ACTAUNIVERSITATIS

UPSALIENSISUPPSALA

2019

Digital Comprehensive Summaries of Uppsala Dissertationsfrom the Faculty of Medicine 1581

The Role of Kidney OxygenHomeostasis for the Developmentof Kidney Disease

CARLA CARVALHO

ISSN 1651-6206ISBN 978-91-513-0691-9urn:nbn:se:uu:diva-387389

Dissertation presented at Uppsala University to be publicly examined in C2:305,Biomedicinsk Centrum, Husargatan 3, Uppsala, Friday, 6 September 2019 at 09:15 for thedegree of Doctor of Philosophy (Faculty of Medicine). The examination will be conductedin English. Faculty examiner: Professor Jenny Nyström ( University of Gothenburg,Department of Physiology at the Institute of Neuroscience and Physiology).

AbstractCarvalho, C. 2019. The Role of Kidney Oxygen Homeostasis for the Development of KidneyDisease. Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty ofMedicine 1581. 56 pp. Uppsala: Acta Universitatis Upsaliensis. ISBN 978-91-513-0691-9.

The relation between oxygen supply and demand determines tissue oxygen tension (PO2). Whenintrarenal tissue PO2 decreases, any compensatory increase in oxygen supply via increasedrenal blood flow is likely to increase glomerular filtration rate. The resulting increased tubularload of electrolytes destined for active transport increases oxygen consumption, thus affectingintrarenal tissue PO2. Consequently, the kidney is particularly sensitive to alterations in oxygenhomeostasis and kidney hypoxia is acknowledged as a common pathway to end stage renaldisease. Different factors that can affect intrarenal oxygen homeostasis, including alterations inblood pressure and sodium intake dietary or pathologies such as diabetes mellitus, anemia oratherosclerosis. This thesis focuses on understanding how these factors influence kidney oxygenhomeostasis.

Pronounced reduction in sodium intake caused tissue hypoxia in kidney cortex via activationof the renin-angiotensin-aldosterone leading to increased tubular sodium reabsorption.Angiotensin II and aldosterone affect kidney oxygen handling differently. Whereas angiotensinII mainly affects kidney oxygen delivery, aldosterone mainly affects oxygen consumption.

The hypoxia-inducible factor (HIF) system is a cellular defense mechanism against prolongedhypoxia. Although diabetes causes intrarenal hypoxia, hyperglycemia per se also preventsHIF-activation. Therefore, the effects of type 1 diabetes were evaluated in geneticallymodified mice with chronic HIF-activation. Diabetic mice with globally increased HIF activity,due to heterozygote prolyl hydroxylase-2 deficiency, displayed reduced mitochondria leakrespiration and preserved cortical PO2. Diabetic mice with kidney-specific HIF activation, due tohomozygous deficiency of von Hippel-Lindau, developed reduced mitochondria leak respirationand reduced urinary albumin excretion.

The normal age-related decline in kidney function has been proposed to be due to, at least inpart, increased oxidative stress, which can induce mitochondrial leak respiration via activationof uncoupling proteins. Indeed, two-year old mice deficient of uncoupling protein-2 presentedwith improved mitochondria efficiency and reduced urinary protein excretion.

Summarizing, the data presented in this thesis provide clear support for potent influence of therenin-angiotensin-aldosterone system, HIF activation and mitochondria function on intrarenaloxygen availability. Maintaining kidney oxygen homeostasis may be a unifying strategy toprotect kidney function.

Keywords: Oxygen, Kidney mitochondria, Hypoxia-inducible factors, Prolyl hydroxylase, vonHippel-Lindau, Diabetes, Aging, Kidney, Sodium, RAAS

Carla Carvalho, Department of Medical Cell Biology, Integrative Physiology, Box 571,Uppsala University, SE-75123 Uppsala, Sweden.

© Carla Carvalho 2019

ISSN 1651-6206ISBN 978-91-513-0691-9urn:nbn:se:uu:diva-387389 (http://urn.kb.se/resolve?urn=urn:nbn:se:uu:diva-387389)

” If you dare nothing, then when the day is over, nothing is all you will have gained.”

The Graveyard Book, by Neil Gaiman

List of Papers

This thesis is based on the following papers, which are referred to in the text by their Roman numerals.

I Patinha, D., Carvalho, C., Persson, P., Pihl, L., Fasching, A.,

O’Neil, J., Palm, F. (2019). Determinants of renal oxygen metab-olism during low Na+ diet: effect of angiotensin AT1 and aldos-terone receptor blockade. Manuscript

II Carvalho, C., Schiffer, T.A., Zheng, X.W., Grünler, J., Karls-son, S., Mazzone, M., Carmeliet, P., Inagi, R., Hansell, P., Catrina, S.B., Friederich-Persson, M. Palm, F. (2019) Activation of hypoxia inducible factor due to reduced prolyl hydroxylase 2 activity prevents renal mitochondria dysfunction and improves cortical oxygenation in type 1 diabetic mice. Manuscript

III Carvalho, C., Schiffer, T.A., Zheng, X.W., Grünler, J., Karls-son, S., Mazzone, M., Carmeliet, P., Inagi, R., Hansell, P., Catrina, S.B., Friederich-Persson, M. Palm, F. (2019) Hypoxia-inducible factors activation protects mitochondria function and prevents albuminuria in kidney-specific diabetic von Hippel-Lindau deficient mice. Manuscript

IV Carvalho, C., Schiffer, T.A., Karlsson, S., Hansell, P., Friederich-Persson, M., Palm, F. (2019) Uncoupling protein 2 mediates age-related mitochondria inefficiency and urinary pro-tein excretion. Manuscript

Contents

Introduction ....................................................................................................... 11 The Kidney ................................................................................................... 11 Renin-Angiotensin-Aldosterone System ..................................................... 12 The Mitochondrion ....................................................................................... 13 Hypoxia-Inducible Factors ........................................................................... 15 Diabetes Mellitus and Diabetic Kidney Disease ......................................... 17 Diabetes and Hypoxia .................................................................................. 17 Aging and Kidney Function ......................................................................... 18 

Aim .................................................................................................................... 19 

Methods ............................................................................................................. 20 Animal Models ............................................................................................. 20 Evaluation of Kidney Function .................................................................... 22 

General Parameters .................................................................................. 22 Measurement of Glomerular Filtration Rate (GFR) ............................... 22 Urinary Excretion of Electrolytes, Protein and Albumin ....................... 23 

Measurement of Oxygen Handling in the Kidney ...................................... 23 Evaluation of Mitochondria Function .......................................................... 23 

Mitochondrial Isolation ........................................................................... 23 High Resolution Respirometry ................................................................ 24 

Gene Expression and Quantification of Angiotensin II .............................. 25 Tissue Collection ..................................................................................... 25 Angiotensin II Extraction and Quantification (Study I) ......................... 25 RNA Extraction and Quantitative Polymerase Chain Reaction ............. 25 

Statistics ........................................................................................................ 26 

Results ............................................................................................................... 27 The Effect of Low Na+ Diet on Kidney Oxygen Homeostasis (Study I) ... 27 The Differential Effect of Angiotensin II and Aldosterone on Kidney Oxygen Homeostasis (Study I) .................................................................... 28 The Effects of Reduction in Prolyl Hydroxylase 2 on Mitochondria Function (Study II) ....................................................................................... 30 The Effects of Reduction in Prolyl Hydroxylase 2 on Kidney Function (Study II) ....................................................................................................... 32 The Effects of Kidney-Specific Deletion of von Hippel-Lindau on Mitochondria Function (Study III) .............................................................. 32 

The Effects of Kidney-Specific Deletion of von Hippel-Lindau on Kidney Function (Study III) ......................................................................... 34 The Effect of Aging and UCP-2 Deletion on Mitochondria and Kidney Function in Healthy Mice (Study IV) .......................................................... 35 

Discussion ......................................................................................................... 37 

Conclusions ....................................................................................................... 42 

Popular Scientific Summary ............................................................................. 43 

Sumário ............................................................................................................. 45 

Acknowledgements ........................................................................................... 47 

References ......................................................................................................... 50 

Abbreviations

ACE Angiotensin-converting enzyme ADP Adenosine diphosphate ANT Adenine nucleotide translocator AT1 Angiotensin II receptor type 1 ATP Adenosine triphosphate Bcl2 B-cell lymphoma 2 BSA Bovine serum albumin CAP Canrenoic acid potassium salt CAT Carboxyatractylocide CoQ Coenzyme Q EGTA Ethylene glycol-bis(β-aminoethyl ether)-N,N,N′,N′-tetraace-

tic acid ESRD End stage renal disease ETC Electron transport chain FADH2 1,3-dihydro-flavine adenine dinucleotide FITC Fluorescein isothiocyanate GDP Guanosine diphosphate GFR Glomerular filtration rate HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid HIF Hypoxia-inducible factors HRE Hypoxia response elements mQO2 Mitochondrial oxygen consumption mTAL Medullary thick ascending limb of the loop of Henle NADH Nicotinamide adenine dinucleotide OXPHOS Oxidative phosphorylation p300 E1A binding protein p300 PBS Phosphate buffer saline PGK1 Phosphoglycerate kinase 1 PHD Prolyl hydroxylase PO2 Partial pressure of oxygen QO2 Oxygen consumption RAAS Renin-angiotensin-aldosterone system RBF Renal blood flow RCR Respiratory control ratio TCA Tricarboxylic acid TGF Tubuloglomerular feedback

UCP Uncoupling protein VHL von Hippel-Lindau

11

Introduction

The Kidney The kidneys are responsible for regulating extracellular volume, electrolyte concentration and pH. This is achieved by their ability to control urinary ex-cretion of electrolytes, waste products, bicarbonate and hydrogen ions, as well as regulate the activity of the renin-angiotensin-aldosterone system (RAAS). The nephron is the functional unit of the kidney and it is divided in glomeru-lus, proximal tubule, loop of Henle, distal tubule and collecting duct. Nutrients and electrolytes are filtered in the glomerulus, forming the primary urine, while large proteins and cells remain in the plasma. In the proximal tubule, all the glucose and the majority of electrolytes are reabsorbed. About 65% of the sodium (Na+) is reabsorbed in this segment, mainly driven by the concentra-tion gradient created by the Na+/K+- ATPase localized to the basolateral mem-brane of the tubular cells. In the loop of Henle, the hyperosmotic milieu char-acteristic of the medulla is created. This is due to the combination of a water permeable descending limb and a water impermeable ascending limb, where the medullary thick ascending limb of the loop of Henle (mTAL), plays a ma-jor role in the reabsorption of circa 25% of the filtered Na+. Finally, the distal tubule and collecting duct have pivotal roles in the regulation of acid-base balance and the final regulation of water and electrolyte balance.

The kidneys receive about 25% of the cardiac output, to support a high glomerular filtration rate (GFR) of approximately 125 ml min-1. Despite ample renal blood flow (RBF), the renal tissue displays heterogeneous oxygenation. The cortico-medullary oxygen tension (PO2) (1, 2) is the result of heterogene-ous oxygen consumption (QO2) in different nephron segments in combination with the close proximity of feeding arteries and draining veins resulting in the oxygen diffusion shunt (3, 4). Indeed, the cortex has a tissue PO2 about 30-40% higher than the medulla (5, 6). In the normal kidney, an attempt to in-crease intrarenal tissue PO2, by increasing RBF also increases GFR and, thus, tubular load of Na+, which also increases the metabolic demand to sustain the resulting increased active tubular transport. For this reason, it is important to keep RBF and GFR relatively constant, regardless of fluctuations in blood pressure, a concept known as autoregulation. Two main mechanisms are re-sponsible for the autoregulation of GFR and RBF; The fast acting myogenic mechanism and the somewhat slower acting tubuloglomerular feedback

12

mechanism (TGF). The myogenic mechanism is the ability of afferent arteri-oles to constrict in response to a sudden increase in perfusion pressure, result-ing in a constant perfusion pressure in the distally located glomerular capillar-ies. The TGF mechanism involves sensing of the Na+- and Cl--load to the mac-ula densa and signaling to the afferent arteriole to control perfusion pressure in order to maintain GFR within normal range. Notably, TGF signaling is also involved in the regulation of renin release.

Renin-Angiotensin-Aldosterone System The RAAS is depicted in Fig.1. Renin release from granular cells in the distal afferent arteriole in response to reduced blood pressure is caused by a direct effect of reduced renal perfusion pressure on the renin producing cells, re-duced perfusion pressure on GFR, and via the increased sympathetic activity due to reduced arterial pressure. Once released into the blood, renin enzymat-ically converts angiotensinogen in angiotensin I, which is thereafter cleaved by the angiotensin converting enzyme (ACE) into angiotensin II. Angiotensin II signals via angiotensin type 1 receptors (AT1) to promote tubular water and Na+ retention and vasoconstriction of resistance vessels, but also cell prolifer-ation, oxidative stress and inflammation (7, 8). Angiotensin also stimulates aldosterone secretion from the adrenal glands, which further increasing tubu-lar Na+ reabsorption via mineralocorticoid receptor signaling and endothelial Na+ channels in the late distal tubule and collecting duct.

13

Figure 1. Schematic representation of activation of the renin-angiotensin-aldosterone system.

Briefly, a reduction in blood pressure lowers renal perfusion pressure and NaCl load to macula

densa, which together with increased sympathetic activation, stimulates renin release from

granular cells in the distal part of the afferent arteriole. Renin cleaves angiotensinogen into

angiotensin I, which is thereafter converted into angiotensin II by angiotensin converting en-

zyme. Angiotensin II exerts different effects through the angiotensin AT1 receptors leading to

increased tubular Na+, Cl- and water reabsorption, increased production of antidiuretic hormone

(ADH) and aldosterone, as well as increased vascular resistance. All of these mechanisms con-

tribute to normalize arterial blood pressure.

The Mitochondrion The mitochondrion is often referred to as the “power plant” of the cell, pro-ducing ATP (adenosine triphosphate) from adenosine diphosphate (ADP) and inorganic phosphate (Pi), via oxidative phosphorylation (OXPHOS), summa-rized in Fig. 2. Briefly, the electron transport chain (ETC), located in the inner membrane of the mitochondrion, consists of complexes I-IV, ATP-synthase and adenine nucleotide translocase (ANT). The nicotinamide adenine dinucle-otide (NADH) or 1,3-dihydro-flavine adenine dinucleotide (FADH2), pro-

14

duced during glycolysis and the tricarboxylic acid (TCA) cycle, serve as elec-tron donors to complexes I and II, respectively. These complexes share the same purpose, to transfer electrons to Coenzyme Q (CoQ). While complex I is responsible for the oxidation of NADH by CoQ, complex II, that contains succinate dehydrogenase (an enzyme from TCA cycle), catalyzes the oxida-tion of FADH2 by CoQ. Complex III oxidizes CoQ through cytochrome c and, finally, complex IV promotes the oxidation of the reduced cytochrome c by molecular oxygen (O2), which is the final electron acceptor. Through these oxidation processes, complexes I, III and IV shuttle protons (H+) from the mi-tochondria matrix to the intermembrane space, creating the electrochemical gradient used by the ATP-synthase to create ATP from ADP and Pi. The pro-duced ATP is thereafter exchanged from the mitochondria matrix into the in-termembrane space for ADP by the ANT (9).

Figure 2. Schematic representation the mitochondrial oxidative phosphorylation. Briefly,

NADH and FADH2, originating primarily form the Krebs cycle, donate electrons to complexes

I and II, respectively. Electrons are transported to complex III and further on to complex IV,

through sequential oxidations. During this process, protons are shuttled to the intermembrane

space creating the electrochemical gradient used by the ATP synthase to produce ATP from

ADP and Pi (inorganic phosphate). Adenine nucleotide translocator (ANT) transports ATP to

the intermembrane space in exchange for ADP. Production of ATP through oxidative phos-

phorylation is coupled to oxygen consumption, since oxygen is the final electron acceptor in

complex IV. Uncoupling proteins (UCP) can be activated by different factors, i.e. increased

membrane potential, and allow the passage of protons to the intermembrane space without pro-

duction of ATP.

Due to the role of oxygen as an electron acceptor, OXPHOS can only occur in the presence of oxygen. Hence, mitochondria ATP production is coupled to QO2, i.e. coupled respiration. Mitochondrial uncoupling, or leak respiration, refers to the QO2 occurring due to proton leak across the inner membrane via e.g. the ANT or uncoupling protein (UCP) (10-13). Uncoupling, or leak, does

15

not result in any production of ATP. In normal mitochondria, leak respiration accounts for about 15-20% of mitochondrial QO2. However, leak respiration can provide the mitochondrion some control over its own membrane potential. If the membrane potential is too high, i.e. if there is increased production of superoxide radicals, proton pumps are inhibited and there is a further increase in superoxide radicals production, initiating a vicious cycle that leads to ETC dysfunction (14-16). By increasing leak respiration, the mitochondrion can reduce the harmful membrane potential to levels that are optimal for electron transport through the different complexes. UCP-1, also known as thermog-enin, was the first UCP described, in brown adipose tissue, and it was associ-ated with non-shivering thermogenesis (17). Later, other isoforms were dis-covered, including UCP-2, which is the predominant isoform expressed in the kidney (18, 19).

Hypoxia-Inducible Factors Cellular hypoxia triggers activation of hypoxia-inducible factors (HIF) to fa-cilitate cell adaptation and survival (20). HIF is a heterodimer composed of HIF-α and HIF-β subunits, that binds to hypoxia-response elements (HRE) present in the DNA when activated (21). While HIF-β can be found in all cells, HIF-α subunit is continuously being degraded, under normoxic conditions (22). There are three known isoforms of HIF-α; HIF-1α, -2α and -3α (23) with different cellular and tissue expression patterns (21, 24, 25). Fig. 3 is a sche-matic representation of HIF-activation. There are three prolyl hydroxylase (PHD) isoforms (PHD1-3) (21) and all require oxygen, α-ketoglutarate and iron (II) for full catalytic activity. In the presence of oxygen, PHDs hydrox-ylate residues proline 402 and 564 of HIF-α subunit (26). The hydroxylated HIF-α is recognized by the on Hippel-Lindau (VHL) tumor suppressor gene, and targeted for proteasomal degradation (27-30). Under hypoxic conditions, and hence in the absence of oxygen, PHDs are not able to hydroxylate the HIF-α subunit, allowing the α- and β-subunits to form the active heterodimer that initiates gene activation via binding to HRE in the promotor sequence of hundreds of genes. HIF activation affects cells and tissue adaptation, including modulation of cellular energy metabolism, stimulation of angiogenesis and erythropoiesis (31-35). Due to this wide range of activity, HIF-activation can be both beneficial or detrimental, depending on the organ, the condition and the duration of the HIF-activation.

16

Figure 3. Schematic representation of oxygen-dependent degradation of hypoxia inducible fac-

tors (HIF). During normoxia, prolyl hydroxylases (PHD) hydroxylate proline residues of the

HIF-α subunit. The products are then recognized by the von Hippel-Lindau protein (VHL) and

targeted for proteasomal degradation. Since PHDs are oxygen dependent, during hypoxia they

remain inactive, allowing HIF-α and –β subunits to for an active heterodimer with the CREB-

binding protein/E1A binding protein p300. The active heterodimer binds to hypoxia responsive

elements (HRE) in the promotor sequence of hundreds of genes responsible for maintaining

cellular and tissue homeostasis and adaptation to an hypoxic environment.

Although hypoxia is the main mechanism for activation of HIF, non-hypoxic stimuli can also activate it (36-42). Different studies have shown that growth factors (36), cytokines (39), vascular hormones (40) and viral proteins (42) can induce HIF activation via increased HIF-α protein translation. This, in it-self, appears to alter the equilibrium between synthesis and degradation, lead-ing to increased HIF signaling (22). Nevertheless, this thesis will focus on HIF activation during tissue hypoxia.

17

Diabetes Mellitus and Diabetic Kidney Disease Type 1 diabetes mellitus, or insulinopenic diabetes mellitus, is a metabolic disease caused by insufficient glucose-induced insulin secretion. It usually de-velops at an early age, as a result of the destruction of pancreatic β-cells, due to autoimmune disorders or viral infections. Type 2 diabetes, or non-insulin-dependent diabetes, is characterized by a reduced sensitivity to insulin nor-mally, and usually has a later onset compared to type 1.

Hyperglycemia has serious detrimental effects, that in the long term, leads to vasculopathy, neuropathy and nephropathy, with increased risk of end-stage renal disease (ESRD) and cardiovascular disease and mortality.

In normal conditions, all filtered glucose is reabsorbed in the proximal tu-bule by the Na+/glucose-linked transporters. About 10-67% of type 1 diabetes patients and 6-73% of type 2 diabetic patients develop glomerular hyperfiltra-tion in an early stage (43). This might be due to 1) a saturation the Na+/glu-cose-linked transporters causing glycosuria and increased osmotic diuresis, and 2) increased proximal tubule reabsorption of Na+ together with glucose, reducing distal load of electrolytes and inactivation of the TGF mechanism (44). Histological alterations in the diabetic kidney include accumulation of extracellular matrix, thickening of glomerular basement membrane, loss of endothelial fenestration, loss of podocyte structure and tubulointersitial changes (45-47). In experimental models of insulinopenic diabetes, such al-terations have been linked to increased tubular workload and increased oxida-tive stress (45). Microalbuminuria is an early indication of diabetic kidney disease, and as the disease progresses GFR starts to decline, fibrosis develops and the initial microalbuminuria progresses to macroabluminuria and later proteinuria. About 45% of patients with diabetic kidney disease progress to ESRD requiring renal replacement therapy (48).

Diabetes and Hypoxia Diabetes leads to functional and morphological changes of the kidney that can cause intrarenal hypoxia (49, 50). The increased tubular Na+ load is one mech-anism by which QO2 increases (51). Also, it has been shown that diabetes causes mitochondria dysfunction via activation of mitochondrial leak respira-tion (52), also leading to increased mitochondrial QO2 and tissue hypoxia (53). Hypoxia has been acknowledge as a final common pathway to ESRD (54-56). Despite causing intrarenal hypoxia, hyperglycemia also hinders HIF-activa-tion (24, 57-59). It has been suggested that both hyperglycemia and oxidative stress cause posttranslational modification of E1A binding protein p300 (p300), which is an essential component of the active HIF heterodimer (59).It has also been reported that hyperosmolarity per se directly affects HIF activa-tion in dermal fibroblasts and endothelial cells (58). However, the beneficial

18

effects of HIF activation in the kidney is somewhat of a controversial issue. Several studies have reported renoprotective effect of HIF activation (60, 61), whereas other studies report that increased HIF signaling causes fibrosis (62) and proliferation of podocytes (63). Thus the currently available knowledge indicates that the effects of increased HIF signaling depend on the duration of HIF activation, cells in which HIF signaling was increased and experimental model used.

Aging and Kidney Function Aging is related to a slow decline in kidney function (64). Humans are esti-mated to have a gradual decrease in GFR of about 0.4-2.6 mL min-1 year-1 (65). Physiological alterations can include increased oxidative stress, altera-tions in the RAAS activity and loss of nephrons (65-69). Increased oxidative stress (70) increases the formation of advanced glycosylation end-products (AGE) and superoxide radicals. While the first can reduce HIF-1 activity (71), the latter can increase mitochondria leak respiration, altering the oxygen ho-meostasis in the kidney (53). Age-induced vascular dysfunction and increased renal vascular resistance impair RBF leading to decrease filtration pressure in glomerular capillaries and decreased GFR (72, 73). All of these alterations can negatively affect kidney oxygen homeostasis and increase the susceptibility of the aging kidney to irreversible damage.

19

Aim

The overall aim of this thesis was to advance our understanding about factors affecting kidney oxygen homeostasis in health and disease. For this purpose, different hypotheses were tested.

Study I We hypothesized that reduced dietary Na+ intake activates the RAAS and causes intrarenal tissue hypoxia.

Study II We hypothesized that increased HIF activation, by reducing PHD2 gene ex-pression genetically, protects mitochondria function and intrarenal oxygen ho-meostasis in a mouse model of type 1 diabetes.

Study III We hypothesized that kidney-specific activation of HIF, by genetic deletion of VHL, protects mitochondria function and intrarenal oxygen homeostasis in a mouse model of type 1 diabetes.

Study IV We hypothesized that global genetic deletion of UCP-2 protects mitochondria function in the ageing kidney, thus also protecting kidney function.

20

Methods

Animal Models All animals were housed in a controlled environment, with 12h light-dark cy-cles, controlled temperature and humidity. Rats and mice had water and chow ad libitum. All experiments were performed in accordance with the National Institutes Guidelines for Use and Care of Laboratory Animals and approved by the local Animal Care and Use Committee.

Study I Sprague-Dawley rats (Charles River, Sulzfeldt, Germany), 8-9 weeks old, were divided into two groups. The normal Na+ group received normal Na+ (0.25%) diet and the low Na+ group received low Na+ (0.025%) diet for 14 days. Later, about half the rats in each group received either intrarenal can-desartan, an AT1 receptor blocker, or canrenoic acid potassium salt (CAP), a mineralocorticoid receptor blocker. Therefore, at the end-point of the experi-mental setting there were four groups: normal Na+ diet with candesartan (n=13) and CAP (n=11) and low Na+ diet with candesartan (n=12) and CAP (n=9).

Rats were anesthetized with an intraperitoneal administration of thiobuta-barbital (120 mg kg-1) and placed on a heating pad to keep the core body tem-perature stable at 37°C. Rats were tracheostomized, to facilitate spontaneous breading and both left carotid artery and femoral vein were cannulated for continuous blood pressure measurement, blood collection and saline infusion (0.9% NaCl, 5 mL kg-1 h-1). Urine was drained through a catheter placed in the bladder. A subcostal flank incision was made in order to expose the left kidney and further immobilize it in a plastic cup. A catheter was placed in the left ureter for urine collection. A lumbar artery was then used to insert a cath-eter ~1-2 mm into the left renal artery, for precise intrarenal infusion. The placement of this catheter was confirmed with infusion of Lissamine green 10% solution. The rats were allowed to stabilize for 45 min before the start of the experimental period. Fig. 4 summarizes the experimental protocol. After the baseline measurement period, either candesartan (AstraZeneca, Mölndal, Sweden; 4.2 µg kg-1 in 200µL) or CAP (bolus 20 mg kg-1 in 200 µL) were

21

administrated. The first was slowly infused into the renal artery, for 10 min, while the latter was infused intravenously.

Figure 4. Summary of experimental design of Study I

Study II Global deletion of PHD2 is embryonically lethal (74) and a PHD2+/- model was therefore created by replacing exon 2 with a neomycin resistance cassette (75). This animal model was first developed and described Mazzone et al to study oxygen delivery, endothelial cell morphogenesis and vessel function in tumour biology (75). In our study, PHD2+/- and aged matched genetic controls were used and it has previously been shown that heterozygote PHD2 deletion causes a profound increased HIF-1α protein expression (76).

Four groups were used in this study: normoglycemic wild type (n=16), di-abetic wild type (n=10), normoglycemic PHD2+/- (n=16) and diabetic PHD2+/- (n=11). Diabetes was induced by low-dose intraperitoneal administration of streptozotocin (50 mg kg-1), for five consecutive days. Streptozotocin is an antimicrobial agent, that causes destruction of pancreatic β-cells, leading to insulinopenic diabetes mellitus (77). Multiple low-dose administration of streptozotocin is believed to mimic the pathogenesis of type 1 diabetes melli-tus, since it prompts an inflammatory response responsible for the destruction of the β-cells (78). Using this approach, mice presented with hyperglycemia about two weeks after the first injection of streptozotocin and studied about 5-6 weeks thereafter.

Study III VHL-/- male mice and aged matched male C57Bl/6J (wild type) were used in this study. Kidney specific genetic deletion of VHL was achieved by breeding Ksp1.3/Cre mouse (79) with the 2-lox allele, VHLhfl mouse (80). The result-ing VHL-/- mouse has shown lack of VHL mRNA and protein expression in

22

the renal tubules, mainly in the loop of Henle, distal tubule and collecting ducts, but not in the glomeruli and peritubular capillaries (79). VHL-/- mice have been reported to have a normal phenotype and kidney function, albeit having increased frequency of non-obstructive hydronephrosis. Nevertheless, these mice had no other morphological abnormalities (79).

Four groups were used: normoglycemic wild type (n=13), diabetic wild type (n=18), normoglycemic VHL-/- (n=19) and diabetic VHL-/- (n=11). Ani-mals were included in the study at 20-27 weeks of age and diabetes was in-duced similarly to study II.

Study IV Male UCP-2-/- mice and C57BL/6 (wild type) littermates used in this study. UCP-2-/- mice (B6.129S4-Ucp2tmLowl/J, stock no.005934) were originally purchased from Jackson Laboratories and continuously bread at the animal facilities of Uppsala University (Uppsala, Sweden). This UCP-2-/- mouse model was created by inserting a PGK-NEO cassette to replace exons 3-7 of the gene, on a C57BL/6 background (81). Animals were kept for approxi-mately two years, before the start of experiments.

Evaluation of Kidney Function General Parameters In Study I, a transducer (model P23dB; Statham Laboratories, Los Angeles, CA, USA) connected to the catheter in the left carotid artery was used to meas-ure blood pressure, while RBF was measured with an ultrasound probe (Tran-sonic Systems Inc., Ithaca, NY, USA) placed around the left renal artery. These parameters were recorded continuously with a Power Lab instrument (AD Instruments, Hastings, UK) connected a computer. Measurement of Glomerular Filtration Rate (GFR) In Study I, GFR was estimated, in anaesthetized rats, by inulin clearance (185 kBq kg-1 h-1 of 3H-Inulin, American Radiolabeled Chemicals, St. Louis, MO, USA).

In Studies II, III and IV, GFR was assessed in awake mice, by clearance of fluorescein isothiocyanate (FITC)-inulin (2%, dissolved in phosphate buffer saline (PBS)). Briefly, circa 200 µL were administered intravenously and blood samples were collected at specific time points after injection. Care was taken to weight the syringe used to administered FITC-inulin pre and post in-jection. In a 384-well black plate 2 µL sample/standard/blank were added to 68 µL 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer

23

(500 mmol L-1 in PBS at pH 7.4) and FITC fluorescence (496/520 nm excita-tion/emission) was measured in Tecan Safire 2 (Tecan Group, Männedorf, Switzerland). GFR was estimated using non-compartmental pharmacokinetic data analysis (82, 83). Urinary Excretion of Electrolytes, Protein and Albumin In all studies, urine volume was determined gravimetrically. The urine con-centration of Na+ was measured by flame spectrophotometry (model IL543; Instrumentation Lab, Milan, Italy). In Study I, tubular transported of Na+ was calculated using the following equation: TNa=[PNa]*GFR-[UNa]*Urine flow, where [PNa] is the concentration of Na+ in the plasma and [UNa] is the concen-tration of Na+ in the urine.

Urinary protein concentration was determined by the Lowry method, using the DC Protein Assay (BioRad Laboratories, Hercules, CA, USA). Albumin concentration in the urine was measured with an ELISA kit (R&D Systems, Minneapolis, MN, USA), according to manufacturer’s instructions.

Results are expressed per min (Study I) or per 24h (Studies II, III and IV).

Measurement of Oxygen Handling in the Kidney In Studies I and II, kidney tissue PO2 was assessed both in cortex and medulla, with modified Clark-type oxygen microelectrodes (Unisense, Aarhus, Den-mark). Air (PO2=147 mmHg) and a water solution saturated with Na2S2O5 (PO2=0 mmHg) where used to perform a two-point calibration. A microma-nipulator was used to help keep the electrode stable and at the right depth for the regional measurement. Cortical PO2 was measured at 1 mm depth in both Study I and II and medullary PO2 was measured at 4 mm depth in Study I and 2 mm depth in Study II. Rats were under Inactin anesthesia (Study I) during this procedure, and mice were under isoflurane anesthesia (1-5% in medical air) (Study II).

Oxygen delivery to the kidney was calculated as arterial content of O2 mul-tiplied by RBF and kidney QO2 was obtained by the product of the arterio-venous difference in oxygen content and RBF.

Evaluation of Mitochondria Function Mitochondrial Isolation Isolation of mitochondria was performed immediately after kidney removal. Cortex was dissected on ice, placed on a glass homogenizer (Potter Elvehjem)

24

and homogenized, at 800 rpm, in cold isolation buffer (250 mmol L-1 sucrose, 10 mmol L-1 HEPES, 1 mmol L-1 ethylene glycol-bis(β-aminoethyl ether)-N,N,N′,N′-tetraacetic acid (EGTA), 1 g L-1 bovine serum albumin (BSA) with pH 7.4 adjusted with KOH. The homogenate was centrifuged for 10 min, at 700g (+4°C) and the supernatant divided between three 1.5 mL tubes before further centrifugation at 10,000g for 10 min (+4°C). The buffy coat was re-moved from the pellet, by gently washing with isolation buffer and, after re-suspension, the samples were pooled and centrifuged one more time at 7000g, for 5 min (+4 °C). Another washing step followed before resuspension of the pellet in 1 μL of preservation medium/mg initial tissue weight (84). The mi-tochondrial suspension was stabilized on ice for 30 min before the experi-ments. High Resolution Respirometry Mitochondria function was assessed by high-resolution respirometry, using a 2-channel respirometer (Oxygraph 2k; Oroboros, Innsbruck, Austria). The chambers were kept at a constant temperature of +37°C, and filled with respi-ration medium (0.5 mmol L-1 EGTA, 10 mmol L-1 KH2PO4, 20 mmol L-1 HEPES, 110 mmol L-1 sucrose, 3 mmol L-1 MgCl2 6H2O, 60 mmol L-1 K-lactobionate, 20 mmol L-1 taurine, and 1 g L-1 BSA). The Oxygraph utilizes Clark-type electrodes to measure oxygen dissolved in the respiration medium, and a background correction was performed to control for the constant, but low, QO2 by the electrodes and any potential oxygen diffusion out of or into the respiration medium (85). Data was acquired with DatLab7 (Oroboros).

Complexes I+II mediated state 3 respiration was supported by the addition of pyruvate (5 mmol L-1), malate (2 mmol L-1), complex I electron donors, and succinate (5 mmol L-1), complex II electron donor, in the presence of saturated levels of ADP. Mitochondria total leak respiration was measured in the pres-ence of pyruvate, malate and oligomycin (25 µmol L-1 to block the ATP syn-thase). Respiratory control ratio (RCR) was calculated as the ratio between complex I mediated state 3 and state 2 respiration (measured in the presence of substrates, but lack of adenylates). Guanosine diphosphate (GDP; 2 mmol L-1, to inhibit UCP activity) was added in order to assess the UCP-mediated leak respiration and ANT-mediated leak respiration was measured after addi-tion of carboxyatractylocide (CAT; 5 μmol L-1, to inhibit ANT activity). Reg-ulated leak respiration was defined as the sum of UCP- and ANT-mediated leak respiration and unregulated leak respiration was determined by subtract-ing mediated leak respiration to the total leak respiration. All values presented were normalized to mitochondrial protein as determined using the DC Protein Assay (BioRad Laboratories).

25

Gene Expression and Quantification of Angiotensin II Tissue Collection In Study I, additional control (n=10) and low Na+ (n=10) rats were anesthe-tized (Inactin, 120 mg kg-1 i.p.) and ice-cold saline solution was infused through the heart. To wash the kidneys before extraction, the renal vein was cut open. The left kidney was collected for angiotensin II extraction and quan-tification while the right kidney was dissected and stored in RNAlater (Am-bion, ThermoFisher Scientific, Waltham, MA, USA) or snap frozen in liquid nitrogen.

In Studies II and III, the right kidney was extracted after the acute experi-ment and a section of the kidney cortex was stored in RNAlater. Angiotensin II Extraction and Quantification (Study I) Extraction of angiotensin II from renal tissue was performed as previously described (86). Briefly, the left kidney was weighed, homogenized in cold methanol (10% wt/vol) and stored at -80°C. Before extraction, the samples were thawed, centrifuged for 10 min (+4°C) and dried in a vacuum centrifuge overnight. PBS (50 mmol L-1, pH 7.4) was used to reconstitute the dried resi-due. A phenyl-bounded solid phase extraction column (Discovery® DSC-Ph SPE Tube, Sigma Aldrich) was conditioned with methanol and equilibrated with water before adding the reconstituted samples. After washing, a solution of 90% methanol in water was used to elute the angiotensin II from the col-umn. The samples were dried under vacuum and angiotensin II was deter-mined using the Angiotensin II EIA kit (Peninsula Laboratories Inc., San Car-los, CA, USA) in accordance with the manufacturer’s instructions. RNA Extraction and Quantitative Polymerase Chain Reaction In Study I, kidney cortex sections were thawed, RNAqueous®-4PCR (Am-bion) was used for RNA extraction and iScript cDNA Synthesis Kit (BioRad Laboratories, Hercules, CA, USA) was used to synthesizes cDNA. cDNA lev-els were then evaluated by real time quantitative polymerase chain reaction (PCR), using the iCycler PCR system (Hoffmann-La Roche, Basel, Switzer-land). In short, amplification reactions contained 2 µL cDNA, 2 µL Mix (LightCycler® FastStart DNA Master SYBR Green I; Hoffmann-La Roche), 2.5 µL primers mix and 3.5 µL of water.

In studies II and III, 20-30 mg of tissue were used to extract RNA, with RNeasy® Mini Kit (Qiagen, Strasse, Germany), following manufacturer’s in-structions. DNase I (Thermo Fisher Scientific, Vilnius, Lithuania) treatment followed, before reverse transcription to cDNA, with High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Warrington, UK). SYBR®

26

Green PCR Master Mix was used for the amplification executed using QuantStudio 5 (Applied Biosystems). The β-actin (Studies I, II and III) was used as housekeeping gene. Results are presented as 2-∆ΔCt relative to the con-trol group. Primers are listed on table 1. Table 1. List of primers

BNIP3 - BCL2 and adenovirus E1B 19-kDa-interacting protein 3; NHE3 - Na+/H+ exchanger 3

(Slc9a3); PGK1 - phosphoglycertate kinase 1; PHD2 – prolyl hydroxylase 2.

Statistics Statistical analysis in all studies were performed using Graph Pad Prism (GraphPad Software, San Diego, CA, USA). Two-way ANOVA was used to determine differences between groups, followed by Fisher’s Least Significant Difference post hoc test, in Studies I, II and III. Unpaired student’s t-test was used in Study IV. A p-value less than 0.05 was considered statistically signif-icant.

Gene Forward primer Reverse primer Study

BNIP3 AACAGCACTCTGTCTGAGG CCGACTTGACCAATCCCA II

NHE3 AGTGGTCCAATTTTGATAGG GACCATATTGTCCGTACTTG I

PGK1 ATTCTGCTTGGACAATGGAGC AGGCATGGGAACACCATCA III

PHD2 GGGCAACTACAGGATAAACGG CTCCACTTACCTTGGCGT II

β-actin AAGACCTCTATGCCAACAC TGATCTTCATGGTGCTAGG I

β-actin CAGCTTCTTTGCAGCTCCTT AGGAGTCCTTCTGACCCATTC II&III

27

Results

The Effect of Low Na+ Diet on Kidney Oxygen Homeostasis (Study I) Rats on a low Na+ diet for 14 days have similar MAP compared to rats on a normal Na+ diet (Fig. 5). However, reduction of Na+ intake caused increased QO2 in the kidney (Fig. 6) and decreased TNa efficiency, manifested as de-creased TNa/QO2 (Fig. 7).

Figure 5. Mean arterial blood pressure during baseline in rats given a normal Na+ or low Na+ diet.

Rats in the low Na+ group had increased intrarenal tissue concentration of an-giotensin II compared to the normal Na+ group (22.3 ±3.0 vs 32.8±3.6, respec-tively; p<0.05). However, relative mRNA expression of Na+/H+ exchanger isoform 3 (NHE3) were similar in both groups (1.05±0.10 vs 0.96±0.10; NS).

Figure 6. Oxygen consumption during baseline in rats given a normal Na+ or low Na+ diet.

Figure 7. Transport of Na+ per oxygen con-sumption (QO2) during baseline in rats given a normal Na+ or low Na+ diet.

28

Rats in the low Na+ group had a shift in the normal cortico-medullary tissue PO2 gradient, with reduced tissue PO2 in the cortex and increased tissue PO2 in the medulla (Fig. 8A and B).

Figure 8. Cortical (A) and medullary (B) partial pressure of oxygen during baseline in rats given a normal Na+ or low Na+ diet.

The Differential Effect of Angiotensin II and Aldosterone on Kidney Oxygen Homeostasis (Study I) Administration of candesartan, an AT1 receptor inhibitor, increased RBF in both groups (Fig.9). Similarly, oxygen delivery rate was also increased in all rats that received candesartan (Fig. 10). These changes appeared to be inde-pendent of the dietary Na+ intake. Candesartan administration increased QO2 in the normal Na+ group only (Fig. 11), but increased cortical PO2 in the low Na+ group to values similar to those observed for the baseline of the normal Na+ group (Fig.12).

Figure 9. Renal blood flow in rats on normal or low Na+ diet, during baseline and after angiotensin II type 1 (AT1) re-ceptor blockade using candesartan.

29

Administration of CAP, a mineralocorticoid receptor blocker, did not cause any changes to RBF or oxygen delivery (Fig. 13A and B). However, it altered kidney QO2 of both rats receiving normal Na+ diet as well as those receiving a low Na+ diet. CAP increased QO2 in normal Na+ diet rats, but reduced QO2 of low Na+ diet rats to the same level as that seen in baseline of normal Na+ rats (Fig. 14).

Figure 13. Renal blood flow (A) and oxygen delivery rate (B) in rats on normal or low Na+ diet, during baseline and after angiotensin II type 1 (AT1) receptor blockade using candesartan.

Figure 10. Oxygen delivery in rats on nor-mal or low Na+ diet, during baseline and after angiotensin II type 1 (AT1) receptor blockade using candesartan.

Figure 11. Oxygen consumption in rats on normal or low Na+ diet, during baseline and after angiotensin type 1 (AT1) recep-tor blockade using candesartan.

Figure 12. Cortical partial pressure of ox-ygen in rats on normal or low Na+ diet, during baseline and after angiotensin type 1 (AT1) receptor blockade using candesar-tan.

30

The Effects of Reduction in Prolyl Hydroxylase 2 on Mitochondria Function (Study II) Normoglycemic PHD2+/- rats had a reduction of PHD2 in the kidney of almost 50%. Induction of diabetes further reduced expression of PHD2 both in normoglycemic as well as in PHD2+/- mice (Fig.15).

Diabetic wild type mice also had increased mitochondria leak respiration, when compared to normoglycemic wild type mice (Fig. 16A). While regulated leak respiration was increased in diabetic PHD2+/- mice, compared to normo-glycemic PHD2+/- mice (Fig. 16B), diabetic wild type mice had increased un-regulated leak respiration, compared to normoglycemic wild type mice (Fig. 16C). Further, UCP-dependent leak respiration was similar in all four groups, however diabetic wild type and PHD2+/- mice had increased ANT-dependent leak respiration when compared to normoglycemic mice (Figs. 16D and E). Also, BCL2 and adenovirus E1B 19-kDa-interacting protein 3 (BNIP3) was increased in normoglycemic PHD2+/- mice compared to normoglycemic wild

Figure 14. Oxygen consumption in rats on normal or low Na+ diet, during base-line and after aldosterone mineralocorti-coid receptor (MR) blockade, using canrenoic acid potassium salt.

Figure 15. mRNA levels of prolyl hydrox-ylase 2 (PHD2) in kidney of wild type and PHD2+/- mice with and without streptozoto-cin-induced diabetes.

31

type mice (1.2±0.1 vs 1.0±0.1, respectively; p<0.05), an indication of in-creased HIF-activation in the PHD2+/- mice.

Figure 16. Mitochondrial leak respiration from mitochondria extracted from kidney cortex of wild type and PHD2+/- mice with and without streptozotocin-induced diabetes. (A) Total leak respiration, (B) total regulated leak respiration, (C) total unregulated leak respiration, (D) Un-coupling protein (UCP) mediated leak respiration, (E) Adenine nucleotide translocator (ANT) mediated leak respiration total unregulated leak respiration.

32

The Effects of Reduction in Prolyl Hydroxylase 2 on Kidney Function (Study II) Diabetic wild type mice had decreased cortical tissue PO2 compared to normo-glycemic wild type mice, while diabetic PDH2+/- maintained a similar cortical tissue PO2 compared to normoglycemic PHD2+/- mice (Fig. 17). Albuminuria was increased in both diabetic wild type and diabetic PHD2+/- mice compared to the normoglycemic mice (Fig. 18).

The Effects of Kidney-Specific Deletion of von Hippel-Lindau on Mitochondria Function (Study III) Diabetes caused a decrease in RCR only in diabetic wild type mice. On the other hand, normoglycemic VHL-/- mice presented reduced RCR compared to normoglycemic wild type mice (Fig. 19). In general, VHL-/- mice had reduced complexes I+II mediated state 3 respiration (Fig. 20). Also, PGK1 was in-creased in diabetic VHL-/- mice, compared to normoglycemic VHL-/- mice (1.54±0.14 vs 1.14±0.11, respectively; p<0.05).

Figure 17. Cortical partial pressure of oxy-gen of wild type and PHD2+/- mice with and without streptozotocin-induced diabetes.

Figure 18. Urinary excretion of albumin in wild type and PHD2+/- mice with and without strep-tozotocin-induced diabetes.

Figure 19. Respiratory control ratio of mito-chondria from wild type and VHL-/- mice with and without streptozotocin-induced di-abetes.

33

Mitochondria leak respiration was in general lower in VHL-/- mice than in wild type mice (Fig. 21A). Regulated leak respiration was decreased in diabetic VHL-/- mice, compared to diabetic wild type mice (Fig. 21B). There were no changes in unregulated leak respiration (Fig. 21C). VHL-/- mice have shown, in general, a lower UCP-dependent and ANT-dependent leak respiration (Fig. 21D and 21E) and diabetic VHL-/-mice have a lower ANT-dependent leak res-piration compared to diabetic wild type mice.

Figure 20. Complexes I+II mediated state 3 respiration of mitochondria from wild type and VHL-/- mice with and without strepto-zotocin-induced diabetes.

34

Figure 21. Mitochondrial leak respiration in kidney cortex of wild type and VHL-/- mice with and without streptozotocin-induced diabetes. (A) Total leak respiration, (B) total regulated leak respiration, (C) total unregulated leak respiration, (D) Uncoupling protein (UCP) mediated leak respiration, and (E) Adenine nucleotide translocator (ANT) mediated leak respiration total un-regulated leak respiration.

The Effects of Kidney-Specific Deletion of von Hippel-Lindau on Kidney Function (Study III) Albuminuria was only increased in diabetic wild type mice compared to normoglycemic wild type mice (Fig.22).

35

The Effect of Aging and UCP-2 Deletion on Mitochondria and Kidney Function in Healthy Mice (Study IV) Mitochondria from kidneys of UCP-2-/- mice had increased respiratory control ratio (Fig. 23). Although GFR was similar in the two groups (Fig. 24), UCP-2-/- mice had lower proteinuria when compared to wild type mice (Fig 25).

Figure 22. Urinary excretion of albumin in wild type and VHL-/- mice with and without strepto-zotocin-induced diabetes.

Figure 23. Respiratory control ratio of kid-ney mitochondria from 2-year old wild type and UCP-2-/- mice.

Figure 24. Glomerular filtration rate of 2-year old wild type and UCP-2-/- mice.

36

Figure 25. Urinary excretion of protein of 2-year old wild type and UCP-2-/- mice.

37

Discussion

The main aim of this thesis was to advance our understanding regarding the mechanisms controlling renal oxygen homeostasis in health and disease. To do so, we studied the relationship between reduced Na+ intake and RAAS ac-tivation, two different experimental models of genetic HIF activation in dia-betes, and the role of mitochondrial leak respiration for age-related decline in kidney function, utilizing global deletion of UCP-2.

Low Na+ intake is recommended to patients at a high risk of cardiovascular disease in order to control blood pressure and, thus, reduce the risk for inci-dence of cardiovascular disease and stroke. Although the negative effects of high Na+ diet on blood pressure and cardiovascular diseases are well known (87), it is still an ongoing debate regarding the beneficial effects of reduced dietary Na+ intake (87-90). In Study I, 90% reduction of dietary Na+ intake for two weeks did not reduce arterial blood pressure, but did alter the renal oxygen homeostasis. In order to preserve electrolyte and water balance, urinary excre-tion of electrolytes and volume should somewhat match intake. Rats receiving low Na+ diet had decreased TNa/QO2 and increased kidney QO2 due to com-pensatory activation of RAAS, as evident from increased intrarenal tissue lev-els of angiotensin II. Frindt et al. recently reported that restricted Na+ intake results in increased tubular Na+ reabsorption in the proximal tubule and sub-sequently decreased Na+ load to the more distal parts of the nephron (91). Also, in a previous study by Riquier-Brison and colleagues, activation of an-giotensin AT1 receptors resulted in recruitment of NHE3 and Na+-Pi co-trans-porter 2, allowing for increased tubular transport of Na+ (92). This can explain why, in Study I, rats on low Na+ had increased tubular Na+ reabsorption de-spite unchanged gene expression of NHE3.

Rats on low Na+ diet had inverted cortico-medulary PO2 gradient. This was originally reported by Stillman et al., where chronically salt depleted rats de-veloped cortical hypoxia and medullary hyperoxia (93). They also observed that salt depleted rats had reduced mTAL mass, which could partially explain the increased medullary PO2.

In order to better understand the role of RAAS activation, the possible in-volvement of angiotensin II acting on AT1 receptors was studied by adminis-tering candesartan, and the possible effects of increased aldosterone signaling was studied by administration of CAP to block mineralocorticoid receptors.

38

Activation of the angiotensin AT1 receptor can influence Na+ reabsorption di-rectly and indirectly. It can activate NHE3 to stimulate Na+/H+ exchange in the proximal tubule (94), promote Na+/K+-ATPase activity (95), and increase Na+/HCO3 co-transport (94). Angiotensin II signaling via AT1 receptor causes vasoconstriction of the efferent arteriole, resulting in increased ne filtration pressure in glomerular capillaries and increased tubular Na+ load. The in-creased tubular Na+ load in combination with a direct stimulation of proximal reabsorption increase proximal tubular transport and, thus, also QO2 in this region of the kidney. In Study I, inhibition of angiotensin AT1 receptors in-creased RBF and oxygen delivery regardless of Na+ intake. Interestingly, QO2 remained unchanged in the low Na+ group, but increased in the normal Na+ group. This effect on the normal Na+ group might be due to redirection of Na+ reabsorption to distal parts of the tubule, where TNa is less efficient. A similar observation was reported by Leong and colleagues, where administration of captopril, to inhibit angiotensin II production by ACE, decreased Na+ reab-sorption in the proximal tubule, although GFR and blood pressure were un-changed. This was at least in part attributed to reduction of NHE3 in the prox-imal tubule (96). Since there was already a shift of Na+ transport to less effi-cient parts of the tubule in the low Na+ group, inhibition of angiotensin sig-naling via AT1 receptors did not have further effect on kidney QO2 in our study. However, it is important to notice that the increased oxygen delivery in the low Na+ group restored cortical PO2 values close to those of the control group, indicating a potent role of oxygen delivery to maintain oxygen home-ostasis.

Inhibition of aldosterone signaling, by inhibiting mineral corticoid receptor activation, on the other hand did not affect RBF, or oxygen delivery to the kidney. It did, however, reduce kidney QO2 during Na+ restriction. This is an indication that increased QO2 in response to reduced dietary Na+ intake is caused by increased aldosterone signaling. Indeed, it has been reported that plasma aldosterone levels and ENaC activity increase in Na+ depleted rats (97). Furthermore, aldosterone mineralocorticoid receptor activation is im-portant for Na+ conservation during low Na+ intake (98).

In summary, low Na+ diet increases QO2, reduces TNa/QO2, and conse-quently alters the normal cortico-medulary PO2 gradient. Angiotensin II acti-vation of AT1 receptors is mainly affecting RBF and oxygen delivery to pro-tect cortical PO2 during dietary Na+ restriction. Aldosterone signaling via min-eralocorticoid receptors mainly affects kidney QO2 and the shift of Na+ reab-sorption to more distal and less efficient parts of the nephron.

Diabetes alters kidney oxygen homeostasis via a combination of increased oxidative stress, increased tubular load due to the initial glomerular hyperfil-tration and mitochondrial dysfunction (49, 99, 100). As a consequence, in-trarenal tissue hypoxia develops early on after the onset of diabetes (101). De-spite the hypoxic environment, hyperglycemia per se prevents effective HIF

39

activation (24, 57, 59). In Study II, a circa 50% reduction in kidney levels of PHD2 was associated with protected mitochondria function in a mouse model of insulinopenic diabetes. Interestingly, diabetes per se decreased PHD2 lev-els, both in wild type as in PHD2+/- mice, which may be a mechanism to coun-teract the direct negative effect of hyperglycemia on hypoxic HIF activation.

Diabetic wild type mice had increased total mitochondria leak respiration, which was prevented by the increased HIF signaling in the diabetic PHD2+/- mice. Interestingly, diabetic wild type mice had predominantly unregulated leak, whereas diabetic PHD2+/- mice had mainly regulated leak. Mitochondria leak respiration is an important defense mechanism to regulate mitochondria membrane potential and limit production of harmful superoxide radicals. It has been shown in previous studies that UCP-2 is upregulated in the kidney of diabetic mice (52) and UCP-2-/- mice were partially protected against diabetic kidney disease (102). UCPs are mainly activated by increased levels of super-oxide radicals (11) and UCP-dependent leak respiration can be prevented by antioxidant treatment (103). In Study II, there were no difference between groups with regards to UCP-dependent leak respiration. However, ANT-de-pendent leak was increased in both diabetic groups independent of HIF activ-ity. This might be explained by the prolonged hyperglycemia. A study by Car-doso and colleagues has shown that ANT-mediated mitochondria leak respi-ration is the predominant mechanism during prolonged hyperglycemia (104).

Mitochondria are highly sensitive to increased HIF activity. Zhang et al. reported that HIF activation induces mitochondria autophagy. The mechanism was identified to involve increased BNIP3 expression, which disrupted the interactions between B-cell lymphoma 2 (Bcl2) and Beclin-1 (105). Mito-chondria autophagy is important to remove dysfunctional and damaged mito-chondria in order to protect normal function. The increased gene expression of BNIP3 observed in Study II supports the hypothesis that diabetic wild type mice have a higher number of dysfunctional mitochondria, which would ex-plain the increased unregulated mitochondrial leak respiration. Indeed, in-creased mitochondria leak respiration is associated with increased total kidney QO2 (52) and intrarenal tissue hypoxia (53). Protected mitochondria function in diabetic PHD2+/- mice with increased HIF signaling can help explain the improved cortical tissue oxygenation in these animals. However, this does not appear sufficient to prevent the development of diabetic kidney disease, as seen by the increased albuminuria in both diabetic groups. Several studies have demonstrated the beneficial effects of pharmacological PHD inhibition for preserving kidney function in diabetes (60, 61). However, the magnitude of HIF activation was likely several fold higher in these studies compared to what was achieved using or genetic approach. Nevertheless, the results from Study II demonstrate that also a seemingly insignificant increase in HIF activ-ity has positive effects on mitochondria function in the diabetic kidney.

40

In Study III, we used a mouse model of kidney-specific VHL-/- to selec-tively increase HIF activation in the kidney. Much like what was observed in Study II, mitochondria function in the diabetic kidney was protected by in-creased HIF signaling. RCR, as an indication of mitochondria efficiency, was significantly reduced in diabetic wild type mice and prevented by kidney-spe-cific HIF activation. Another mechanism by which HIF activation can im-prove mitochondria function during hypoxia, is through promoting a shift from aerobic to anaerobic metabolism (106-108). In order to promote cell sur-vival, HIF-1α regulates the shunting of glucose from the TCA cycle, thus re-ducing mitochondria workload and QO2 (106). These previous reports to-gether with the finding that inhibition of mitochondria QO2 is dependent on HIF activation (107), highlight the possibility that increased HIF activity in the VHL-/- mice inhibit complex I and II-mediated mitochondrial respiration regardless of the glycemic status. Furthermore, increased expression of phos-phoglycerate kinase 1 (PGK1), a pyruvate dehydrogenase inhibitor, in diabetic VHL-/- mice indicates that pyruvate is shunted away from the TCA cycle and the mitochondria. VHL-/- mice had lower total mitochondria leak respiration, which was predominately due to lower regulated leak respiration. This may indicate a smaller fraction of dysfunctional mitochondria in these animals. Im-portantly, while diabetic wild type mice developed albuminuria, an early in-dication of kidney disease, diabetic VHL-/- mice did not. Therefore, the results from Study III provide additional support for a beneficial effect of increased HIF activity in the diabetic kidney, and that the protective mechanism involves protected mitochondria function and maintained oxygen homeostasis.

Friederich-Persson and colleagues have previously demonstrated the im-portance of increased mitochondrial QO2, due to increased mitochondria leak respiration, for the development of intrarenal hypoxia and development of kid-ney disease (14). During normal conditions, mitochondria leak respiration ac-counts for only for a fraction of total mitochondria QO2. However, in patho-logical conditions such as diabetes, increased production of superoxide radi-cals directly affects kidney oxygen homeostasis. As previously mentioned, UCPs are proteins mediating proton leak across the inner mitochondria mem-brane. UCP-2 is the main isoform expressed in kidneys (19), and protein leak via UCP-2 is activated by superoxide radicals from the matrix side (11, 109).

Aging is normally associated with a slow decline in kidney function (64, 110) and increase in oxidative stress (68, 111). In Study IV, two-year old UCP-2-/- mice had similar GFR to that of aged-matched wild type mice. How-ever, UCP-2-/- mice had increased mitochondria efficiency, indicated by higher RCR, and reduced urinary protein excretion. The protective effects of UCP-2 deletion on mitochondria efficiency is likely to protect oxygen home-ostasis, which provides further support for positive effects of maintaining ox-ygen metabolism also in otherwise healthy, by ageing kidneys. However, a limitation of this study is that C57BL/6 mice are known to be very resistant to

41

kidney disease, and it is possible that the effects of the genetic intervention might have been significantly larger if using a more damage-prone mouse strain. In a previous study, Franzén and colleagues evaluated four different mouse strains in regards to their susceptibility to develop diabetic kidney dis-ease. It was demonstrated that Balb/C, NMRI and 129S mouse strains all de-velop more profound indications of diabetic kidney disease compared to the most commonly used C57BL/6 mouse strain (112). Nevertheless, our results suggest that improvement in mitochondria efficiency by preventing UCP-2-mediated mitochondrial inefficiency has positive effects on oxygen homeo-stasis and function in the ageing kidney.

42

Conclusions

Study I Low dietary Na+ intake impairs kidneys oxygenation due to RAAS activation. Angiotensin II signaling via AT1 receptors have major impact in oxygen de-livery, while aldosterone signaling has a major impact on QO2. Study II Activation of HIF, through reduction of PHD2, protects mitochondria function in type 1 diabetic mice. This, in turn, protects cortical oxygen homeostasis in this disease model. Study III Kidney specific deletion of VHL protects mitochondria function in type 1 di-abetes mouse model. Study IV Deletion of UCP-2 protects mitochondria efficiency and kidney function in aged mice.

43

Popular Scientific Summary

The kidneys are important organs with different main function, such as regu-lation of blood pressure, reabsorption of important electrolytes and molecules, excretion of waste products and drug, and regulation of acid-base balance. Usually, when tissue oxygen levels decrease (hypoxia) there is an increase of oxygen supply, i.e. increased blood flow. However, in the kidneys, an in-creased renal blood flow would increase the amount of plasma filtered per unit of time (glomerular filtration rate). Sodium transport along the tubule requires energy consumption. The main energy source in our cells are the mitochon-dria, which require oxygen to produce energy in the form of ATP. Therefore, if glomerular filtration increases, more sodium needs to be transported, more energy is needed and, consequently, more oxygen is utilized, worsening the tissue hypoxia. In healthy kidneys, a few mechanisms help to keep the glo-merular filtration rate constant. Fast mechanism can act on the arterioles trans-porting blood into the glomeruli, protecting the glomeruli from fluctuations in mean arterial blood pressure, while slower acting mechanisms activate pro-duction and release of different hormones, through activation of the renin-an-giotensin-aldosterone system, that can regulate blood pressure and sodium and electrolyte reabsorption. Since kidney tissue hypoxia can lead to kidney dam-age, it was the main aim of this thesis to improve our understanding regarding factors involved in the kidney oxygen homeostasis in disease and health.

In the first study, a low sodium diet was given to otherwise healthy rats. Usually patients with a high risk for cardiovascular diseases are advised to reduce their sodium consumption, in order to help reduce blood pressure. We observed that a drastic reduction of sodium intake, for two weeks, did not change blood pressure, but increased kidney tubular workload leading to cor-tical hypoxia. This is due to the action of the renin-angiotensin-aldosterone system. When specialized cells in the distal tubule sense a decrease of sodium, renin is released and angiotensin II is produced. This hormone can induce vas-oconstriction, increase sympathetic activity, aldosterone production, water re-absorption and sodium and chloride reabsorption. All of these effects lead to an increase in blood pressure. In this study, angiotensin II activity through angiotensin II type 1 receptor mainly mediated renal oxygen delivery, while aldosterone mainly affected intrarenal oxygen consumption.

44

In Studies II and III, the effect of chronical activation of hypoxia-inducible factors (HIF) was studied, in type 1 diabetes mouse model. HIF are transcrip-tion factors, activated during hypoxia, that promote cell adaptation and sur-vival. HIF is composed by two subunits, HIF-α and HIF-β. During normal conditions, HIF-α subunit is constantly being degraded, by undergoing hy-droxylation by prolyl hydroxylases (PHDs) allowing HIF-α to be targeted by von Hippel-Lindau (VHL) protein for proteasomal degradation. Since PHDs require oxygen to function, during hypoxia the α- and β-subunit are able to bind, forming an active heterodimer. Diabetes can lead to intrarenal hypoxia, due to increased tubular workload and increased oxidative stress. However, it can also negatively impact on HIF-activation. In Study II and III, a prolyl hy-droxylase heterozygote model and a kidney specific von Hippel-Lindau knockout model were used, respectively. Both studies shown that promoting HIF activation during diabetes increased mitochondria efficiency, thus reduc-ing intrarenal oxygen consumption.

Aging is usually associated with a gradual decline in renal function, as seen by the progressive loss of glomerular filtration rate. Aging is also associated with increased oxidative stress. Oxidative stress can affect mitochondria, de-creasing its efficiency (by affecting the membrane potential), thus increasing the amount of oxygen spent in energy production. As a protective mechanism, uncoupling proteins are activated. These proteins can help restore the mem-brane potential of the mitochondria, by allowing the passage of protons across the mitochondria inner membrane. Since this process still consumes oxygen, but does not lead to energy production, it is called mitochondria leak respira-tion. While defending the mitochondria from oxidative stress, mitochondria leak respiration also increases mitochondrial oxygen consumption. This can have a negative impact in intrarenal oxygen homeostasis. In Study IV, the ef-fects of aging were studied in healthy UCP-2 knockout mice. Although there were no differences in functional changes, mitochondria in UCP-2 knockout mice was more efficient, probably leading to the reduced urinary protein ex-cretion observed in these mice.

Overall, this thesis presents new data regarding the importance of main-taining oxygen homeostasis in the kidneys.

45

Sumário

Os rins exercem diferentes funções, como regulação da pressão arterial, reabsorção de electrólitos e moléculas importantes, excreção de subtâncias e moléculas residuais e fármacos, e regulação do equilíbrio ácido-base. Normalmente, quando há uma redução dos níveis de oxigénio num tecido (hipóxia), há um aumento do fluxo sanguineo como resposta, que leva ao aumento da quantidade de plasma filtrada por unidade de tempo (taxa de filtração glomerular). O transporte de sódio, ao longo dos tubulos requer energia sob a forma de adenosina trifosfato (ATP). A principal fonte de energia das células são as mitocondrias. Estas consomem oxigénio para produzir ATP. Desta forma, se a taxa de filtração glomerular aumenta, o transporte de sódio nos tubulos aumenta, sendo necessária a presença de mais ATP, havendo um maior consumo de oxigénio. Consequentemente, há um agravamento da hipóxia. Existem mecanismos diferentes para proteger o glomérulo e manter a taxa de filtração constante. Existe um mecanismo com uma rápida resposta de acção que proteje o glomérulo contra flutuações da pressão arterial, ao regular a contração das artérias aferentes e eferentes. Já o sistema renina-angiotensina-aldosterona tem uma acção mais lenta. A ativação deste sistema leva ao aumento de angiotensina II, que regula a pressão arterial não só por causar vasoconstrição, mas também por regular a reabsorção de eletrólitos ao longo dos túbulos e por estimular a produção de aldosterona. Tendo em conta que hipóxia renal pode levar a lesão renal, o objetivo desta tese foi o de melhorar o conhecimento relativo aos fatores envolvidos na manutenção da homeostasia de oxigénio nos rins, na saúde e na doença.

Doentes com alto risco de doenças cardiovasculares são aconselhados a re-duzir a ingestão de sódio, de modo a ajudar a reduzir e controlar a pressão arterial. No primeiro estudo, uma dieta com baixo teor de sódio foi dada a ratos saudáveis durante duas semanas. Neste estudo, a pressão arterial não sofreu alterações, contudo houve um aumento da reabsorção de eletrólitos nos túbulos gerando hipóxia no cortex renal. A ativação do sistema renina-angio-tensina-aldosterona foi um dos contribuintes para resulatdos observados, sendo que a ativação do recetor tipo 1 da angiotensina II, pela angiotensina II, teve efeitos a nível do fluxo sanguíneo renal, enquanto que a aldosterona teve mais efeitos a nível do consumo de oxigénio.

46

Nos Estudos II e III foi estudado o efeito da ativação crónica de fatores induzidos pela hipóxia (HIF), em modelos animais de diabetes mellitus tipo 1. HIF são fatores de activação que, em situação de hipóxia, promovem a tran-scrição de genes que facilitam a adaptação e sobrevivência das células. HIF é composto por duas subunidades. A subunidade α é hidroxilada por prolil hi-droxilases (PHD) e reconhecida pela proteína von Hippel-Lindau (VHL) que a marca para degradação. Como as PHDs requerem oxigénio para funcion-erem, em caso de hipóxia, a subunidade α liga-se à β, formando um hetero-dímero funcional. A diabetes mellitus pode causar hipóxia intrarenal, devido ao aumento do consumo de energia associado ao transporte de eletrólitos nos túbulos e ao aumento de stress oxidativo. Contudo, esta patologia tem um im-pacto negativo na ativação de HIF. Nos Estudos II e III foram utilizados ratin-hos heterozigóticos para a PHD e ratinhos com knockout renal de VHL, re-spectivamente. Ambos os estudos revelam que promover a ativação de HIF durante diabates aumenta a eficácia da mitocôndria e, desta forma, reduz o consumo de oxigénio no tecido renal.

O envelhecimento está associado a um declínio gradual da função renal, visível pela redução lenta da taxa de filtração glomerular. O envelhecimento também está associado a um aumento dos níveis de stress oxidativo. Este, por sua vez, pode afectar a mitocôndria negativamente, aumentando o seu potên-cial de membrana e diminuindo a sua eficácia. As mitocôndrias tem na sua membrana interna “uncoupling proteins” (UCP), que podem ser ativadas pelo aumento de stress oxidativo. Estas proteínas permitem a passagem de protões pela membrana interna sem haver produção de ATP. A este mecanismo dá-se o nome de “leak respiration”. Contudo, se por um lado este mecanismo pro-tege a mitocôndria, por outro lado aumenta o consumo de oxigénio, tendo um impacto negativo na homeostasia de oxigénio no tecido renal.

No Estudo IV, estudamos os efeitos do envelhecimento em ratinhos knock-out para a UCP-2. Embora não houvessem diferenças a nível da função renal, estes ratinhos apresentam uma mitocôndria mais eficiente, o que provavel-mente leva à redução de proteina excretada na urina observada nestes animais.

Em conclusão, esta tese apresenta novos resultados relativos à importância da manutenção do balanço dos níveis de oxigénio no tecido renal.

47

Acknowledgements

This thesis was carried out at the Division of Integrative Physiology, Depart-ment of Medical Cell Biology, Uppsala University, Sweden. The work pre-sented was supported by grants from Swedish Research Council, the Swedish Diabetes Foundation, the Swedish Heart-Lung Foundation, the Family Ern-fors Fund, the British Heart Foundation (FS/14/2/30630 and PG/15/68/31717) and the European Union, Seventh 7 Framework Programme, Marie Curie Ac-tions (CARPEDIEM - No 612280). There are many that I would like to thank for all the support and help, not only during the preparation of this thesis, but also during my time as a PhD. My supervisor Fredrik Palm. Thank you! Words cannot express how grateful I am that you gave me the opportunity to do a PhD with you, and how my life has changed because of that. Thank you for all the support throughout these years, for allowing me to pursue my own ideas and, most importantly, for teaching me how to shoot clay disks (a great way of handling stress)! Thank you Peter Hansell, my co-supervisor, for always being there. Your constant support and understanding has helped me in so many situations. Malou Friederich-Persson, I already admired you before you accepted to be my co-supervisor. And I am so glad you did! You have inspired me so many times along the way and have been and still are my role model in this world of science. Thank you Mediha, our discussions, scientific and otherwise, have helped me so much along the way! Thank you for being a great listener and for under-standing! Thank you Sofia, for always brightening up the day and our office with your cheerful disposition and your amazing cakes! It has been really amazing sharing the office with both of you! I couldn’t have asked for better company along this journey. Thank you Oskar, for the random conversations, about work or, most likely, something completely different. It has been great to try to be better than you at bowling, shooting clay or anything at all. And it has been even greater when I succeeded!

48

Ebba, it is always great to have you in the lab! I wish that you could have been there more often. Thank you for being understanding and supportive. Thank you Michael Hultström, for the random office distractions (some of them were actually appreciated)! Thank you Tomas, for all the mitochondria knowledge you shared and for all the discussions. To all the Kidney Research Group, Patrik, Angelica, Sussi, Henrik, Dick and Micol, thank you all for contributing to a truly amazing group. Thank you for all the fika room discussions, the great journal clubs and DoDo’s and all the help around the lab. Thank you Carmen, for all the great conversations and for “forcing” me to go to the gym. Kristel, thank you for coming with me to all those MDR and DN meetings. Thank you both for listening to my ramblings and for being sup-portive and understanding. Thank you to everyone else in this corridor, Mia, Gustav, Antoine, Emelie, Cedric, Haoyu, Feilong, Mikhail, Per-Ola, Martin and Björn for all the nice conversations in the fika room. And thank you to all of those I have met along the way that made this journey all the better. Loora, Filip, Martin, Megha, Linda, Marcus, Anton, Tyra and Lejon. A big thank you to all Portuguese students that I had the pleasure to supervise in some way, Maria João, Catarina, Carolina and Amanda. Obrigada por trazerem um bocadinho de Português a este laboratório na Suécia! Vocês foram e são fantásticas! Thank you to all my collaborators for all the work and time you put into these projects. I would also like to leave my gratitude to the foundations that, by giving me grants, allowed me to attend many international conferences. Bergmark travel stipend, Eva & Oscar Ahréns Foundation and Anna Maria Lundins, my sin-cere thank you. Um agradecimento em especial aos meus amigos Carla, José, Bruna, Joana, Miguel (Banjo) e Miguel (Boss)! Infiltrar-me no vosso grupo, à mais de 15 anos atrás foi uma das melhores decisões que tomei! Bea, obrigada por tudo! Obrigada pelas nossas horas de “pôr a conversa em dia” pelo skype! E sim, havemos de ir a algum lado as duas e “ir tomar um café!”.

49

Thank you to all of those I might have forgotten to mention by name. (The stress is big and it does nothing good to a person’s memory!) Thank you Vladimir, for being there when I needed the most. For all the talks and discussion about life, history and science. I have learned so much from you! Finally, to my family. Um agradecimento especial à minha enorme família! Pai e mãe, obrigada! Sei que não foi fácil. Mas as coisas que são importantes nesta vida nunca são fáceis. Obrigada por todo o apoio que me deram! Obrigada por todos os sacrifícios! Manas Guida e Tina, obrigada! Sem vocês eu não teria conseguido chegar tão longe. Obrigada por estarem sempre presentes e por todo o vosso apoio! Obrigada por acreditarem em mim, mesmo quando eu não acredito e por me “puxarem” as orelhas sempre que isso acontece. Amo-vos muito!

50

References

1. H. Baumgärtl, H. P. Leichtweiss, D. W. Lübbers, C. Weiss, H. Huland, The oxygen supply of the dog kidney: measurements of intrarenal pO 2. Microvasc Res 4, 247-257 (1972).

2. P. Liss, A. Nygren, N. P. Revsbech, H. R. Ulfendahl, Intrarenal oxygen tension measured by a modified clark electrode at normal and low blood pressure and after injection of x-ray contrast media. Pflugers Arch 434, 705-711 (1997).

3. M. N. LEVY, G. SAUCEDA, Diffusion of oxygen from arterial to venous seg-ments of renal capillaires. Am J Physiol 196, 1336-1339 (1959).

4. M. N. LEVY, E. S. IMPERIAL, Oxygen shunting in renal cortical and medul-lary capillaries. Am J Physiol 200, 159-162 (1961).

5. K. Aukland, J. Krog, Renal oxygen tension. Nature 188, 671 (1960). 6. M. Brezis, S. Rosen, P. Silva, F. H. Epstein, Renal ischemia: a new perspective.

Kidney Int 26, 375-383 (1984). 7. S. Kim, H. Iwao, Molecular and cellular mechanisms of angiotensin II-medi-

ated cardiovascular and renal diseases. Pharmacol Rev 52, 11-34 (2000). 8. G. Wolf, Angiotensin II: a pivotal factor in the progression of renal diseases.

Nephrol Dial Transplant 14 Suppl 1, 42-44 (1999). 9. D. Voet, J. G. Voet, C. W. Pratt, Fundamentals of Biochemistry: Life at the

Molecular Level. (Wiley, 2006). 10. I. G. Shabalina, T. V. Kramarova, J. Nedergaard, B. Cannon, Carboxyatracty-

loside effects on brown-fat mitochondria imply that the adenine nucleotide translocator isoforms ANT1 and ANT2 may be responsible for basal and fatty-acid-induced uncoupling respectively. Biochem J 399, 405-414 (2006).

11. K. S. Echtay et al., Superoxide activates mitochondrial uncoupling proteins. Nature 415, 96-99 (2002).

12. M. D. Brand et al., The basal proton conductance of mitochondria depends on adenine nucleotide translocase content. Biochem J 392, 353-362 (2005).

13. M. D. Brand et al., The significance and mechanism of mitochondrial proton conductance. Int J Obes Relat Metab Disord 23 Suppl 6, S4-11 (1999).

14. M. Friederich, P. Hansell, F. Palm, Diabetes, oxidative stress, nitric oxide and mitochondria function. Curr Diabetes Rev 5, 120-144 (2009).

15. A. A. Starkov, G. Fiskum, Regulation of brain mitochondrial H2O2 production by membrane potential and NAD(P)H redox state. J Neurochem 86, 1101-1107 (2003).

16. S. S. Korshunov, V. P. Skulachev, A. A. Starkov, High protonic potential ac-tuates a mechanism of production of reactive oxygen species in mitochondria. FEBS Lett 416, 15-18 (1997).

17. P. Jezek, Possible physiological roles of mitochondrial uncoupling proteins--UCPn. Int J Biochem Cell Biol 34, 1190-1206 (2002).

51

18. L. Alán, K. Smolková, E. Kronusová, J. Santorová, P. Jezek, Absolute levels of transcripts for mitochondrial uncoupling proteins UCP2, UCP3, UCP4, and UCP5 show different patterns in rat and mice tissues. J Bioenerg Biomembr 41, 71-78 (2009).

19. M. Friederich et al., Identification and distribution of uncoupling protein isoforms in the normal and diabetic rat kidney. Adv Exp Med Biol 645, 205-212 (2009).

20. G. L. Semenza, G. L. Wang, A nuclear factor induced by hypoxia via de novo protein synthesis binds to the human erythropoietin gene enhancer at a site required for transcriptional activation. Mol Cell Biol 12, 5447-5454 (1992).

21. C. J. Schofield, P. J. Ratcliffe, Oxygen sensing by HIF hydroxylases. Nat Rev Mol Cell Biol 5, 343-354 (2004).

22. M. A. Déry, M. D. Michaud, D. E. Richard, Hypoxia-inducible factor 1: regu-lation by hypoxic and non-hypoxic activators. Int J Biochem Cell Biol 37, 535-540 (2005).

23. M. Yee Koh, T. R. Spivak-Kroizman, G. Powis, HIF-1 regulation: not so easy come, easy go. Trends Biochem Sci 33, 526-534 (2008).

24. C. Rosenberger et al., Adaptation to hypoxia in the diabetic rat kidney. Kidney Int 73, 34-42 (2008).

25. M. S. Wiesener et al., Widespread hypoxia-inducible expression of HIF-2al-pha in distinct cell populations of different organs. FASEB J 17, 271-273 (2003).

26. K. L. Gorres, R. T. Raines, Prolyl 4-hydroxylase. Crit Rev Biochem Mol Biol 45, 106-124 (2010).

27. M. E. Cockman et al., Hypoxia inducible factor-alpha binding and ubiquityla-tion by the von Hippel-Lindau tumor suppressor protein. J Biol Chem 275, 25733-25741 (2000).

28. P. H. Maxwell et al., The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature 399, 271-275 (1999).

29. T. Kamura et al., Activation of HIF1alpha ubiquitination by a reconstituted von Hippel-Lindau (VHL) tumor suppressor complex. Proc Natl Acad Sci U S A 97, 10430-10435 (2000).

30. M. Ohh et al., Ubiquitination of hypoxia-inducible factor requires direct bind-ing to the beta-domain of the von Hippel-Lindau protein. Nat Cell Biol 2, 423-427 (2000).

31. R. Fukuda et al., HIF-1 regulates cytochrome oxidase subunits to optimize ef-ficiency of respiration in hypoxic cells. Cell 129, 111-122 (2007).

32. J. W. Kim, I. Tchernyshyov, G. L. Semenza, C. V. Dang, HIF-1-mediated ex-pression of pyruvate dehydrogenase kinase: a metabolic switch required for cellular adaptation to hypoxia. Cell Metab 3, 177-185 (2006).

33. D. D. Kline, Y. J. Peng, D. J. Manalo, G. L. Semenza, N. R. Prabhakar, Defec-tive carotid body function and impaired ventilatory responses to chronic hy-poxia in mice partially deficient for hypoxia-inducible factor 1 alpha. Proc Natl Acad Sci U S A 99, 821-826 (2002).

34. J. A. Forsythe et al., Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1. Mol Cell Biol 16, 4604-4613 (1996).

52

35. B. D. Kelly et al., Cell type-specific regulation of angiogenic growth factor gene expression and induction of angiogenesis in nonischemic tissue by a con-stitutively active form of hypoxia-inducible factor 1. Circ Res 93, 1074-1081 (2003).

36. D. Feldser et al., Reciprocal positive regulation of hypoxia-inducible factor 1alpha and insulin-like growth factor 2. Cancer Res 59, 3915-3918 (1999).

37. D. E. Richard, E. Berra, E. Gothié, D. Roux, J. Pouysségur, p42/p44 mitogen-activated protein kinases phosphorylate hypoxia-inducible factor 1alpha (HIF-1alpha) and enhance the transcriptional activity of HIF-1. J Biol Chem 274, 32631-32637 (1999).

38. D. E. Richard, E. Berra, J. Pouyssegur, Nonhypoxic pathway mediates the in-duction of hypoxia-inducible factor 1alpha in vascular smooth muscle cells. J Biol Chem 275, 26765-26771 (2000).

39. T. Hellwig-Bürgel, K. Rutkowski, E. Metzen, J. Fandrey, W. Jelkmann, Inter-leukin-1beta and tumor necrosis factor-alpha stimulate DNA binding of hy-poxia-inducible factor-1. Blood 94, 1561-1567 (1999).

40. A. Görlach et al., Thrombin activates the hypoxia-inducible factor-1 signaling pathway in vascular smooth muscle cells: Role of the p22(phox)-containing NADPH oxidase. Circ Res 89, 47-54 (2001).

41. N. Wakisaka et al., Epstein-Barr virus latent membrane protein 1 induces syn-thesis of hypoxia-inducible factor 1 alpha. Mol Cell Biol 24, 5223-5234 (2004).

42. E. J. Moon et al., Hepatitis B virus X protein induces angiogenesis by stabiliz-ing hypoxia-inducible factor-1alpha. FASEB J 18, 382-384 (2004).

43. L. Tonneijck et al., Glomerular Hyperfiltration in Diabetes: Mechanisms, Clin-ical Significance, and Treatment. J Am Soc Nephrol 28, 1023-1039 (2017).

44. N. Bank, H. S. Aynedjian, Progressive increases in luminal glucose stimulate proximal sodium absorption in normal and diabetic rats. J Clin Invest 86, 309-316 (1990).

45. P. L. Brito et al., Proximal tubular basement membrane width in insulin-de-pendent diabetes mellitus. Kidney Int 53, 754-761 (1998).

46. R. Z. Alicic, M. T. Rooney, K. R. Tuttle, Diabetic Kidney Disease: Challenges, Progress, and Possibilities. Clin J Am Soc Nephrol 12, 2032-2045 (2017).

47. N. Papadopoulou-Marketou, G. P. Chrousos, C. Kanaka-Gantenbein, Diabetic nephropathy in type 1 diabetes: a review of early natural history, pathogenesis, and diagnosis. Diabetes Metab Res Rev 33, (2017).

48. J. E. Hall, A. C. Gyuton, Guyton and Hall textbook of medical physiology. (Elsevier, ed. 13th edition., 2016).

49. F. Palm, J. Cederberg, P. Hansell, P. Liss, P. O. Carlsson, Reactive oxygen species cause diabetes-induced decrease in renal oxygen tension. Diabetologia 46, 1153-1160 (2003).

50. P. Hansell, W. J. Welch, R. C. Blantz, F. Palm, Determinants of kidney oxygen consumption and their relationship to tissue oxygen tension in diabetes and hypertension. Clin Exp Pharmacol Physiol 40, 123-137 (2013).

51. A. Baines, P. Ho, Glucose stimulates O2 consumption, NOS, and Na/H ex-change in diabetic rat proximal tubules. Am J Physiol Renal Physiol 283, F286-293 (2002).

52. M. Friederich, A. Fasching, P. Hansell, L. Nordquist, F. Palm, Diabetes-in-duced up-regulation of uncoupling protein-2 results in increased mitochondrial uncoupling in kidney proximal tubular cells. Biochim Biophys Acta 1777, 935-940 (2008).

53

53. M. Friederich-Persson et al., Kidney hypoxia, attributable to increased oxygen consumption, induces nephropathy independently of hyperglycemia and oxi-dative stress. Hypertension 62, 914-919 (2013).

54. F. Palm, L. Nordquist, Renal tubulointerstitial hypoxia: cause and consequence of kidney dysfunction. Clin Exp Pharmacol Physiol 38, 474-480 (2011).

55. L. G. Fine, J. T. Norman, Chronic hypoxia as a mechanism of progression of chronic kidney diseases: from hypothesis to novel therapeutics. Kidney Int 74, 867-872 (2008).

56. M. Nangaku, Hypoxia and tubulointerstitial injury: a final common pathway to end-stage renal failure. Nephron Exp Nephrol 98, e8-12 (2004).

57. S. B. Catrina, Impaired hypoxia-inducible factor (HIF) regulation by hypergly-cemia. J Mol Med (Berl) 92, 1025-1034 (2014).

58. S. B. Catrina, K. Okamoto, T. Pereira, K. Brismar, L. Poellinger, Hyperglyce-mia regulates hypoxia-inducible factor-1alpha protein stability and function. Diabetes 53, 3226-3232 (2004).

59. H. Thangarajah et al., The molecular basis for impaired hypoxia-induced VEGF expression in diabetic tissues. Proc Natl Acad Sci U S A 106, 13505-13510 (2009).

60. L. Nordquist et al., Activation of hypoxia-inducible factors prevents diabetic nephropathy. J Am Soc Nephrol 26, 328-338 (2015).

61. M. Matsumoto et al., Induction of renoprotective gene expression by cobalt ameliorates ischemic injury of the kidney in rats. J Am Soc Nephrol 14, 1825-1832 (2003).

62. D. F. Higgins, K. Kimura, M. Iwano, V. H. Haase, Hypoxia-inducible factor signaling in the development of tissue fibrosis. Cell Cycle 7, 1128-1132 (2008).

63. M. Ding et al., Loss of the tumor suppressor Vhlh leads to upregulation of Cxcr4 and rapidly progressive glomerulonephritis in mice. Nat Med 12, 1081-1087 (2006).

64. C. Baylis, B. Corman, The aging kidney: insights from experimental studies. J Am Soc Nephrol 9, 699-709 (1998).

65. D. Bolignano, F. Mattace-Raso, E. J. Sijbrands, C. Zoccali, The aging kidney revisited: a systematic review. Ageing Res Rev 14, 65-80 (2014).

66. U. B. Berg, Differences in decline in GFR with age between males and fe-males. Reference data on clearances of inulin and PAH in potential kidney do-nors. Nephrol Dial Transplant 21, 2577-2582 (2006).

67. J. H. Lim et al., Age-associated molecular changes in the kidney in aged mice. Oxid Med Cell Longev 2012, 171383 (2012).

68. E. D. O'Sullivan, J. Hughes, D. A. Ferenbach, Renal Aging: Causes and Con-sequences. J Am Soc Nephrol 28, 407-420 (2017).

69. A. Denic et al., The Substantial Loss of Nephrons in Healthy Human Kidneys with Aging. J Am Soc Nephrol 28, 313-320 (2017).

70. J. F. Reckelhoff et al., Vitamin E ameliorates enhanced renal lipid peroxidation and accumulation of F2-isoprostanes in aging kidneys. Am J Physiol 274, R767-774 (1998).

71. G. Frenkel-Denkberg, D. Gershon, A. P. Levy, The function of hypoxia-induc-ible factor 1 (HIF-1) is impaired in senescent mice. FEBS Lett 462, 341-344 (1999).

72. D. Fliser et al., Renal function in the elderly: impact of hypertension and car-diac function. Kidney Int 51, 1196-1204 (1997).

73. R. M. Carey, Angiotensin receptors and aging. Hypertension 50, 33-34 (2007).

54

74. K. Takeda et al., Placental but not heart defects are associated with elevated hypoxia-inducible factor alpha levels in mice lacking prolyl hydroxylase do-main protein 2. Mol Cell Biol 26, 8336-8346 (2006).

75. M. Mazzone et al., Heterozygous deficiency of PHD2 restores tumor oxygen-ation and inhibits metastasis via endothelial normalization. Cell 136, 839-851 (2009).

76. E. Berra et al., HIF prolyl-hydroxylase 2 is the key oxygen sensor setting low steady-state levels of HIF-1alpha in normoxia. EMBO J 22, 4082-4090 (2003).

77. S. Lenzen, The mechanisms of alloxan- and streptozotocin-induced diabetes. Diabetologia 51, 216-226 (2008).

78. B. L. Furman, Streptozotocin-Induced Diabetic Models in Mice and Rats. Curr Protoc Pharmacol 70, 5.47.41-20 (2015).

79. X. Shao, S. Somlo, P. Igarashi, Epithelial-specific Cre/lox recombination in the developing kidney and genitourinary tract. J Am Soc Nephrol 13, 1837-1846 (2002).

80. V. H. Haase, J. N. Glickman, M. Socolovsky, R. Jaenisch, Vascular tumors in livers with targeted inactivation of the von Hippel-Lindau tumor suppressor. Proc Natl Acad Sci U S A 98, 1583-1588 (2001).

81. C. Y. Zhang et al., Uncoupling protein-2 negatively regulates insulin secretion and is a major link between obesity, beta cell dysfunction, and type 2 diabetes. Cell 105, 745-755 (2001).

82. Z. Qi et al., Serial determination of glomerular filtration rate in conscious mice using FITC-inulin clearance. Am J Physiol Renal Physiol 286, F590-596 (2004).

83. C. Sturgeon, A. D. Sam, W. R. Law, Rapid determination of glomerular filtra-tion rate by single-bolus inulin: a comparison of estimation analyses. J Appl Physiol (1985) 84, 2154-2162 (1998).

84. F. J. Larsen et al., Dietary inorganic nitrate improves mitochondrial efficiency in humans. Cell Metab 13, 149-159 (2011).

85. E. Gnaiger, Polarographic oxygen sensors, the oxygraph and high-resolution respirometry to assess mitochondrial function. Drug-induced mitochondrial dysfunction 327, 352 (2008).

86. J. Fox, S. Guan, A. A. Hymel, L. G. Navar, Dietary Na and ACE inhibition effects on renal tissue angiotensin I and II and ACE activity in rats. Am J Phys-iol 262, F902-909 (1992).

87. F. J. He, G. A. MacGregor, Role of salt intake in prevention of cardiovascular disease: controversies and challenges. Nat Rev Cardiol 15, 371-377 (2018).

88. N. Graudal, G. Jürgens, Conflicting Evidence on Health Effects Associated with Salt Reduction Calls for a Redesign of the Salt Dietary Guidelines. Prog Cardiovasc Dis 61, 20-26 (2018).

89. J. P. Midgley, A. G. Matthew, C. M. Greenwood, A. G. Logan, Effect of re-duced dietary sodium on blood pressure: a meta-analysis of randomized con-trolled trials. JAMA 275, 1590-1597 (1996).

90. F. J. He, G. A. MacGregor, Reducing population salt intake worldwide: from evidence to implementation. Prog Cardiovasc Dis 52, 363-382 (2010).

91. G. Frindt, L. Yang, K. Bamberg, L. G. Palmer, Na restriction activates epithe-lial Na channels in rat kidney through two mechanisms and decreases distal Na. J Physiol 596, 3585-3602 (2018).

55

92. A. D. Riquier-Brison, P. K. Leong, K. Pihakaski-Maunsbach, A. A. McDonough, Angiotensin II stimulates trafficking of NHE3, NaPi2, and asso-ciated proteins into the proximal tubule microvilli. Am J Physiol Renal Physiol 298, F177-186 (2010).

93. I. E. Stillman et al., Effects of salt depletion on the kidney: changes in medul-lary oxygenation and thick ascending limb size. J Am Soc Nephrol 4, 1538-1545 (1994).

94. J. Geibel, G. Giebisch, W. F. Boron, Angiotensin II stimulates both Na(+)-H+ exchange and Na+/HCO3- cotransport in the rabbit proximal tubule. Proceed-ings of the National Academy of Sciences of the United States of America 87, 7917-7920 (1990).

95. D. R. Yingst, K. J. Massey, N. F. Rossi, M. J. Mohanty, R. R. Mattingly, An-giotensin II directly stimulates activity and alters the phosphorylation of Na-K-ATPase in rat proximal tubule with a rapid time course. Am J Physiol Renal Physiol 287, F713-721 (2004).

96. P. K. Leong et al., Effects of ACE inhibition on proximal tubule sodium transport. Am J Physiol Renal Physiol 290, F854-863 (2006).

97. G. Frindt, L. Yang, K. Bamberg, L. G. Palmer, Na restriction activates ENaC in rat kidney through two mechanisms and decreases distal Na delivery. The Journal of physiology, (2018).

98. C. Ronzaud et al., Impairment of sodium balance in mice deficient in renal principal cell mineralocorticoid receptor. Journal of the American Society of Nephrology : JASN 18, 1679-1687 (2007).

99. K. Sharma et al., Metabolomics reveals signature of mitochondrial dysfunction in diabetic kidney disease. J Am Soc Nephrol 24, 1901-1912 (2013).

100. L. L. Dugan et al., AMPK dysregulation promotes diabetes-related reduction of superoxide and mitochondrial function. J Clin Invest 123, 4888-4899 (2013).

101. S. Franzén, L. Pihl, N. Khan, H. Gustafsson, F. Palm, Pronounced kidney hy-poxia precedes albuminuria in type 1 diabetic mice. Am J Physiol Renal Phys-iol 310, F807-809 (2016).

102. M. Friederich-Persson, P. Persson, P. Hansell, F. Palm, Deletion of Uncou-pling Protein-2 reduces renal mitochondrial leak respiration, intrarenal hypoxia and proteinuria in a mouse model of type 1 diabetes. Acta Physiol (Oxf) 223, e13058 (2018).

103. M. F. Persson et al., Coenzyme Q10 prevents GDP-sensitive mitochondrial uncoupling, glomerular hyperfiltration and proteinuria in kidneys from db/db mice as a model of type 2 diabetes. Diabetologia 55, 1535-1543 (2012).

104. S. Cardoso, M. S. Santos, A. Moreno, P. I. Moreira, UCP2 and ANT differently modulate proton-leak in brain mitochondria of long-term hyperglycemic and recurrent hypoglycemic rats. J Bioenerg Biomembr 45, 397-407 (2013).

105. H. Zhang et al., Mitochondrial autophagy is an HIF-1-dependent adaptive met-abolic response to hypoxia. J Biol Chem 283, 10892-10903 (2008).

106. J. J. Lum et al., The transcription factor HIF-1alpha plays a critical role in the growth factor-dependent regulation of both aerobic and anaerobic glycolysis. Genes Dev 21, 1037-1049 (2007).

107. I. Papandreou, R. A. Cairns, L. Fontana, A. L. Lim, N. C. Denko, HIF-1 me-diates adaptation to hypoxia by actively downregulating mitochondrial oxygen consumption. Cell Metab 3, 187-197 (2006).

108. T. N. Seagroves et al., Transcription factor HIF-1 is a necessary mediator of the pasteur effect in mammalian cells. Mol Cell Biol 21, 3436-3444 (2001).

56

109. K. S. Echtay, M. P. Murphy, R. A. Smith, D. A. Talbot, M. D. Brand, Super-oxide activates mitochondrial uncoupling protein 2 from the matrix side. Stud-ies using targeted antioxidants. J Biol Chem 277, 47129-47135 (2002).

110. W. Yumura et al., Age-associated changes in renal glomeruli of mice. Exp Gerontol 24, 237-249 (1989).

111. J. R. Weinstein, S. Anderson, The aging kidney: physiological changes. Adv Chronic Kidney Dis 17, 302-307 (2010).

112. S. Franzén et al., Differences in susceptibility to develop parameters of dia-betic nephropathy in four mouse strains with type 1 diabetes. Am J Physiol Renal Physiol 306, F1171-1178 (2014).

Acta Universitatis UpsaliensisDigital Comprehensive Summaries of Uppsala Dissertationsfrom the Faculty of Medicine 1581

Editor: The Dean of the Faculty of Medicine

A doctoral dissertation from the Faculty of Medicine, UppsalaUniversity, is usually a summary of a number of papers. A fewcopies of the complete dissertation are kept at major Swedishresearch libraries, while the summary alone is distributedinternationally through the series Digital ComprehensiveSummaries of Uppsala Dissertations from the Faculty ofMedicine. (Prior to January, 2005, the series was publishedunder the title “Comprehensive Summaries of UppsalaDissertations from the Faculty of Medicine”.)

Distribution: publications.uu.seurn:nbn:se:uu:diva-387389

ACTAUNIVERSITATIS

UPSALIENSISUPPSALA

2019