1

Identification of BAMBI, an inhibitor of TGF-β signaling, as a target of the

β-catenin pathway in colorectal tumor cells

Takashi Sekiya*, Shungo Adachi*, Kazuyoshi Kohu*††††, Tatsuya Yamada‡‡‡‡, Osamu

Higuchi*¶¶¶¶, Yoichi Furukawa§§§§, Yusuke Nakamura§§§§, Tsutomu Nakamura*,

Kousuke Tashiro＄＄＄＄, Satoru Kuhara＄＄＄＄, Susumu Ohwada‡‡‡‡ and Tetsu Akiyama*＃＃＃＃

*Laboratory of Molecular and Genetic Information, Institute of Molecular and

Cellular Biosciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo

113-0032, Japan.§§§§Laboratory of Molecular Medicine, Human Genome Center, Institute of Medical

Science, The University of Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108-8639,

Japan.‡‡‡‡Second Department of Surgery, Gunma University School of Medicine, 3-39-22

Showa-machi, Maebashi, Gunma 371, Japan.＄＄＄＄Laboratory of Molecular Gene Technics, Department of Genetic Resources

Technology, Faculty of Agriculture, Kyushu University, Hakozaki 6-10-1, Higashi-

ku, Fukuoka, 812-8581, Japan.

Present Address: ††††Department of Molecular Immunology, Institute of

Development, Aging, and Cancer, Tohoku University, Sendai, Japan.¶¶¶¶Department of Cell Regulation, Medical Research Institute, Tokyo Medical and

Dental University, Bunkyo-ku, Tokyo 113-8510, Japan.

Running Title: Induction of BAMBI by β-catenin signaling

＃＃＃＃To whom correspondence should be addressed.

E-mail:akiyama@iam.u-tokyo.ac.jp

by guest on March 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

2

Summary

The Wnt signaling pathway is activated in most human colorectal tumors.

Mutational inactivation in the tumor suppressor adenomatous polyposis coli (APC),

as well as activation of β-catenin causes the accumulation of β-catenin, which in

turn associates with the TCF/LEF family of transcription factors and activates

transcription of their target genes. Here we show that β-catenin activates

transcription of the BMP and activin membrane-bound inhibitor (BAMBI)/NMA

gene. The expression level of BAMBI was found to be aberrantly elevated in most

colorectal and hepatocellular carcinomas relative to the corresponding non-

cancerous tissues. Expression of BAMBI in colorectal tumor cell lines was

repressed by a dominant-negative mutant of TCF-4 or by ICAT, an inhibitor of β-

catenin-TCF interaction, suggesting that β-catenin is responsible for the aberrant

expression of BAMBI in colorectal tumor cells. Furthermore, overexpression of

BAMBI inhibited the response of tumor cells to transforming growth factor-

β (TGF-β) signaling. These results suggest that β-catenin interferes with TGF-β-

mediated growth arrest by inducing the expression of BAMBI, and this may

contribute to colorectal and hepatocellular tumorigenesis.

by guest on March 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

3

Introduction

The conversion of an intestinal epithelial cell into a fully transformed, metastatic cancer

cell requires mutations in multiple proto-oncogenes and tumor suppressor genes (1,2).

Mutations in the tumor suppressor APC and β-catenin occur during the early stages of

this process. The product of the APC gene interacts with various proteins including β-

catenin, Axin, Rac-specific guanine nucleotide exchanger Asef, kinesin superfamily-

associated protein 3 (KAP3), EB1, microtubules and the human homolog of the

Drosophila Discs large (hDLG) (3-11). Through interacting with these molecules,

APC functions in multiple signaling pathways, thereby regulating Wnt signaling, actin

and microtubule cytoskeletal networks, cell morphology and migration (8,12-18).

β-catenin is an essential component of the Wnt signaling pathway and plays

important roles in development and tumorigenesis (19-22). Wnt signaling promotes

the stabilization and accumulation of β-catenin, which in turn interacts with the

TCF/LEF family of transcription factors and activates transcription of downstream

genes such as c-Myc, cyclin D1 and Axin2 (23-27). APC interacts with β-catenin,

glycogen synthase kinase-3β (GSK-3β), casein kinase 1α and Axin or the closely

related factor conductin/Axil (3-7,28-30). By recruiting β-catenin into this multi-

protein complex, APC promotes its proteasome-mediated degradation, hence mutations

in APC or β-catenin result in the accumulation of β-catenin in colorectal tumor cells

(31,32). Mutations in β-catenin and Axin have also been identified in many other

types of tumors, including hepatocellular carcinoma, ovarian cancer and endometrial

cancer (33-35). Thus, constitutive activation of β-catenin-TCF-mediated transcription

is believed to be a critical step in the tumorigenesis of various types of tumors.

The transforming growth factor-β (TGF-β) pathway inhibits the growth of

multiple epithelial cell types, and loss of this negative regulation is believed to

contribute to tumor development, including colorectal tumorigenesis. Indeed,

by guest on March 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

4

inactivating mutations in the type II receptor (TβRII), Smad2 and Smad4 have been

reported to occur during colorectal tumorigenesis. In addition, it has been reported

that the TGF-β receptor is often downregulated in tumor cells, or otherwise unavailable

at the cell surface, thus allowing tumor cells to escape the growth inhibitory activities of

TGF- β (36,37).

TGF-β signals through a heteromeric cell-surface complex of two types of

transmembrane serine/threonine kinases, the type I and type II receptors (TβRI and

TβRII). TβRII activates TβRI, which in turn propagates the TGF-β signal by

phosphorylating the Smads, Smad2 and Smad3 (38,39). Receptor-mediated

phosphorylation of Smads induces their association with Smad4, followed by

translocation into the nucleus, where these complexes activate transcription of target

genes, including CDK inhibitors p15INK4B and p21CIP1 (40,41).

ICAT is a β-catenin-interacting protein that interferes with the interaction between

β-catenin and TCF, and inhibits the proliferation of colorectal tumor cells containing

mutations in APC or β-catenin and hepatocellular carcinoma cells containing mutations

in Axin (42-45). In the present study, we examined the effects of ICAT on gene

expression in the human colorectal tumor cell line SW48, in which β-catenin-TCF4-

mediated transcription is aberrantly activated due to a mutation in β-catenin. We

found that ICAT suppresses expression of the BAMBI (BMP and activin membrane-

bound inhibitor). Furthermore, we found that β-catenin activates transcription of

BAMBI and that BAMBI expression is aberrantly elevated in most colorectal and

hepatocellular carcinomas, compared to the corresponding non-cancerous tissues. The

product of the BAMBI gene is a transmembrane protein that lacks an intracellular kinase

domain but has sequence similarity to the extracellular domain of TβRI and thereby

inhibits TGF-β signaling by forming heterodimer with TβRII (46). Our data suggest

that β-catenin-mediated overexpression of BAMBI may be one of the strategies by

which tumor cells escape the growth inhibitory activities of TGF-β.

by guest on March 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

5

Experimental Procedures

Construction of plasmids and recombinant viruses. For construction of the

BAMBI-luciferase reporter plasmids, a human BAC clone RP13-43N24, which contains

the entire promoter region and several exons and introns, was purchased from BACPAC

Resources. The longest construct, 7.1 kb, and deletion constructs were generated by

cloning each sequence into the appropriate enzyme sites in the pGL3-basic vector

(Promega). Site-directed mutagenesis of each TCF/LEF binding elements was created

by standard PCR techniques using Pyrobest DNA polymerase (TAKARA), with the

following primers (substituted nucleotides are written in bold-face); for TBE1, 5'-

GCTGCAGAGGATTGATTAGCGGTAG-3' and 5'- CTACCGCTAATCAATCCTCTG

CAGC-3', for TBE2, 5'- CTCTGTGTCTAGTTAAATGTATCTCTG-3' and 5'- CAGAG

ATACATTTAACTAGACACAGAG-3', for TBE3, 5'- CTCTAAGTGTAGTTATATCT

CTGAATG-3' and 5'- CATTCAGAGATATAACTACACTTAGAG-3', for TBE4, 5'-

CTGGAAATATAGAAAGCGGGCAGAAC-3' and 5'- GTTCTGCCCGCTTTCTATAT

TTCCAG-3', for TBE5, 5'- CTAAAAGTTCATGCAGTTAAATTTGGG-3' and 5'-

CCCAAATTTAACTGCATGAACTTTTAG-3', for TBE1', 5'-CCGTGCTGCTCGCCA

AATGTGGGTGCC-3' and 5'-GGCACCCACATTTGGCGAGCAGCACGG-3', for

TBE2', 5'-CGCCGCGGGGATTTGGCGCCGGCTGC-3' and 5'-GCAGCCGGCGCCA

AATCCCCGCGGCG-3', for TBE3', 5'-GTTGCTGTGTTATTAGCAGTCGCGGCG-3'

and 5'-CGCCGCGACTGCTAATAACTCTGCAAC-3', for TBE4', 5'- CGGACTCCGA

GCTAATGGCAGGCGCTG-3' and 5'-CAGCGCCTGCCATTAGCTCGGAGTCCG-3'.

pTOP-tk-luciferase and pFOP-tk-luciferase were kindly provided by V. Korinek and H.

Clevers (University Medical Center, Utrecht, The Netherlands). The adenoviruses

encoding myc-ICAT and LacZ were generated as previously described (43). Ad-Flag-β-

catenin S33Y was constructed using the pAdenoXTM Expression system (Clontech)

by guest on March 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

6

according to the manufacturer's directions. BAMBI expression plasmids: the full-

length BAMBI-GFP fusion expression vector pEGFP-N3-hBAMBI was constructed by

cloning RT-PCR products into the pEGFP-N3 vector (Clontech). A variant of this

vector, containing BAMBI lacking amino acids 20-131 (BAMBI∆N) was constructed

similarly.

Cells and clinical materials. All cells were cultured as monolayers in appropriate

media [DMEM (NISSUI) for COS-1, DU145, HepG2 and Alexander cells; Leibovit's L-

15 (SIGMA) for SW48 and SW480 cells, and McCoy's 5A (SIGMA) for HCT116 cells]

supplemented with 10% fetal bovine serum (JCS). All cells were maintained at 37°C

in an atmosphere of humidified air with 5% CO2. Cancerous tissues and corresponding

noncancerous tissue samples were excised during surgery at the Gunma University

Hospital, after informed consent had been obtained.

Northern blotting. Total RNA was extracted using NucleoSpin (MACHEREY-

NAGEL). Total RNA (20 µg per lane) was electrophoresed on a formaldehyde-

containing 1% agarose gel, transferred onto a Hybond-N+ (Amersham Pharmacia

Biotech), and hybridized with 32P-labeled cDNA probe specific for indicated genes, and

examined via BAS1500 (FUJI FILM).

Antibodies. Antibodies to the amino- and carboxy-terminal regions of BAMBI were

prepared by immunizing rabbits with bacterially-expressed, GST fusion proteins

containing human BAMBI amino acids 45-147 and 177-241, respectively. Rabbit

polyclonal antibody to ICAT was prepared as described (42). Mouse monoclonal

antibody to α-tubulin was purchased from OncogeneTM. Mouse monoclonal antibody

to FLAG (M2) and β-galactosidase (Ab-1) were purchased from SIGMA and

CALBIOCHEM, respectively. Immunoblotting was performed as described

by guest on March 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

7

previously (11).

Luciferase reporter assays. Cells were plated in 12-well dishes 18 h prior to

transfection. Transfections were performed with Lipofectamine PLUS (Invitrogen)

according to the manufacturer's protocol. Luciferase assays were performed using the

Dual-Luciferase Reporter Assay System (Promega) following the manufacturer's

protocol.

Semi-quantitative RT-PCR assay. Total RNA was extracted from cancerous and

corresponding noncancerous tissues, using NucleoSpin (MACHEREY-NAGEL). First

strand cDNA was synthesized using random hexamers and Superscript II reverse

transcriptase (Invitrogen). One µl of cDNA from each sample was used for PCR with

the PTC-2000 Peltier Thermal Cycler (MJ Research). All of the reactions were

performed in 25 µl volumes and amplified for 3 min at 94°C for initial denaturation,

followed by appropriate cycles at 94°C for 30 s, 62°C for 30 s, and 72°C for 1 min. The

PCR products were electrophoresed on a 1% agarose gel, and detected by EtBr staining.

Immunohistochemical analysis. Immunostaining of paraffin-embedded tissue

sections was performed according to standard procedures. In brief, sections were

deparaffinized in xylene, and then rehydrated into distilled water using graded ethanols.

Antigens were retrieved by microwaving the slides in citrate buffer (pH 6.0) for 15 min.

Sections were incubated with the indicated antibodies overnight at 4°C. Staining

patterns obtained with the antibodies to β-catenin and BAMBI were visualized with

RITC-labeled anti-mouse antibody, and FITC-labeled anti-rabbit antibodies,

respectively. The sections were visualized and photographed with a confocal

microscope. In Fig. 2C (insets, right), COS-1 cells were transfected with FLAG-

tagged TCF4-∆C and stained with ant-FLAG antibody followed by FITC-labelled anti-

by guest on March 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

8

rabbit secondary antibody. The nucleus was stained with TOTO-3 (Molecular Probes).

Colony formation assay. One day before seeding, DU145 cells were transfected with

the indicated plasmids, using Lipofectamine2000 (Invitrogen) according to the

manufacturer's protocol. Cells (5 x 105 cells) were seeded in each 10 cm dishes and

cultured in the presence or absence of 1 ng/ml TGF-β1 (R&D), under the selection with

400 µg/ml G418 (GIBCO). Medium change and TGF-β1 stimulation were performed

every 5 days. Three weeks after seeding, colonies were either stained with methylene

blue, or isolated for further experiments.

Results and Discussion

Using a cDNA microarray approach, we examined the effects of ICAT on gene

expression in SW48 cells. Infection of SW48 cells with a recombinant adenovirus

encoding ICAT (Ad-ICAT) induced changes in the expression levels of a number of

genes, including c-MYC, AXIN2 and BCL-XL. We found that one of the genes

repressed by Ad-ICAT is BAMBI.

To confirm that BAMBI expression is indeed repressed by ICAT, we examined

BAMBI expression in SW48 cells infected with Ad-ICAT by RT-PCR analysis (Fig. 1A,

left). We found that BAMBI was expressed in SW48 cells and repressed significantly

after Ad-ICAT infection similar to the known β-catenin target gene, AXIN2. In these

experiments, expression of adenovirus-transduced genes, ICAT, TCF-4-∆N (see below)

and β-galactosidase, was confirmed by immunoblotting analysis (Fig. 1A, right). We

also examined expression of BAMBI protein using antibodies directed against the

amino-terminal and carboxy-terminal regions of human BAMBI: viz. anti-BAMBI-N-

ter and anti-BAMBI-C-ter, respectively. Immunoblotting analysis of the lysates from

SW48 cells infected with Ad-ICAT revealed that BAMBI protein expression was also

by guest on March 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

9

repressed by ICAT (Fig. 1B).

These results suggest that the expression of BAMBI is regulated by β-catenin.

We therefore examined the effect of an active mutant of β-catenin, β-catenin-S33Y, on

the expression of BAMBI. β-catenin-S33Y is a mutant that was initially identified in

human colorectal tumors, and contains a tyrosine (Y) in pace of the normal serine at

residue 33 (S33), a change that renders the protein resistant to APC-mediated

degradation (34). Northern blot analysis of RNA isolated from COS-1 cells showed

that BAMBI expression is increased following infection with an adenovirus encoding β-

catenin-S33Y (Fig. 1C). Immunoblot analysis demonstrated a similar increase in

BAMBI protein expression by expression of β-catenin-S33Y (Fig. 1B). Induction of

BAMBI was evident within 6 h after Ad-β-catenin-S33Y infection and an

approximately five-fold increase was observed at 24 h after infection. To further

confirm that expression of BAMBI in SW48 cells is induced by β-catenin-TCF4-

mediated transactivation, we examined the effect of a dominant-negative mutant of

TCF-4, TCF-4-∆N, which lacks the amino-terminal β-catenin-binding domain but

contains the carboxy-terminal DNA-binding domain. Expression of BAMBI at both

the mRNA and protein levels in SW48 cells was found to be repressed by expression of

TCF-4-∆N (Fig, 1A, B). These results suggest that expression of BAMBI is regulated

by β-catenin-TCF4-mediated transactivation and that the expression of BAMBI in

SW48 cells is induced by mutated β-catenin.

We next investigated whether transcription of BAMBI is directly regulated by β-

catenin. We isolated a BlnI (-3384)-NcoI (+3866) genomic fragment encompassing

the upstream and downstream regions of the transcription start site (Fig. 2A) and

examined whether the BAMBI promoter is contained within this fragment. When a

XhoI(-586)-NheI (+82) fragment was inserted upstream of a luciferase reporter gene in

the sense and anti-sense orientations, and transfected into COS-1 cells, the sense

construct exhibited about 170-fold higher luciferase activity than the anti-sense

by guest on March 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

10

construct or empty vector (Fig. 2B). Thus, the BAMBI promoter is presumably

contained within this fragment. However, the activity of the reporter containing this

BAMBI promoter region (-586+82-luc in Fig. 2A) was not enhanced by cotransfection

with β-catenin-S33Y (Fig. 2A). Similarly, β-catenin-S33Y did not stimulate the

activity of a reporter construct that contains the further upstream regions containing at

least 3 consensus sites for TCF-binding (-3384+82-luc in Fig. 2A). We therefore

examined the β-catenin responsiveness of the region downstream of the BAMBI

promoter [SacI(+421)-SacI(+3806) fragment]. We inserted this fragment upstream of

the SV40 minimal promoter in a luciferase reporter vector (Int1-luc in Fig. 2A) and

examined the construct for responsiveness to β-catenin. When transfected into COS-1

cells, activity of this reporter was found to be enhanced significantly by β-catenin-S33Y

(Fig. 2A). These results suggest that this region, which encompasses intron 1, is

responsible for β-catenin-mediated transactivation. Intron 1 contains at least 5

consensus sites for TCF-binding, and synthetic oligonucleotides containing each of

these sites demonstrated specific binding to the DNA-binding region of TCF-4, fused to

glutathione-S-transferase (GST), in an electrophoretic mobility-shift assay (data not

shown).

We next examined whether transcription of BAMBI is activated by the

endogenous β-catenin-TCF complexes using the colorectal tumor cell lines SW480,

HCT116 and SW48. SW480 contains mutated APC and wild-type β-catenin, whereas

HCT116 and SW48 possesses wild-type APC and mutated β-catenin. The activity of

Int1-luc but not –586+82-luc was repressed in a dose-dependent manner in SW480,

HCT116 and SW48 cells by a dominant-negative mutant of TCF-4, TCF-4-∆C, which

contains the amino-terminal β-catenin-binding domain but lacks the carboxy-terminal

DNA-binding domain (Fig. 2C). This mutant was constructed as a fusion to the

nuclear localization signal of SV40, and was found to localize efficiently to the nucleus

(Fig. 2D). Under these experimental conditions, TCF-∆C also repressed the activity of

by guest on March 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

11

pTOP-tk-luciferase, which contains optimal TCF-binding sites upstream of a luciferase

reporter gene, in these cell lines.

These results imply that BAMBI is a direct target for β-catenin-TCF-mediated

transactivation. However, we noticed that even when all five consensus TCF-binding

sites in Int1-luc were mutated, some β-catenin responsiveness remained (Int1-mut1-5-

luc in Fig. 2A). In addition to these five sites, we also mutated four sites in Int1-luc,

which diverge one nucleotide from the TCF-binding consensus sequence. This

construct (Int1-mut-All-luc in Fig. 2A) exhibited slightly lower activity than Int1-mut-5-

luc, suggesting that these sites contribute only a little to β-catenin-mediated

transactivation. Furthermore, the β-catenin-mediated transactivation of Int1-luc was

only weakly inhibited by TCF-4-∆N, whereas it was significantly inhibited by ICAT as

well as TCF-4-∆C (Fig. 2D). The weak effect of TCF-4-∆N is not due to low levels of

expression, since immunoblotting analysis revealed that TCF-4-∆N and TCF-4-∆C were

expressed at similar levels in these experiments. On the other hand, TCF-4-∆N as well

as TCF-4-∆C and ICAT exhibited significant inhibitory effects on the β-catenin-

mediated transactivation of pTOP-tk-luciferase. TCF-4-∆N differs from TCF-4-∆C in

that the former blocks TCF-binding to DNA, whereas TCF-4-∆C is able to inhibit the

interaction of a number of proteins, including β-catenin. These results suggest that

BAMBI may be transcriptionally regulated not only by β-catenin-TCF complexes, but

by β-catenin complexed to other proteins. This finding is consistent with recent

reports showing that complexes of β-catenin with partners other than TCF can also

transactivate target genes (47-50).

Northern blotting analysis revealed that BAMBI is expressed at very low levels in

human colon, small intestine, thymus and peripheral bloods, at moderate levels in brain,

skeletal muscle, liver and lung, and at high levels in heart, spleen, kidney and placenta

(data not shown). Since β-catenin accumulates in most human colorectal tumors due

to mutations in APC or β-catenin, we expected BAMBI expression to be up-regulated in

by guest on March 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

12

colorectal tumors. We examined BAMBI expression in 18-paired colorectal tumors

and adjacent non-cancerous tissues by semi-quantitative RT-PCR analysis. In 13 of 18

(72%) cases, the expression level of BAMBI was very high in colorectal tumors but was

very low in the corresponding non-cancerous tissues (Fig. 3A). In the other 5 cases,

BAMBI expression was almost equal to or lower than that of the non-cancerous tissues.

Immunostaining experiments also demonstrated that BAMBI is expressed at high levels

in colorectal tumors but at very low levels in non-cancerous tissues (Fig. 3B).

Furthermore, we found that BAMBI expression is higher in hepatocellular carcinomas

than in adjacent normal tissues in 3 of 5 cases, consistent with the fact that AXIN1 as

well as β-catenin is mutated in a certain subset of hepatocellular carcinomas (35,51).

Consistent with the fact that expression of AXIN2 is activated by β-catenin and up-

regulated in colorectal tumors (25,27), we observed that the expression patterns of

BAMBI and AXIN2 were similar in most tumors examined.

Since BAMBI has been shown to act as an antagonist of TGF-β signaling (46,52),

we examined the effect of overexpression of BAMBI on the growth of tumor cells in the

presence of TGF-β. In these experiments, we used the prostate tumor cell line DU145,

because it responds to TGF-β and does not exhibit aberrant β-catenin-mediated

transactivation (data not shown), suggesting that it does not possess mutations in APC,

β-catenin or AXIN. We transfected BAMBI into DU145 cells and performed a colony

formation assay in the presence or absence of TGF-β. TGF-β strongly inhibited

colony formation among DU145 cells that were transfected with GFP or mutant

BAMBI-GFP lacking the amino-terminal extracellular domain (BAMBI∆N-GFP). In

contrast, BAMBI-GFP-transfected cells were resistant to the growth inhibitory effects of

TGF-β (Fig. 4A). Immunoblotting analysis of BAMBI-GFP-transfected cells

propagated from TGF-β-resistant colonies revealed that BAMBI-GFP is indeed

expressed in these cells (Fig. 4B). We also examined the effect of BAMBI-GFP on

TGF-β-mediated transactivation in DU145 cells using the reporter p3TP-lux, which

by guest on March 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

13

contains a TGF-β-responsive element from the PAI-1 promoter placed upstream of a

luciferase reporter gene. Luciferase assay revealed that TGF-β-mediated

transactivation is repressed by exogenously expressed BAMBI-GFP (Fig. 4C). These

results imply that BAMBI has the potential to inhibit TGF-β-mediated transactivation

and cell growth inhibition.

Loss of TGF-β responsiveness provides an advantage for developing tumors

(36,37). Most colorectal tumors possess mutations in a component of the TGF-β

signaling pathway such as TβRII, SMAD2 or SMAD4. Our results show that, in

addition, an inhibitor of TGF-β signaling, BAMBI, is induced by β-catenin and

overexpressed in colorectal and hepatocellular carcinoma cells. In the multistep

progression into cancer, mutations in the Wnt signaling pathway generally precede

those in other tumor suppressor genes and oncogenes (1,20). It is therefore interesting

to speculate that overexpression of BAMBI may allow adenomas and tumor cells to

escape the growth inhibitory activities of TGF-β until a component of TGF-β signaling

is mutated. BAMBI also interferes with signaling pathways other than that mediated

by the SMADs, thus its overexpression may be more advantageous to oncogeneic

transformation than mutation of the SMADs alone. It is also possible that β-catenin-

induced BAMBI expression plays a role in embryogenesis. These possibilities could

be examined using BAMBI knockout mice, as well as APC and BAMBI double knockout

mice. Furthermore, our findings suggest that BAMBI may have the potential as a

target for therapy using monoclonal antibodies (53). Development of monoclonal

antibodies to BAMBI as anti-tumor reagents is currently under-way in our laboratory.

Acknowledgment

We thank I. Saito and Y. Kanegae for helping us to prepare the recombinant

adenoviruses; K. Miyazono for p3TP-lux; M. Lamphier and T. Okabe for reading the

manuscript. Supported by Grants-in-Aid for Scientific Research on Priority Areas and

by guest on March 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

14

the Organization for Pharmaceutical Safety and Research.

References

1. Kinzler, K. W., and Vogelstein, B. (1996) Cell 88887777, 159-170

2. Nakamura, Y. (1995) J Cancer Res Clin Oncol 111122221111, 529-534

3. Rubinfeld, B., Souza, B., Albert, I., Muller, O., Chamberlain, S. H., Masiarz, F. R.,

Munemitsu, S., and Polakis, P. (1993) Science 222266662222, 1731-1734

4. Su, L. K., Vogelstein, B., and Kinzler, K. W. (1993) Science 222266662222, 1734-1737

5. Kishida, S., Yamamoto, H., Ikeda, S., Kishida, M., Sakamoto, I., Koyama, S., and

Kikuchi, A. (1998) J Biol Chem 222277773333, 10823-10826

6. Nakamura, T., Hamada, F., Ishidate, T., Anai, K., Kawahara, K., Toyoshima, K., and

Akiyama, T. (1998) Genes Cells 3333, 395-403

7. Hamada, F., Tomoyasu, Y., Takatsu, Y., Nakamura, M., Nagai, S., Suzuki, A., Fujita,

F., Shibuya, H., Toyoshima, K., Ueno, N., and Akiyama, T. (1999) Science 222288883333,

1739-1742

8. Kawasaki, Y., Senda, T., Ishidate, T., Koyama, R., Morishita, T., Iwayama, Y.,

Higuchi, O., and Akiyama, T. (2000) Science 222288889999, 1194-1197

9. Jimbo, T., Kawasaki, Y., Koyama, R., Sato, R., Takada, S., Haraguchi, K., and

Akiyama, T. (2002) Nat Cell Biol 4444, 323-327

10. Su, L. K., Burrell, M., Hill, D. E., Gyuris, J., Brent, R., Wiltshire, R., Trent, J.,

Vogelstein, B., and Kinzler, K. W. (1995) Cancer Res 55555555, 2972-2977

11. Matsumine, A., Ogai, A., Senda, T., Okumura, N., Satoh, K., Baeg, G. H., Kawahara,

T., Kobayashi, S., Okada, M., Toyoshima, K., and Akiyama, T. (1996) Science 222277772222,

1020-1023

12. Fearnhead, N. S., Britton, M. P., and Bodmer, W. F. (2001) Hum Mol Genet 11110000,

721-733

13. Rosin-Arbesfeld, R., Ihrke, G., and Bienz, M. (2001) Embo J 22220000, 5929-5939

14. Nathke, I. S., Adams, C. L., Polakis, P., Sellin, J. H., and Nelson, W. J. (1996) J Cell

Biol 111133334444, 165-179

15. Mimori-Kiyosue, Y., Shiina, N., and Tsukita, S. (2000) J Cell Biol 111144448888, 505-518

16. Munemitsu, S., Souza, B., Muller, O., Albert, I., Rubinfeld, B., and Polakis, P. (1994)

Cancer Res 55554444, 3676-3681

17. Smith, K. J., Levy, D. B., Maupin, P., Pollard, T. D., Vogelstein, B., and Kinzler, K. W.

(1994) Cancer Res 55554444, 3672-3675

by guest on March 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

15

18. Kawasaki, Y., Sato, R., and Akiyama, T. (2003) Nat Cell Biol 5555, 211-215

19. Cadigan, K. M., and Nusse, R. (1997) Genes Dev 11111111, 3286-3305

20. Polakis, P. (2000) Genes Dev 11114444, 1837-1851

21. Bienz, M., and Clevers, H. (2000) Cell 111100003333, 311-320

22. Peifer, M., and Polakis, P. (2000) Science 222288887777, 1606-1609

23. He, T. C., Sparks, A. B., Rago, C., Hermeking, H., Zawel, L., da Costa, L. T., Morin, P.

J., Vogelstein, B., and Kinzler, K. W. (1998) Science 222288881111, 1509-1512

24. Tetsu, O., and McCormick, F. (1999) Nature 333399998888, 422-426

25. Yan, D., Wiesmann, M., Rohan, M., Chan, V., Jefferson, A. B., Guo, L., Sakamoto, D.,

Caothien, R. H., Fuller, J. H., Reinhard, C., Garcia, P. D., Randazzo, F. M., Escobedo,

J., Fantl, W. J., and Williams, L. T. (2001) Proc Natl Acad Sci U S A 99998888, 14973-

14978

26. Leung, J. Y., Kolligs, F. T., Wu, R., Zhai, Y., Kuick, R., Hanash, S., Cho, K. R., and

Fearon, E. R. (2002) J Biol Chem 222277777777, 21657-21665

27. Lustig, B., Jerchow, B., Sachs, M., Weiler, S., Pietsch, T., Karsten, U., van de

Wetering, M., Clevers, H., Schlag, P. M., Birchmeier, W., and Behrens, J. (2002) Mol

Cell Biol 22222222, 1184-1193

28. Rubinfeld, B., Albert, I., Porfiri, E., Fiol, C., Munemitsu, S., and Polakis, P. (1996)

Science 222277772222, 1023-1026

29. Liu, C., Li, Y., Semenov, M., Han, C., Baeg, G. H., Tan, Y., Zhang, Z., Lin, X., and He,

X. (2002) Cell 111100008888, 837-847

30. Behrens, J., Jerchow, B. A., Wurtele, M., Grimm, J., Asbrand, C., Wirtz, R., Kuhl, M.,

Wedlich, D., and Birchmeier, W. (1998) Science 222288880000, 596-599

31. Aberle, H., Bauer, A., Stappert, J., Kispert, A., and Kemler, R. (1997) Embo J 11116666,

3797-3804

32. Sakanaka, C., Weiss, J. B., and Williams, L. T. (1998) Proc Natl Acad Sci U S A 99995555,

3020-3023

33. Munemitsu, S., Albert, I., Rubinfeld, B., and Polakis, P. (1996) Mol Cell Biol 11116666,

4088-4094

34. Morin, P. J., Sparks, A. B., Korinek, V., Barker, N., Clevers, H., Vogelstein, B., and

Kinzler, K. W. (1997) Science 222277775555, 1787-1790

35. Satoh, S., Daigo, Y., Furukawa, Y., Kato, T., Miwa, N., Nishiwaki, T., Kawasoe, T.,

Ishiguro, H., Fujita, M., Tokino, T., Sasaki, Y., Imaoka, S., Murata, M., Shimano, T.,

Yamaoka, Y., and Nakamura, Y. (2000) Nat Genet 22224444, 245-250

36. Derynck, R., Akhurst, R. J., and Balmain, A. (2001) Nat Genet 22229999, 117-129

37. Massague, J., Blain, S. W., and Lo, R. S. (2000) Cell 111100003333, 295-309

by guest on March 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

16

38. Massague, J., and Chen, Y. G. (2000) Genes Dev 11114444, 627-644

39. Miyazono, K., ten Dijke, P., and Heldin, C. H. (2000) Adv Immunol 77775555, 115-157

40. Hannon, G. J., and Beach, D. (1994) Nature 333377771111, 257-261

41. Datto, M. B., Li, Y., Panus, J. F., Howe, D. J., Xiong, Y., and Wang, X. F. (1995) Proc

Natl Acad Sci U S A 99992222, 5545-5549

42. Tago, K., Nakamura, T., Nishita, M., Hyodo, J., Nagai, S., Murata, Y., Adachi, S.,

Ohwada, S., Morishita, Y., Shibuya, H., and Akiyama, T. (2000) Genes Dev 11114444,

1741-1749

43. Sekiya, T., Nakamura, T., Kazuki, Y., Oshimura, M., Kohu, K., Tago, K., Ohwada, S.,

and Akiyama, T. (2002) Cancer Res 66662222, 3322-3326

44. Daniels, D. L., and Weis, W. I. (2002) Mol Cell 11110000, 573-584

45. Graham, T. A., Clements, W. K., Kimelman, D., and Xu, W. (2002) Mol Cell 11110000,

563-571

46. Onichtchouk, D., Chen, Y. G., Dosch, R., Gawantka, V., Delius, H., Massague, J., and

Niehrs, C. (1999) Nature 444400001111, 480-485

47. Tice, D. A., Szeto, W., Soloviev, I., Rubinfeld, B., Fong, S. E., Dugger, D. L., Winer,

J., Williams, P. M., Wieand, D., Smith, V., Schwall, R. H., Pennica, D., and Polakis, P.

(2002) J Biol Chem 222277777777, 14329-14335

48. Xu, L., Corcoran, R. B., Welsh, J. W., Pennica, D., and Levine, A. J. (2000) Genes

Dev 11114444, 585-595

49. Shtutman, M., Zhurinsky, J., Oren, M., Levina, E., and Ben-Ze'ev, A. (2002) Cancer

Res 66662222, 5947-5954

50. Kioussi, C., Briata, P., Baek, S. H., Rose, D. W., Hamblet, N. S., Herman, T., Ohgi, K.

A., Lin, C., Gleiberman, A., Wang, J., Brault, V., Ruiz-Lozano, P., Nguyen, H. D.,

Kemler, R., Glass, C. K., Wynshaw-Boris, A., and Rosenfeld, M. G. (2002) Cell 111111111111,

673-685

51. Taniguchi, K., Roberts, L. R., Aderca, I. N., Dong, X., Qian, C., Murphy, L. M.,

Nagorney, D. M., Burgart, L. J., Roche, P. C., Smith, D. I., Ross, J. A., and Liu, W.

(2002) Oncogene 22221111, 4863-4871

52. Tsang, M., Kim, R., de Caestecker, M. P., Kudoh, T., Roberts, A. B., and Dawid, I. B.

(2000) Genesis 22228888, 47-57

53. Carter, P. (2001) Nat Rev Cancer 1111, 118-129

54. Suzuki, Y., Yamashita, R., Nakai, K., and Sugano, S. (2002) Nucleic Acids Res 33330000,

328-331

Figure Legends

by guest on March 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

17

Fig. 1. Expression of BAMBI is regulated by β-catenin-TCF-mediated

transactivation. (A) Left, Semi-quantitative RT-PCR analysis of RNA from SW48

cells infected with Ad-LacZ, Ad-ICAT or Ad-TCF-4-∆N using primers specific for

BAMBI, AXIN2 or β-ACTIN. Right, Expression of adenovirus-transduced genes were

detected by immunoblotting analysis. TCF-4-∆N was tagged with FLAG-tag and

detected with anti-FLAG antibody. Cells were infected with the indicated

adenoviruses at a MOI 100. (B) Immunoblotting analysis of lysates from SW48 cells

infected with Ad-LacZ, Ad-ICAT or Ad-TCF-4-∆N, or from COS-1 cells infected with

Ad-LacZ or Ad-Flag-β-catenin-S33Y, with anti-BAMBI-N-ter antibody or anti-α-

tubulin antibody. Cells were infected with adenoviruses at a MOI 100. (C) Time

course of BAMBI upregulation following Ad-Flag-β-catenin-S33Y infection of COS-1

cells. Total RNA was isolated at the indicated times and analyzed by Northern blot.

Two different blots were hybridized with the BAMBI and G3PDH probes, with EtBr

staining serving as a loading control. Lysates prepared at the indicated times were

subjected to immunoblotting analysis with FLAG antibody or anti-α-tubulin antibody.

Cells were infected with adenoviruses at a MOI 20.

Fig. 2. β-catenin-TCF-mediated transactivation of the BAMBI promoter. (A)

Schematic representation of the BAMBI promoter region. O, consensus TCF-binding

sites (CTTTGA/TA/T); ∆, potential TCF-binding sites, which differ from the consensus

TCF-binding sites by one base; X, mutated TCF-binding sites (three nucleotides in O

and two nucleotides in ∆ were mutated). The nucleotide sequence of this region is

available from the NCBI database (accession no. AL390996). The transcription

initiation site was adopted from DBTSS [Database of Transcriptional Start Sites (54)].

The fragments indicated in the figure were inserted directly upstream of the luciferase

gene in pGL3 (-3384+82-luc and –586+82-luc) or upstream of the SV40 minimal

by guest on March 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

18

promoter in a luciferase reporter vector (Int1-luc, Int1-mut1-5-luc and Int1-mut-All-luc),

respectively. COS-1 cells were transfected with β-catenin-S33Y (0.8 µg) along with

the indicated promoter construct (0.4 µg), and luciferase activity was measured.

pTOP-tk- and pFOP-tk-luciferase (0.4 µg) were used as positive and negative controls,

respectively. Error bars represent the standard deviation of triplicate assays. (B) A

fragment containing nucleotides –586 to +82 was inserted in the sense or anti-sense

orientation into pGL3 [-586+82-luc(S) or –586+82-luc(AS), respectively]. COS-1

cells were transfected with these reporter constructs and luciferase activity was

measured. (C) Effects of a dominant-negative mutant of TCF-4 on the activity of the

BAMBI promoter in colorectal tumor cells. SW480, HCT116 and SW48 cells were

transfected with a luciferase reporter plasmid (0.4 µg of pTOP-tk-luc, Int1-luc or

–586+82-luc) and increasing amounts of TCF-4-∆C (0, 0.1, 0.4, and 1.2 µg), and

luciferase activity were measured. (D) (Left) Effects of dominant-negative mutants of

TCF-4 and ICAT on β-catenin-mediated activation of the BAMBI promoter. COS-1

cells were transfected with a luciferase reporter plasmid (0.3 µg, pTOP-tk-luciferase or -

586+82-luc) along with indicated plasmids (0.6 µg for β-cat S33Y, 1.2 µg for others),

and luciferase activity was measured. In all of the luciferase-reporter assays in this

figure, the total amount of plasmid DNA was adjusted with pcDNA3.1(+) empty

plasmid. The pRL-tk Renilla luciferase reporter (0.07 µg) was co-transfected to

normalize transfection efficiency. (Right, upper panel) Detection of exogenously

expressed FLAG-tagged TCF4-∆C, TCF4-∆N, and ICAT. Lysates prepared from

COS-1 cells transfected with the indicated plasmids were subjected to immunoblotting

with anti-FLAG antibody. (Right, lower panel) Nuclear localization of TCF4-∆C.

COS-1 cells were transfected with FLAG-tagged TCF4-∆C and stained with ant-FLAG

antibody (left). The nucleus was stained with TOTO-3 (right).

Fig. 3. Expression of BAMBI in colorectal and hepatocellular carcinomas. (A)

by guest on March 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

19

BAMBI expression was examined by semi-quantitative RT-PCR analysis. AXIN2 was

used as a marker of β-catenin-TCF-mediated activation. β-ACTIN was used as an RT-

PCR control to verify both the quality and quantity of template. N, non-cancerous

tissue; T, tumor. (B) Human colon tumor tissues and adjacent non-cancerous tissues

were double-stained with anti-β-catenin antibody (A, B, C, D) and anti-BAMBI-N-ter

(E, G) or –C-ter (F, H) antibody.

Fig. 4. BAMBI expression interferes with TGF-β signaling. (A) Effect of BAMBI

on colony formation. DU-145 cells were transfected with the indicated plasmids, and

cultured with 400 µg/ml of geneticin in the presence or absence of TGF-β1 for 3 weeks.

(B) Colonies generated in A were cloned and propagated. Lysates from these cells

were subjected to immunoblotting with anti-GFP or -α-tubulin antibody. Arrowheads

indicate BAMBI-GFP. BAMBI was detected as two bands presumably because of N-

glycosylation, since BAMBI was detected as one band in cells treated with tunicamycin

(our unpublished observation). The asterisk indicates a non-specific protein. (C)

BAMBI represses TGF-β-mediated transactivation. Cells expressing BAMBI obtained

in B were transfected with p3TP-lux, cultured in the presence or absence of TGF-β, and

luciferase activity was measured.

by guest on March 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Kuhara, Susumu Ohwada and Tetsu AkiyamaYoichi Furukawa, Yusuke Nakamura, Tsutomu Nakamura, Kousuke Tashiro, Satoru

Takashi Sekiya, Shungo Adachi, Kazuyoshi Kohu, Tatsuya Yamada, Osamu Higuchi,b-catenin pathway in colorectal tumor cellsS

Identification of BAMBI, an inhibitor of TGF-b signaling, as a target of the

published online December 1, 2003J. Biol. Chem. 

  10.1074/jbc.M310876200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on March 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from