Identification of NURR1 (Exon 4) and FOXA1 (Exon 3 ...Parkinson’sDisease 5 100 400 300 200 MNURR1 exon 4 (1) M 349bp (a) 100 200 400 300 500 M NURR1 exon 4 (2) 416bp (b) 100 200

Research ArticleIdentification of NURR1 (Exon 4) and FOXA1 (Exon 3)Haplotypes Associated with mRNA Expression Levels inPeripheral Blood Lymphocytes of Parkinson’s Patients inSmall Indian Population

Jayakrishna Tippabathani, Jayshree Nellore, Vaishnavie Radhakrishnan,Somashree Banik, and Sonia Kapoor

Department of Biotechnology, Sathyabama University, Chennai 600119, India

Correspondence should be addressed to Jayshree Nellore; sree [email protected]

Received 20 October 2016; Revised 29 December 2016; Accepted 10 January 2017; Published 31 January 2017

Academic Editor: Cristine Alves da Costa

Copyright © 2017 Jayakrishna Tippabathani et al. This is an open access article distributed under the Creative CommonsAttribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work isproperly cited.

Here, we study the expression of NURR1 and FOXA1 mRNA in peripheral blood lymphocytes and its haplotypes in coding regionin a small Chennai population of India. Thirty cases of Parkinson’s patients (PD) with anti-PD medications (20 males aged 65.85 ±1.19 and 10 females aged 65.7 ± 1.202) and 30 age matched healthy people (20 males aged 68.45 ± 1.282 and 10 females aged65.8 ± 1.133) were included. The expression of NURR1 and FOXA1 in PBL was detected by Q-PCR and haplotypes were identifiedby PCR-SSCP. In the 30 PD cases examined, NURR1 and FOXA1 expression was significantly reduced in both male and female PDpatients. However, NURR1 (57.631% reduced inmales; 28.93% in females) and FOXA1 (64.42% inmales; 55.76% in females) mRNAexpression did differ greatly between male and female PD patients. Polymorphisms were identified at exon 4 of the NURR1 and atexon 3 of the FOXA1, respectively, in bothmale and female patients. A near significant difference in SSCP patterns between gendersof control and PD population was analyzed suggesting that further investigations of more patients, more molecular markers, andcoding regions should be performed. Such studies could potentially reveal peripheral molecular marker of early PD and differentsignificance to the respective genders.

1. Introduction

Parkinson’s disease (PD) is the second most common neu-rodegenerative disorder. PD is characterized by the loss ofdopaminergic neurons in the substantia nigra pars compactawhich leads to rigidity, bradykinesia, tremor, and posturalinstability. These symptoms do not develop until about 50–60% of the nigral neurons are lost and about 80–85% ofthe dopamine content of the striatum is depleted. The exactpathogenic mechanisms underlying the selective dopaminer-gic cell loss in PD are still not understood, although researchpoints that the disease is caused by a combination of geneticand environmental factors. The prevalence and incidence ofPD increase exponentially with age (∼1-2% of the populationabove age 65 and 4–5% above age 85) and are slightly higher

in men than in women. Recently in Deccan Chronicle, it hasbeen published that in India the incidence is bound to doublein ten years [1]. Magnetic resonance imaging (MRI) andcomputed tomography (CT) scan are usually unremarkableor may show age specific changes in Parkinson’s disease.There is no lab test for PD, so it can be difficult to diagnose.Doctors use medical history and a neurological examinationto diagnose it, but 70% of nigral neurons are lost whensymptoms appear [2]. Late diagnosis hampers clinical devel-opment of new disease-modifying therapies; only alleviatingsymptoms is possible at present. For this reason, great interestin developing peripheral biomarker for PD has increased.

Molecular biomarkers in body fluids are likely tomeet theexpectation of unprecedented specificity together with coststhat are lower than those of imaging/functional biomarkers.

HindawiParkinson’s DiseaseVolume 2017, Article ID 6025358, 8 pageshttps://doi.org/10.1155/2017/6025358

https://doi.org/10.1155/2017/6025358

2 Parkinson’s Disease

Quantitative assays of cerebrospinal fluid proteomics, serumor plasma metabolomics, and gene expression profile inperipheral blood lymphocytes (PBL) are done in an attemptto identify potential peripheral biomarkers of the disease.Several studies have used PBL to quantity specific changesin dopamine (DA) content, tyrosine hydroxylase activity, DAreceptors, and DA transporters in patients with PD [3, 4].In addition, a significant decrease in mitochondrial complexI activity and a significant increase in caspase-3 activityhave been reported in PBL of PD patients [5]. Likewise,genome-wide expression in PBL of PD patients and healthycontrols identified co-chaperone protein ST13 as a potentialmolecular marker of early PD [6]. Based on these data, ithas been proposed that PBL can be used for detecting thepossible indicators of pathological mechanisms occurring inthe brains of patients with PD.

Several studies demonstrated that transcription factors(TFs) like FOXA1/FOXA2, NURR1, PITX3, OTX2, LMX1a/b,and EN1/2 play a key role in mediating mesodiencephalicdopaminergic (mDA) neuron development and remainexpressed in adulthood though dopaminergic neuronal mat-uration is completed [7]. Mutations or variations in genescoding for transcription factors involved in regulation ofneuronal development and maintenance of nigrostriatal sys-tem function may be risk factors for PD [8, 9]. The humanNurr1 gene has been mapped on chromosome 2q22-23 andis composed of eight exons [10]. It is the key regulator fordevelopment of DA neurons and is also considered as acrucial regulator for the expression of several genes involvedin PD pathology including DA transporter (DAT), tyrosinehydroxylase (TH), and vesicular monoamine transporter(VMAT2). In addition, variants in NURR1 gene have beenfound in association with sporadic and familial PD [11–14].Also, deletion of FOXA1 and FOXA2 in embryonic DA neu-rons affects the binding of NURR1 to the promoter region ofTH and aromatic L-amino acid decarboxylase (AADC) genesleading to a significant loss of TH and AADC expression inthe SNpc of embryos and adult mice [15]. The deregulationof FOXA1/2 may also contribute to demise of DA neuronsduring PD progression in humans [16]. These observationssuggest that Nurr1 and FOXA1 are potential candidate genesfor PD susceptibility. However, there is no evidence on thegenetic variations in FOXA1 gene in PD patients. Althoughwe are diagnosing more patients with PD today, much needsto be done in the Indian context. Hence, the current study hasbeen proposed to explore the peripheral NURR1 and FOXA1gene expression in PD and to initially look for variation inexon 4 of NURR1 and exon 3 of FOXA1, respectively.

2. Subjects and Methods

2.1. Subjects. In the present study a total of 60 PBL samples,20 male PD patients aged 65.85 ± 1.19, 10 female PD patientsaged 65.7 ± 1.202, and 30 healthy controls (HC) matched bygender, age, and origin, were collected from Malar hospital,Chennai.The inclusion criteria for PD patients are as follows:being diagnosis with idiopathic PD, patients who are “on”medication (both male and female 𝑁 = 10) and who aremedically stable, Minimal Mini Mental State Examination 3

score of 24 or higher, and being able to walk independentlyindoors without an aid and outdoors with an aid. Controlsubjects were patient’s spouses and volunteers who are free ofneurological and psychiatric illnesses. All the female subjectswere considered postmenopausal who self-reported the com-pletion of menopause. All subjects or their legally authorizedcaregivers signed a written consent, approved by the Institu-tional Human Ethics Committee, Sathyabama University.

2.2. RNA Extraction and cDNA Synthesis. Whole blood(1mL) was anticoagulated with ethylene diamine tetra aceticacid (EDTA), mixed with phosphate-buffered saline (PBS)1 : 1, layered over HiSep LSM medium (HiMedia), and cen-trifuged at 400×g for 30min according to the manufacturer’sinstructions. Peripheral blood mononuclear cells (PBMCs)were isolated andwashed in ice-cold PBS for RNA extraction.Total RNA was isolated from PBMCs using the TRIzolReagent method (Invitrogen) and then cDNA synthesis wasperformed according to themanufacturer’s protocol (AppliedBiosystem).

2.3. Q-PCR Assay of NURR1 and FOXA1 Gene Expressionagainst Internal Control𝛽-Actin. Thedetailed information onthe NURR1, FOXA1, and 𝛽-actin primers is shown in Table 1.The experiment of QPCR was performed in duplicate withApplied Biosystem power SYBR green following protocol asdescribed: initial denaturation for 5min at 95∘C, followed by40 cycles of denaturation for 30 sec at 95∘C, annealing for45 sec at 61.5∘C, and extension for 45min at 72∘C.𝛽-Actinwasused as a house keeping gene to standardize the results. Therelative quantification of gene expression among the differentgroups was determined by the formation of 2−ΔΔCt [17].

2.4. Detection of Haplotypes by PolymeraseChain Reaction and Single Stranded ConformationPolymorphism (PCR SSCP) Analysis

2.4.1. DNA Isolation and Amplification of DNA. GenomicDNA (200–300 ng) was isolated from each blood samplefollowing the standard protocol [18]. 50 ng of this DNA wasadded to each 50 𝜇L of polymerase chain reaction (PCR)mix which contained Amplicon master mix and 10 pmol ofeach primer. The detailed information of the primers usedto explore haplotype variation in the exon 4 of NURR1 andexon 3 of FOXA1 are shown in Table 2. As the respectiveexons are too long for PCR-SSCP analysis it is divided intotwo reactions 1 and 2, respectively. PCR consisted of initialdenaturation at 94∘C for 5 minutes, 35 cycles of denaturationat 94∘C for 45 seconds, annealing at 60.4∘C for 45 seconds,and extension at 72∘C for 45 seconds with final extension at72∘C for 10 minutes.

2.4.2. Single Strand Conformation Polymorphism Analysis(SSCP). Single strand conformation polymorphism (SSCP)is a reproducible, rapid, and quite simple method for thedetection of deletions/insertions/rearrangements in the gene,which has been performed as described by Orita et al.[19]. Samples of purified double–stranded PCR productwere added to formamide dye (95% formamide, 0.025%

Parkinson’s Disease 3

Table 1: Genes with corresponding primers which are used for gene expression study.

Gene Primers sequence Size (bp) Accession no.

NURR1 Forward primer 5 CGGGTCGGTTTACTACAAG 3 111 AB017586.1

Reverse primer 5 TGGTGGAAGTTGTGGAGAG 3

FOXA1 Forward primer 5 GTTACAGGGAGGACTACCA 3 111 NM 004496.3

Reverse primer 5 TCCAAGGCAGTTCCAATAC 3

ACTB Forward primer 5 TCGTGCGTACATTAAGG 3 175 X00351.1

Reverse primer 5 AAGGAAGGCTGGAAGAGT 3

Table 2: Genes with corresponding primers which are used for SSCP analysis.

Gene Primers sequence Size (bp)

NURR1Exon 4 (1) Forward 5

AGACACGGGCTCAAGGAACC 3 349Reverse 5 ACTGCTCACACGGCTATCTCTG 3

Exon 4 (2) Forward 5 CCATTTCTGTAACCCTCCTAGC 3 416

Reverse 5 CCACCCACGCAACATTTAGT 3

FOXA1Exon 3 (1) Forward 5

TCGGAGCAGCAGCATAAG 3 488Reverse 5 GGCAAGGAAGGAGGAGAAT 3

Exon 3 (2) Forward 5 GAGAACGGCTGCTACTTG 3 300

Reverse 5 GGAGGCTGGAGTCTTCAA 3

xylenecyanol, 0.025% bromophenol blue, and 0.5M EDTA),denatured at 95∘C for 10 minutes, and immediately snapcooled on ice for 15 minutes. Aliquots were loaded on 12%polyacrylamide gel and subjected to electrophoresis for 10hours at 200V, 4∘C. The gel was stained with 0.1% silvernitrate to visualize the reannealed single stranded PCRproducts.

2.5. Statistical Analysis. Quantitative data were expressed asSEM (standard error mean). The chi-square test or Student’st-test was used to test for differences between the PD patientsand control subjects in the distribution of gender and age.Multivariate analysis was used to evaluate the differencesin the mean value of the NURR1 and FOXA1 mRNA geneexpression in PD Patients compared with controls.

3. Results and Discussion

This study aimed to detect differences in the expression ofgenes possibly related to the differentiation, survival, con-nectivity, and migration of dopamine neurons in peripheralblood of both male and female PD and respective controlsubjects.

3.1. Research Participants. We enrolled 30 consecutive PDpatients who were ethnic Indians, diagnosed by the clinicalassessments and stringent diagnosis criteria for PD [20]and 30 age matched healthy and neurodegenerative diseasecontrol individuals (Table 3) from Fortis Malar Hospital,Adyar. Amongst the PD patients, 20 were men and 10 werewomen. Further age matched, 30 healthy control individualswere enrolled where 20 were men and 10 were women. Theage ranged from 58 to 76 with a mean of 65.85±1.19 years formale PD patients andmale controls 68.45±1.282, while in thecase of females the age ranged from 59 to 74 years with amean

of 65.7±1.202 for PDpatients and female controls 65.8±1.133.From Table 3, there is good evidence that the incidence of PDis more in male population when compared to women. Ourfinding is in concurrence with the previous reports wheremen in general are about 1.5 times more likely to develop PDthan women, that is, in the ratio of 3 : 1 (male : female) [21].

3.2. NURR1 and FOXA1 Expression on PBL of All StudyGroups. NURR1 is highly expressed in midbrain DAergicneurons [22] as well as other tissues, including PBL [23].Emerging evidence indicates that impaired NURR1 functionmight contribute to the pathogenesis of PD: NURR1 andits transcriptional targets are downregulated in midbrainDA neurons that express high levels of the disease-causingprotein 𝛼-synuclein. Recent studies indicated decreasedexpression in PBL in PD patients independent of medication,disease duration, or severity; NURR1 could be a usefulbiomarker for PD and related disorders [24, 25]. In ourstudy, we observed reduction in mean mRNA expression ofNURR1 inmale patients with PD by 57.91% than healthymalecontrols (𝑝 < 0.05). To further determine the association ofgender with the changes of NURR1 expression, we performedanalyses in female PD and found that the NURR1 geneexpression was reduced by 28.93% than healthy femalecontrols (𝑝 < 0.05; Figure 1; Table 3). This data indicatesthat the decreased expression inNURR1 gene in PDwasmorerobust in male patients and the difference between male PDand female PDwas statistically significant (𝑝 < 0.05; Table 3).Moreover, NURR1 gene expression was more significantlydecreased in older and female patients [25]. Focusing onthe NURR1 levels in control samples, females showed lesserlevels of NURR1 mRNA expression compared to men (𝑝 <0.05; Table 3). Pérez-Sieira et al. demonstrated that estrogensare implicated in the upregulation of NURR1 in female rats[26]. Matsuki et al. confirmed that the levels of NURR1 in


Table 3: NURR1 gene expression versus 𝛽-actin as internal control in all groups.

Group Gender Age Number of samples used NURR1 mRNA mean ± SME p valueHC Male 68.45 ± 1.282 20 1.208 ± 0.36


100

400300200

NURR1 exon 4 (1) MM

349bp

(a)

100200400300500

NURR1 exon 4 (2)M M

416bp

(b)

100

200300400500

FOXA1 exon 3 (1) MM

488bp

(c)

M

FOXA1 exon 3 (2)

300bp 300bp

(d)

Figure 3: PCR amplification for exon 4 of the NURR1 gene (a-b) and exon 3 of the FOXA1 gene (c-d). The exons were divided into tworeactions: 1 and 2, respectively.

♀ NURR1 exon 4 (2)

Control

PD patients

♂ NURR1 exon 4 (1) ♂ NURR1 exon 4 (2) ♀ NURR1 exon 4 (1)

A A A A A A A B B B B B B B B B B B B B B B B B B B B B B

D D D D D D D B B B D D D D B B B B B B B B B B

Figure 4: Representative SSCP analyses for exon 4 of the NURR1 gene in male and female PD patients. The exon was divided into tworeactions: 1 and 2. A, B, and D represent conformational patterns of the bands found.

Table 4: FOXA 1 gene expression versus 𝛽-actin as internal control in all groups.

Group Gender Age Number of samples used FOXA1 mRNA mean ± SME p valueHC Male 68.45 ± 1.282 20 1.373 ± 0.77


♀ FOXA1 exon 3 (2)

Control

PD patients

♂ FOXA1 exon 3 (1) ♂ FOXA1 exon 3 (2) ♀ FOXA1 exon 3 (1)

C C C C C C C B B B B B B B DD D D D D D D D D D D

B B B B B B A A A A A A D D D D D D D D D D D D

Figure 5: Representative SSCP analyses for exon 3 of the FOXA1 gene in male and female PD patients. The exon was divided into tworeactions: 1 and 2. A, B, C, and D represents conformational patterns of the bands found.

Table 5: Mean values (±SEM) of mRNA expression (2−Δct) with PCR-SSCP patterns of NURR1 and FOXA1 gene.

Gene Gender Condition 2−ΔCT SSCP patterns SignificancePCR1 PCR2

NURR1Male

HC 1.208 A B


dependent genetic variation was demonstrated in exon 4 ofNURR1 and exon 3 of FOXA1 of healthy controls, respectively.

4. Conclusions

In conclusion, these findings endorse the fact that com-mon haplotype variation in transcription factors might haveimportant and clinically relevant associations with PD. Weanticipate that these findings will have implications for ourunderstanding of gender differences in PD and also morebroadlywith potential applications in risk stratification, prog-nostication, and the development of appropriately targeted-treatment strategies. However, because only a small numberof samples andonly exon 4/3 regionwere investigated, amuchlarger association study is warranted in further studies.

Competing Interests

The authors declare that there are no competing interestsregarding the publication of this paper.

Acknowledgments

The authors would like to thank patients, doctors, and otherstaff of Brain and Spine Care Unit, Fortis Malar Hospital,for their assistance. The authors would also like to thank theGenetics and Molecular Biology Laboratory, Directorate ofPoultry Research, Hyderabad, for giving them access to theirQ-PCR facility.The authors would like to extend great thanksto Sathyabama University for providing the opportunity tocarry out this research work.

References

[1] A. S. John, “Multi-disciplinary care for Parkinson’s must, saydocs. LifestyleHealth andWellbeing,”DeccanChronicle, http://www.deccanchronicle.com.

[2] C. W. Olanow, M. B. Stern, and K. Sethi, “The scientific andclinical basis for the treatment of Parkinson disease (2009),”Neurology, vol. 72, no. 21, S4, pp. S1–S136, 2009.

[3] M. Shi, B. R. Huber, and J. Zhang, “Biomarkers for cognitiveimpairment in parkinson disease,” Brain Pathology, vol. 20, no.3, pp. 660–671, 2010.

[4] R. Buttarelli, Francesca, A. Fanciulli, C. Pellicano, and F. E. Pon-tieri, “The dopaminergic system in peripheral blood lympho-cytes: from physiology to pharmacology and potential applica-tions to neuropsychiatric disorders,” Current Neuropharmacol-ogy, vol. 9, no. 2, pp. 278–288, 2011.

[5] F. Blandini, A. Mangiagalli, M. Cosentino et al., “Peripheralmarkers of apoptosis in parkinson’s disease: the effect ofdopaminergic drugs,” Annals of the New York Academy of Sci-ences, vol. 1010, no. 1, pp. 675–678, 2003.

[6] C. R. Scherzer, A. C. Eklund, L. J. Morse et al., “Molecularmarkers of early Parkinson’s disease based on gene expressionin blood,” Proceedings of the National Academy of Sciences of theUnited States of America, vol. 104, no. 3, pp. 955–960, 2007.

[7] H. Doucet-Beaupré and M. Lévesque, “The role of develop-mental transcription factors in adult midbrain dopaminergicneurons,” OA Neurosciences, vol. 1, no. 1, article no. 3, 2013.

[8] K. N. Alavian, C. Scholz, and H. H. Simon, “Transcriptionalregulation of mesencephalic dopaminergic neurons: the full

circle of life and death,” Movement Disorders, vol. 23, no. 3, pp.319–328, 2008.

[9] J. Jankovic, S. Chen, and W. D. Le, “The role of Nurr1 in thedevelopment of dopaminergic neurons and Parkinson’s dis-ease,”Progress inNeurobiology, vol. 77, no. 1-2, pp. 128–138, 2005.

[10] T. Torii, T. Kawarai, S. Nakamura, and H. Kawakami, “Organi-zation of the human orphan nuclear receptor Nurr1 gene,”Gene,vol. 230, no. 2, pp. 225–232, 1999.

[11] K.-S. Kim, C.-H. Kim, D.-Y. Hwang et al., “Orphan nuclearreceptor Nurr1 directly transactivates the promoter activity ofthe tyrosine hydroxylase gene in a cell-specificmanner,” Journalof Neurochemistry, vol. 85, no. 3, pp. 622–634, 2003.

[12] E. Hermanson, B. Joseph, D. Castro et al., “Nurr1 regulatesdopamine synthesis and storage in MN9D dopamine cells,”Experimental Cell Research, vol. 288, no. 2, pp. 324–334, 2003.

[13] S. M. Smits, T. Ponnio, O. M. Conneely, J. P. H. Burbach, andM. P. Smidt, “Involvement of Nurr1 in specifying the neuro-transmitter identity of ventral midbrain dopaminergic neu-rons,” European Journal of Neuroscience, vol. 18, no. 7, pp. 1731–1738, 2003.

[14] W.-D. Le, P. Xu, J. Jankovic et al., “Mutations in NR4A2 asso-ciated with familial Parkinson disease,”Nature Genetics, vol. 33,no. 1, pp. 85–89, 2003.

[15] S. R. W. Stott, E. Metzakopian, W. Lin, K. H. Kaestner, R. Hen,and S.-L. Ang, “Foxa1 and Foxa2 are required for the main-tenance of dopaminergic properties in ventral midbrain neu-rons at late embryonic stages,”The Journal of Neuroscience, vol.33, no. 18, pp. 8022–8034, 2013.

[16] G. T. Sutherland, N. A. Matigian, A. M. Chalk et al., “A cross-study transcriptional analysis of Parkinson’s disease,” PLoSONE, vol. 4, no. 3, Article ID e4955, 2009.

[17] T. D. Schmittgen and K. J. Livak, “Analyzing real-time PCR databy the comparative CT method,” Nature Protocols, vol. 3, no. 6,pp. 1101–1108, 2008.

[18] J. Sambrook andD.W. Russell,Molecular Cloning: A LaboratoryManual, Coldspring-Harbour Laboratory Press, London, UK,3rd edition, 2001.

[19] M. Orita, H. Iwahana, H. Kanazawa, K. Hayashi, and T. Sekiya,“Detection of polymorphisms of human DNA by gel electro-phoresis as single-strand conformation polymorphisms,” Pro-ceedings of the National Academy of Sciences of the United Statesof America, vol. 86, no. 8, pp. 2766–2770, 1989.

[20] N. Pankratz,W.C.Nichols, S. K.Uniacke et al., “Significant link-age of Parkinson disease to chromosome 2q36-37,” AmericanJournal of Human Genetics, vol. 72, no. 4, pp. 1053–1057, 2003.

[21] G. F. Wooten, L. J. Currie, V. E. Bovbjerg, J. K. Lee, and J. Patrie,“Are men at greater risk for Parkinson’s disease than women?”Journal of Neurology, Neurosurgery & Psychiatry, vol. 75, no. 4,pp. 637–639, 2004.

[22] M. J. Bannon, B. Pruetz, A. B. Manning-Bog et al., “Decreasedexpression of the transcription factor NURR1 in dopamine neu-rons of cocaine abusers,” Proceedings of the National Academy ofSciences of the United States of America, vol. 99, no. 9, pp. 6382–6385, 2002.

[23] T. Pan, W. Xie, J. Jankovic, andW. Le, “Decreased Nurr1 mRNAin peripheral blood lymphocytes in Parkinson’s disease,”Neuro-logy, vol. 62, no. 7, article A108, 2004.

[24] W. Le, T. Pan, M. Huang et al., “Decreased NURR1 gene expres-sion in patients with Parkinson’s disease,” Journal of the Neuro-logical Sciences, vol. 273, no. 1-2, pp. 29–33, 2008.

http://www.deccanchronicle.comhttp://www.deccanchronicle.com


[25] H. Liu, L.Wei, Q. Tao et al., “DecreasedNURR1 and PITX3 geneexpression in Chinese patients with Parkinson’s disease,” Euro-pean Journal of Neurology, vol. 19, no. 6, pp. 870–875, 2012.

[26] S. Pérez-Sieira, M. López, R. Nogueiras, and S. Tovar, “Regula-tion of NR4A by nutritional status, gender, postnatal develop-ment and hormonal deficiency,” Scientific Reports, vol. 4, articleno. 4264, 2014.

[27] C.Matsuki, M. To, Y. Kondo et al., “Associations between brain-derived neurotrophic factor and estradiol in women’s saliva,”Neuroendocrinology Letters, vol. 35, no. 3, pp. 236–241, 2014.

[28] M. A. Hauser, Y.-J. Li, H. Xu et al., “Expression profiling ofsubstantia nigra in Parkinson disease, progressive supranu-clear palsy, and frontotemporal dementia with parkinsonism,”Archives of Neurology, vol. 62, no. 6, pp. 917–921, 2005.

[29] Y. Zhang, M. James, F. A. Middleton, and R. L. Davis, “Tran-scriptional analysis of multiple brain regions in Parkinson’sdisease supports the involvement of specific protein processing,energy metabolism, and signaling pathways, and suggests noveldisease mechanisms,” American Journal of Medical Genetics—Neuropsychiatric Genetics, vol. 137, no. 1, pp. 5–16, 2005.

[30] L. B. Moran, D. C. Duke, M. Deprez, D. T. Dexter, R. K. B.Pearce, andM. B. Graeber, “Whole genome expression profilingof themedial and lateral substantia nigra in Parkinson’s disease,”Neurogenetics, vol. 7, no. 1, pp. 1–11, 2006.

[31] T. G. Lesnick, S. Papapetropoulos, D. C.Mash et al., “A genomicpathway approach to a complex disease: axon guidance andParkinson disease,” PLoS Genetics, vol. 3, no. 6, article e98, 2007.

[32] A. Domanskyi, H. Alter, M. A. Vogt, P. Gass, and I. A.Vinnikov, “Transcription factors Foxa1 and Foxa2 are requiredfor adult dopamine neurons maintenance,” Frontiers in CellularNeuroscience, vol. 8, article no. 275, 2014.

[33] E.-K. Tan, H. Chung, Y. Zhao et al., “Genetic analysis of Nurr1haplotypes in Parkinson’s disease,”Neuroscience Letters, vol. 347,no. 3, pp. 139–142, 2003.

[34] D. A. Grimes, F. Han, M. Panisset et al., “Translated mutationin the Nurr1 gene as a cause for Parkinson’s disease,”MovementDisorders, vol. 21, no. 7, pp. 906–909, 2006.

Submit your manuscripts athttps://www.hindawi.com

Stem CellsInternational

Hindawi Publishing Corporationhttp://www.hindawi.com Volume 2014


MEDIATORSINFLAMMATION

of


Behavioural Neurology

EndocrinologyInternational Journal of



Disease Markers


BioMed Research International

OncologyJournal of



Oxidative Medicine and Cellular Longevity


PPAR Research

The Scientific World JournalHindawi Publishing Corporation http://www.hindawi.com Volume 2014

Immunology ResearchHindawi Publishing Corporationhttp://www.hindawi.com Volume 2014

Journal of

ObesityJournal of



Computational and Mathematical Methods in Medicine

OphthalmologyJournal of


Diabetes ResearchJournal of



Research and TreatmentAIDS


Gastroenterology Research and Practice


Parkinson’s Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttp://www.hindawi.com

Documents

Identification of NURR1 (Exon 4) and FOXA1 (Exon 3 ...Parkinson’sDisease 5 100 400 300 200 MNURR1 exon 4 (1) M 349bp (a) 100 200 400 300 500 M NURR1 exon 4 (2) 416bp (b) 100 200