26 PBW 343/KAUZ//STAR/LUCO-M DWR, Karnal
10 DBW 29 DL 788-2/HUW 234 DWR, Karnal
11 DBW 30 PBW 373/DBW 11 DWR, Karnal
12 GW 173 TW 275/7/7/10/LOK 1 SDAU, Vijapur
13 HD 2009 LR 64A/NA 160 IARI, N. Delhi
14 HD 2402 HD 2261/HD 2236 IARI, N. Delhi
15 HD 2733 ATTILA/3TUI/CARC//CHEM/CHTO/4/ATTILA IARI, N. Delhi
16 HP 1731 LIRA//PARULA/TONICHI PUSA, Bihar
17 HUW 234 HUW 12*2/CPAN 1666/HUW 12 BHU, Varanasi
18 K 9901 HD 2236/HD 2448//K 68 SAU, Kanpur
19 NIAW 34 CNO 79/PRL “S” MPKV, Niphad
20 PBW 343 ND/VG 9144//KAL/B 3.3/YCO ’S/4 PAU, Ludhiana
21 PBW 373 ND/VG 9144//KAL/BB 3/YACO ‘S’/4/VEE PAU, Ludhiana
22 PBW 435 HD 2160/CALIDAD PAU, Ludhiana
23 PBW 443 PBW 304/CPAN 1922 PAU, Ludhiana
24 PBW 502 W 485/PBW 343/RAJ 1482 PAU, Ludhiana
25 PBW 593 WH 581/PBW 346//CC 527 PAU, Ludhiana
26 PHR 412 UP 2338//KAUZ/ALTAR 84 DWR, Karnal
27 RAJ 3765 HD 2402/VL 639 RAU, Durgapura
28 RAJ 4119 RJ 3777/WR 413 RAU, Durgapura
29 RAJ 4123 PBW 343/UP 2442//WR 258/UP 2425 RAU, Durgapura
30 RAJ 4129 HP 1721/RAJ 3077 RAU, Durgapura
31 RWPZW5-17 CPAN 3031/PMF/MAYA/YACO//VL 75S DWR, Karnal
32 RUP2005-22 85D3 453/P 10859//RAJ 3765 DWR, Karnal
33 UP 2425 HD 2320/UP 2263 GBPUAT, Pantnagar
34 UP 2687 NAC/3/STW 163/AGEL//ANZA/4/BOW “S”/CEP 7788/HPW 42 GBPUAT, Pantnagar
35 WH 730 CPAN 2092/IMP.LOKI CCSHAU, Hisar
Table 3—AUDPC value of Lr34 positive lines
Genotypes AUDPC value
GW 366, PBW 574, PBW 575, VL 616 0
HD 2189, HS 277, HUW 468, HUW 598,
RAJ 3765, UP 2425, VL 882
101-200
HS 375, K 917 201-500
K 0402, NW(S) 2-4 501-1000
PRIYAMVADA et al: Lr34 GENE IN INDIAN WHEAT
211
including 24 single cross and five top crosses were
amplified and the profile was obtained (Fig. 1).
Among these, approximately 48% F1s showed the
presence of Lr34 alleles in heterozygous state,
indicating that at least one of the parents in these
lines had Lr34 gene, while rest of the 52% F1s
were homozygous for the 229 bp allele (carrying
non-Lr34).
In F2 population, out of the total 41 bulks tested, 16
showed the presence of Lr34 gene; while 25 lines
were negative for Lr34 gene marker (Fig. 2). Thus,
39% F2 lines carried the durable rust resistance
gene Lr34.
Discussion The AUDPC scores for leaf rust indicated that most
of the lines had low disease spread; this may be due to
Fig. 1—Lr34 gene distribution in F1 population: M- 100 bp ladder; Lane 1- FLW 3/PHR 412; 2- FLW 3/DBW 30; 3- FLW 3/PBW 502;
4- FLW 2//PBW 343/K 9901; 5- FLW 2/RAJ 4123; 6- FLW 2/NIAW 34; 7- FLW 2/DBW 20; 8- FLW 2//RAJ 3765/NIAW 34; 9- FLW
2/PBW 502; 10- FLW 2/DBW 30; 11- FLW 2/DBW 29; 12- FLW 6/PBW 435//RAJ 4129; 13- FLW 6/RAJ 4119; 14- FLW 6/RWP2W5-
17; 15- FLW 6//PBW 343/K 9901; 16- FLW 6/DBW 29; 17- FLW 6/HUW 234l; 18- FLW 6/GW 173;l 19- FLW 6/CBW 14; 20- FLW
8/HUW 234; 21- FLW 8/RUP 2005; 22- FLW 3/HD 2009; 23- FLW 3//PBW 43/K 9901; 24- Tc*34; 25- FLW 6/DBW 30; 26- FLW 8/
DBW 29; 27- FLW8/GW 173; 28: FLW 8/DBW 30; 29- FLW 9/HD 2733;l 30- FLW 9/WH 730
Fig. 2—Lr34 gene distribution in F2 population: M- 100 bp ladder; Lane 1- FLW 2/HD 2402; 2- FLW 2/CBW 14; 3- FLW 2/CBW 16; 4-
FLW 2/UP 2425; 5- FLW 2/PBW 435; 6- FLW 2/NIAW 34; 7- FLW 2/DBW 30; 8- FLW 2/PBW 443; 9- FLW 2/RAJ 3765; 10- FLW
2/HP 1731; 11- FLW 2/RA J3765//UP 2687; 12- FLW 2/HD 2402//NIAW 34; 13- Tc* 34; 14- FLW 2/RAJ 4123; 15- FLW 2//NIAW
343/K 9901; 16- FLW2 /DBW 29; 17- FLW 2/DBW 30; 18- FLW 2/PBW 502; 19- FLW 2/DBW 343; 20- FLW 2//NIAW 34; 21- FLW
6//PBW 373; 22- Tc* 34; 23- FLW 6/PBW 435; 24- FLW 6/PBW 343; 25- FLW 6/HP 1731; 26- FLW 6/PBW 435//PBW 593; 27- FLW
2/CBW 14; 28- FLW 6/GW 173; 29- FLW 6/NIAW 34; 30- FLW 3/PHR 421; 31- FLW 3/PBW 502; 32- FLW3/DBW30
INDIAN J BIOTECHNOL, APRIL 2009
212
the reason that only those lines became part of
Advanced Varietal Trial which have proven resistance
against the rusts. In popular cultivars (C 306, HUW
234, Kharchia 65 & WH 147), the resistance has been
overcome by evolution of new pathotypes and,
therefore, they depicted high AUDPC values. Upon
comparing the AUDPC scores, lines found positive
for Lr34 gene were towards lower AUDPC value,
whereas the non-Lr34 possessing lines had higher
AUDPC range. Lines falling in the range of 101-200
for AUDPC truly represent the slow rusters. These
lines infer long lasting field resistance and must be
preferred while breeding to develop lines possessing
durable resistance.
In the F1 population, cultivars showed the presence
of Lr34 genes in heterozygous state and none of the
lines had Lr34 gene in homozygous state. It clearly
indicates that only one parent involved in the cross at
best carried Lr34 gene and other parent was without
Lr34 gene. In some F2 progenies, the Lr34 gene was
present in homozygous condition showing fixing of
Lr34 gene. The F2 population showed 9% decrease in
lines possessing Lr34 gene in comparison to F1
population. This may be due to the lack of direct
selection method for Lr34 gene and, therefore, the
population some times lost having Lr34 gene
(negative selection). A percentage of the lines
selected for advance generation by breeders showed
possession Lr34 durable rust resistance gene at
molecular level also, which clearly shows that, in the
absence of direct selection method, the breeders are
selecting Lr34 gene carrying lines unintentionally as
they showed better resistance.
Conclusion It was observed that about 20% of the advance
breeding lines and a good proportion of early
generation breeding lines (F1 & F2 bulks) carry
durable rust resistance gene Lr34. Breeders can now
use these Lr34 possessing lines/cultivars to rapidly
incorporate Lr34/Yr18 into adapted wheat cultivars
for minimizing the scope of losses due to leaf rust
epidemics in future and thereby realizing higher yield
potential. In order to maintain diversity of effective
resistance genes in released cultivars, durable rust
resistance gene like Lr34 should be utilized for wheat
breeding programmes.
Acknowledgement Authors thankfully acknowledge the financial
support provided by the Indo-Swiss Collaboration in
Biotechnology (ISCB) through its project “Enhancing
genetic resistance against stripe and leaf rust using
molecular markers in wheat adapted to the moisture
stress regime”. Thanks are also due to Dr Sanjay
Kumar Singh for going through the manuscript and
Mr Om Prakash for assistance in providing the details
of breeding lines.
References 1 Anilkster Y, Bushnell W R, Eilam T, Manisterski J & Roelfs
A P, Puccinia recondita causing wheat leaf rust on cultivated
wheats, wild wheats and rye, Can J Bot, 75 (1997) 2082-
2096.
2 Dyck P L & Kerber E R, Resistance of the race specific type,
in The cereal rusts, vol 2. Diseases, distribution,
epidemiology, and control, edited by A P Roelfs & W R
Bushnell (Academic Press, Orlando, Fla) 1985, 469-500.
3 Roelfs A P, Race specificity and methods of study, in The
cereal rusts, vol 1. Origin, specificity, structure and
physiology, edited by W R Bushnell & A P Roelfs
(Academic Press, Orlando, Fla) 1984, 131-154.
4 Dyck P L, The association of a gene for leaf rust resistance
with the chromosome 7D suppressor of stem rust resistance
in common wheat, Genome, 29 (1987) 467-69.
5 Kerber E R & Dyck P L, Transfer to hexaploid wheat of
linked genes for adult-plant leaf rust and seedling stem rust
resistance from an amphiploid of Aegilops speltoides ×
Triticum monococcum, Genome, 33 (1990) 530-537.
6 Singh R P, Association between gene Lr34 for leaf rust
resistance and leaf tip necrosis in wheat, Crop Sci, 32 (1990)
874-878.
7 Ma H & Singh R P, Contribution of adult plant resistance
gene Yr18 in protecting in seedlings and adult plants, Plant
Dis, 80 (1996) 66-69.
8 Singh R P & Gupta A K, Expression of wheat leaf rust
resistance gene Lr34 in seedlings and adult plants, Plant Dis,
76 (1992) 489-491.
9 Singh R P & Huerta-Espino J, Effect of leaf rust resistance
gene Lr34 on grain yield and agronomic traits of spring
wheat, Crop Sci, 37 (1997) 390-395.
10 Singh R P, Huerta-Espino J & William M, Slow rusting
genes bases resistance to leaf and yellow rusts in wheat:
Genetics and breeding at CIMMYT, Proc of 10th Assembly of
Wheat Breed Soc of Australia (Mildura, Australia) 2001,
103-10.
11 Singh R P & Rajaram S, Genetic of adult-plant resistance to
leaf rust in ‘Frontana’ and three CIMMYT wheats, Genome,
35 (1992) 24-31.
12 Saini R G, Kaur L & Kaur M, Adult plant leaf rust (Puccinia
recondita) resistance of known Lr genes against three
virulence variants of race 77 from Indian subcontinent,
Indian J Agric Sci, 68 (1998) 776-79.
13 Singh R P & Gupta A K, Genes for leaf rust resistance in
Indian and Pakistani wheats tested with Mexican pathotypes
of Puccinia recondita f. sp. tritici, Euphytica, 57 (1991) 27-
36.
14 Bahadur P, Adult plant resistance to leaf rust in 37 Indian
wheats, Proc of Indian Phytopathol Golden Jubilee, held at
IARI, New Delhi, 1998, 644-649.
PRIYAMVADA et al: Lr34 GENE IN INDIAN WHEAT
213
15 Roelfs A P, Resistance to leaf and stem rust in wheat, in
Breeding strategies for resistance to rusts of wheat, edited by
N W Simmonds & S Rajaram (CIMMYT, Mexico) 1988, 10-
22.
16 Suenaga K, Singh R P, Huerta-Espino J & William H M,
Microsatellite markers for genes Lr34/Yr18 and other
quantitative trait loci for leaf rust resistance in bread wheat,
Phytopathology, 93 (2003) 881-890.
17 Schnurbusch T, Bossolini E, Messmer M & Keller B,
Tagging and validation of a major quantitative trait locus for
leaf resistance and leaf tip necrosis in winter wheat cultivar
Forno, Phytopathology, 94 (2004) 1036-1041.
18 Spielmeyer W, McIntosh R A, Kolmer J & Lagudah E S,
Powdery mildew resistance and Lr34/Yr18 genes for durable
resistance to leaf and stripe rust cosegregate at a locus on the
short arm of chromosome 7D of wheat, Theor Appl Genet,
111 (2005) 731-735.
19 Bossoline E, Krattinger S G & Keller B, Development of
simple sequence repeat markers specific for the Lr34
resistance region of wheat using sequence information from
rice and Aegilops tauschii, Theor Appl Genet, 113 (2006)
1049-1062.
20 Lagudah E S, McFadden H, Singh R P, Huerta-Espino J,
Bariana H S et al, Molecular genetic characterization of the
Lr34/Yr18 slow rusting resistance gene region in wheat,
Theor Appl Genet, 114 (2006) 21-30.
21 Doyle J J & Doyle J L, A rapid isolation procedure from
small quantities of fresh leaf tissue, Phytochem Bull, 19
(1987) 11-15.