Identification of HeLa cell nuclear factors that bind to and activate

MOLECULAR AND CELLULAR BIOLOGY, Sept. 1989, p. 3821-3828 Vol. 9, No. 90270-7306/89/093821-08$02.00/0Copyright © 1989, American Society for Microbiology

Identification of HeLa Cell Nuclear Factors That Bind to andActivate the Early Promoter of Human Polyomavirus BK In Vitro

TUSHAR CHAKRABORTY AND GOKUL C. DAS*

Department of Molecular Biology, The University of Texas Health Center at Tyler, P.O. Box 2003, Tyler, Texas 75710

Received 10 February 1989/Accepted 30 May 1989

Human polyomavirus BK (BKV), an oncogenic DNA virus, differs from other papovaviruses in theorganization of the regulatory region and in tissue tropism for kidney cells. The noncoding regulatory regionof the viral genome in prototype strains includes three 68-base-pair (bp) repeats, each containing a number ofpotential regulatory elements. Some of these signals are unique to human papovaviruses, and others arehomologous to those identified in many viral and cellular genes. We evaluated the contribution of individual68-bp repeats to the initiation of transcription from the early promoter in a HeLa cell extract and identifiedcis-acting elements to which human cellular factors bind to activate transcription. The early promoter with onlyone copy of the 68-bp repeat could accurately initiate transcription in vitro, but additional copies were requiredfor its stimulation. DNA-binding assays and DNase I protection experiments identified six domains in theregulatory region protected by human cellular factors. Two of these footprints were located within the proximaland distal 68-bp repeats, and one was located at the late side of the repeats. These footprints were centered overa TGGA(N)s_6GCCA core and were produced by a protein of the nuclear factor 1 (NF-1) family. This proteinis either identical or similar to that which binds to the high-affinity site at the origin of adenovirus DNAreplication. Three other domains, two at the junctions of the 68-bp repeats and one in the late side of therepeats, were partially protected by proteins with AP-1- and Sp-1-like activities. Transcription initiation fromthe early promoter was drastically reduced when a complete 68-bp repeat or the NF-1 binding site was used asa competitor in the in vitro assay. However, a point mutation within the NF-1 binding site, which reduced NF-1binding in vitro to a level comparable to that of nonspecific DNA, also eliminated its ability to compete withearly transcription. The murine homolog of the AP-1 binding site had a modest effect on in vitro transcription.Our results suggest that, among the multiple HeLa cell nuclear factors, NF-1 acts as a major activator of theearly promoter in vitro.

BK virus (BKV) is a human polyomavirus that infectsmost of the world's population by the time of adolescenceand is thought to be a causative agent for human cancer (34,36, 37, 46). It can transform rodent cells, either in livinganimals or in culture (52-54). Transgenic mice containing theearly region of the viral genome develop tumors in tissuescommonly affected by this virus (49). In infected individuals,the virus persists in a latent form throughout life and isreactivated by unknown mechanisms when immunity issuppressed naturally or therapeutically (5, 6, 16). Reactiva-tion of this virus has been shown recently to be associatedwith acute hemorrhagic cystitis (1, 2).

Several strains of BKV have been isolated, cloned, andsequenced (3, 16, 35, 41, 47, 51, 55). All of them showextensive homology in protein-coding sequences both witheach other and with the closely related simian virus 40.However, the sequences of the noncoding regulatory regionsof simian virus 40 and BKV are strikingly different. Twoprototype BKV strains (Gardner and Dunlop) contain three68-base-pair (bp) repeats in the regulatory region, with an18-bp deletion in the middle copy. This region can act as anenhancer (40) and also contains core promoter elementsimportant for the initiation of transcription in vivo (11, 12).Thus, questions related to defining the host range, tissuetropism, and reactivation of BKV in latency could be ad-dressed by identifying the cis-acting elements and the trans-acting factors from human cells that interact with theseelements.

Cell-free transcription and DNA-binding assays have been

* Corresponding author.

very important in the identification of cis- and trans-actingelements of cellular and viral genes. No in vitro transcrip-tional studies of the BKV promoter have yet been reported.In this paper, we report an investigation of the roles ofDNA-protein interactions in promoter function in vitro byDNA binding and transcriptional analyses in a HeLa cellextract. We show that multiple HeLa cell nuclear proteinsbind to each 68-bp repeat and that among these proteins,nuclear factor 1 (NF-1) acts as the major transcriptionalactivator for early transcription in vitro.

MATERIALS AND METHODSPlasmids and DNA. Three plasmids, pBK501, pBK503,

and pBK504, containing the BKV genome (Gardner strain)with three, two, and one copy, respectively, of the 68-bprepeat were obtained as a gift from K. Yoshike, NationalInstitutes of Health, Tokyo, Japan. Another plasmid, con-taining the full-length viral genome of the Dun strain (ATCC45025), was obtained from the American Type CultureCollection, Rockville, Md. Plasmids PLTG and CAS-9,containing G-less cassettes, were kindly provided by G. U.Ryffel, Institute for Genetics and Toxicology, University ofKarlsruhe, Karlsruhe, FRG (45). Recombinant plasmidPLTG-BK was constructed by cloning a HaeIII fragment ofBKV (Gardner) form nucleotide positions 142 to 400 with aPstI linker at the PstI site of the vector PLTG. PlasmidspKB 67/88, containing 88 copies of the NF-1 binding site,and pM 26/57, carrying a base substitution in the NF-1binding site, were obtained from T. Kelley, John HopkinsSchool of Medicine, Baltimore, Md. (38). All DNAs werepurified by banding twice in a CsCI-ethidium bromide gradi-

3821

3822 CHAKRABORTY AND DAS

Early transcription Late transcription

Hae III

17 (142) 210 261 328 Insert (Gardner)

a Fl -41^'' . 1 a Flo --,

nDI 4 4 L

Hae III(400)

I I

III

NF-1 HCR ElA5' CACAGGGAGGAGCTGCTTACCCATGGAATGCAGCCAAACCATGACCTCAGGAAG GAAAGTGCATGACT 3'3' GTGTCCCTCCTCGACGAATGGGTACCTTACGTCGGTTTGGTACTGGAGTCCTTC CTTTCACGTACTGA 5'

I-------4-18 ----------1FIG. 1. (A) Regulatory region of BKV. Symbols and abbreviations: <, TATA box: E, CCTCCC; rI1, NF-1 binding site; *, 4, simian

virus 40 core enhancer; HCR; *, adenovirus core enhancer; 02 CCGCCC sequence; r., T-antigen binding sites I, II, and III; E andL, initiation sites for major early and late RNAs, respectively; ORI, origin of DNA replication. PAL, Palindromic sequences; IR-l and IR-II,inverted repeats. The shaded area between the two vertical arrows ( t ) is an 18-bp deletion. Numbering for the 5,196-bp BKV genome

(Gardner) begins at the start site of the coding sequences for large T and small t antigens according to the convention of Seif et al. (47) forBKV (Dun), taking into account an additional 43-bp insertion, and proceeds toward the late region. (B) Sequence of a 68-bp repeat withpotential regulatory elements and the 18-bp deletion in the second repeat (underlined).

ent. DNAs were digested with the indicated restrictionendonucleases, extracted with phenol, and precipitated withethanol before transcription in vitro.

Synthetic oligonucleotides. The following double-strandedoligonucleotides (oligos) containing the recognition site forpotential trans-acting factors were prepared by annealing thecomplementary strands of the chemically synthesized oligo-nucleotides (sequences of the strands are shown in the5'-to-3' direction): oligo A, 5'-TTACCCATGGAATGCAGCCA-3'; oligo B, 5'-ATCGATAACCATGACCTCA-3'; oligoC, 5'-GGAAGGAAAGTGCATGACTGT-3'; oligo D, 5'-TTTTGGCTTGAAGCCAATATGAG-3'; oligo E, 5'-AGCTTACCCATGGAATGCAGCCAA-3'; polyomavirus A enhancer(PyA)/AP-1, 5'-GATCCTGTCAAGTCAGTTAAGCAGGAAGTGACTAACTGACCGCAGCTG-3'; 68-bp repeat, com-

plementary strands of the BKV (Gardner) genome betweennucleotide positions 143 and 210 (Fig. iB).

In vitro transcription and RNA analysis. For in vitrotranscription, a HeLa whole-cell extract was prepared by themethod of Manley et al. (29) and titrated over a range ofDNA concentrations from 3.2 to 32 jig/ml. Assays were

conducted under conditions described previously (8, 9). Forrapid quantitative analysis, we used the assay system devel-oped by Sawadogo and Roeder (43), in which the testpromoter is linked to an artificial DNA fragment that doesnot contain G residues on the messenger strand. In theabsence of GTP, the size of the transcript is defined only bythe cap site and the first G residue flanking the 3' border ofthe cassette. As an internal control, another plasmid con-

taining the adenovirus type 2 major late promoter with a

shorter G-less cassette of 190 nucleotides was used. PurifiedRNA samples were analyzed on 8% polyacrylamide-ureagels.

Primer extension analysis of the 5' ends of RNA. The 5'ends of the RNA synthesized in vitro were mapped byprimer extension analysis (26). A 20-mer oligonucleotidecomplementary to the early RNA sequence corresponding tothe viral genome between nucleotide positions 49 and 68 wassynthesized chemically and used as a primer. RNA synthe-sized in vitro from the supercoiled templates was purifiedand hybridized with 2 ng of y-32P-end-labeled primer (25,000cpm). The primer was then elongated with mouse mammary

tumor virus reverse transcriptase at 42°C for 30 min. Theextended products were purified and loaded on 8% poly-acrylamide-urea gels.

Gel electrophoresis DNA-binding assay. Nuclear extractwas prepared from actively growing HeLa cells as describedby Dignam et al. (13). Both strands of the DNA probes were

synthesized chemically, labeled at the 5' ends in the pres-

ence of [_y-32P]ATP and T4 polynucleotide kinase, and an-

nealed to obtain double-stranded probes of very high specificactivity. The probes (0.2 ng, 20,000 cpm) were incubatedwith nuclear extract after a 10-min preincubation withpoly(dI-dC) as nonspecific competitor DNA. The bindingreaction (30 pAl) was carried out in 25 mM N-2-hydroxyeth-ylpiperazine-N'-2-ethanesulfonic acid (HEPES; pH 7.9)-6mM MgCl2-0.5 mM EDTA-0.5 mM dithiothreitol-10% glyc-erol-0 to 500 mM NaCI at room temperature for 30 min. Theconditions for optimal binding were determined by separatetitration experiments. DNA-protein complexes were ana-

lyzed by electrophoresis at low ionic strength (6.7 mM Trishydrochloride [pH 7.5], 3.3 mM sodium acetate, 1 mMEDTA) in a 4% polyacrylamide gel at 150 V for 2 h as

described elsewhere (17, 48).DNase I footprinting. Plasmid PLTG-BK, containing the

258-bp enhancer-promoter fragment, was first digested withBamHI and then radiolabeled with [y-32P]ATP and T4 poly-nucleotide kinase. The labeled product was further digestedwith Hindlll, and the smaller fragment was purified byelectroblotting to obtain the early-strand probe. The late-strand probe was similarly prepared by radiolabeling at theHindlll site of PLTG-BK, followed by digestion withBamHI. Binding conditions were essentially as described forthe gel electrophoresis DNA-binding assay. PancreaticDNase I (RQ1; Promega Biotec) was added to a finalconcentration of 5 U/ml, and partial digestion was performedby incubation at room temperature for 90 s. The reaction wasstopped by addition of 5 volumes of a stop buffer containing10 mM EDTA, 0.1% sodium dodecyl sulfate, 5 ,ug ofproteinase K, and 1 ,ug of yeast tRNA. The mixture was

incubated at 37°C for an additional 20 min, extracted withphenol-chloroform (1:1), ethanol precipitated, and separatedin a 6% polyacrylamide-7 M urea sequencing gel.

A

50hC

E

9.

PAL IR-II

I L'JnI

---

11

B

-------

MOL. CELL. BIOL.

NF-1 AS A MAJOR ACTIVATOR OF BKV EARLY TRANSCRIPTION

B NtA M 12 3

m40

2322-2027-

_- 0. _"ftas "

_ I 3 Minor

Major

*j5 4(97)xi.A

-*- Primer

RESULTS

Role of 68-bp repeats in the efficiency and accuracy of invitro transcription initiation. The role of individual 68-bprepeats in the early promoter function was investigated byboth primer extension experiments and runoff assays. Threeplasmids, pBK501, pBK503, and pBK 504, containing theviral genome with three, two, and one copy of the repeat,respectively, were used as templates for RNA synthesis invitro. For primer extension analyses, RNA was hybridizedto an end-labeled single-stranded 20-mer complementary tothe early RNA sequence. Examination of the extendedproducts suggested that transcription was initiated from theearly promoter at two clusters of closely spaced sites, onemajor and another minor (Fig. 2A, lane 3). More than 50% ofthe chain started at nucleotide position 97 in the majorcluster, a site identical to that utilized in vivo (11). Noprimer-extended product was obtained when supercoiledpBR322 DNA was used as a template (not shown). Theextended products were absent when a low concentration ofa-amanitin was included in the assay, indicating that thetemplate was transcribed by RNA polymerase II (data notshown). A substantial amount of the extended chains pre-

maturely terminated within 10 nucleotides of the 3' end ofthe primer, probably because of the palindromic nature ofthis region. The start sites for pBK503 and pBK504 wereidentical to those for pBK501. Direct visualization of theautoradiogram revealed that the promoter efficiency de-creased drastically with the decrease in the number of 68-bprepeats (Fig. 2A, lanes 1 to 3).

Since multiple initiation sites were used in vitro, we usedrunoff assays for quantitative analysis of promoter effi-

,j I -

FIG. 2. Role of the 68-bp repeat in early in vitro transcription.(A) Primer extension analysis. A 20-mer was end labeled with[y-32PATP and T4 polynucleotide kinase for use as a primer forreverse transcription. This labeled primer was hybridized withRNAs transcribed from a supercoiled template and extended byreverse transcription. The products were separated in an 8% poly-acrylamide-urea gel. Lanes: M, DNA size marker; 1, pBK504; 2,pBK503; 3, pBK501. The major and minor RNA initiation sites areindicated by arrows. Two nonspecific bands have also been marked(0). Primer 5'-AGGCCTCAGAAAAAGCCTCC-3'. (B) Runoff as-say. Three plasmids, pBK501 (wild type), pBK503, and pBK504,containing, respectively, three, two, and one copy of the 68-bprepeat, were used for transcription as described in the text. Posi-tions of the early transcript and of the internal control are marked byarrows. Lanes: 1, pBK501; 2, pBK503; 3, pBK504; M, DNA sizemarkers (indicated in base pairs).

ciency. All three templates were linearized by BamHI beforetranscription. For use as an internal control, the pBK501template was double digested with BamHI and NdeI andthen cotranscribed. The former digest gave rise to a tran-script of about 3,550 nucleotides, and the latter produced atranscript of 1,554 nucleotides (Fig. 2B, lane 1). The ratio ofthe two transcripts for each template was determined bydensitometric scanning. The transcriptional efficiency of theearly promoter was reduced to about 65% that of the wildtype with deletion of the middle copy of the repeat (lane 2).A further reduction to about 15% was observed when onemore copy of the repeat was deleted (lane 3). These datasuggest that the early promoter with a single copy of the68-bp repeat can accurately transcribe the early genes invitro but that additional copies of this element potentiatetranscription utilizing identical start sites.

Binding of multiple HeLa cell nuclear proteins to the 68-bprepeat and to its constituent motifs. Gel electrophoresisDNA-binding assays were performed to identify trans-actingnuclear factors that bind to the promoter region. We chem-ically synthesized both strands of the 68-bp repeat for use asthe probe. The 32P-labeled probes were incubated withnuclear extracts that had been preincubated with poly(dI-dC), used as a nonspecific competitor. The DNA-proteincomplexes were analyzed in a low-ionic-strength polyacryl-amide gel as described in Materials and Methods.A double-stranded 73-mer containing the sequences for

the 68-bp repeat formed three major complexes, C-I, C-II,and C-III, with the nuclear extract (Fig. 3A, lane 1). Mag-nesium ion was required for the formation of C-I, in itsabsence only C-II and C-III were formed, which were stableup to 15 mM EDTA and 150 mM NaCl or KCl (results notshown). To examine the specificity of protein binding, we

3823VOL. 9, 1989

li P. C, q % .2,

--Q- , .,F,:., '.1

:-- - r- -

C --


A _ _Cornpetitor B Comet or

0 0

0-{ _NW

C-t w

Free-

FIG. 3. Gel electrophoresis DNA-binding assay. (A) Competi-tion binding analysis. The end-labeled 68-bp repeat (20,000 cpm/0.2ng) was incubated with unfractionated HeLa cell nuclear extract inthe presence of poly(dI-dC) in a standard binding reaction mixture(see Materials and Methods). Competitor fragments in 100-foldmolar excess over the labeled probe (68-bp repeat) were included inthe binding mixture during preincubation as indicated above thelanes. (B) Direct binding analyses of factors interacting with theNF-1 binding site. The double-stranded adenovirus NF-1 bindingsite was labeled with 32P and incubated with 5 pLg of HeLa nuclearextract under standard binding conditions. The unlabeled competi-tors in a 100-fold molar excess were added to the assays as indicatedabove the lanes.

synthesized potential regulatory elements and used them as

competitors in the DNA-binding assay. These included (i)the binding site for NF-1-like protein, TGGA(N)5GCCA,with a 3' extension up to the CCA terminal to avoid inclusionof the adjacent element (oligo A); (ii) a 19-mer containing thesequence (12 nucleotides) of a human cellular repeat (HCR[40]) that is present in multiple copies in a human genomicclone (oligo B); and (iii) sequences homologous to the core

enhancer of the adenovirus ElA gene (oligo C). As compet-itors in the binding assay, all of them competed with C-I tovarious extents, but none of these oligonucleotides com-

peted with either C-II or C-Ill (Fig. 3A). To investigate thisfinding further, we synthesized two other oligonucleotides,one corresponding to the high-affinity NF-1 binding site ofthe adenovirus origin of replication (oligo D) and the othercontaining the sequences of oligo A with an additionalflanking sequences of 6 nucleotides (oligo E). Both oligo Dand oligo E competed with all three complexes, indicatingthat NF-1 was the major protein that bound to the 68-bprepeat.The binding studies were next extended by using the

high-affinity NF-1 binding site from adenovirus as the probe.Multiple bands were generated when this probe was com-

plexed with HeLa cell nuclear proteins (Fig. 3B). The

banding pattern was consistent with that reported for NF-1(7). All of these bands were eliminated by cold self-compet-itor as well as by the 68-bp repeat. These results show that aprotein of the same family as NF-1 bound to the 68-bp repeatand generated multiple bands in the DNA-binding assay.

Analysis of the protein-binding sites by DNase I footprint-ing. DNase I footprinting experiments on both the codingand noncoding strands were performed with nuclear extractto define precisely the protein-binding site. A 258-bp frag-ment from BKV (Gardner) containing a 68-bp triplicate andthe late flanking sequence was used for this purpose. Severalregions on the BKV promoter-enhancer were protected byfactors present in the nuclear extract. Three clear footprintswere found, one in the TATA box-proximal 68-bp repeat,another in the distal 68-bp repeat, and the third in the Celement. The protected regions in the 68-bp repeats spannedabout 26 nucleotides symmetrically on both strands (Fig. 4Aand B) and centered on the sequence TGGA(N)5GCCA. Theendpoints of protection included two flanking TGG motifs oneach side. The footprint on the C element was also centeredon a TGGA(N)6GCCA core and was identical to the othertwo protected regions. The protective effects were found tobe abolished simultaneously when the NF-1 binding site ofBKV with full flanking sequence (oligo E) was used as acompetitor (Fig. 4A and C). This finding indicated that allthree footprints were produced by the binding of a nuclearprotein(s) of the NF-1 family (10). However, only theTGGA(N)5GCCA core without the flanking sequence poorlycompeted with these three footprints (data not shown). Themiddle 50-bp repeat with the a T-to-G transition in the NF-1recognition sequence did not produce any clear footprintunder our assay conditions (Fig. 4A and B).Two more footprints, centered on an AP-1/PEA 1 recog-

nition sequence (28), were detected at both junctions of the68-bp repeats. The protection at the junction distal to theTATA box was more prominent than protection at the other(Fig. 4A and B). A complete loss of protection at these siteswas observed when a DNA fragment from PyA containingthe PEA 1 site was used as a competitor in the footprintingassay (Fig. 4A). Another partial DNase I protection site wasdetected at the late side, centered on a perfect GC box,which might be conferred by an Sp-i-like factor present inHeLa cells (4, 15).

Altogether, we identified six footprints in the promoter-enhancer region upstream of the TATA box. Two werewithin the 68-bp repeats, two were on the late side of the68-bp repeats, and two were at the junctions of the 68-bprepeats. Three of these protected sites may have beenproduced by a protein(s) of the NF-1 family present in HeLacells, two by AP-1-like proteins, and one by an Sp-l-likefactor. However, no footprint was detected on the HCR orElA enhancer-core sequence.

Binding of HeLa cell nuclear factor(s) to the BKV earlypromoter activates transcription initiation in vitro. We nextinvestigated the significance of DNA-protein interactions atdifferent sites by transcriptional competition assays. Forrapid quantitative analysis, we used the G-less cassettevector developed by a Sawadogo and Roeder (43), as de-scribed in Materials and Methods. In plasmid PLTG-BK, a

258-bp early promoter-enhancer region was cloned upstreamof the TATA box of the adenovirus major late promoter,which was linked to a downstream 400-nucleotide G-lesscassette (45). Transcription of this plasmid gave rise to a

transcript of 400 nucleotides that was resistant to RNase T1.As an internal control, we included in the assay anotherplasmid, CAS-9, with a shorter G-less cassette, which pro-

MOL. CELL. BIOL.


] NF-1

I : NF-1

AP-l

i] AP-1I

HCR

NF-1

B

'IT

di0U

3'

1n

.

!@

3'

m

I

I L7

U-

ILLC

_-.

6-

a~~~ OR

w a)i~~~z~

:~~~~~~~~~~~~~~~~~a- 1

..- U

i- u}Late

:r, L0Zr-

0

U,i

Iv

I 0.., , t:

*i (

a _- |1

Late

FIG. 4. DNase I footprints. The 258-bp HaeIII fragment was labeled at the 5' end of the early or late strand. The probe (50,000 cpm/2 ng)was incubated with the unfractionated nuclear extract under standard binding conditions and treated with 5 U of DNase I/ml (see Materialsand Methods). The amount of nuclear extract (NE) and the competitor added are indicated above each lane. Other lanes: M, DNA sizemarker; 0, no added extract; G+A, sequencing ladder (31). The protected regions are shown schematically on the left, and the potentialcis-acting elements are shown on the right. The footprints are numbered 1 to 6, starting from the TATA box-proximal end. (A) Early-strandfootprint; (B) late-strand footprint; (C) analysis of the protein factor(s) responsible for footprints 4 and 5 on the late strand. An approximately200-fold molar excess of oligo E was added as competitor.

duced a transcript of 190 nucleotides under the control of theadenovirus major late promoter. This promoter did notcompete for limiting factors with the BKV early promoterunder our assay conditions (results not shown). We useddensitometric scanning to determine the ratio of the tran-script originating from the early promoter to the 190-nucle-otide internal standard.Both the 68-bp repeat and the adenovirus NF-1 binding

site reduced the specific transcription from the early pro-moter by at least 80% when used in 20- to 40-fold molarexcess. PyA containing a PEA 1/AP-1 binding site reducedtranscription by about 40% at a 50- to 100-fold molar excess(Fig. 5A, lane 4). The HCR in similar assays reduced thepromoter activity by only 25% even at the highest concen-tration (100-fold molar excess) used. To confirm the stimu-latory role of NF-1 in transcription, we used as competitor apoint mutant of the NF-1 binding site that does not bindNF-1 in vitro (39). Results of the transcription assay (Fig.SB) showed that the NF-1 binding sites from both adenovirusand BKV competed efficiently with early transcription (lanes2 and 4) but that the mutant NF-1 binding site with a G-to-Atransition has very little, if any, effect (lane 3). We interpret

these results to mean that competitor fragments that affecttranscription in a more dramatic fashion bind factors that aremore crucial for this process. These results suggest thatNF-1 present in human cellular extracts is the major deter-minant of early promoter activity in vitro.

DISCUSSION

This is the first in vitro transcriptional study of the BKVpromoter in a homologous HeLa cell extract. The majorfindings are as follows: (i) the early promoter containing onlya single copy of the 68-bp repeat can initiate transcriptionaccurately in vitro, but the additional copies of this repeataugment transcription initiation using the same start sites;(ii) multiple nuclear proteins from HeLa cells bind to each68-bp repeat, and the major component appears to be aprotein of the NF-1 family; and (iii) NF-1 acts as the majoractivator of early transcription in vitro.The major early RNA initiation sites utilized in vitro and in

vivo were found to be identical (11). Whereas the accuracyof transcription initiation is not affected by deletion of the68-bp repeats, the efficiency of transcription initiation is

Competitor_-..

M OcLC< <

Z-I n>:Z1QC (5

A

5,

LO)

CO)

C\4

ITiS

3.3

II

3lW.;*s

*_

Early

VOL. 9, 1989 3825

la at

.& - a


A

C-

-3 LL

1fC _- < c

0 o0 LL ,,.- (-a co zcL I

+ ++ + 4-

BK E -- _ .

CAS-9 -o*

1 2 3 4 5 6

BC-I

m.0

;..or.,r:_ 0

393348

270 FIG. 5. (A) Competition transcriptional assays. The templates259 from PLTG-BK and CAS-9 plasmids were cotranscribed in the

presence or absence (control) of a 50- to 100-fold molar excess of_w 2206 different competitor DNAs, as indicated above the lanes. The4w X1 90 transcripts were purified and analyzed by electrophoresis in 4%4_ , 7 X acrylamide-7 M urea gels. An end-labeled HhaI digest of pBR322

was used as a size marker. Positions of the early transcript (BK E)7 and of the internal standard (CAS-9) are shown. (B) Same assay as

in panel A, with the competitors used indicated above the lanes.Mnlfe-rid,r Ci7PC, (in hn,ce nqircA) qc chnwn to the- ricrht nf P-,qrh nqnel

reduced drastically, suggesting that none of the 68-bp re-peats are redundant in vitro. This finding could be correlatedwith the observation that deletion of the 68-bp repeat re-duces the plaque size of the virus in human embryonickidney cells, the early gene product being required for viralreplication (21, 53, 54). How the multiple copies of thisrepeat generate greater efficiency of transcription initiation isnot understood. It is, however, known that a multimer of thesame motif generates strong enhancer activity and that thereis a direct correlation between the number of such motifs andthe efficiency of transcription (44).By gel electrophoresis DNA-binding assays, we have

identified three specific DNA-protein complexes formed bythe 68-bp repeat with a HeLa nuclear extract which involveNF-1-like proteins (32). One biochemical difference betweenthe C-II/C-III and C-I complexes was the requirement forMg2+ for the formation of C-I. Since the formation of C-Iwas prevented when either the NF-1 binding site (oligos Dand E) or any of oligos A, B, and C were used as competi-tors, the complex might involve a protein whose binding isfacilitated by NF-1. Alternatively, the binding site involvedin C-I formation may be more degenerated than thoseinvolved in formation of C-II and C-Ill. A 4-nucleotidehomology (CATG) was found among the sequences thatcompeted for C-I.The footprints on the 68-bp repeat are centered over the

TGGA(N)5GCCA motif and on the C element over theTGGA(N)6GCCA motif. The two binding sites are identicalexcept for the presence of one extra base in the spacer of thesecond, and both have a dyad symmetry. The presence ofthis symmetry and of the flanking sequences containingadditional TGG sequences are required for optimal binding.The NF-1 sites from both adenovirus and BKV competeequally with these protecting proteins, indicating that allthree domains are protected by the same or a similar proteinthat binds to the origin of replication of human adenovirus(32). The prevalence of the NF-1 family of proteins is nowwell recognized (20, 23-27, 50), and the diversity among themembers of this family with respect to molecular weight andbiochemical and DNA-binding properties has been sug-

gested (7, 14, 22). Multiple complexes formed by nuclearfactors with a 68-bp repeat were inhibited by the NF-1binding site from adenovirus and vice versa. This result isnot unexpected, since a single NF-1 gene can producemultiple transcripts by alternate splicing (42). Our data onDNase I footprinting are in agreement with those reportedrecently from another laboratory (30) and with those gener-ated by chicken oviduct TGGCA-binding protein (33).Our studies show that the binding of NF-1 to its cognate

sequence plays a major role in transcriptional activation ofthe early promoter in vitro. This conclusion is derived fromthe observation that the wild-type NF-1 .inding site com-petes efficiently with the early transcription, whereas themutant site does not. A stimulatory effect of NF-1 on theadenovirus major late and ,-globin promoters in vitro hasalso been observed (19, 24, 50). The results of our in vitrostudies are in agreement with the in vivo genetic analysis ofthe BKV early promoter in CV-1 cells (11, 12). The HCR aswell as the PEA 1/AP-1 binding site from PyA have only amarginal effect on transcription in vitro. The former islocated adjacent to the NF-1 binding site in each 68-bprepeat, and the protection by NF-1 includes 6 nucleotideswithin this site. In the footprinting experiments, only a partof the HCR adjacent to the NF-1 site was protected. If thisflanking sequence is required for NF-1 binding, it can act asa weak competitor in vitro and reduce the level of transcrip-tion. The low level of inhibition by the PEA 1/AP-1 bindingsite may be due to the low activity of AP-1 in uninducedHeLa cells. This site may play a more important role undermetabolic conditions of induction of AP-1.

Recently, it has been reported that in HeLa cells the earlypromoter of one strain of BKV (BKV-P2) is negative-ly regulated (18). In our studies, we could not identifyany repressor in HeLa extract that binds to this promoter.We did detect a footprint corresponding to the reportedrepressor-binding site that includes the sequenceTGGA(N)6GCCA. DNase I protection experiments withextract prepared from 293 cells also show footprints identical

MOL. CELL. BIOL.

lvlvm.-Ulal NILE;,5 kill L)dNc; PctllN) a.S NIIVWII LU LIIC; I lrIIL VI Cat.;Jl pajiC;j.


to those obtained with HeLa cell extract (T. Chakrabortyand G. C. Das, unpublished data). This study clearly iden-tifies this site as an additional NF-1 binding site, since theprotection was abolished simultaneously with that of theother sites when cold NF-1 binding site was used as thecompetitor. This site may therefore be important for tran-scriptional activation rather than repression; however, fromin vitro studies we cannot rule out the possibility of arepressor binding to other neighboring or overlapping sites invivo.

In summary, we have shown that proteins of the NF-1family from HeLa cells bind at multiple sites within theregulatory region of a human polyomavirus and that thisbinding is important for early transcription in vitro. None ofthe 68-bp repeats are redundant in vitro, indicating a syner-gistic action among these repeats. The footprints on AP-1motifs (TGACTCA) in the junction of 68-bp repeats werepartial, and the role of AP-1 as a transcriptional activatorappears to be less pronounced than that of NF-1 in vitro.However, the BKV early promoter is inducible by 12-O-tetradecanoylphorbol-13-acetate (T. Chakraborty, S. Das-Gupta, and G. C. Das, unpublished observation), which isthought to be mediated through the AP-1 binding site insignal transduction pathways (28). The positioning of multi-ple copies of the TGGA(N)5_GCCA-binding site within theenhancer-promoter region of all strains of BKV makes BKVan attractive model for studying the multiple functions of thisprotein in bidirectional transcription, replication, and possi-bly the induction of viral genes.

ACKNOWLEDGMENTS

We are grateful to S. DasGupta for synthesizing the oligonucleo-tides. Thanks are due to K. Yoshike, G. U. Ryffel, and T. Kelley forgifts of plasmids. We thank M. Pangburn and H. James for criticalreading of the manuscript and Joyce Robertson for excellent secre-tarial assistance.

LITERATURE CITED

1. Arthur, R. R., K. V. Shah, J. Baust, G. W. Santos, and R. Saral.1986. Association of BK virus with hemorrhagic cystitis inrecipients of bone marrow transplants. N. Engl. J. Med. 315:230-234.

2. Arthur, R. R., K. V. Shah, P. Charache, and R. Saral. 1988. BKand JC virus infections in recipients of bone marrow transplan-tations. J. Infect. Dis. 158:563-569.

3. Berg, D. T., J. D. Walls, and B. W. Grinnel. 1988. A variantenhancer/regulatory region from a cloned human prototype BKvirus genome. Nucleic Acids Res. 16:9057.

4. Briggs, M. R., J. T. Kadonaga, S. P. Bell, and R. Tjian. 1986.Purification and biochemical characterization of the promoterspecific transcription factor, Sp-1. Science 234:47-52.

5. Caputo, A., A. Corallini, M. P. Grossi, L. Carra, P. G. Balboni,M. Negrini, G. Milanesi, G. Federspil, and G. Barbanti-Brodano.1983. Episomal DNA of a BK virus variant in a human insuli-noma. J. Med. Virol. 12:37-49.

6. Chauhan, S., G. Lacastas, and E. H. Harley. 1984. Genomeanalysis of BK (WW) viral DNA cloned directly from humanurine. Intervirology 22:170-176.

7. Chodosh, L. A., A. S. Baldwin, R. W. Carthew, and P. A. Sharp.1988. Human CCAAT binding proteins have heterologous sub-units. Cell 53:11-24.

8. Das, G. C., and J. Piatigorsky. 1986. The chicken 1-crystallinegene promoter: binding of transcription factors to the upstreamG+C-rich region is necessary for promoter function in vitro.Proc. Natl. Acad. Sci. USA 83:3131-3135.

9. Das, G. C., and N. P. Salzman. 1985. Simian virus 40 earlypromoter mutation that affect promoter function and autoregu-lation by large T-antigen. J. Mol. Biol. 182:229-239.

10. deVries, E., W. van Driel, S. J. L. vanden Heuvel, and P. C.vander Vliet. 1987. Contact point analysis of the HeLa nuclearfactor 1 recognition site reveals symmetrical binding at one sideof the DNA helix. EMBO J. 6:161-168.

11. Deyerle, K. L., J. A. Cassill, and S. Subramani. 1987. Analysisof the early regulatory region of the human papovavirus BK.Virology 158:181-193.

12. Deyerle, K. L., and S. Subramani. 1988. Linker scan analysis ofthe early regulatory region of human papovavirus BK. J. Virol.62:3378-3387.

13. Dignam, J. D., R. M. Lebovitz, and R. G. Roeder. 1983.Accurate transcription initiation by RNA polymerase II in asoluble extract from isolated mammalian nuclei. Nucleic AcidsRes. 11:1475-1489.

14. Dorn, A., J. Bolkens, A. Staub, C. Benoist, and D. Mathis. 1987.A multiplicity ofCCAAT box-binding proteins. Cell 50:863-872.

15. Dynan, W., and R. Tjian. 1983. The promoter-specific transcrip-tion factor Spl binds to upstream sequences in the SV40 earlypromoter. Cell 35:79-87.

16. Gardner, S. D., A. M. Field, D. V. Colemen, and B. Hulme.1971. New human papovavirus (BK) isolated from urine afterrenal transplantation. Lancet i:1253-1257.

17. Garner, M. M., and A. Revzin. 1981. A gel electrophoresismethod for quantifying the binding of proteins to specific DNAregions. Application to components of the E. coli lactose operonregulatory system. Nucleic Acids Res. 9:3047-3060.

18. Grinnel, B. W., D. T. Berg, and J. D. Walls. 1988. Negativeregulation of the human polyoma virus BK enhancer involvescell specific interaction with a nuclear repressor. Mol. Cell.Biol. 8:3448-3457.

19. Gronostajski, R., J. Knox, D. Berry, and N. G. Miyamoto. 1988.Stimulation of transcription in vitro by binding sites for nuclearfactor 1. Nucleic Acids Res. 16:2087-2098.

20. Gronostajski, R. M., S. Adhya, K. Nagata, R. A. Guggenheimer,and J. Huriwitz. 1985. Site-specific DNA binding of nuclearfactor 1: analysis of cellular binding sites. Mol. Cell. Biol.5:964-971.

21. Hara, K., Y. Oya, and Y. Yogo. 1985. Enhancement of thetransforming capacity of BK virus by partial deletion of the68-base-pair tandem repeats. J. Virol. 55:867-869.

22. Jackson, S. P., and R. Tjian. 1988. 0-glycosylation of eukary-otic transcription factors: implications for mechanism of tran-scriptional regulation. Cell 55:125-133.

23. Jeang, K. D., D. R. Rawlins, P. J. Rosenfeld, J. H. Shero, T. J.KeUly, and G. S. Hayward. 1987. Multiple tandemly repeatedbinding sites for cellular nuclear factor 1 that surround the majorimmediate-early promoters of simian and human cytomegalovi-rus. J. Virol. 61:1559-1570.

24. Jones, K. A., J. T. Kadonago, P. J. Rosenfeld, T. J. Kelly, and R.Tjian. 1987. A cellular DNA binding protein that activateseukaryotic transcription and DNA replication. Cell 48:79-89.

25. Jones, K. A., P. A. Lucin, and N. Duchange. 1988. Structuralarrangements of transcription control domains within the 5'-untranslated leader regions of the HIV-1 and HIV-2 promoters.Genes Dev. 2:1101-1114.

26. Jones, K. A., K. R. Yamamoto, and R. Tjian. 1985. Two distincttranscription factors bind to the HSV thymidine kinase pro-moter in v'itro. Cell 42:559-572.

27. Knight, G. B., J. M. Guidas, and A. B. Pardee. 1987. Cell-cycle-specific interaction of nuclear DNA-binding proteins witha CCAAT sequence from the human thymidine kinase gene.Proc. Natl. Acad. Sci. USA 84:8350-8354.

28. Lee, W., P. Mitchell, and R. Tjian. 1987. Purified transcriptionfactor AP-1 binds to TPA-inducible enhancer elements. Cell49:741-752.

29. Manley, J. L., A. Fire, A. Cano, P. A. Sharp, and M. L. Gefter.1988. DNA-dependent transcription and adenovirus genes in asoluble whole cell extract. Proc. Natl. Acad. Sci. USA 77:3855-3859.

30. Markowitz, R. B., and W. S. Dynan. 1988. Binding of cellularproteins to the regulatory region of BK virus DNA. J. Virol.62:3388-3398.

31. Maxam, A. M., and W. Gilbert. 1980. Sequencing end-labeled

VOL. 9, 1989 3827


DNA with base-specific chemical cleavages. Methods Enzymol.65:499-560.

32. Nagata, K., R. A. Guggenheimer, and J. Hurwitz. 1983. Specificbinding of a cellular DNA replication protein to the origin ofreplication of adenovirus DNA. Proc. Natl. Acad. Sci. USA80:6177-6151.

33. Nowock, J., U. Borgemeyer, A. W. Puschal, R. A. W. Rupp, andA. E. Sippel. 1985. The TGGCA protein binds to the MMTVLTR, the adenovirus origin of replication and the BK virusenhancer. Nucleic Acids Res. 13:2045-2061.

34. Padgett, B. 1980. Human papovaviruses, p. 339-370. In J. Tooze(ed.) Molecular biology of DNA tumor viruses: DNA tumorviruses. Cold Spring Harbor Laboratory, Cold Spring Harbor,N.Y.

35. Pagnani, M., M. Negrini, P. Reschiglian, A. Corallini, P. G.Balboni, S. Schernck, R. Macino, G. Milanesi, and G. Barbanti-Broadano. 1986. Molecular and biological properties of BKvirus IR, a BK virus variant isolated from a human tumor. J.Virol. 59:500-505.

36. Pater, A., M. M. Pater, L. S. Chang, L. Slawin, and G.diMayorca. 1983. Multiple origins of the complementary defec-tive genome of RF and origin proximal sequences of GS, twohuman papovavirus isolates. Virology 131:426-436.

37. Ronde, A., M. MacDonald, C. Sol, J. T. Schegget, E. Walters, A.van Strien, and J. V. D. Noordaa. 1987. The early enhancer-promoter of BKV and its host range for transformation. Inter-virology 27:38-44.

38. Rosenfeld, P. J., and T. J. Kelley. 1986. Purification of nuclearfactor 1 by DNA recognition site affinity chromatography. J.Biol. Chem. 261:1398-1408.

39. Rosenfeld, P. J., E. A. O'Neill, R. J. Wides, and T. J. Kelly.1987. Sequence specific interactions between cellular DNA-binding proteins and the adenovirus DNA replication. Mol.Cell. Biol. 7:875-886.

40. Rosenthal, N., M. Kress, P. Gruss, and G. Khoury. 1983. BKviral enhancer element and a human cellular homolog. Science222:749-755.

41. Rubinstein, R., N. Pare, and E. H. Harley. 1987. Structure andfunction of the transcriptional control region of nonpassagedBK virus. J. Virol. 61:1747-1750.

42. Santoro, C., N. Mermod, P. C. Andrews, and R. Tjian. 1988.Cloning of cDNAs encoding human CCAAT-box binding pro-teins: a family of transcription and replication factors. Nature(London) 334:218-224.

43. Sawadogo, M., and R. G. Roeder. 1985. Factors involved in

specific transcription by human RNA polymerase II: analysis bya rapid and quantitative in vitro assay. Proc. Natl. Acad. Sci.USA 82:4394-4398.

44. Schaffner, G., S. Schirm, B. Muller-Baden, F. Weber, and W.Schaffner. 1988. Redundancy of information in enhancer as aprincipal of mammalian transcriptional control. J. Mol. Biol.201:81-90.

45. Schorpp, M., W. Kuglor, U. Wagner, and G. U. Ryffel. 1988.Hepatocyte-specific promoter element HP-1 of the Xenopusalbumin gene interacts with transcriptional factors of mamma-lian hepatocytes. J. Mol. Biol. 202:307-320.

46. Schrier, A. A., and J. Gruber. 1986. Oncogenic human polyomaviruses. J. Natl. Cancer Inst. 6:1255-1258.

47. Seif, I., G. Khoury, and R. Dhar. 1979. The genome of humanpapovavirus BKV. Cell 18:963-977.

48. Sen, R., and D. Baltimore. 1986. Multiple nuclear factorsinteracts with the immunoglobulin enhancer sequence. Cell46:703-716.

49. Small, J. A., G. Khoury, G. Jay, P. M. Howley, and G. A.Scangos. 1986. Early region of JC virus and BK virus inducedistinct and tissue-specific tumors in transgenic mice. Proc.Natl. Acad. Sci. USA 83:8288-8292.

50. Tamura, T., M. Miura, K. Ikeneka, and K. Mikoshiba. 1988.Analysis of transcription control elements of the mouse myelinbasic protein gene in HeLa cell extract: demonstration of astrong NF-1 binding motif in the upstream region. Nucleic AcidsRes. 16:11441-11459.

51. Terschegget, J., C. J. A. Sol, E. W. W. Baan, J. V. D. Noorda,and H. V. Ormandt. 1985. Naturally occurring BK virus vari-ants (JL and Dik) with deletion in the putative early enhancer-promoter sequences. J. Virol. 53:302-305.

52. Uchida, S., S. Watanabe, T. Aizawa, A. Furuno, and T. Muto.1979. Polyoncogeneicity and insulinoma-inducing ability of BKvirus, a human papovavirus, in Syrian golden hamsters. J. Natl.Cancer Inst. 63:119-126.

53. Watanabe, S., and K. Yoshiike. 1982. Change of DNA near theorigin of replication enhances the transcriptional capacity ofhuman papovavirus BK. J. Virol. 42:978-985.

54. Watanabe, S., and K. Yoshiike. 1985. Decreasing the number of68-base-pair tandem repeats in the BK virus transcriptionalcontrol region reduces plaque size and enhances transformingcapacity. J. Virol. 55:823-825.

55. Yang, R. C. A., and R. Wu. 1979. BK virus DNA: completenucleotide sequence of a human tumor virus. Science 206:456-462.

MOL. CELL. BIOL.

Documents

Identification of HeLa cell nuclear factors that bind to and activate