Embed Size (px)
Citation preview
The Plant Cell, Vol. 14, 2509–2526, October 2002, www.plantcell.org © 2002 American Society of Plant Biologists
High-Flavonol Tomatoes Resulting from the Heterologous Expression of the Maize Transcription Factor Genes
LC
and
C1
Arnaud Bovy,
a,1
Ric de Vos,
a
Mark Kemper,
a
Elio Schijlen,
a
Maria Almenar Pertejo,
a
Shelagh Muir,
b
Geoff Collins,
b
Sue Robinson,
b
Martine Verhoeyen,
b
Steve Hughes,
c
Celestino Santos-Buelga,
d
and Arjen van Tunen
a
a
Plant Research International, Droevendaalsesteeg 1, P.O. Box 16, 6700 AA Wageningen, The Netherlands
b
Unilever Research, Colworth House, Sharnbrook, Bedford 44 MK 1LQ, United Kingdom
c
University of Exeter, School of Biological Sciences, Washington Singer Laboratory, Exeter EX4 4QG, United Kingdom
d
Unidad de Nutricion y Bromatologia, Facultad de Farmacia, Universidad de Salamanca, E-37007 Salamanca, Spain
Flavonoids are a group of polyphenolic plant secondary metabolites important for plant biology and human nutrition. Inparticular flavonols are potent antioxidants, and their dietary intake is correlated with a reduced risk of cardiovasculardiseases. Tomato fruit contain only in their peel small amounts of flavonoids, mainly naringenin chalcone and the fla-vonol rutin, a quercetin glycoside. To increase flavonoid levels in tomato, we expressed the maize transcription factorgenes
LC
and
C1
in the fruit of genetically modified tomato plants. Expression of both genes was required and suffi-cient to upregulate the flavonoid pathway in tomato fruit flesh, a tissue that normally does not produce any flavonoids.These fruit accumulated high levels of the flavonol kaempferol and, to a lesser extent, the flavanone naringenin in theirflesh. All flavonoids detected were present as glycosides. Anthocyanins, previously reported to accumulate upon
LC
expression in several plant species, were present in
LC
/
C1
tomato leaves but could not be detected in ripe
LC
/
C1
fruit.RNA expression analysis of ripening fruit revealed that, with the exception of chalcone isomerase, all of the structuralgenes required for the production of kaempferol-type flavonols and pelargonidin-type anthocyanins were inducedstrongly by the LC/C1 transcription factors. Expression of the genes encoding flavanone-3
�
-hydroxylase and fla-vanone-3
�
5
�
-hydroxylase, which are required for the modification of B-ring hydroxylation patterns, was not affected byLC/C1. Comparison of flavonoid profiles and gene expression data between tomato leaves and fruit indicates that theabsence of anthocyanins in
LC
/
C1
fruit is attributable primarily to an insufficient expression of the gene encoding fla-vanone-3
�
5
�
-hydroxylase, in combination with a strong preference of the tomato dihydroflavonol reductase enzyme touse the flavanone-3
�
5
�
-hydroxylase reaction product dihydromyricetin as a substrate.
INTRODUCTION
Flavonoids form a large group of polyphenolic compoundsthat occur naturally in plants. Based on their core structure,the aglycone, they can be grouped into different classes,such as chalcones, flavanones, dihydroflavonols, flavonols,and anthocyanins (Figure 1). To date,
�
4000 different fla-vonoids have been identified. This large diversity is attribut-able to single or combinatorial modifications of the agly-cone, such as glycosylation, methylation, and acylation. Asa group, flavonoids are involved in many aspects of plant
growth and development, such as pathogen resistance, pig-ment production, UV light protection, pollen growth, andseed coat development (Harborne, 1986).
There is increasing evidence to suggest that flavonoids, inparticular those belonging to the class of flavonols (such askaempferol and quercetin), are potentially health-protectingcomponents in the human diet as a result of their high anti-oxidant capacity (Rice Evans et al., 1995, 1997; Sugihara etal., 1999; Dugas et al., 2000; Duthie and Crozier, 2000; Nget al., 2000) and their ability, in vitro, to induce human pro-tective enzyme systems (Cook and Samman, 1996; Manachet al., 1996; Janssen et al., 1998; Choi et al., 1999; Frankel,1999; Hollman and Katan, 1999; Shih et al., 2000). Based onthese findings, it was postulated that flavonoids may offerprotection against major diseases such as coronary heartdiseases and cancer (Hertog and Hollman, 1996; Steinmetz
1
To whom correspondence should be addressed. E-mail [email protected]; fax 31-317-418094.Article, publication date, and citation information can be found atwww.plantcell.org/cgi/doi/10.1105/tpc.004218.
2510 The Plant Cell
and Potter, 1996; Trevisanato and Kim, 2000). In addition,several epidemiological studies have suggested a direct re-lationship between cardioprotection and consumption offlavonols from dietary sources such as onion, apple, and tea(Hertog et al., 1993; Keli et al., 1996). These studies suggestthat a systematic increase in the daily intake of certain fla-vonoids could lead to a 30 to 40% reduction in death bycoronary heart diseases.
Based on studies of this type, there is growing interest inthe development of food crops enriched with health-protec-tive flavonoids. An excellent candidate for such an approachis tomato, one of the most important food crops worldwide.In tomato, the main flavonol is rutin (quercetin-3-
O
-rutino-side) (Woeldecke and Herrmann, 1974; Herrmann, 1979).Quantitative analysis of hydrolyzed extracts revealed thatthe levels of the quercetin aglycone range from 4 to 11 mg/kgfresh weight in large tomato varieties (Crozier et al., 1997).These levels are low compared with those in onion (300 mgquercetin/kg fresh weight) and broccoli (30 mg kaempferol/kg fresh weight) (Hertog et al., 1992; Crozier et al., 1997;Price et al., 1998).
Previously, we had characterized the flavonoid content offruit of the processing tomato variety FM6203 (Muir et al.,2001). Red fruit peel contained naringenin chalcone, the fla-vonol glycosides rutin and kaempferol-3-
O
-rutinoside, andsmall amounts of a quercetin trisaccharide. In the fruit flesh(pericarp), flavonoids were absent, except for traces of rutin.These biochemical data correlated well with the expressionof the flavonoid biosynthesis genes in these fruit. In the peel,significant levels could be detected of the transcripts en-coding chalcone synthase (CHS), flavanone-3-hydroxylase(F3H), and flavonol synthase (FLS), enzymes required for theproduction of flavonols. By contrast, chalcone isomerase(
CHI
) mRNA levels were barely detectable, explaining theaccumulation of the CHI substrate naringenin chalcone (Fig-ure 1). In the flesh, there was no significant accumulation ofany of these transcripts compared with that in the peel.Subsequent overexpression of the petunia
CHI-A
gene inthe tomato fruit resulted in a dramatic increase of flavonols(mainly rutin) in the peel at the expense of naringenin chal-cone. In the flesh, however, no detectable increase of anyflavonoids was observed (Muir et al., 2001). These resultsindicated that the flavonoid biosynthesis pathway in tomatofruit is active only in the peel and that the flavonoid levelsfound are determined, at least in part, by the expression offlavonoid biosynthesis genes. Because the peel constitutesonly 5% of the total fruit weight, we aimed to upregulate theflavonoid biosynthesis pathway in the fruit flesh by overex-pressing regulatory genes.
In the past decade, a number of regulatory genes involvedin the production of flavonoids have been isolated. In gen-eral, these genes belong to one of two families of transcrip-tion factors, the MYB-type C1 family and the basic helix-loop-helix, MYC-type R family (Dooner et al., 1991). Mutantanalysis and gene expression studies in several plant spe-cies (maize, petunia, and
Antirrhinum
) revealed that these
two gene families are required for the production of antho-cyanins in the plant. In maize, the encoded R and C1 tran-scription factors control the expression of several structuralgenes in the pathway leading to anthocyanins, starting withthe first step, CHS, up to anthocyanidin-3-glucosyltrans-ferase (Dooner et al., 1991). Two of the best-studied exam-ples of these transcription factor genes from maize, theMYB-type
C1
and the MYC-type
LC
genes, have been ex-pressed ectopically in various transgenic plant species,such as tobacco, Arabidopsis (Lloyd et al., 1992), petunia(Bradley et al., 1998), and tomato (Goldsbrough et al., 1996).Although there was no detectable effect when
C1
was intro-duced, expression of the
LC
gene led to an enhanced an-thocyanin pigmentation of those tissues that normally arecapable of producing anthocyanins. Similar results were ob-tained with the ectopic expression of the
Antirrhinum Delila
gene, another member of the
MYC
transcription factor fam-ily (Mooney et al., 1995). However, the effects of
LC
and
C1
on flavonoids other than anthocyanins have not been stud-ied to date.
We have expressed the maize
LC
and
C1
genes specifi-cally in the fruit of transgenic tomatoes. In this article, weshow that the expression of both genes is required and suf-ficient to upregulate the flavonoid pathway in tomato flesh, atissue that normally does not produce any flavonoids. Thisresulted in a strong accumulation of flavonols and a moremodest increase in flavanones, but remarkably, not in theaccumulation of anthocyanins. We provide a mechanism toexplain the accumulation of these types of flavonoids com-pared with the anthocyanins reported in other plants.
RESULTS
Approach, Gene Constructs, and Plant Transformation
Because we had shown previously (Muir et al., 2001) thatthe flavonoid biosynthesis pathway is not active in tomatofruit flesh, based on both metabolite and gene expressionstudies, we aimed to upregulate the entire flavonoid path-way in this tissue by expressing the maize transcription fac-tor genes
LC
and
C1
in transgenic tomato plants.The
LC
gene was expressed under the control of the fruit-specific tomato
E8
promoter, whereas the
C1
gene was ex-pressed under the control of either the
E8
promoter or theconstitutive double
35S
promoter of
Cauliflower mosaic vi-rus
(CaMV). LC and C1 are thought to act in a coordinatedmanner (Mol et al., 1998); therefore, this approach was ex-pected to lead to an increase of flavonoids specifically in thefruit. As shown in Figure 2, seven binary constructs weremade containing fusions of either the
C1
or
LC
gene alone(pBBC10, pBBC20, and pBBC30) or both
LC
and
C1
to-gether (pBBC200, pBBC250, pBBC300, and pBBC350). Twoversions of the
LC
gene were used: an
LC
cDNA with its 5
�
leader (LC
�
) and an
LC
cDNA lacking its 5
�
untranslated
High-Flavonol Tomatoes 2511
leader (LC
�
). The 5
�
leader contains a small open readingframe that represses
LC
translation; hence, higher levels ofLC protein are obtained when the 5
�
leader is removed(Damiani and Wessler, 1993). A detailed description of theconstruction of all plasmids is given in Methods.
The constructs referred to above were used to transformFM6203 tomato tissue by
Agrobacterium tumefaciens
–mediated transformation. Transgenic plants obtained aftertransformation with construct pBBC10, pBBC20, pBBC30,pBBC200, pBBC250, pBBC300, or pBBC350 were num-bered from 100, 200, 300, 2000, 2500, 3000, and 3500onward, respectively.
Analysis of Flavonoid Levels in the Fruit ofTransgenic Plants
Red fruit from both
LC
/
C1
(2000, 2500, 3000, and 3500numbers) and wild-type tomato plants was harvested, andthe flesh was analyzed by HPLC for the presence of fla-vonoids. In hydrolyzed
LC
/
C1
extracts (Figure 3), a largeincrease was observed in the level of kaempferol comparedwith that seen in wild-type extracts. In addition to kaemp-
ferol, we observed a significant increase in the level of narin-genin. Because flavonoids generally are present in a conju-gated form (i.e., as
O
-glycosides), we determined whetherdifferent kaempferol and naringenin glycosides were pro-duced by analyzing nonhydrolyzed flesh extracts of
LC
/
C1
and wild-type fruit. Detailed spectral analysis of these HPLCresults (Figure 4) revealed that at least five different kaemp-ferol-
O
-glycosides (e.g., kaempferol-3-
O
-rutinoside) and atleast five different naringenin-
O
-glycosides (e.g., naringin)accumulated in the flesh of red
LC/C1
fruit. These com-pounds were barely detectable in the flesh of unripe greenfruit, but they increased rapidly upon ripening of the fruit, re-flecting the ripening-dependent increase in the activity ofthe
E8
promoter used in the gene constructs (data notshown).
To determine whether both
LC
and
C1
were required toupregulate the flavonoid pathway, hydrolyzed extracts fromwhole red fruit of plants transformed with either
C1
or
LC
alone and wild-type plants were analyzed by HPLC. As shownin Figure 5, the chromatograms of plants transformed withonly one of these two transcription factor genes showed nodifferences compared with untransformed wild-type plants.By contrast, whole fruit extracts of plants transformed with
Figure 1. Scheme of the Flavonoid Biosynthesis Pathway.
Only the flavonoid classes relevant to this article are shown (in boxes). ANS, anthocyanidin synthase; C, cyanidin; CHI, chalcone isomerase;CHS, chalcone synthase; D, delphinidin; DFR, dihydroflavonol reductase; DK, dihydrokaempferol; DM, dihydromyricetin; DQ, dihydroquercetin;F3H, flavanone-3-hydroxylase; F3�H, flavanone-3�-hydroxylase; F3�5�H, flavanone-3�5�-hydroxylase; FLS, flavonol synthase; K, kaempferol; M,myricetin; P, pelargonidin; PAL, Phe-ammonia lyase; Q, quercetin; 4CL, 4-coumarate:coenzyme A ligase; C4H, cinnamic acid 4-hydroxylase.
2512 The Plant Cell
Figure 2. Constructs Used in this Study.
Fusion constructs consisted of the following gene fusions: pBBC10, 35S-C1; pBBC20, E8-LC�; pBBC30, E8-LC�; pBBC200, 35S-C1/E8-LC�;pBBC300, 35S-C1/E8-LC�; pBBC250, E8-C1/E8-LC�; and pBBC350, E8-C1/E8-LC�. C1, maize C1 cDNA; LC, maize LC cDNA (LC�, versionminus the 5� leader; LC�, version plus the 5� leader); Pd35s, double 35S promoter of CaMV; Pe8, tomato E8 promoter; Tnos, Agrobacterium no-paline synthase terminator, Trbc: pea ribulose bisphosphate carboxylase small subunit terminator.
both
LC
and
C1
revealed a clear accumulation ofkaempferol. Detailed spectral analysis of the chromatogrampeaks in nonhydrolyzed extracts confirmed that in
LC
/
C1
plants, both kaempferol and naringenin glycosides were in-creased, and that in
LC
or
C1
single-gene transgenic plants,no significant difference in the levels of any tested fla-vonoids was observed compared with the wild type (datanot shown).
Hydrolyzed extracts of whole red fruit were used to quan-tify the levels of quercetin, kaempferol, and naringenin in
LC
/
C1 plants. Figure 6A shows only the results obtained for35S-C1/E8-LC� plants (3000 numbers), because this serieswas analyzed most extensively. In fruit of transformedplants, kaempferol levels were increased up to 60-fold rela-tive to the mean level in wild-type fruit, whereas quercetinwas increased slightly (up to 3-fold) in fruit of only a fewplants. When expressed on a whole-fruit basis, the level ofnaringenin was increased up to twofold in only a few plants(Figure 6A), although all fruit accumulated naringenin in theflesh (Figure 4). This apparent discrepancy is explained bythe fact that the naringenin level measured in the wholeLC/C1 fruit represents the increased amount of naringeninpresent in flesh plus the amount of naringenin formed duringhydrolysis from naringenin chalcone that is always presentin the peel, the latter being highly variable between fruitsamples. From the data in Figure 6A, it can be concludedthat the accumulation of kaempferol accounted predomi-nantly for the increase in total flavonols (quercetin pluskaempferol) in the fruit (up to 20-fold).
A significant accumulation of kaempferol also was ob-served for the other three types of LC/C1 plants (data notshown). To compare the effect of the LC leader and the typeof promoter controlling C1 gene expression, we determinedthe levels of kaempferol in hydrolyzed red fruit extracts of35S-C1/E8-LC� (2000 series), 35S-C1/E8-LC� (3000 se-ries), and E8-C1/E8-LC� (2500 series). Unfortunately, forE8-C1/E8-LC� plants (3500 series), only three transformantswere obtained; therefore, these plants were not used in this
comparison. As shown in Figure 6B, all three types of con-structs tested resulted in plants with kaempferol levels rang-ing from 2 mg/kg fresh weight (equal to control levels) to 40to 80 mg/kg fresh weight. Apparently, neither the LC leader(LC� versus LC�) nor the type of promoter driving C1 ex-pression (35S versus E8) was a critical determinant for theextent of flavonoid induction in tomato fruit. Nevertheless,the highest kaempferol levels were found in plants trans-formed with E8-C1/E8-LC� (2500 series). However, we can-not yet conclude that this is attributable to a significant pro-moter effect, because there was a rather large (twofold tothreefold) variation in kaempferol levels within fruit of a sin-gle transgenic plant during the year and between clones ofthe same line (data not shown).
Anthocyanin formation, which has been reported to beinduced by LC in various plant species, such as tomato(Goldsbrough et al., 1996), tobacco (Lloyd et al., 1992), andpetunia (Bradley et al., 1998), occasionally was visible byeye but not by HPLC (i.e., anthocyanin level �1 mg/kg freshweight) in the peel of some young green 35S-C1/E8-LC fruit(2000/3000 series). This reddish-purple pigmentation disap-peared when ripening progressed: anthocyanins never weredetectable in red fruit, either by eye or by HPLC.
In summary, these results show that both regulatorygenes (LC and C1) are required and sufficient to induce thebiosynthesis of flavonoids in tomato fruit. This leads to amarked accumulation of kaempferol and naringenin glyco-sides in the flesh, a tissue that normally does not producesignificant levels of any flavonoids.
Stability of the High-Flavonol Phenotype
To determine whether the high-flavonol phenotype was re-tained in later generations, flavonol levels were determinedin red fruit of segregating T1 and homozygous T2 popula-tions of three single-copy 35S-C1/E8-LC lines (Figure 7). Foreach line, plants were grouped as either transgenic (�) or
High-Flavonol Tomatoes 2513
azygous (�) based on NPT-II PCR analysis. The azygouslines are progeny of transgenic parent lines that have lostthe transgene through segregation. Azygous plants are con-sidered ideal controls because they have been through theentire process of generating transgenic plants, exactly liketheir transgenic “sibling” plants. In all three lines, the trans-gene was inherited in a 3:1 ratio, as expected for single-copy transgene insertions. Transgenic T1 plants had astrongly increased kaempferol content compared with theirazygous relatives, whereas the quercetin content did notdiffer significantly between transgenic and azygous plants(Figure 7A). Similar results were obtained in the T2 genera-tion (Figure 7B). It also was shown that there was no differ-ence in the results obtained for azygous lines and FM6203plants that had not been through the tissue culture processat all. These results indicate that the high-flavonol pheno-type is inherited stably in later generations.
Flavonoids in Leaves of Transgenic Plants
The flavonoid content in mature leaves of homozygous T2populations of the above-mentioned LC/C1 lines was deter-mined by HPLC analysis of hydrolyzed extracts. As shownin Figure 8, the level of the main flavonol in leaves, querce-tin, was not altered significantly in transgenic leaves (�)compared with azygous leaves (�). However, there was aclear increase in the levels of both kaempferol and naringe-nin in transgenic leaves compared with their azygous rela-tives. In leaves of primary transformants containing eitherLC or C1 alone, there was no significant increase in the levelof kaempferol. This finding indicates that, as in fruit, the ex-pression of both LC and C1 is required and sufficient to up-regulate the flavonoid biosynthesis pathway in leaves. In allplants analyzed for flavonoids in leaves, the C1 gene wasexpressed under the control of the constitutive double 35Spromoter of CaMV, whereas the LC gene was expressedunder the control of the fruit-specific tomato E8 promoter.The requirement for LC in addition to C1 expression to up-regulate the flavonoid pathway in leaves suggests that theactivity of the E8 promoter is not confined strictly to the fruitbut also is significant in leaves. Leaves of LC/C1 plants ex-pressing both LC and C1 under the control of the E8 pro-moter were not analyzed in this experiment.
Analysis of Anthocyanins in Tomato Leaves
Although all transgenic plants were phenotypically similar tothe wild type, we observed a clearly increased reddish-pur-ple anthocyanin pigmentation in nodes and old leaves ofsome LC/C1 plants containing 35S-C1/E8-LC comparedwith LC/C1 plants containing E8-C1/E8-LC, plants express-ing LC or C1 alone, or wild-type plants (Figure 9).
To compare the anthocyanins produced in LC/C1 leaveswith those accumulating in wild-type tomato leaves in re-
sponse to abiotic stress, the anthocyanin content and com-position in extracts of 3-week-old, light-stressed LC/C1 andwild-type seedlings was determined using HPLC/photo-diode array/mass spectrometry. In both extracts, the samethree major anthocyanin peaks could be identified, corre-sponding to petunidin 3-(caffeoyl)rutinoside-5-glucoside,petunidin 3-(p-coumaroyl)rutinoside-5-glucoside, and malvi-din 3-(p-coumaroyl)rutinoside-5-glucoside (Table 1). Quanti-fication of these peaks, using malvidin 3-glucoside as astandard, revealed that light-stressed LC/C1 seedlings con-tained threefold to fourfold higher levels of these anthocya-nins than light-stressed wild-type seedlings. In agreementwith published data (Bongue-Bartelsman and Philips, 1995),our HPLC/photodiode array/mass spectrometry mea-surements revealed that all anthocyanins detected in thesecolored leaves were of the petunidin and malvidin type andthus were derived solely from the precursor dihydromyrice-tin. In contrast to our results with mature leaves, in which weobserved a clear increase of kaempferol and, occasionally,anthocyanins in LC/C1 plants relative to wild-type plants,these light-stressed LC/C1 and wild-type seedlings con-tained similarly high levels of both quercetin and kaemp-ferol. This finding suggests that the LC/C1 effect observedin mature leaves and fruit mimics an integral part of the
Figure 3. HPLC Results, Recorded at 370 nm, of Hydrolyzed Ex-tracts from the Flesh of Red Fruit of Wild-Type and Transgenic (LC/C1) Tomato Plants. q, quercetin; k, kaempferol; AU, absorption units.
2514 The Plant Cell
natural induction of the flavonoid pathway in response toabiotic stress.
Analysis of LC and C1 Gene Expression
The expression of the introduced LC and C1 genes in trans-genic plants was analyzed by real-time quantitative reversetranscriptase–mediated (RT) PCR. For these experiments,we made use of the fluorogenic TaqMan assay on the ABIPRISM7700 sequence detection system. Using this technol-ogy, we analyzed transgene expression in fruit of single-gene plants (LC or C1 alone) and double-gene plants (LCand C1 together). As an internal control, we used the tomatocyclophylin gene (CYP), which is expressed constitutively inturning and red tomato fruit, as observed by RNA gel blotanalysis (data not shown). Total RNA was isolated from red
fruit of the tomato plants mentioned above, and first-strandcDNA was synthesized by reverse transcription. Aliquots of100 ng of cDNA were used in three TaqMan PCRs withprobes for LC, C1, and CYP, respectively. LC and C1 mRNAexpression levels were quantified relative to the amount ofCYP mRNA. The absolute amount of CYP mRNA varied by�2.5-fold between the different transgenic plants (mean �SD of Ct values [see Methods] was 20.44 � 0.34; n � 13),indicating that this gene can be used as an authentic inter-nal control. As shown in Figure 10, the control plant 004failed to give a signal with either the C1 probe or the LCprobe. By contrast, all transgenic plants tested showedclear expression of the introduced transgenes at the tran-scriptional level. The C1 single-gene plants (104, 109, and117) showed only C1 gene expression, and the LC single-gene plants (201, 204, 209, 302, and 305) showed only LCgene expression, whereas all tested LC/C1 double-gene
Figure 4. HPLC Results, Recorded at 280 nm, of Nonhydrolyzed Extracts from the Flesh of Red Fruit of Wild-Type and Transgenic (LC/C1) To-mato Plants.
AU, absorption units; K, kaempferol; N, naringenin; WT, wild type.
High-Flavonol Tomatoes 2515
plants (2509, 2511, 2519, and 3031) showed expression ofboth LC and C1 in their fruit. Although the expression levelsof the individual LC and C1 genes in some single-genetransgenic plants were higher than the levels found in somedouble-gene plants, there was no detectable increase inkaempferol levels in hydrolyzed extracts of any single-geneplant compared with the wild type (Figure 8). These resultsconfirm our previous conclusion that the expression of bothLC and C1 together is required to upregulate the flavonoidpathway in tomato fruit.
In the same way, LC and C1 mRNA levels were deter-mined in mature leaves of transgenic and wild-type plants(Figure 10). In the control plant 003, there was no detectableexpression of either LC or C1. In the leaves of the C1 single-gene plant 104, there was high C1 expression and, as ex-pected, no LC expression. In leaves of LC/C1 plants con-taining 35S-C1/E8-LC, high C1 expression and low, butsignificant, LC expression were observed. These results areconsistent with our previous observation that in leaves, as infruit, the expression of both LC and C1 is required to upreg-ulate the flavonoid pathway. Although the LC gene is ex-pressed under the control of the E8 promoter, its expressionin leaves remains sufficient to induce the biosynthesis of fla-vonoids, provided that C1 is expressed simultaneously bythe 35S promoter.
Effect of LC/C1 on the Expression of FlavonoidPathway Genes
The effect of the introduced LC and C1 transcription factorson the expression of flavonoid biosynthesis genes was ex-amined by real-time quantitative SYBR-Green RT-PCR, asdescribed in Methods. Fruit samples of representative LC/C1 and wild-type plants, harvested in the green, turning,and red stages, were separated into peel and flesh, and to-tal RNA was isolated from each tissue. Expression levels forPhe-ammonia lyase (PAL), the flavonoid pathway geneschalcone synthase (CHS), chalcone isomerase (CHI), flava-none-3-hydroxylase (F3H), flavanone-3�-hydroxylase (F3�H),flavanone-3�5�-hydroxylase (F3�5�H), flavonol synthase (FLS),dihydroflavonol reductase (DFR), and anthocyanidin syn-thase (ANS), and the glycosyltransferases flavonol-3-gluco-syltransferase (GT) and flavonol-3-glucoside-rhamnosyl-transferase (RT) were determined and expressed relative tothe ASR1 gene encoding an abscisic stress ripening protein(Iusem et al., 1993). This gene was chosen as an internalcontrol because DNA microarray analysis (data not shown)and SYBR-Green RT-PCR analysis showed that it has ahigh and stable mRNA expression level in all three ripeningstages and fruit tissues tested (mean � SD of Ct values was15.69 � 0.33; n � 6).
Figure 5. HPLC Results, Recorded at 370 nm, of Hydrolyzed Extracts from Whole Red Fruit of Tomato Plants.
Samples were from wild-type (A), LC (B), C1 (C), and LC/C1 (D) tomato plants. AU, absorption units; k, kaempferol; q, quercetin.
2516 The Plant Cell
As shown in Figure 11, there was a clear expression ofPAL, F3H, F3�H, FLS, GT, and RT in the peel of wild-typegreen fruit. Transcript levels of these genes increased duringripening, reaching a maximum level in the turning stage, andthen decreased again in the red stage. Expression levels forCHS and CHI were low in green fruit peel and thus may beresponsible for the relatively low flavonoid levels found ingreen fruit (Muir et al., 2001). Upon ripening, expression ofCHS increased dramatically (�100-fold), whereas CHI tran-script levels remained low. The genes required for the pro-duction of tomato leaf anthocyanins (F3�5�H, DFR, and ANS)were not expressed in tomato fruit peel. Together, the ex-pression profiles of the above-mentioned genes correlatedwell with the accumulation of naringenin chalcone and quer-cetin in tomato fruit peel during ripening (Muir et al., 2001).In flesh of wild-type fruit, there was very low expression ofall genes tested, in accordance with the observation that fla-vonoids are not detected in flesh. In LC/C1 flesh (Figure 11),however, we observed a �100-fold induction of the genes
encoding CHS, F3H, and DFR and a 5- to 15-fold inductionof the genes encoding FLS, ANS, GT, and RT relative towild-type flesh. Neither PAL nor CHI, F3�H, or F3�5�H wereinduced by LC/C1 in flesh. In LC/C1 peel (Figure 11A), thesame transcripts were induced by LC/C1, but the inductionratios for CHS, F3H, FLS, GT, and RT were much lower thanthose in flesh as a result of the clear expression of thesegenes in wild-type peel. In conclusion, these results indicatethat the expression of the maize LC and C1 transcriptionfactor genes in tomato leads to the induction of all of the fla-vonoid biosynthesis genes required for the production ofkaempferol-type flavonols and pelargonidin-type anthocya-nins.
Because mature leaves of some LC/C1 plants containboth kaempferol- and quercetin-type flavonols and delphini-din-type anthocyanins (Figure 1), this tissue is expected toproduce adequate transcript levels of all of the flavonoidstructural genes involved. Expression levels in green wild-type and purple LC/C1 mature leaves of all genes tested are
Figure 6. Quantification of Flavonoids in Hydrolyzed Extracts of Whole Red Fruit Obtained from Plants Transformed with LC/C1 Constructs.
(A) Kaempferol, quercetin, and naringenin levels are shown for plants transformed with 35S-C1/E8-LC� (3000 series). WT, untransformed con-trol wild-type fruit (n � 10).(B) Kaempferol levels are shown in plants transformed with constructs 35S-C1/E8-LC� (3000 series), 35S-C1/E8-LC� (2000 series), and E8-C1/E8-LC� (2500 series).
High-Flavonol Tomatoes 2517
shown in Figure 12A. Compared with that in fruit, the LC/C1effect on flavonoid gene expression is much more modest inleaves (ranging from twofold to sixfold). This is most likelythe result of the fact that the flavonoid pathway is alreadyactive in wild-type leaves. In addition, we observed muchless variation in the transcript levels between genes inleaves (Figure 12A) and fruit (Figure 11), suggesting that allof the genes are expressed at a sufficient level to producethe flavonols and anthocyanins found. To compare gene ex-pression levels in leaves and fruit, we determined the RNAlevels of the genes encoding enzymes acting at and around
the branch point between the formation of flavonols and an-thocyanins (Figure 1) in peel and flesh of turning LC/C1 fruitrelative to the levels found in LC/C1 leaves (Figure 12B).This was possible because the two internal controls usedshowed constant expression levels in leaves and green fruit(CYP) and in the three ripening stages tested (ASR1). In LC/C1 flesh, expression levels of F3H, FLS, DFR, and ANS werein the same range as in leaves, whereas expression levels ofF3�H and F3�5�H were 10- to 100-fold lower than those inLC/C1 leaves. This finding suggests that the expression ofthe latter two genes may be limiting steps in the partitioning
Figure 7. Stability of the High-Kaempferol Phenotype.
Red fruit were harvested from segregating T1 (A) and homozygous T2 (B) populations of three independent transgenic lines. Three fruit of eachplant were pooled, hydrolyzed extracts were prepared, and quercetin and kaempferol levels were determined. The results shown representmean values obtained for 5 to 10 transgenic plants for each transgenic (�) and azygous (�) line. For comparison, analysis of hydrolyzed extractsfrom fruit of FM6203 parent plants that did not go through the tissue culture procedure is shown. DW, dry weight.
2518 The Plant Cell
of the pathway toward dihydroquercetin and dihydromyrice-tin in LC/C1 flesh.
In LC/C1 peel, we also observed a low expression level ofF3�5�H but a very strong expression of F3�H and FLS com-pared with that in leaves. This finding suggests that in LC/C1 peel, the production of dihydromyricetin is limited be-cause of the low F3�5�H expression and that there is astrong pull of the pathway toward the production of dihydro-quercetin, quercetin, and kaempferol because of the highF3�H and FLS expression.
In combination with the apparent substrate preference ofthe DFR enzyme for dihydromyricetin and of the FLS en-zyme for dihydrokaempferol and dihydroquercetin, theseexpression data suggest that F3�5�H expression is a keyfactor in the accumulation of anthocyanins in LC/C1 leavesand their absence in fruit.
DISCUSSION
In this article, we show that the simultaneous expression ofthe maize transcription factor genes LC, a member of theMYC-type R gene family, and C1, a member of the MYB-type C1 gene family, in fruit of transgenic tomato plantsleads to a strong induction of flavonoid biosynthesis in theflesh of the fruit, a tissue that normally lacks significant lev-els of any flavonoids. On a whole-fruit basis, this resulted inan up to 60-fold increase in the level of the flavonolkaempferol, which was conjugated with different sugars. Inaddition to these kaempferol glycosides, a significant in-crease was observed in the level of several naringenin gly-cosides in the flesh. Both LC and C1 were required and suf-ficient to induce the biosynthesis of these flavonoids,because plants containing either LC or C1 alone did not dif-fer from control plants with respect to flavonoid levels.
Two versions of the LC cDNA were used in our gene con-structs: one with and one without the 5� untranslated region(UTR). The LC 5� UTR contains a small upstream open read-ing frame that is involved in the translational control of LCexpression. It was shown by transient expression studies inmaize kernels that the removal of this 5� UTR results in 25-to 30-fold enhanced LC protein expression (Damiani andWessler, 1993). Although we did not investigate whether thesame mechanism exists in tomato, accumulation of the endproduct kaempferol in tomato fruit was not influenced sig-nificantly by the presence or absence of the LC 5� UTR. Inaddition, there was no clear correlation between LC or C1gene expression levels and kaempferol levels, except for therequirement of a basal expression of both genes.
We aimed to induce the flavonoid biosynthesis pathwayspecifically in the fruit by expressing either the LC gene orboth LC and C1 under the control of the fruit-specific E8promoter to prevent the possible confounding effects of in-creased flavonoid levels during tissue culture or subsequentplant growth. Nevertheless, in leaves of E8-LC/35S-C1plants, a small but clear increase in flavonoids was detect-able, whereas in leaves of plants expressing E8-LC or35S-C1 alone, no increase of flavonoids was detected com-pared with control leaves. This suggests that in leaves, as infruit, the expression of both LC and C1 is required to inducethe biosynthesis of certain flavonoids. TaqMan gene expres-sion analysis showed that a low but significant expression ofthe LC gene was detectable in E8-LC/35S-C1 leaves, indi-cating that the E8 promoter is somewhat leaky or not re-stricted fully to fruit.
Figure 8. Flavonol Levels in Leaves of Homozygous LC/C1 T2 Linesand T0 Lines Transformed with LC or C1 Alone.
Leaves were harvested from homozygous T2 populations of threeindependent transgenic lines. Three leaves of each plant werepooled, hydrolyzed extracts were prepared, and quercetin (A) andkaempferol and naringenin (B) levels were determined. The resultsshown represent mean values obtained for 5 to 10 transgenic plantsfor each transgenic (�) and azygous (�) line. Similarly, kaempferollevels were determined in T0 lines transformed with the single-geneconstructs pBBC10, pBBC20, and pBBC30 (C). DW, dry weight.
High-Flavonol Tomatoes 2519
Genes that encode homologs of the maize R and C1 tran-scription factor families have been expressed ectopically inmaize cell lines (Grotewold et al., 1998) and in several dicot-ylenous plant species, such as petunia (Bradley et al., 1998),tomato (Goldsbrough et al., 1996), tobacco, and Arabidop-sis (Lloyd et al., 1992; Mooney et al., 1995). In all studies re-ported to date, ectopic expression of an R gene, eitheralone or in combination with C1, resulted in an increasedproduction of anthocyanins. None of these studies mentionan effect of these transgenes on flavonoids other than an-thocyanins. In agreement with these observations, we alsoobserved anthocyanins in our LC/C1 plants, but only in veg-etative tissues and occasionally in some young green fruit.By contrast, we never detected anthocyanins at later stagesof LC/C1 fruit ripening, despite the fact that LC/C1 stronglyinduced the accumulation of other flavonoids.
To provide an explanation for the accumulation of fla-vonols and the lack of anthocyanins in our LC/C1 fruit, weinvestigated the partitioning of the flavonoid pathway to-ward flavonols and anthocyanins in more detail by combin-ing metabolic information with gene expression data. Asshown in Figure 1, dihydrokaempferol (DK) is produced as aproduct of the F3H enzyme. Using DK as a substrate, theaction of the two cytochrome P450 hydroxylases F3�H andF3�5�H leads to the production of two other dihydrofla-vonols, dihydroquercetin (DQ) and dihydromyricetin (DM).These three types of dihydroflavonols (DK, DQ, and DM)serve as common precursors for the formation of the threetypes of flavonols (kaempferol, quercetin, and myricetin)through the action of FLS as well as the three types of an-thocyanins (pelargonidin, cyanidin, and delphinidin) throughthe action of DFR. In LC/C1 leaves, all three types of dihy-
droflavonols (DK, DQ, and DM) must be present, becausesignificant amounts of the derived reaction productskaempferol, quercetin (both flavonols), and delphinidin (an-thocyanin) are present. This is in agreement with our obser-vations that in leaves, all genes required for the biosynthesisof DK, DQ, and DM, including F3�H and F3�5�H, are ex-pressed. However, and in accordance with previous find-ings (Bongue-Bartelsman and Philips, 1995), only delphini-din-type anthocyanins, which are derived from DM, wereobserved. These results indicate (1) that the tomato DFRenzyme, which is encoded by a single gene in tomato(Goldsbrough et al., 1994; Yoder et al., 1994), is restricted inits substrate specificity to DM, because only delphinidin isformed, and (2) that the tomato FLS enzyme preferentiallyuses DQ and DK as substrates, because the flavonol
Figure 9. Phenotypical Analysis of Leaves and Green and Red Fruit of LC/C1 Plants.
In plants containing 35S-C1/E8-LC, anthocyanins accumulate in older leaves. In plants expressing both C1 and LC under the control of the fruit-specific E8 promoter, this effect is not seen. Fruit of either type of LC/C1 plants do not accumulate anthocyanins.
Table 1. Amounts of Anthocyanins and Flavonols Detected inLight-Stressed Seedlings
CompoundControl(mg/kg fresh wt)
LC/C1(mg/kg fresh wt)
Petunidin 3-(caffeoyl)rutinoside-5-glucoside 7.5 30.8
Petunidin 3-(p-coumaroyl)rutinoside-5-glucoside
76.0 266.0
Malvidin 3-(p-coumaroyl)rutinoside-5-glucoside
46.0 117.1
Quercetin 279.2 277.2Kaempferol 67.1 76.6
2520 The Plant Cell
myricetin was not detected in any tomato tissue examined.A substrate preference for specific dihydroflavonol precur-sors of DFR and FLS has been shown in other solanaceousspecies as well (Oud et al., 1995).
In LC/C1 fruit peel, at least two types of dihydroflavonols(DK and DQ) must be formed, because their respective re-action products (kaempferol and quercetin) were present inthis tissue. This is in agreement with our gene expressiondata showing that all genes, except CHI, required for theproduction of DK and DQ, plus the flavonols and anthocya-nins derived from them, were expressed. The lack of antho-cyanins in fruit peel can be explained by the observationthat DFR cannot use DK and DQ as substrates and that theonly substrate that can be used by DFR (DM) is not pro-duced, as a result of a very low F3�5�H expression in fruitpeel compared with leaves.
A similar situation was found in LC/C1 fruit flesh. Despitethe induction of DFR, ANS, and FLS, only kaempferol wasdetected in this tissue. This finding suggests that of the di-hydroflavonols, only DK is produced in fruit flesh. The ab-sence of DQ and DM, and thus their respective reactionproducts quercetin (from FLS activity) and delphinidin (fromDFR activity), most likely is attributable to the very low, andLC/C1-insensitive, expression of both F3�H and F3�5�H infruit flesh compared with leaves.
Together, these results lead to the conclusion that ex-pression of the LC and C1 transcription factors in tomatoleads to the induction of all of the genes required for theproduction of flavonols and anthocyanins, except for CHIand the two B-ring hydroxylases F3�H and F3�5�H. The en-dogenous expression pattern of the F3�5�H gene (a 10- to100-fold higher level in leaves than in fruit), in combinationwith the substrate specificity of the tomato DFR enzyme(i.e., DM), are the primary factors determining the absenceof anthocyanins in fruit and their presence in leaves of theseLC/C1 tomato lines. The observation of anthocyanins insome young green LC/C1 fruit suggests that, at least inthese fruit, all flavonoid pathway genes, including F3�5�H,were expressed sufficiently to enable anthocyanin formationat early stages of fruit development. Our results also indi-cate that the types of flavonols found in fruit peel and fleshand in leaves are determined mainly by the expression ofthe F3�H gene, in combination with the substrate specificityof the FLS enzyme. In addition to the low F3�5�H gene ex-pression, a strong pull of the pathway toward DQ, quercetin,and kaempferol by F3�H and FLS may be of significance forthe absence of anthocyanins in fruit peel as well.
In contrast to our results with E8-LC and E8-LC/35S-C1plants, Goldsbrough et al. (1996) reported the accumulationof anthocyanins in leaves and red fruit of cherry tomato
Figure 10. TaqMan Analysis of LC and C1 Gene Expression in Red Fruit and Leaves of Wild-Type and Transgenic Tomato Plants.
Results are shown separately for red fruit (A) and leaves (B). Total RNA was reverse transcribed, and aliquots were amplified using primer pairsspecific for LC, C1, and CYP (cyclophylin). RNA levels for each gene were expressed relative to the amount of CYP RNA, as described in Meth-ods. The mean value for CYP expression (determined as Ct values) was 20.44 � 0.34 for all fruit samples (mean � SD; n � 13) and 18.09 � 0.22for all leaf samples (n � 6).
High-Flavonol Tomatoes 2521
Figure 11. SYBR-Green RT-PCR Analysis of Flavonoid Pathway Gene Expression in Fruit Peel and Flesh during Ripening of Wild-Type andLC/C1 Tomato Fruit.
Total RNA was reverse transcribed, and aliquots were amplified using primer pairs specific for PAL, CHS, CHI, F3H, F3�H, F3�5�H, FLS, DFR, ANS, GT, RT,and the internal control ASR1. RNA levels for each gene were expressed relative to the amount of ASR1 RNA, as described in Methods, and multiplied by1000. The mean value for ASR1 expression (determined as Ct values) of all fruit samples was 15.69 � 0.33 (mean � SD; n � 6). WT, wild type.
2522 The Plant Cell
plants expressing the LC gene under the control of the con-stitutive 35S promoter. For E8-LC leaves, this discrepancybetween results can be explained by a LC gene dosage ef-fect resulting from the relatively high activity of the 35S pro-moter compared with the E8 promoter in this tissue (Figure10). Apparently, the activity of the E8 promoter is too weakin leaves to produce sufficient LC to stimulate the flavonoidpathway. Only when C1 was expressed coordinately at highlevels (E8-LC/35S-C1) was E8-driven LC expression suffi-cient to induce the flavonoid pathway in leaves. In ripe fruit,the activity of the E8 promoter was on the same order asthat of the 35S promoter (Figure 10A, E8-C1 in plant 2509versus 35S-C1 in plant 3031). Nevertheless, we did not ob-serve anthocyanin production in ripe LC or LC/C1 fruit be-cause of the low F3�5�H activity, as argued above. This find-ing suggests that anthocyanins present in ripe 35S-LCcherry tomato fruit must be produced primarily at very earlystages of ripening. Strikingly, and in agreement with thisidea, we detected low levels of anthocyanins in some younggreen LC/C1 fruit, suggesting that in these early ripeningstages, F3�5�H expression is sufficient to make anthocyaninproduction possible. Differences in the activities of the E8and 35S promoters in these early stages of fruit develop-ment (up to the green stage) may explain the apparentlycontradictory observations with respect to anthocyanin ac-cumulation in ripe cherry tomato versus ripe FM6203 to-mato, because the activity of the E8 promoter was relativelylow at the green stage compared with later stages of devel-opment (e.g., as reflected by the expression of the targetgenes; Figure 11).
Other explanations also are possible. For example, wecannot exclude the possibility that the F3�5�H gene is ex-pressed in ripe cherry tomato fruit as a result of genotypicalor physiological differences. Alternatively, the DFR enzymein cherry tomatoes may have different substrate specificitythan the one in our tomato line, such that it is able to use DKor DQ as substrate. It is noteworthy, in this respect, that al-teration of a single amino acid in the substrate binding do-main of the petunia DFR enzyme was sufficient to alter itsspecificity for the three dihydroflavonol substrates (Johnsonet al., 2001).
In conclusion, these results clearly show that ectopic ex-pression of combinations of transcription factor genes is apowerful way to influence metabolic pathways. However,
Figure 12. Comparative Analysis of Flavonoid Pathway Gene Ex-pression in Leaves and Fruit of WT and LC/C1 Tomatoes.
(A) SYBR-Green RT-PCR analysis of flavonoid pathway gene ex-pression in green wild-type and purple LC/C1 tomato leaves, as de-scribed in Figure 11. RNA levels for each gene were expressed rela-tive to the amount of ASR1 RNA and multiplied by 10. Because theASR1 gene has a 100-fold lower expression in leaves than in fruit,multiplication of the ratios by 10 instead of 1000 (as for fruit) resultsin values that can be compared directly with those given for fruit.The raw Ct values for ASR1 expression in leaves were 22.67 (wildtype) and 22.47 (LC/C1). WT, wild type.
(B) Comparison of RNA expression levels of F3H, F3�H, F3�5�H,FLS, DFR, and ANS in turning LC/C1 peel and flesh relative to thelevels in LC/C1 leaves. Expression levels in leaves were extrapolatedto the levels found in fruit, based on the constitutive expression ofCYP in leaves and green fruit (mean � SD of Ct values is 19.47 � 0.27;n � 4) and of ASR1 in the three ripening stages tested (mean � SD
of Ct values is 15.69 � 0.33; n � 6). Expression of each gene isgiven as a percentage of the expression in leaves. Experimental de-tails are described in Methods.
High-Flavonol Tomatoes 2523
the effects on metabolite content are not easy to predictand can vary considerably between plant species and vari-eties as a result of gene dosage effects, the endogenousand transgene-induced expression profiles of structuralgenes, and the substrate specificities of the enzymes in-volved, which may differ from plant to plant.
METHODS
Plant Growth Conditions
Tomato (Lycopersicon esculentum) line FM6203 and transgenicplants were grown in a containment greenhouse with a 16-h photo-period and 21/17C day/night temperatures.
Cloning Procedures and Plasmid Constructions
All DNA manipulations, including PCR, restriction digestion, agarosegel electrophoresis, ligation, and transformation into Escherichia coliDH5, were performed as described previously (Sambrook et al.,1989).
In general, all promoters, structural genes, and terminators usedwere amplified by PCR with primers containing the desired restric-tion enzyme site attached to their 5� ends. Restriction sites were cho-sen in such a way that all promoters were cloned as KpnI-BamHIfragments, all structural genes were cloned as BamHI-SalI frag-ments, and all terminators were cloned as SalI-ClaI fragments, un-less stated otherwise.
Plasmid pFLAP10 (P35S-C1-Tnos) was constructed as follows.First, the Agrobacterium tumefaciens nopaline synthase (NOS) termi-nator was amplified from plasmid pBI121 (Jefferson et al., 1987) andcloned as a 0.2-kb SalI-ClaI fragment in the pUCAP (van Engelen etal., 1995) derivative pUCM2, in which suitable restriction sites forcloning were introduced. This resulted in plasmid pFLAP1. Second,the C1 gene was isolated as a 1.6-kb EcoRI-PacI fragment fromplasmid pAL71 (Lloyd et al., 1992), suitable adapters were ligated,and the C1 gene was cloned as a 1.6-kb BamHI-SalI fragment intopFLAP1, resulting in plasmid pFLAP2. Third, the double 35S pro-moter of Cauliflower mosaic virus was amplified from plasmidpMOG18 (Sijmons et al., 1990) and cloned as a 0.85-kb KpnI-BamHIfragment into plasmid pFLAP3, resulting in plasmid pFLAP10.
To construct plasmids pFLAP20 (Pe8-LC�-Trbc) and pFLAP30(Pe8-LC�-Trbc), the LC gene and the pea ribulose bisphosphate car-boxylase terminator (Trbc) were isolated from plasmid pAL144 (LC�)and pAL65 (LC�), respectively (Lloyd et al., 1992) and cloned as aBamHI-ClaI fragment in plasmid pUCM2. This resulted in plasmidpFLAP4(LC�) and pFLAP5 (LC�). Next, a 2-kb tomato E8 promoterfragment was amplified by PCR from plasmid pT7E8 (Bovy et al.,1999) and cloned as a KpnI-BamHI fragment upstream of the LCgenes of pFLAP4 and pFLAP5, resulting in plasmids pFLAP20 andpFLAP30, respectively. Plasmid pFLAP15 (Pe8-C1-Tnos) was con-structed by replacing the 35S promoter in pFLAP10 with the E8 pro-moter from pFLAP20.
To make the two-gene constructs pFLAP200 (P35S-C1-Tnos/Pe8-LC�-Trbc) and pFLAP300 (P35S-C1-Tnos/Pe8-LC�-Trbc), the in-serts of plasmids pFLAP10 and either pFLAP20 or pFLAP30 werecloned behind each other in plasmid pUCM3, a derivative of plasmid
pUCAP (van Engelen et al., 1995) in which the multiple cloning sitewas modified in such a way that it contained suitable cloning sites.First, the insert of pFLAP10 was cloned as a KpnI-ClaI fragment inpUCM3. This resulted in plasmid pFLAP100. Then, the inserts ofplasmids pFLAP20 and pFLAP30 were cloned as a NotI-AscI frag-ment behind the C1 gene in plasmid pFLAP100, resulting in plasmidspFLAP200 and pFLAP300, respectively.
To make the two-gene constructs pFLAP250 (Pe8-C1-Tnos/Pe8-LC�-Trbc) and pFLAP300 (Pe8-C1-Tnos/Pe8-LC�-Trbc), the insertsof plasmids pFLAP15 and either pFLAP20 or pFLAP30 were clonedbehind each other in plasmid pUCM3. First, the insert of pFLAP15was cloned as a KpnI-ClaI fragment in pUCM3. This resulted in plas-mid pFLAP150. Then, the inserts of plasmids pFLAP20 and pFLAP30were cloned as a NotI-AscI fragment behind the C1 gene in plasmidpFLAP150, resulting in plasmids pFLAP250 and pFLAP350, respec-tively.
For plant transformation, we made use of the binary vectorpBBC3, a derivative of plasmid pGPTV-KAN (Becker et al., 1992). Toconstruct pBBC3, pGPTV-KAN was digested with EcoRI-HindIII, andthe gusA-Tnos gene was replaced by a small multiple cloning siteconsisting of PacI-EcoRI-HindIII-AscI restriction sites. The inserts ofplasmids pFLAP10, pFLAP20, pFLAP30, pFLAP200, pFLAP250,pFLAP300, and pFLAP350 were transferred as PacI-AscI fragmentsto plasmid pBBC3. This resulted in plasmids pBBC10, pBBC20,pBBC30, pBBC200, pBBC250, pBBC300, and pBBC350, respec-tively.
Plant Transformation
Binary plasmids were transformed into Agrobacterium strain LBA4404(Hoekema et al., 1985) by the freeze-thaw method (Gynheung et al.,1988). The presence of the plasmids was tested by restriction en-zyme analysis after back transformation to E. coli.
Tomato variety FM6203 was transformed by Agrobacterium-medi-ated transformation of cotyledons (Fillatti et al., 1987). Plants trans-formed with pBBC10, pBBC20, pBBC30, pBBC200, pBBC250,pBBC300 and pBBC350 were numbered from 100, 200, 300, 2000,2500, 3000 and 3500 onward, respectively.
Harvest of Plant Material
For both flavonoid (HPLC) and RNA (TaqMan) analyses, fruit, fully ex-panded mature leaves, and germinating seedlings were harvestedand frozen immediately in liquid nitrogen. The material was storedfrozen at �80C. Extracts were made of pools of at least three fruit ofeach plant to minimize sample variation. Likewise, the first, second,and eighth fully expanded leaves of each plant were pooled beforeextraction.
Flavonoid Extraction and HPLC Analyses
Flavonoids were determined as aglycones or as their glycosides bypreparing hydrolyzed and nonhydrolyzed extracts, respectively.Hydrolyzed extracts were prepared and analyzed by HPLC with pho-todiode detection essentially according to Hertog et al. (1992). tert-Butylated hydroxyquinon was left out of the extraction protocolbecause it coeluted with naringenin during isocratic HPLC (25%
2524 The Plant Cell
acetonitrile in 0.1% trifluoroacetic acid). Dose–response curves ofquercetin, naringenin, and kaempferol (0 to 20 �g/mL) were estab-lished to quantify these compounds in the hydrolyzed extracts. Non-hydrolyzed extracts were prepared in 75% aqueous methanol with10 min of sonication. Subsequent HPLC of the flavonoid species ex-tracted was with a gradient of 5 to 50% acetonitrile in 0.1% trifluoro-acetic acid.
Absorbance spectra and retention times of eluting peaks werecompared with those of commercially available flavonoid standards(Apin Chemicals, Abingdon, UK). It was established that during thehydrolysis step, 100% of aglycones were released from their respec-tive glycosides, whereas �95% of naringenin chalcone was con-verted chemically into naringenin. Recoveries of quercetin, kaemp-ferol, and naringenin standards added to peel or flesh extracts justbefore hydrolysis were �90%. The lowest detection limit for fla-vonoids in the tomato extracts was �0.1 �g/mL, corresponding to 1mg/kg fresh weight. Variation between replicate extractions and in-jections was �5%.
Anthocyanins in seedlings were extracted in acid methanol (95%methanol plus 5% 1 N HCl; 0.5 g fresh weight in 10 mL). After soni-cation and centrifugation at 3500g, the residue was extracted twice.The supernatants were combined, methanol was evaporated afteradding 5 mL of water, and the remaining water extract was washedwith hexane to remove lipid-soluble compounds. Analysis of antho-cyanins in the extracts was performed by reverse-phase HPLC(Hewlett-Packard 1100 HPLC, equipped with a Phenomenex AquaC18 4.6 � 150-mm column, 5 �m, at 35C; Phenomenex, Torrence,CA) with photodiode array and mass detection. The mass spectrom-eter was a Finnigan LCQ (ThermoQuest, San Jose, CA) with an elec-trospray ionization interface. Both the auxiliary and the sheath gaswere a mixture of nitrogen and helium. The capillary voltage was 3 V,and the capillary temperature was 195C. Spectra were recorded inpositive ion mode between mass-charge ratios of 120 and 1500. Themass spectrometer was programmed to perform a series of threescans: a full mass spectrum, an MS2 of the most abundant ion in thefirst scan using a collision energy of 30, and an MS3 of the most abun-dant ion in the second scan using a collision energy of 30. An aliquotof the aqueous anthocyanin extract was subjected to hydrolysis bymixing (1:1) with 6 N HCl and heating at 100C in a closed vial purgedwith nitrogen for 45 min. Separation of this hydrolyzed extract was ona Waters Spherisorb ODS2 column (3 �m; 4.6 � 150 mm; 35C) usinga gradient of acetonitrile in 4.5% formic acid. Quantification of antho-cyanins was made from the areas of their peaks recorded at 520 nmcompared with an external standard of malvidin 3-glucoside.
TaqMan Analysis
The expression of the introduced LC and C1 genes in the obtainedtransgenic plants was analyzed by real-time quantitative reversetranscriptase–mediated (RT) PCR using the fluorogenic TaqMan as-say on the ABI PRISM7700 sequence detection system (Perkin-Elmer Applied Biosystems). The principle of this procedure is as fol-lows. Total RNA, extracted from the source of interest, is convertedinto cDNA by reverse transcription. The expression of the target geneis monitored by PCR with a fluorogenic TaqMan probe that hybrid-izes specifically between the forward and reverse primers. The sin-gle-stranded TaqMan probe is labeled with two fluorescent dyes: areporter dye (6-carboxyfluorescein) at the 5� end and a quencher dye(6-carboxytetramethylrhodamine) at the 3� end. When the probe isintact, the signal from the reporter dye is absorbed by the quencher
dye. During PCR, however, the probe is cleaved as a result of the 5�
nuclease activity of Taq DNA polymerase, leading to uncoupling ofthe reporter dye and the quencher dye. This results in an increase inreporter fluorescence. With each cycle, additional reporter dye mol-ecules are cleaved from their respective probes, and the increase influorescence intensity is monitored continuously during PCR. ThePCR cycle at which the fluorescence reaches a certain thresholdvalue, Ct, which is defined as the PCR cycle at which a statisticallysignificant increase of reporter fluorescence is first detected, is ameasure for the starting copy number of the target RNA. Relativequantitation of the target RNA expression level was performed usingthe comparative Ct method (User Bulletin 2, ABI PRISM7700 Se-quence Detection System, December 1997; Perkin-Elmer AppliedBiosystems) in which the differences in the Ct for the target RNA andan endogenous control RNA, called Ct, were calculated to normal-ize for the differences in the total amount of cDNA present in each re-action and the efficiency of the RT step. Finally, the target RNA ex-pression level was expressed as a percentage of the control RNAexpression level using the equation 2 EXP Ct � 100%.
Total RNA was isolated from red fruit and leaves of tomato plantsas described (Bovy et al., 1995). First-strand cDNA was synthesizedfrom 350 ng of total RNA by reverse transcription. Aliquots of 100 ngof cDNA were used in three TaqMan PCR procedures (according tothe manufacturer’s protocol) with a C1, a LC, and a CYP probe, re-spectively. The tomato cyclophylin gene (CYP) is expressed consti-tutively in turning and red tomato fruit, as observed by RNA gel blotanalysis (data not shown); therefore, it can be used as an internalcontrol. The sequences of the TaqMan primers and probes used arelisted in Table 2. The LC and C1 transcript levels were expressed rel-ative to the amount of CYP mRNA, as described above.
SYBR-Green Analysis
As an alternative to the use of TaqMan probes, the fluorescent inter-calating dye SYBR-Green can be used to monitor the RT-PCR on linewith the ABI PRISM7700 sequence detection system. This dye givesa specific fluorescent signal when bound to double-stranded DNA,so fluorescence increases with the formation of PCR product. Al-though the sensitivity of SYBR-Green is at least as good as that forTaqMan probes, it is necessary that the PCR be specific, becausethe dye will bind equally well to aspecific PCR amplification prod-ucts. Therefore, for each primer combination, the specificity of theamplification must be confirmed on an agarose gel. As for TaqManprobes, quantitation of target mRNA levels can be performed relativeto an endogenous control RNA using the comparative Ct method.
Using sequence information from randomly chosen or specificallyisolated tomato cDNAs (data not shown) or from ESTs and cDNAspresent in the public domain databases, gene-specific primers weredeveloped for tomato homologs of the genes encoding Phe-ammo-nia lyase, the flavonoid pathway genes chalcone synthase, chalconeisomerase, flavanone-3-hydroxylase, flavanone-3�-hydroxylase, flava-none-3�5�-hydroxylase, flavonol synthase, dihydroflavonol reductase,and anthocyanidin synthase, and the flavonol glycosyltransferasesflavonol-3-glucosyltransferase and flavonol-3-glucoside-rhamnosyl-transferase. All of these tomato homologs showed �90% amino acididentity to the established petunia genes. The sequences of all of theprimers used are shown in Table 2.
Total RNA was isolated from turning fruit of tomato plants as de-scribed previously (Bovy et al., 1995). First-strand cDNA was synthe-sized from 1.5 �g of total RNA by reverse transcription. Aliquots of
High-Flavonol Tomatoes 2525
100 ng of cDNA were used in SYBR-Green PCR (according to themanufacturer’s protocol) with the primers mentioned above. As acontrol, we used primers specific for abscisic stress ripening gene1(ASR1). Using the comparative Ct method, all genes were expressedrelative to ASR1.
To compare the expression levels in leaves with those found infruit, we made use of the constitutive expression of our internal con-trols in leaves and green fruit (CYP) and in the three ripening stagestested (ASR1). First, expression levels of each gene in turning fruitwere expressed relative to their expression in green fruit using ASR1as a control, according to the equation Ct(T-G) � Ct (turning fruit) � Ct (green fruit). Second, expression levels of each gene in leaveswere expressed relative to their expression in green fruit using CYPas a control, according to the equation Ct(L-G) � Ct (leaves) � Ct (green fruit). Third, all genes can be expressed relative to leavesusing the equation Ct(T-L) � Ct(T-G) � Ct(L-G). Finally, RNA ex-pression in leaves was expressed as a percentage of the level of thecorresponding gene in leaves, according to the equation 2 EXP Ct(T-L) � 100%.
Upon request, all novel materials described in this article will bemade available in a timely manner for noncommercial research pur-poses. No restrictions or conditions will be placed on the use of anymaterials described in this article that would limit their use for non-commercial research purposes.
ACKNOWLEDGMENTS
We thank Ronald Davis for the kind provision of constructs pAL69,pAL144, and pAL71; Bob Cowper for organizing and performing theT1 and T2 trials; Carl Jarman for PCR screening of T1 and T2 seedsfor segregation analysis; and Dirk Bosch for critically reading themanuscript.
Received April 30, 2002; accepted June 26, 2002.
REFERENCES
Becker, D., Kemper, E., Schell, J., and Masterson, R. (1992). Newplant binary vectors with selectable markers located proximal tothe left T-DNA border. Plant Mol. Biol. 20, 1195–1197.
Bongue-Bartelsman, M., and Philips, D.A. (1995). Nitrogen stressregulates gene expression of enzymes in the flavonoid biosyn-thetic pathway of tomato. Plant Physiol. Biochem. 33, 539–546.
Bovy, A., van den Berg, C., de Vrieze, G., Thompson, W.F.,Weisbeek, P., and Smeekens, S. (1995). Light-regulated expres-sion of the Arabidopsis thaliana ferredoxin gene requiressequences upstream and downstream of the transcription initia-tion site. Plant Mol. Biol. 27, 27–39.
Bovy, A.G., Hijden, H.T., Hughes, S.G., Muir, S.R., Tunen, A.J.,Verhoezen, M.E., and Vos, C.H. (1999). Methods and compositionfor modulating flavonoid content. W09937794 A 19990729.
Bradley, J.M., Davies, K.M., Deroles, S.C., Bloor, S.J., and Lewis,D.H. (1998). The maize Lc regulatory gene up-regulates the fla-vonoid biosynthetic pathway of petunia. Plant J. 13, 381–392.
Choi, S.U., Ryu, S.Y., Yoon, S.K., Jung, N.P., Park, S.H., Kim,K.H., Choi, E.J., and Lee, C.O. (1999). Effects of flavonoids onthe growth and cell cycle of cancer cells. Anticancer Res. 19,5229–5233.
Cook, N.C., and Samman, S. (1996). Flavonoids: chemistry, metab-olism, cardioprotective effects, and dietary sources. J. Nutr. Bio-chem. 7, 66–76.
Crozier, A., Lean, M.E.J., McDonald, M.S., and Black, C. (1997).Quantitative analysis of the flavonoid content of commercial toma-toes, onions, lettuces, and celery. J. Agric. Food Chem. 45, 590–595.
Damiani, R.D., Jr., and Wessler, S.R. (1993). An upstream openreading frame represses expression of Lc, a member of the R/Bfamily of maize transcriptional activators. Proc. Natl. Acad. Sci.USA 90, 8244–8248.
Dooner, H.K., Robbins, T.P., and Jorgensen, R.A. (1991). Geneticand developmental control of anthocyanin biosynthesis. Annu.Rev. Genet. 25, 173–199.
Dugas, A.J., Castaneda Acosta, J., Bonin, G.C., Price, K.L.,Fischer, N.H., and Winston, G.W. (2000). Evaluation of the totalperoxyl radical-scavenging capacity of flavonoids: Structure-activity relationships. J. Nat. Prod. 63, 327–331.
Table 2. Overview of TaqMan/SYBR-Green Primers andProbes Used
Primer/probe Gene Sequence (5� to 3�)
C1F C1 GCCCTGGCGTCGTTTCTC1R C1 TGGACATCTATACGTGTACTTGTTGTCTACC1Ta C1 CTCCGCTGTCAGACGGCCGGLCF LC CGGGAGCAGCACAGGAAATLCR LC GTCGCTTTCGCTCCGACATLCTa LC TGGCACTGGCACCAAGAACCACGCYPF CYP GAGTGGCTCAACGGAAAGCACYPR CYP CCAACAGCCTCTGCCTTCTTACYPTa CYP ACATCCATGCCTTCAACAACTTGTCCAAPAL_TOM_F PAL ATTGGGAAATGGCTGCTGATTPAL_TOM_R PAL TCAACATTTGCAATGGATGCACHS_TOM_F CHS TGGTCACCGTGGAGGAGTATCCHS_TOM_R CHS GATCGTAGCTGGACCCTCTGCCHI_TOM_F CHI GTTTTTCACAAACCAACAGTTCTGATCHI_TOM_R CHI GAAGCAGTGCTCGATTCCATAATF3H_TOM_F F3H CACACCGATCCAGGAACCATF3H_TOM_R F3H GCCCACCAACTTGGTCTTGTAF3�H_TOM_F F3�H GCACCACGAATGCACTTGCF3�H_TOM_R F3�H CGTTAGTACCGTCGGCGAATF3�5’H_TOM_F F3�5�H GGCAATTGGACGAGATCCTGF3�5’H_TOM_R F3�5�H AAGGAACCTCTCGGGAGTGAAFLS_TOM_F FLS GAGCATGAAGTTGGGCCAATFLS_TOM_R FLS TGGTGGGTTGGCCTCATTAADFR_TOM_F DFR TCCGAAGACGACAACGGTTTDFR_TOM_R DFR TGACAAGCCAAGAGCCGATAAANS_TOM_F ANS GAACTAGCACTTGGCGTCGAAANS_TOM_R ANS TTGCAAGCCAGGCACCATAGT_TOM_F GT CGAACGACGAAACACTGTTGAGT_TOM_R GT TGCAGCATAGATGGCATTGGRT_TOM_F RT CTGGCAATGCAAACAGAGTGART_TOM_R RT TCGACTTGCGGAAGAGTGAGAASR1_TOM_F ASR1 CCTGTTCCACCACAAGGACAAASR1_TOM_R ASR1 GTGCCAAGTTTACCGATTTGC
a Fluorescently labeled TaqMan probes.
2526 The Plant Cell
Duthie, G., and Crozier, A. (2000). Plant-derived phenolic antioxi-dants. Curr. Opin. Lipidol. 11, 43–47.
Fillatti, J.J., Kiser, J., Rose, R., and Comai, L. (1987). Efficienttransfer of a glyphosate tolerance gene into tomato using a binaryAgrobacterium tumefaciens vector. Bio. Technol. 5, 726–730.
Frankel, E.N. (1999). Food antioxidants and phytochemicals:Present and future perspectives. Fett Lipid 101, 450–455.
Goldsbrough, A., Belzile, F., and Yoder, J.I. (1994). Complementa-tion of the tomato anthocyanin without (aw) mutant using thedihydroflavonol 4-reductase gene. Plant Physiol. 105, 491–496.
Goldsbrough, A.P., Tong, Y., Yoder, J.I., and Tong, Y.S. (1996). Lcas a non-destructive visual reporter and transposition excisionmarker gene for tomato. Plant J. 9, 927–933.
Grotewold, E., Chamberlin, M., Snook, M., Siame, B., Butler, L.,Swenson, J., Maddock, S., St. Clair, G., and Bowen, B. (1998).Engineering secondary metabolism in maize cells by ectopicexpression of transcription factors. Plant Cell 10, 721–740.
Gynheung, A.N., Ebert, P.R., Mitra, A., and Ha, S.B. (1988). Binaryvectors. In Plant Molecular Biology Manual, S.B. Gelvin, R.A.Schilperoort, and D.P.S. Verma, eds (Dordrecht, The Netherlands:Kluwer Academic Publishers), pp. A3/1–A3/19.
Harborne, J.B. (1986). The Flavonoids. Advances in Research Since1986, 1st ed. (London: Chapmand Hall).
Herrmann, K. (1979). Uebersicht ueber die Inhaltsstoffe derTomaten. Z. Lebensm. Unters. Forsch. 169, 179–200.
Hertog, M.G., Feskens, E.J., Hollman, P.C., Katan, M.B., andKromhout, D. (1993). Dietary antioxidant flavonoids and risk ofcoronary heart disease: The Zutphen Elderly Study. Lancet 342,1007–1011.
Hertog, M.G.L., and Hollman, P.C.H. (1996). Potential healtheffects of the dietary flavonol quercetin. Eur. J. Clin. Nutr. 50, 63–71.
Hertog, M.G.L., Hollman, P.C.H., and Katan, M.B. (1992). Contentof potentially anticarcinogenic flavonoids of 28 vegetables and 9fruits commonly consumed in The Netherlands. J. Agric. FoodChem. 40, 2379–2383.
Hoekema, A., van Haaren, M., Fellinger, A., Hooykaas, P., andSchilperoort, R. (1985). Non-oncogenic vectors: Plant vectors foruse in the Agrobacterium binary system. Plant Mol. Biol. 5, 85–89.
Hollman, P.C.H., and Katan, M.B. (1999). Health effects and bioavail-ability of dietary flavonols. Free Radical Res. 31 (suppl. S), S75–S80.
Iusem, N.D., Bartholomew, D.M., Hitz, W.D., and Scolnik, P.A.(1993). Tomato (Lycopersicon esculentum) transcript induced bywater deficit and ripening. Plant Physiol. 102, 1353–1354.
Janssen, K., Mensink, R.P., Cox, F.J., Harryvan, J.L., Hovenier,R., Hollman, P.C., and Katan, M.B. (1998). Effects of the fla-vonoids quercetin and apigenin on hemostasis in healthy volun-teers: Results from an in vitro and a dietary supplement study.Am. J. Clin. Nutr. 67, 255–262.
Jefferson, R.A., Kavanagh, T.A., and Bevan, M.W. (1987). GUSfusion: �-Glucuronidase as a sensitive and versatile gene fusionmarker in higher plants. EMBO J. 6, 3901–3907.
Johnson, E.T., Ryu, S., Yi, H., Shin, B., Cheong, H., Choi, G., Ryu,S.H., Yi, H.K., Shin, B.C., Cheong, H.S., and Choi, G.T. (2001).Alteration of a single amino acid changes the substrate specificityof dihydroflavonol 4-reductase. Plant J. 25, 325–333.
Keli, S.O., Hertog, M.G., Feskens, E.J., and Kromhout, D. (1996).Dietary flavonoids, antioxidant vitamins, and incidence of stroke:The Zutphen Study. Arch. Intern. Med. 156, 637–642.
Lloyd, A.M., Walbot, V., and Davis, R.W. (1992). Arabidopsis andNicotiana anthocyanin production activated by maize regulators Rand C1. Science 258, 1773–1775.
Manach, C., Regerat, F., Texier, O., Agullo, G., Demigne, C., andRemesy, C. (1996). Bioavailability, metabolism and physiologicalimpact of 4-oxo-flavonoids. Nutr. Res. 16, 517–544.
Mol, J., Grotewold, E., and Koes, R. (1998). How genes paint flow-ers and seeds. Trends Plant Sci. 3, 212–217.
Mooney, M., Desnos, T., Harrison, K., Jones, J., Carpenter, R.,and Coen, E. (1995). Altered regulation of tomato and tobaccopigmentation genes caused by the delila gene of Antirrhinum.Plant J. 7, 333–339.
Muir, S.R., Collins, G.J., Robinson, S., Hughes, S.G., Bovy, A.G.,de Vos, C.H., van Tunen, A.J., and Verhoeyen, M.E. (2001).Overexpression of petunia chalcone isomerase in tomato resultsin fruit containing dramatically increased levels of flavonols. Nat.Biotechnol. 19, 470–474.
Ng, T.B., Liu, F., and Wang, Z.T. (2000). Antioxidative activity ofnatural products from plants. Life Sci. 66, 709–723.
Oud, J.S.N., Schneiders, H., Kool, A.J., and van Grinsven, M.(1995). Breeding of transgenic orange Petunia hybrida varieties.Euphytica 84, 175–181.
Price, K.R., Casuscelli, F., Colquhoun, I.J., and Rhodes, M.J.C.(1998). Composition and content of flavonol glycosides in broccoliflorets (Brassica oleracea) and their fate during cooking. J. Sci.Food Agric. 77, 468–472.
Rice Evans, C.A., Miller, N.J., Bolwell, P.G., Bramley, P.M., andPridham, J.B. (1995). The relative antioxidant activities of plant-derived polyphenolic flavonoids. Free Radical Res. 22, 375–383.
Rice Evans, C.A., Miller, N.J., Paganga, G., and Miller, N.(1997). Antioxidant properties of phenolic compounds: Thepolyphenolic content of fruit and vegetables and their antioxidantactivities. What does a serving constitute? Trends Plant Sci. 2,152–159.
Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). MolecularCloning: A Laboratory Manual. (Cold Spring Harbor, NY: ColdSpring Harbor Laboratory Press).
Shih, H., Pickwell, G.V., and Quattrochi, L.C. (2000). Differentialeffects of flavonoid compounds on tumor promoter-induced acti-vation of the human CYP1A2 enhancer. Arch. Biochem. Biophys.373, 287–294.
Sijmons, P.C., Dekker, B.M.M., Schrammeijer, B., Verwoerd,T.C., van der Elzen, P.J.M., and Hoekema, A. (1990). Productionof correctly processed human serum albumin in transgenic plants.Biol. Technol. 8, 217–221.
Steinmetz, K.A., and Potter, J.D. (1996). Vegetables, fruit, and can-cer prevention: A review. J. Am. Diet. Assoc. 96, 1027–1039.
Sugihara, N., Arakawa, T., Ohnishi, M., and Furuno, K. (1999).Anti- and pro-oxidative effects of flavonoids on metal-inducedlipid hydroperoxide-dependent lipid peroxidation in culturedhepatocytes loaded with alpha-linolenic acid. Free Radical Biol.Med. 27, 1313–1323.
Trevisanato, S.I., and Kim, Y.I. (2000). Tea and health. Nutr. Rev.58, 1–10.
van Engelen, F.A., Molthoff, J.W., Conner, A.J., Nap, J.P.,Pereira, A., and Stiekema, W.J., (1995). pBINPLUS: An im-proved plant transformation vector based on pBIN19. Trans-genic Res. 4, 288–290.
Woeldecke, M., and Herrmann, K. (1974). Flavonole und Flavoneder Gemuesearten. III. Flavonole und Flavone der Tomaten und desGemuesepaprikas. Z. Lebensm. Unters. Forsch. 155, 216–219.
Yoder, J.I., Belzile, F., Tong, Y., and Goldsbrough, A. (1994).Visual markers for tomato derived from the anthocyanin biosyn-thetic pathway. Euphytica 79, 163–167.
DOI 10.1105/tpc.004218 2002;14;2509-2526Plant Cell
TunenCollins, Sue Robinson, Martine Verhoeyen, Steve Hughes, Celestino Santos-Buelga and Arjen van
Arnaud Bovy, Ric de Vos, Mark Kemper, Elio Schijlen, Maria Almenar Pertejo, Shelagh Muir, GeoffC1 and LCFactor Genes
High-Flavonol Tomatoes Resulting from the Heterologous Expression of the Maize Transcription
This information is current as of July 7, 2018
References /content/14/10/2509.full.html#ref-list-1
This article cites 45 articles, 5 of which can be accessed free at:
Permissions https://www.copyright.com/ccc/openurl.do?sid=pd_hw1532298X&issn=1532298X&WT.mc_id=pd_hw1532298X
eTOCs http://www.plantcell.org/cgi/alerts/ctmain
Sign up for eTOCs at:
CiteTrack Alerts http://www.plantcell.org/cgi/alerts/ctmain
Sign up for CiteTrack Alerts at:
Subscription Information http://www.aspb.org/publications/subscriptions.cfm
is available at:Plant Physiology and The Plant CellSubscription Information for
ADVANCING THE SCIENCE OF PLANT BIOLOGY © American Society of Plant Biologists
