魚 病 研 究 Fish Pathology, 40 (2), 67-71, 2005.6 2005 The Japanese Society of Fish Pathology

I dentification and Pathogenicity of Intracellular

Francisella Bacterium in Three-line Grunt

Parapristipoma trilineatum

Takashi Kamaishi1*, Yutaka Fukuda2, Masaru Nishiyama3,5,　 Hidemasa Kawakami4,

Tomomasa Matsuyama1, Tomoyoshi Yoshinaga1,6 and Norihisa Oseko1

1National Research Institute of Aquaculture, Fisheries　 Research Agency, Nansei, Mie 519-0193, Japan

2Fisheries　 Research Institute, Oita Prefectural Agriculture,　 Forestry and Fisheries Research Center,

Kamiura, Oita 879-2602, Japan

3Kochi Prefectural Sukumo Fisheries Guidance Station,　Sukumo, Kochi 788-0265, Japan

4Ehime Prefectural Fish　 Disease Control Center, Uwajima, Ehime 798-0087 Japan

5Present address: Kochi Prefectural Government Fisheries　 Promotion Section,

Marunoushi, Kochi 780-0850, Japan

6Present address: Department of Aquatic Bioscience, Graduate School of Agricultural

and Life Sciences, The University of Tokyo,　 Bunkyo, Tokyo 113-8657, Japan

(Received February 3, 2005)

ABSTRACT-Bacteriological examination was conducted on the disease of cultured marine fish,

three-line grunt Parapristipoma trilineatum (Japanese common name: isaki).　 The affected fish

characteristically showed white spots of granulomas containing an intracellular bacterium in the　 kid

ney and spleen. Total DNA was extracted from the kidney of the diseased fish. The coding

region of small subunit　 ribosomal RNA (16S rDNA) of eubacteria was amplified from　 the DNA by

PCR, and nucleotide sequence was determined.　 The sequenced 16S rDNA revealed high similar

ity (97.3-98.5%) to those of Francisella species. On the basis of phylogenetic analysis, the clos

est relative organism　 was revealed to be Francisella philomiragia. A bacterium　 was isolated from

the spleen of one affected fish using　 cystine heart agar medium with 1% hemoglobin. The 16S

rDNA sequence of the isolated bacterium was consistent with that determined from the kidney tis

sue of the affected fish. An experimental infection with the isolate exhibited the same disease

signs in the injected fish, and the bacterium was reisolated from these fish. These results demon

strate that the intracellular bacterium is pathogenic and is identified to the genus Francisella This

is the first report of pathogenic Francisella from marine fish.

Key words: granuloma, intracellular bacterium, 16S rDNA, Francisella, Parapristipoma trilineatum

Mortality of cultured three-line grunt Parapristipoma

trilineatum (Japanese common name: isaki) has been

occurring sporadically in Kyushu and Shikoku districts,

Japan since autumn in 1999 (Fukuda et al., 2002).

These fish had been imported from China or produced

from the　 imported brood fish. According to Fukuda et

al. (2002), external signs of diseased fish are hemor

rhage in the body surface, gill and ventral part. Internal

signs are white　 foci scattered in the kidney, spleen and

sometimes liver.　 These white foci are composed of

granuloma. An intracellular organism was detected in

the internal organs of affected fish. This organism was

suggested to be a　 coccoid Gram-negative bacterium

from the results of　 histological observations on tissue

imprints, but it could not be isolated using general bacte

rial media (Fukuda et　al., 2002). The cause of the mor

tality was suggested to be attributed to the infection of

the intracellular bacterium, because isaki intraperito

neally injected with a spleen homogenate of diseased

fish died with granulomas containing the intracellular

bacterium (Fukuda et　al., 2002).

In this study, the coding region of small subunit ribo

somal RNA (16S rDNA) sequence of the suspected bac

terium was determined and the phylogenetic relationship

was inferred. The isolation and cultivation of the bacte-

*Corresponding author

E-mail: kamaishi@fra.affrc.go.jp

68 T.Kamaishi,Y.Fukuda,M.Nishiyama,H.Kawakami,T.Matsuyama,T.Yoshinaga and N.Oseko

rium was performed by referring to the cultivation

method for the close relatives,which were inferred from

phylogenetic analysis. Furthermore,the isolated bacte

rium was injected into fish to confirm the etiology of the

disease.

Materials and Methods

Fish employed

For DNA extraction and histological observation,

spontaneously diseased isaki were collected from

aquaculture facilities in Oita Prefecture on 29 October

1999 and Kochi Prefecture on 13 November 2000,

Japan. For isolation of the bacterium,a moribund isaki

(body weight:127g)was collected from a nursery pond on 23 October 2001 at Uwajima,Ehime Prefecture,

Japan. The disease occurred from zero years old fish

of 10g or less to three years old fish of 500g or more,

regardless of age and weight of the fish. These fish

had been imported from China. Healthy isaki used for

an experimental infection were provided from Fisheries

Research Institute,Oita Prefectural Agriculture,Forestry

and Fisheries Research Center,where the fish were arti

ficially bred from native brood stock.

1 6S rDNA sequencing and phylogenetic analysis

Genomic DNA was extracted from the frozen kidney

(50mg)of one diseased fish by a general method using

proteinase K and phenol-chloroform(Sambrook et al.,

1989). 16S rDNA was amplified by using the universal

primers for eubacteria;EubA(AAGGAGGTGATC

CANCCRCA)and EubB(AGAGTTTGATCMTGGC

TCAG)(Giovannoni,1991). The expression of the

primer sequence is based on the IUPAC code. Cycling

conditions for the PCR were 94℃(30 sec),55℃(30

sec)and 72℃(1min)for 30 cycles. The amplified frag

ment was purified,ligated with the plasmid vector pDrive

(QIAGEN),and applied for nucleotide sequencing. The

16S rRNA sequences of eubacterial species were

aligned. Evolutionary distances were calculated by the

method of Kimura's two-parameter model. 16S rDNA

tree was inferred by the neighbor-joining(NJ)method.

The phylogenetic analyses were carried out using

the GENETYX software package(version 10.6,

GENETYX). The determined sequence was aligned

with other 16S rRNA sequences of various eubacteria.

From the alignment,the regions unique to the bacterium

from isaki were deduced to design primers and

probes.

Histological observation and in situ hybridization

Tissue samples of naturally infected isaki were pre

served in Bouin's fixative for 24h. The fixed tissues

were embedded in paraffin,sectioned 6μm thick and

placed on silane coated slides,and then were provided

for hematoxylin-eosin staining,in situ hybridization and

Giemsa staining. Two oligonucleotide probes comple

mentary to 16S rDNA of the bacterium were selected

from the regions in the sequence and synthesized with

5-prime end labeled digoxigenin. These putatively spe

cific bacterial probes were designated as Isaki-DIG-80r

(CTCGTCAGCATCCGAAGACCTGTTA)and lsaki-DIG200r(GGCAGCGCAAAGGCCACCTTTAATCCGCAGA

TAT). The method of in situ hybridization was followed

Stokes and Burreson(2001). The kidney sample of

healthy fish and the reaction without probes were per

formed as negative controls.

Det ection of the bacterium by PCR

For detection of the bacterium using PCR,putatively

specific primers of the bacterium were designed from the

determined 16S rDNA sequences. These were Isaki

60(GTCGAACGGTAACAGGTCTTCGGA)and Isaki

840r(GCCACTAGATCCTTTACACCGAAT). Cycling

conditions for the PCR procedure were 94℃(30 sec),

55℃(30 sec)and 72℃(1min)for 30 cycles.

Isoation and growth of the bacterium

The spleen sample of one fish was spread onto cys

tine heart agar(Difco,USA)with 1% (w/v)hemoglobin

and then cultured at 25℃ for two weeks. After cultiva

tion,four colonies were sequenced for their 16S rDNA

regions. Eugon agar(BBL,USA)with 1% (w/v)hemo

globin or Eugon broth(BBL,USA)with 2mM FeCl3,were

also used for the cultivation. Eugon agar with hemoglo

bin is the modification of Eugon agar supplemented with

blood,which is used for isolation of Francisella tularensis

in Japan(Sato et al,1975;Sato and Ohara,1982). For

the preparation of Eugon broth with FeCI3,Eugon broth

was autoclaved and then mixed with filter-sterilized 1 M

FeCI3 stock solution before use.

Experimental infection with isolate

One strain(Ehime-1)was cultivated on the cystine

heart agar with hemoglobin at 25℃ for 72h and sus

pended in PBS. The bacterium was serially ten-fold

diluted with PBS. Twenty-five healthy fish(average

weight:10.9g)were held in 60L circulatory tanks at

25℃ for each experimental inoculum group. The fish

were inoculated with 0.1mL of the bacterial suspension

by intraperitoneal injection. The final doses of infec

tions were from 107 to 104 CFU/fish. A control group

was injected with 0.1mL of PBS. After inoculation,

these fish were kept for 19 days without feeding. Dead

fish were subjected to standard necropsy procedures

including isolation of bacteria from the kidney using cys

tine heart agar with hemoglobin. After cultivation,the

isolates were checked by the PCR using isaki-60 and

isaki-840r primers.

Identification of intracellular bacterium 69

Fig.1. Phylogenetic relationships of 16S rDNA. A sequence detected from diseased isaki was grouped in genus Francisella. The closest relative of the sequence was F.philomiragia. The phylogenetic tree was inferred from 16S rDNA sequences by using the neighbor-joining method. This tree was unrooted. Bootstrap probabilities are shown on the internal branches

(%). Database accession numbers are shown in parentheses following scientific names.

Results

Determination of the 16S rDNA sequence

The sequence of the 16S rDNA(Database acces

sion number:AB194068)was aligned with the other

eubacterial I6S rRNA sequences. A high similarity

97.3-98.5% of the sequence was shown between the

bacterium and Francisella species. Phylogenetic tree

of 16S rDNA inferred by the NJ method is shown in Fig.

1. The analyzed sequence was included in the cluster

of the intracellular bacteria, Francisella species.

Among these species,Francisella philomiragia was the

closest relative to the bacterium. Bootstrap probabili

ties also showed that they were closely related.

Detection of the bacterium by PCR

The PCR products with the expected size(788bp)

were obtained from the isolated bacteria and eight natu

rally diseased fish using the designed primers,lsaki-60

and lsaki-840r.

I solation of the bacterium

Smooth colonies were formed on cystine heart agar

with hemoglobin from an affected fish. These were

gray or green in color. 16S rDNA region of four isolates

were exhibited almost consistent(similarity of 99.7-

100%)with the previously determined sequence of the

bacterium in the tissue of naturally diseased fish. The

bacterium grew optimally at 25℃ but not at 37℃.

Eugon agar with hemoglobin was also able to support

the growth of the bacterium. For the large-scale cultiva

tion,the bacterial growth was considerably improved by

the addition of FeCl3 to Eugon broth.

Experimental infection

All the fish of every infected group died within 19

days in a dose dependent manner(Fig.2). The same

Fig.2. Mortalities of isaki infected with the cultivated bacterium by intraperitoneal injection. One fish of the 106

CFU/fish injection group jumped out from the tank by accident at 15th day. This fish was moribund show

ing same disease signs as other affected fish.

70T. Kamaishi, Y. Fukuda, M. Nishiyama, H. Kawakami, T. Matsuyama, T. Yoshinaga and N. Oseko

disease signs as diseased fish in the farms were observed in these infected fish, e.g. white foci in the spleen and ulcer around the site of injection. Sphere or short rod-shaped bacteria were intracellularly or extra-cellularly observed in the spleen imprint of an affected fish (Fig. 3). The bacteria were reisolated from the kid-ney of the experimentally infected dead fish using cys-tine heart agar with hemoglobin. The PCR confirmed the isolates as the same bacterium in the natural outbreaks. The fish of the control group did not show any disease signs, and no bacterium was isolated from the kidney.

Discussion

In the histological observations, intracellular organ-isms which appeared as bacteria were observed in the kidney of naturally diseased fish. DNA extracted from these kidneys was applied for the sequence of 16S rDNA, and the oligonucleotide probes for in situ hybrid-ization were designed from the sequence. After in situ hybridization using these probes, these organisms in the cells of the kidney showed positive reaction (data not shown). This result indicates that these intracellular organisms include the bacterial 16S rDNA.

The 16S rDNA sequence of the bacterium revealed a 98.5% similarity to F. philomiragia and a 97.3% similar-ity to F. tularensis. From the phylogenetic analysis, the bacterium in the kidney of diseased isaki was inferred to belong to a same cluster among genus Francisella. The phylogenetic tree showed that F. philomiragia was the closest relative of the bacterium. F. philomiragia has been known as the bacterium isolated from dead muskrat Ondatra zibethica and river water. It is also occasionally associated with diseases in humans

(Jensen et al., 1969; Hollis et al., 1989; Forsman et al., 1994).

Characteristics of the members of genus Francisella

are intracellular, pathogenic, rod-shaped, Gram-nega-

tive, nonmotile and aerobic (Anonymous, 1994). F.

tularensis is the causative agent of tularemia in humans

and animals (Eigelsbach and McGann, 1984; Wong and

Shapiro, 1999). Although F. tularensis causes zoono-

sis, the bacterium isolated from isaki may be innocuous

for mammals because they cannot grow at 37•Ž.

However, further study is necessary on the virulence of

the bacterium to mammalian hosts.

The bacterium could not be isolated on standard

media like brain heart infusion agar, Trypto-Soya agar,

nutrient agar, 1% Ogawa medium, 3% Ogawa medium,

thiosulfate citrate bile saccharose agar and Salmonella-

Shigella agar (Fukuda et al., 2002). The present study

showed that some specific media for genus Francisella

supported the growth of the bacterium isolated from

naturally and experimentally infected fish.

The isolate was able to infect healthy isaki experi-

mentally, and the disease signs were reproduced in the

infected fish. The isolates from the dead fish by experi-

mental infection showed positive by PCR using specific

primers of the bacterium. Based on all these informa-

tion, it is suggested that the bacterium is a species

belonging to genus Francisella. This is the first report

on isolation of Francisella species from marine fish.

A few intracelluar bacteria have been reported in

several species of fish (Fryer and Maurel, 1997; Mauel

and Miller, 2002) The present isaki bacterium is appar-

ently different from Piscirickettsia salmonis reported by

Fryer et al. (1992) (Fukuda et al. 2002). In Taiwan and

Hawai, the diseases of tilapia with similar disease signs

such as multiple white granulomas have been reported,

which were caused by Piscirickettsia-like organisms

(HTPLOs) (Chern and Chao, 1994; Chen et al., 1994;

Mauel et al., 2003). One Taiwanese bacterium was

isolated and cultivated in several fish cell lines with cyto-

pathic effect (Chern and Chao, 1994), and another

Taiwanese bacterium grew in CHSE-214 cells with no

cytopathic effect (Chen et al., 1994). In contrast, the

isaki bacterium was not able to be isolated using some

fish cell lines (CHSE-214, BF-2, FHM and EPC) (data

not shown). Phylogenetic relationship between the

isaki bacterium and HTPLOs remains to be investigated.

It is further necessary to clarify the physicochemical

and biochemical properties for the identification of the

present bacterium, and it is also important to examine

the susceptibility of other fish species to the bacterium.

Acknowledgements

The authors thank Mses. J. Hiraga, K. Hayashi

and N. Isetani for their technical support and Dr. N.

Tsutsumi for the scientific advice.

Fig. 3. A spleen imprint of experimentally challenged isaki with

the isolated bacterium. Intracellular bacteria are

observed (arrows). The bar is 10 ƒÊm.

Identification of intracellular bacterium 71

References

Anonymous(1994): Genus Francisella. In"Bergey's manual of determinative bacteriology,9th ed."(ed.by Holt,J.G.,N.

R. Krieg, P.H.A. Sneath, J.T. Staley and S.T. Williams).Willams and Wilkins, Baltimore, pp.83.

Chern, R.S. and C.B. Chao(1994):Outbreaks of a disease caused by rickettsia-like organism in cultured tilapias in

Taiwan. Fish Pathol., 29,61-71.Chen, S.C., M.C. Tung, S.P. Chern, J.F. Tsai, P.C. Wang,R.

S. Chen,S.C. Lin and A.Adams(1994):Systematic granulomas caused by a rickettsia-like organism in Nile tilapia,Oreochromis niloticus (L.), from southern Taiwan. J. Fish

Dis., 17,591-599.

Eigelsbach, H.T. and V.G. McGann(1984):Genus Francisella Dorofe'ev 1947,176AL. In"Bergey's manual of systematic

bacteriology 1st ed." (ed. by N.R. Kreig and J.G. Holt).The Williams and Wilkins, Baltimore, vol. 1, pp. 394-399.

Forsman, M., G. Sandstrom and A. Sjostedt(1994):Analysis of 16S ribosomal DNA sequences of Francisella strains and

utilization for determination of the phylogeny of the genus and for identification of strains by PCR. Int. J. Syst.

Bacteriol., 44,38-46.Fryer, J.L. and M.J. Mauel(1997):The rickettsia:an emerging

group of pathogens in fish. Emerg.Inf. Dis., 3,137-144.Fryer, J.L., C.N. Lannan, S.J. Giovannoni, N.D. Wood(1992):

Piscirickettsia salmonis gen.nov.,sp.nov.,the causative

agent of an epizootic disease in salmonid fishes. Int. J.Syst. Bacterilo., 42,120-126.

Fukuda, Y.,A. Okamura, M. Nishiyama, H. Kawakami,T.Kamaishi and T. Yoshinaga(2002):Granulomatosis of cultured three-line grunt Parapristipoma trilineatum caused by

an intracellular bacterium. Fish Pathol., 37,119-124.

Giovannoni, S. (1991): The polymerase chain reaction. In"Nucleic acid techniques in bacterial systematics" (ed.by E

. Stackebrandt and M. Goodfellow). John Wiley and Sons,New York, pp.177-201.

Hollis, D.G.,R.E. Weaver, A.G. Steigerwalt, J.D. Wenger, C.

W. Moss and D.J. Brenner(1989):Francisella philomiragia

comb. nov.(formerly Yersinia philomiragia) and Francisella tularensis biogroup novicida(formerly Francisella novicida)

associated with human disease. J. Clin. Microbiol.,27,1601-1608.

Jensen, W.L.,C.R. Owen and W.L. Jellison(1969):Yersiniaphilomiragia sp.n.,a new member of the Pasteurella group

of bacteria, naturally pathogenic for the muskrat(Ondatrazibethica). J.Bacteriol., 100,1237-1241.

Mauel, M.J. and Miller, D.L. (2002):Piscirickettsiosis and

piscirickettsiosis-like infections in fish:a review. Vet.Microbiol., 87,279-289.

Mauel, M.J.,D.L. Miller, K.Frazier, A.D. Liggett, L. Styer,D. Montgomery-Brock and J. Brock (2003):Characterization

of a piscirickettsiosis-like disease in Hawaiian tilapia. Dis.

Aquat. Org., 53,249-255.Sato, T.,Y. Watanabe and A. Fukuoka(1975):Utilization of

commercially available agar medium for cultivation ofFrancisella tularensis. Jpn. Assoc. Med. Tech.,24,29-32(in Japanese).

Sato, T.and S. Ohara(1982):On isolation and cultivation ofFrancisella tularensis. Annu. Rep. Ohara Hosp.,25,1-5

(in Japanese with English summary).Sambrook, J.,E.F. Fritsch and T. Maniatis(1989):Commonly

used techniques in molecular cloning. In"Molecular cloning, 2nd ed.".Cold Spring Harbor Laboratory Press, NewYork,pp.E.3-E.4.

Stokes, N.A. and E.M. Burreson(2001):Differential diagnosisof mixed Haplosporidium costale and Haplosporidium

nelsoni infections in the eastern oyster, Crassostreavirginica, using DNA probes. J. Shellfish Res., 20,207-

213.Wong, J.D. and D.S. Shapiro(1999):Francisella. In"Manual

of clinical microbiology, 7th ed."(ed.by P.R. Murray,E.J.Baron, M.A. Pfaller, F.C. Tenover and R.H. Yolken).American Society for Microbiology, Washington, D.C., pp.647-651.